DOCSLIB.ORG

Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast Cancer Progression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast Cancer Progression Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Glucocorticoid receptor signaling activates TEAD4 to promote breast cancer progression Lingli He1, Liang Yuan2, Yang Sun1, Pingyang Wang1, Hailin Zhang3, Xue Feng1, Zuoyun Wang1, Wenxiang Zhang1, Chuanyu Yang3, Yi Arial Zeng1, Yun Zhao1,2, Ceshi Chen3,4,5* & Lei Zhang1,2,* Author affiliations 1State Key Laboratory of Cell Biology, CAS Center for Excellence in Molecular Cell Science, Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, University of Chinese Academy of Sciences, 320 Yueyang Road, Shanghai, 200031, People's Republic of China 2School of Life Science and Technology, ShanghaiTech University, Shanghai, 201210, People’s Republic of China 3Key Laboratory of Animal Models and Human Disease Mechanisms of Chinese Academy of Sciences & Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, People’s Republic of China 4Institute of Stem Cell and Reproductive Biology, Chinese Academy of Sciences, Beijing, 100101, People’s Republic of China 5KIZ-CUHK Joint Laboratory of Bioresources and Molecular Research in Common Diseases, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, People’s Republic of China *Corresponding author Running title: GCs-activated TEAD4 contributes to breast cancer progression Corresponding author: Lei Zhang or Ceshi Chen Phone: +8602145921336 Fax: +8602145921336 Address: 320 Yue Yang Road, New building Room 505, Shanghai 200031, China Email: [email protected] or [email protected] Conflict of interest statement: The authors declare no potential conflicts of interest 1 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Hippo pathway plays a critical role in cell growth and tumorigenesis. The activity of TEA domain transcription factor 4 (TEAD4) determines the output of Hippo signaling, however, the regulation and function of TEAD4 has not been explored extensively. Here, we identified glucocorticoids (GCs) as novel activators of TEAD4. GC treatment facilitated glucocorticoid receptor (GR)-dependent nuclear accumulation and transcriptional activation of TEAD4. TEAD4 positively correlated with GR expression in human breast cancer, and high expression of TEAD4 predicted poor survival of breast cancer patients. Mechanistically, GC activation promoted GR interaction with TEAD4, forming a complex that was recruited to the TEAD4 promoter to boost its own expression. Functionally, the activation of TEAD4 by GC promoted breast cancer stem cells maintenance, cell survival, metastasis and chemo-resistance both in vitro and in vivo. Pharmacological inhibition of TEAD4 inhibited GC-induced breast cancer chemo-resistance. In conclusion, our study reveals a novel regulation and functional role of TEAD4 in breast cancer and proposes a potential new strategy for breast cancer therapy. Significance : This study provides new insight into the role of glucocorticoid signaling in breast cancer with potential for clinical translation. Introduction The Hippo signaling pathway, originally discovered in Drosophila melanogaster and highly conserved in mammals, plays key roles in cell proliferation, cell fate determination, organ size control, and tumor suppression (1-3). Hippo pathway mainly contains upstream kinase complex, transcriptional cofactor Yes associated-protein (YAP) and its paralog WW domain containing transcription regulator 1 (TAZ), and TEA domain transcription factors (TEAD1-4). Upstream core MST-LATS kinase cascade phosphorylates YAP/TAZ and restricts their localization in the cytoplasm, while unphosphorylated YAP/TAZ translocate into nucleus and binds with TEADs to 2 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. activate TEADs transcriptional activity (4,5). Activated TEADs stimulates the expression of genes involved in cell proliferation and metastasis (CYR61, CTGF, BIRC5, ANKRD1, Vimentin and N-cadherin) and then promote tumorigenesis and progression (2,6). Regulators, such as energy/osmotic stress (7,8), cell contact/mechanical force (9,10) and hormones (11) trigger Hippo pathway by controlling YAP/TAZ activity, while YAP/TAZ require TEADs binding to regulate target genes (12). Thus, it is of importance to understand the regulation and function of TEADs. TEADs have been reported to be phosphorylated by protein kinase A (PKA) and protein kinase C (PKC), which impairs TEADs DNA binding ability (13,14). TEAD4 is also palmitoylated to enhance its association with YAP/TAZ and transcriptional activity (15). RBM4-facilitated alternative splicing of TEAD4 generates a TEAD4- shorter form to suppress cancer cell proliferation and migration (16). In addition, It has been studied that p38 regulates TEADs nuclear–cytoplasmic shuttling in response to osmotic stress (8). Moreover, TEAD4 nuclear localization is critical for establishing the trophectoderm (TE)-specific transcriptional program and segregating TE from the inner cell mass (ICM) (17). More importantly, TEAD4 nuclear localization positively auto- regulates its own transcription and increases its protein level in the TE lineage, and the high TEAD4 concentration facilitates its nuclear localization as a positive feedback response (17). Recently, it has been reported that GR binds to the promoter of TEAD4 to regulate TEAD4 transcription during adipogenesis (18). The activity of TEADs is also regulated by its cofactors. Besides the most well-known co-activators YAP/TAZ, some other Hippo-independent cofactors have been also identified as TEADs-binding partners, such as the vestigial-like protein family (VGLL1–4) (19), C-terminal binding protein 2 (CtBP2) (20), transcription factor 4 (TCF4) (21), Krüppel-like factor 5 (KLF5) (22) and activator protein-1 (AP-1) (23). Together with their cofactors, TEADs bind to the conserved MCAT motif to regulate transcriptional activity involved in cancer initiation and progression (24,25). 3 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Glucocorticoids (GCs), as a kind of steroid hormones, function through glucocorticoid receptor (GR) and play important roles in various biological processes, such as cell growth, metabolism, immune and inflammatory reactions (26,27). Due to its anti-proliferative and pro-apoptotic roles, GCs have been used in various diseases therapies, such as acute lymphoblastic leukemia and multiple myeloma (27). Nevertheless, GCs treatment has side effect for the emergence of GCs-induced apoptosis resistance (28). It has been shown that GCs promote cancer cells survival and protect cells from chemotherapy-induced apoptosis (29,30). For example, Dexamethasone (Dex) treatment inhibits paclitaxel-induced apoptosis especially in breast cancer (11,31,32). Consistently, high expression of GCs-related GR correlates with poor survival and poor prognosis in breast cancer patients (11,33). However, the molecular mechanism and the key mediators that respond to GCs-GR signaling and induce cell growth, remain unclear. Breast cancer is the most common malignancy in women. In clinical diagnosis, breast cancers are divided into four subtypes based on the expression of the markers: oestrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2). Among the different subtypes, patients with triple negative breast cancer (TNBC), characterized by ER/HER2/PR negative, have the highest frequency of lymph node metastasis and poorest prognosis (34). TNBC has a relatively good response to chemotherapy, however, chemo-resistance is an alarming issue following treatment (34). The Hippo signaling pathway has been linked to breast cancer progression. The high expression of YAP and TAZ contribute to breast cancer cell survival and metastasis dependent on TEAD4 interaction (35,36). Besides, TEAD4 also acts as an oncogene in breast cancer (22). In this study, we identify glucocorticoids as new regulators of TEAD4 in breast cancer. GCs promote TEAD4 transcriptional levels, nuclear accumulation and TEAD4 transcriptional activity. These actions of GCs depend on glucocorticoid receptor (GR). 4 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Specifically, GCs-activated GR is recruited to the promoter of TEAD4 and forms a complex with TEAD4 to regulate TEAD4 transcription and auto-activation. The activity of TEAD4 positively correlates with GR expression in clinical breast cancer samples.
