USOO8686 125B2

(12) United States Patent (10) Patent No.: US 8,686,125 B2 Espley et al. (45) Date of Patent: Apr. 1, 2014

(54) CHIMERIC PROMOTERS COMPRISING (52) U.S. Cl. MYB1OREPEATELEMENT AND METHODS USPC ...... 536/24.1:536/22.1536/23.1536/23.6; FOR REGULATING PLANT GENE 435/410; 435/243; 435/320.1; 435/419: 800/278:

OSSCO Sea (75) Inventors: Richard Espley, Auckland (NZ); Roger None P. Hellens, Auckland (NZ); Andrew C. See application file for complete search history. Allan, Auckland (NZ); David Chagne, Palmerston North (NZ): Cyril (56) References Cited Brendolise, Auckland (NZ) U.S. PATENT DOCUMENTS (73) Assignee: The New Zealand Institute for Plant 4,795,855 A 1/1989 Filatti et al. and Food Research Limited, Auckland 5,004,863. A 4, 1991 Umbeck (NZ) (Continued) (*) Notice: Subject to any disclaimer, the term of this FOREIGN PATENT DOCUMENTS patent is extended or adjusted under 35 U.S.C. 154(b) by 330 days. NZ 555127 5/2007 WO 2008/140334 11, 2008 (21) Appl. No.: 12/992,543 WO 2009/1396.49 11, 2009 OTHER PUBLICATIONS (22) PCT Filed: May 12, 2009 Takos et al. Light-induced Expression of a MYB gene regulates (86). PCT No.: PCT/NZ2009/000076 anthocyanin biosynthesis in red apples. Plant Physiology. 2006. S371 (c)(1) 142(3): 1216-1232.* (2), (4) Date: Mar. 16, 2011 (Continued) (87) PCT Pub. No.: WO2009/139649 Primary Examiner — Cathy Kingdon Worley Assistant Examiner — Ashley K Buran PCT Pub. Date: Nov. 19, 2009 (74) Attorney, Agent, or Firm — Lathrop & Gage LLP (65) Prior Publication Data (57) ABSTRACT US 2011 FO271396 A1 Nov. 3, 2011 The invention provides a method for producing a chimeric O O promoter polynucleotide capable of controlling transcription (30) Foreign Application Priority Data of an operably linked polynucleotide in a plant cell or plant, wherein the method comprises combining: a) at least one May 12, 2008 (NZ) ...... 568190 sequence motif comprising a sequence with at least 70% identity to SEQID NO:1, 11 or 12, and b) another polynucle (51) Int. Cl. otide sequence. The invention also provides chimeric promot C7H 2L/00 (2006.01) ers polynucleotides comprising the sequences defined in a) C7H 2L/04 (2006.01) and b). The invention also provides constructs, vectors, host CI2N IS/00 (2006.01) cells, plant cells and plants comprising the chimeric promoter CI2N 15/09 (2006.01) polynucleotides of the invention. The invention also provided CI2N IS/II3 (2010.01) methods for modifying gene expression and phenotype of CI2N 15/63 (2006.01) plant cells and plants by transforming the plant cells and CI2N 15/82 (2006.01) plants with the chimeric promoter polynucleotides of the AOIH I/O (2006.01) invention. AOIH 4/00 (2006.01) AOIH 5/00 (2006.01) 35 Claims, 15 Drawing Sheets

6 3b 3a 2 microsatellite 1 ------r m r ------gttagactggtagctataacaagttagactgctggtagctataacaagttagactggtagctataacaagttagactgtgtgtgtgtgtgtattoacaagttagactggtagctataacaa

---- 5 4 -. gttagactggtagctataacaagttagactggtagctataacaa US 8,686,125 B2 Page 2

(56) References Cited Search Report, dated Oct. 7, 2009, corresponding to International Application No. PCT/NZ2009/000076 (filed May 12, 2009), parent U.S. PATENT DOCUMENTS of the present application, 10 pp. Alam et al. (1999) “Transgenic insect-resistant maintainer line 5,159,135 A 10, 1992 Umbeck (IR68899B) for improvement of hybrid rice.” Plant Cell Reports 5,177,010 A 1/1993 Goldman et al. 18:572-575. 5,187,073. A 2f1993 Goldman et al. Albert et al. (1997) “BANYULS, a Novel Negative Regulator of 5,188,958 A 2/1993 Moloney et al. 5,352,605 A 10/1994 Fraley et al. Flavonoid Biosynthesis in the Arabidopsis Seed Coat.” Plant Journal 5,364,780 A 1 1/1994. Hershey et al. 11(2):289-299. 5,416,011 A 5, 1995 Hinchee et al. Altschul et al. (1997) “Gapped BLAST and PSI-BLAST: a new 5,463,174 A 10/1995 Moloney et al. generation of protein database search programs. Nucleic Acids Res 5,510,474 A 4/1996 Quail et al. 25(17):3389-3402. 5,563,055 A 10, 1996 Townsend et al. Bajajetal. (2006) “A High Throughput Agrobacterium tumefaciens 5,569,834 A 10, 1996 Hinchee et al. Mediated Transformation Method for Functional Genomics of 5,591,616 A 1/1997 Hiei et al. Perennial Ryegrass (Lolium perenne L.). Plant Cell Rep. 25:651 5,750,871 A 5/1998 Moloney et al. 659. 5,792,935 A 8, 1998 Arntzen et al. Baxevanis, A.D. (2001) “The Molecular Biology Database Collec 5,824,877 A 10, 1998 Hinchee et al. tion: an updated compilation of biological database resources.” 5,846,797 A 12/1998 Strickland 5,952,543 A 9/1999 Firoozabady et al. Nucleic Acids Research 29(1): 1-10. 5,968,830 A 10, 1999 Dan et al. Birch, R.G. (1997) “Plant Transformation: Problems and Strategies 5,981,840 A 11/1999 Zhao et al. for Practical Application.” Ann Rev Plant Phys Plant Mol Biol 6,020,539 A 2, 2000 Goldman et al. 48:297-326. 6,037,522 A 3/2000 Dong et al. Bolton et al. (1962) “A General Method for the Isolation of RNA 6,074,877 A 6, 2000 DHalluin et al. Complementary to DNA” PNAS 48:1390-1397. 2002/0160378 A1* 10/2002 Harper et al...... 435/6 Borevitz et al. (Dec. 2000) "Activation Tagging Identifies a Con 2004/OOO9476 A9 1/2004 Harper et al. served MYB Regulator of Phenylpropanoid Biosynthesis.” Plant Cell 2004/0025205 A1* 2/2004 Spangenberg et al...... 800,287 12:2383-2393. 2007, OO16976 A1 1/2007 Katagiri et al. Bulley et al. (2009) "Gene Expression Studies in Kiwifruit and Gene 2007, 0118921 A1 5, 2007 Boukharov et al. Over-Expression in Arabidopsis Indicates That GDP--Galactose 2007/0209085 A1 9, 2007 Wu et al. Guanyltransferase is a Major Control Point of Vitamin C OTHER PUBLICATIONS Biosynthesis,” J Exp. Bot 60(3):765-778. Chagné et al. (2007) "Mapping a Candidate Gene (Md MYB10) for Telias et al. Apple skin patterning is associated with differential Red Flesh and Foliage Colour in Apple.” BMC Genomics, 8:212, 11 expression of MYB10. BMC Plant Biology. 2011. 11 (93): 1-15.* pp. published online Jul. 3, 2007. Kim et al. A 20 nucleotide upstream element is essential for the Degenhardt et al. (1994) "Two 10-bp Regions are Critical for nopaline synthase (nos) promoter activity. Plant Molecular Biology. Phytochrome Regulation of a Lemna gibba Lhcb Gene Promoter.” 1994. 24: 105-117. Plant Cell 6(8): 1123-1134. Jin et al. Multifunctional and diversity within the plant MYB-gene Espley et al. (2007) “Red Colouration in Apple Fruit is Due to the family. Plant Molecular Biology. 1999. 41(5): 577-585.