Load more

Recommended publications
  • TEAD3 (NM 003214) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210621 TEAD3 (NM_003214) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TEAD3 (NM_003214) Human Tagged ORF Clone Tag: Myc-DDK Symbol: TEAD3 Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC210621 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATAGCGTCCAACAGCTGGAACGCCAGCAGCAGCCCCGGGGAGGCCCGGGAGGATGGGCCCGAGGGCCTGG ACAAGGGGCTGGACAACGATGCGGAGGGCGTGTGGAGCCCGGACATCGAGCAGAGCTTCCAGGAGGCCCT GGCCATCTACCCGCCCTGCGGCCGGCGGAAGATCATCCTGTCAGACGAGGGCAAGATGTACGGCCGAAAT GAGTTGATTGCACGCTATATTAAACTGAGGACGGGGAAGACTCGGACGAGAAAACAGGTGTCCAGCCACA TACAGGTTCTAGCTCGGAAGAAGGTGCGGGAGTACCAGGTTGGCATCAAGGCCATGAACCTGGACCAGGT CTCCAAGGACAAAGCCCTTCAGAGCATGGCGTCCATGTCCTCTGCCCAGATCGTCTCTGCCAGTGTCCTG CAGAACAAGTTCAGCCCACCTTCCCCTCTGCCCCAGGCCGTCTTCTCCACTTCCTCGCGGTTCTGGAGCA GCCCCCCTCTCCTGGGACAGCAGCCTGGACCCTCTCAGGACATCAAGCCCTTTGCACAGCCAGCCTACCC CATCCAGCCGCCCCTGCCGCCGACGCTCAGCAGTTATGAGCCCCTGGCCCCGCTCCCCTCAGCTGCTGCC TCTGTGCCTGTGTGGCAGGACCGTACCATTGCCTCCTCCCGGCTGCGGCTCCTGGAGTATTCAGCCTTCA TGGAGGTGCAGCGAGACCCTGACACGTACAGCAAACACCTGTTTGTGCACATCGGCCAGACGAACCCCGC CTTCTCAGACCCACCCCTGGAGGCAGTAGATGTGCGCCAGATCTATGACAAATTCCCCGAGAAAAAGGGA GGATTGAAGGAGCTCTATGAGAAGGGGCCCCCTAATGCCTTCTTCCTTGTCAAGTTCTGGGCCGACCTCA
    [Show full text]
  • Down-Regulation of Stem Cell Genes, Including Those in a 200-Kb Gene Cluster at 12P13.31, Is Associated with in Vivo Differentiation of Human Male Germ Cell Tumors
    Research Article Down-Regulation of Stem Cell Genes, Including Those in a 200-kb Gene Cluster at 12p13.31, Is Associated with In vivo Differentiation of Human Male Germ Cell Tumors James E. Korkola,1 Jane Houldsworth,1,2 Rajendrakumar S.V. Chadalavada,1 Adam B. Olshen,3 Debbie Dobrzynski,2 Victor E. Reuter,4 George J. Bosl,2 and R.S.K. Chaganti1,2 1Cell Biology Program and Departments of 2Medicine, 3Epidemiology and Biostatistics, and 4Pathology, Memorial Sloan-Kettering Cancer Center, New York, New York Abstract on the degree and type of differentiation (i.e., seminomas, which Adult male germ cell tumors (GCTs) comprise distinct groups: resemble undifferentiated primitive germ cells, and nonseminomas, seminomas and nonseminomas, which include pluripotent which show varying degrees of embryonic and extraembryonic embryonal carcinomas as well as other histologic subtypes patterns of differentiation; refs. 2, 3). Nonseminomatous GCTs are exhibiting various stages of differentiation. Almost all GCTs further subdivided into embryonal carcinomas, which show early show 12p gain, but the target genes have not been clearly zygotic or embryonal-like differentiation, yolk sac tumors and defined. To identify 12p target genes, we examined Affymetrix choriocarcinomas, which exhibit extraembryonal forms of differ- (Santa Clara, CA) U133A+B microarray (f83% coverage of 12p entiation, and teratomas, which show somatic differentiation along genes) expression profiles of 17 seminomas, 84 nonseminoma multiple lineages (3). Both seminomas and embryonal carcinoma GCTs, and 5 normal testis samples. Seventy-three genes on 12p are known to express stem cell markers, such as POU5F1 (4) and were significantly overexpressed, including GLUT3 and REA NANOG (5).
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast
    Published OnlineFirst July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012 Cancer Molecular Cell Biology Research Glucocorticoid Receptor Signaling Activates TEAD4 to Promote Breast Cancer Progression Lingli He1,2, Liang Yuan3,Yang Sun1,2, Pingyang Wang1,2, Hailin Zhang4, Xue Feng1,2, Zuoyun Wang1,2, Wenxiang Zhang1,2, Chuanyu Yang4,Yi Arial Zeng1,2,Yun Zhao1,2,3, Ceshi Chen4,5,6, and Lei Zhang1,2,3 Abstract The Hippo pathway plays a critical role in cell growth and to the TEAD4 promoter to boost its own expression. Func- tumorigenesis. The activity of TEA domain transcription factor tionally, the activation of TEAD4 by GC promoted breast 4 (TEAD4) determines the output of Hippo signaling; how- cancer stem cells maintenance, cell survival, metastasis, and ever, the regulation and function of TEAD4 has not been chemoresistance both in vitro and in vivo. Pharmacologic explored extensively. Here, we identified glucocorticoids (GC) inhibition of TEAD4 inhibited GC-induced breast cancer as novel activators of TEAD4. GC treatment facilitated gluco- chemoresistance. In conclusion, our study reveals a novel corticoid receptor (GR)-dependent nuclear accumulation and regulation and functional role of TEAD4 in breast cancer and transcriptional activation of TEAD4. TEAD4 positively corre- proposes a potential new strategy for breast cancer therapy. lated with GR expression in human breast cancer, and high expression of TEAD4 predicted poor survival of patients with Significance: This study provides new insight into the role breast cancer. Mechanistically, GC activation promoted GR of glucocorticoid signaling in breast cancer, with potential for interaction with TEAD4, forming a complex that was recruited clinical translation.
    [Show full text]
  • Full Text (PDF)
    Published OnlineFirst May 1, 2014; DOI: 10.1158/0008-5472.CAN-13-3147 Cancer Tumor and Stem Cell Biology Research Loss of the Polycomb Mark from Bivalent Promoters Leads to Activation of Cancer-Promoting Genes in Colorectal Tumors Maria A. Hahn1, Arthur X. Li2, Xiwei Wu3, Richard Yang1, David A. Drew4, Daniel W. Rosenberg4, and Gerd P. Pfeifer1 Abstract In colon tumors, the transcription of many genes becomes deregulated by poorly defined epigenetic mechanisms that have been studied mainly in established cell lines. In this study, we used frozen human colon tissues to analyze patterns of histone modification and DNA cytosine methylation in cancer and matched normal mucosa specimens. DNA methylation is strongly targeted to bivalent H3K4me3- and H3K27me3-associated promoters, which lose both histone marks and acquire DNA methylation. However, we found that loss of the Polycomb mark H3K27me3 from bivalent promoters was accompanied often by activation of genes associated with cancer progression, including numerous stem cell regulators, oncogenes, and proliferation-associated genes. Indeed, we found many of these same genes were also activated in patients with ulcerative colitis where chronic inflammation predisposes them to colon cancer. Based on our findings, we propose that a loss of Polycomb repression at bivalent genes combined with an ensuing selection for tumor-driving events plays a major role in cancer progression. Cancer Res; 74(13); 3617–29. Ó2014 AACR. Introduction cells (21, 22). The acquisition of the more permanent silencing Tumorigenesis is a complex process that is driven by a mark, 5mC, at the promoters of Polycomb target genes does number of genetic and epigenetic alterations, which often not fundamentally change their expression levels although result in aberrant gene expression (1–3).
    [Show full text]
  • Accompanies CD8 T Cell Effector Function Global DNA Methylation
    Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Methylome and Transcriptome Maps of Human Visceral and Subcutaneous
    www.nature.com/scientificreports OPEN Methylome and transcriptome maps of human visceral and subcutaneous adipocytes reveal Received: 9 April 2019 Accepted: 11 June 2019 key epigenetic diferences at Published: xx xx xxxx developmental genes Stephen T. Bradford1,2,3, Shalima S. Nair1,3, Aaron L. Statham1, Susan J. van Dijk2, Timothy J. Peters 1,3,4, Firoz Anwar 2, Hugh J. French 1, Julius Z. H. von Martels1, Brodie Sutclife2, Madhavi P. Maddugoda1, Michelle Peranec1, Hilal Varinli1,2,5, Rosanna Arnoldy1, Michael Buckley1,4, Jason P. Ross2, Elena Zotenko1,3, Jenny Z. Song1, Clare Stirzaker1,3, Denis C. Bauer2, Wenjia Qu1, Michael M. Swarbrick6, Helen L. Lutgers1,7, Reginald V. Lord8, Katherine Samaras9,10, Peter L. Molloy 2 & Susan J. Clark 1,3 Adipocytes support key metabolic and endocrine functions of adipose tissue. Lipid is stored in two major classes of depots, namely visceral adipose (VA) and subcutaneous adipose (SA) depots. Increased visceral adiposity is associated with adverse health outcomes, whereas the impact of SA tissue is relatively metabolically benign. The precise molecular features associated with the functional diferences between the adipose depots are still not well understood. Here, we characterised transcriptomes and methylomes of isolated adipocytes from matched SA and VA tissues of individuals with normal BMI to identify epigenetic diferences and their contribution to cell type and depot-specifc function. We found that DNA methylomes were notably distinct between diferent adipocyte depots and were associated with diferential gene expression within pathways fundamental to adipocyte function. Most striking diferential methylation was found at transcription factor and developmental genes. Our fndings highlight the importance of developmental origins in the function of diferent fat depots.
    [Show full text]