* Activity of the MYB Transcription Factor, Md MYB 10.” Plant J. Takos et al. Malus x domestica MYB transcription factor (MYB1) 49:414-427. gene, MYB1-1 allele, promoter region and complete cods. GenBank Espley etal. (2009) “Multiple Repeats of a Promoter Segment Causes Accession No. DQ886414.1. Published Nov. 18, 2006.* Transcription Factor Autoregulation in Red Apples.” Plant Cell Gonzalez et al. Regulation of the anthocyanin biosynthetic pathway 21:168-183. by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis Feng and Doolittle (1987) “Progressive Sequence Alignment as a seedlings. The Plant Journal. 2008. 53: 814-827.* Prerequisite to Correct Phylogenetic Trees.” J. Mol. Evol. 25:351 Allan et al. (Jul. 21, 2006) NCBI Nucleotide Accession No. 360. DQ267900.1, “Malus x domestica cultivar Royal Gala MYB9 Folta et al. (2006) "Characterization of LF9, an octoploid strawberry mRNA, complete cols'. genotype selected for rapid regeneration and transformation. Planta Gleave, A. (Nov. 4, 2010) NCBI Nucleotide Accession No. 224:1058-1067. CN934367.1, “000202AVBB002218HT (AVBB) Royal Gala young Frohman, M.A. (1993) “Rapid Amplification of Complementary shoot Malus X domestica cDNA clone AVBB002218, mRNA DNA Ends for Generation of Full-Length Complementary DNAS: sequence'. Thermal RACE.” Methods Enzymol. 218:340-356. Romero et al. (Apr. 18, 2005) NCBI Nucleotide Accession No. Gleave, A.P. (1992) “A Versatile Binary Vector System with a T-DNA CAB09230.1, “R2R3-MYB transcription factor Arabidopsis Organisational Structure Conducive to Efficient Integration of thaliana'. Cloned DNA into the Plant Genome. Plant Mol Biol 20:1203-1207. Takos et al. (Nov. 18, 2006) NCBI Nucleotide Accession No. Gonzalez Padillaetal. (2003) “Early antibiotic selection and efficient DQ886414.1, “Malus x domestica MYB transcription factor rooting and acclimatization improve the production of transgenic (MYB1) gene, MYB1-1 allele, promoter region and complete cols'. plum plants (Prunus domestica L.). Plant Cell Reports 22(1):38-45. Takos et al. (Nov. 18, 2006) NCBI Nucleotide Accession No. Graham et al. (1995) "Agrobacterium-Mediated Transformation of DQ886415.1, “Malus x domestica MYB transcription factor Soft Fruit Rubus, Ribes, and Fragaria.” Methods Mol Biol. 44:129 (MYB1) gene, MYB1-2 allele, promoter region and complete cols'. 33. Takos et al. (Nov. 18, 2006) NCBI Nucleotide Accession No. Gruber, et al. (1993) “Vectors for Plant Transformation' Methods in DQ886416.1. "Malus x domestica MYB transcription factor Plant Molecular Biology and Biotechnology) et al. eds, CRC Press, (MYB1) gene, MYB1-3 allele, promoter region and complete cols'. pp. 89-119. NCBI Nucleotide Accession No. NM 105042.4 (Apr. 30, 2008) Hashimoto et al. (2004)“5'-End SAGE for the Analysis of Transcrip “Arabidopsis thaliana transcription factor EGL1 (EGL3) mRNA, tional Start Sites.” Nature Biotechnology 22(9): 1146-1149. complete cods'. Hellens et al. (2005) “Transient expression vectors for functional NCBI Nucleotide Accession No. NM 104541.3 (Apr. 30, 2008) genomics, quantification of promoter activity and RNA silencing in “Arabidopsis thaliana transcription factor MYB75 (PAP1) plants.” Plant Methods 1:13, 14 pages, http://www.plantmethods. mRNA.complete cds”. com/content 1/1/13. International Preliminary Report on Patentability, dated Mar. 24. Herrera-Estrella et al. (1983) “Expression of chimaeric genes trans 2010, corresponding to International Application No. PCT/NZ2009/ ferred into plant cells using a Ti-plasmid-derived vector.” Nature 000076 (filed May 12, 2009), parent of the present application, 11 pp. 3O3:209-213. US 8,686,125 B2 Page 3

(56) References Cited Notredame et al. (2000) “T-Coffee: A Novel Method for Fast and Accurate Multiple Sequence Alignment.” J. Mol. Biol. 302:205-217. OTHER PUBLICATIONS Oosumi et al. (2006) "High-efficiency transformation of the diploid Strawberry (Fragaria vesca) for functional genomics.” Planta Horsch et al. (1985) “A Simple and General Method for Transferring Genes into Plants.” Science 227: 1229-1231 with correction of 223(6):1219-1230, published online Dec. 1, 2005. authorship. Ortiz et al. (1996) "Hygromycin resistance as an efficient selectable Huang, X. (1994) "On Global Sequence Alignment. Computer Appli marker for wheat stable transformation.” Plant Cell Reports 15:877 cations in the Biosciences.” 10(3):227-235. 881. Husselstein-Muller et al. (Jan. 2001) "Molecular Cloning and Pena et al. (1995) “High efficiency Agrobacterium-mediated trans Expression in Yeast of 2,3-oxidosqualenetriterpenoid Cyclases from formation and regeneration of citrus.” Plant Science 104:183-191. Arabidopsis thaliana.” Plant Mol Biol. 45(1):75-92. Ramesh et al. (2006) “Improved methods in Agrobacterium-medi Kardailsky et al. (1999) 'Activation Tagging of the Floral Inducer ated transformation of almond using positive (mannose/pmi) or nega FT. Science 286:1962-1965, downloaded Nov. 17, 2011. tive (kanamycin resistance) selection-based protocols.” Plant Cell Kominato et al. (1997) “Transcription of Human ABO Histo-blood Reports 25 (8):821-828, published online Mar. 14, 2006. Group Genes is Dependent upon Binding of Transcription Factor CBF/NF-Y to Minisatellite Sequence.” J. Biol. Chem. Rice et al. (Jun. 2000) EMBOSS: The European Molecular Biology 272(41):25890-25898. Open Software Suite, Trends in Genetics 16(6):276-277. Krens et al. (1997) “Transgenic caraway, Carum carvi L.: a model Rushton et al. (2008) "Tobacco Transcription Factors: Novel Insights species for metabolic engineering.” Plant Cell Reports 17:39-43. into Transcriptional Regulation in the Solanaceae.” Plant Physiol Kumar et al. (1996) "Potato plants expressing antisense and sense 147:280-295. S-adenosylmethionine decarboxylase (SAMDC) transgenes show Schrott, M. (1995) “Selectable Marker and Reporter Genes.” In: altered levels of polyamines and ethylene: antisense plants display Gene Transfer to Plants (Potrykus, T., Spangenberg. Eds) Springer abnormal phenotypes.” The Plant J.9(2): 147-158. Verlag. Berline, pp. 325-336. Laing et al. (May 29, 2007) “The missing step of the L-galactose Song et al. (2006) "Transformation of Montmorency sour cherry pathway of ascorbate biosynthesis in plants, an L-galactose (Prunus cerasus L.) and Gisela 6 (P. cerasus XP canescens) cherry guanyltransferase, increases leaf ascorbate content.” PNAS USA rootstock mediated by Agrobacterium tumefaciens.” Plant Cell 104(22):9534-9539. Reports 25(2): 117-123, published online Dec. 21, 2005. Lew et al., (2000) “Unusual DNA Structure of the Diabetes Suscep Takos et al. (2006) “Light-Induced Expression of a MYB Gene Regu tibility Locus IDDM2 and its Effect on Transcription by the Insulin lates Anthocyanin Biosynthesis in Red Apples.” Plant Physiology Promoter Factor Pur-ly MAZ.” PNAS97(23): 12508-12512. 142:1216-1232. Li et al. (1996) "Genetic transformation of cassava (Manihot Tatusova et al. (1999) “BLAST 2 Sequences, a New Tool for Com esculenta Crantz).” Nature Biotechnology 14:736-740. paring Protein and Nucleotide Sequences'. FEMS Microbiol Lett. Li et al. (2003) "Transgenic rose lines harboring an antimicrobial 174:247-2SO. protein gene, Ace-AMPI, demonstrate enhanced resistance to pow Thompson et al. (1994) “CLUSTALW. improving the sensitivity of dery mildew (Sphaerotheca pannosa).” Planta 218(2):226-232. progressive multiple sequence alignment through sequence weight Matsuda et al. (2005) “Development of an Agrobacterium-mediated ing, position-specific gap penalties and weight matrix choice.” transformation method for pear (Pyrus communis L.) with leaf-sec Nucleic Acids Research 22:4673-4680. tion and axillary shoot-meristem explants.” Plant Cell Reports Ubietal. (2006) “Expression Analysis of Anthocyanin Biosynthetic 24(1):45-51. Michelmore etal. (1987) “Transformation of lettuce (Lactuca sativa) Genes in Apple Skin: Effect of UV-B and Temperature.” Plant Sci. mediated by Agrobacterium tumefaciens.” Plant Cell Reports 6:439 170:571-578. 442. Verstrepen et al. (2005) “Intragenic Tandem Repeats Generate Func Needleman et al. (1970) “A General Method Applicable to the Search tional Variability.” Nat. Genet. 37(9):986-990. for Similarities in the Amino Acid Sequence ofTwo Proteins,” J. Mol. Wheeler et al. (2001) “Database resources of the National Center for Biol. 48:443-453. Biotechnology Information.” Nucleic Acids Research 29(1):11-16. Nesietal. (Sep. 2001) “The Arabidopsis TT2 Gene Encodes an R2R3 Xie et al. (Jan. 17, 2003) “Role of Anthocyanidin Reductase, MYB Domain Protein that Acts as a Key Determinant for Encoded by BANYULS in Plant Flavonoid Biosynthesis,” Science Proanthocyanidin Accumulation in Developing Seed.” Plant Cell 299:396-399, downloaded Nov. 18, 2005. 13:2099-2114. Yao et al. (1995) “Regeneration of transgenic plants from the com Niu et al. (1998) "Transgenic peppermint (Mentha x piperita L.) mercial apple cultivar Royal Gala.” Plant Cell Reports 14:407-412. plants obtained by cocultivation with Agrobacterium tumefaciens.” Plant Cell Reports 17:165-171. * cited by examiner U.S. Patent Apr. 1, 2014 Sheet 1 of 15 US 8,686,125 B2

Figure 1

zneadeg

108 TO?I IC81 U.S. Patent Apr. 1, 2014 Sheet 2 of 15 US 8,686,125 B2

igure 2

9-ZSpeed?>} eº|w9de

U.S. Patent Apr. 1, 2014 Sheet 3 of 15 US 8,686,125 B2

Figure 3 U.S. Patent Apr. 1, 2014 Sheet 4 of 15 US 8,686,125 B2

Figure 4

0.8

0.7

0.6

0.5

0.4

0.3

O.2

R.LUC RLUC R.LUC Re:LUC +35S:MYB 10 +35S:MYB10 U.S. Patent Apr. 1, 2014 Sheet 5 Of 15 US 8,686,125 B2

Figure 5

atus sieversi Maius X purpurea Malus pumila illets x elongestice task correstica 93.05 GC1-C48 Alderhanensis Niedwetzkyana cv. 'Prairiere cv. 'Geneva 3 4. 5

aius Sieversi aus donesia Alaus X donestica afts x donestics Aaius x donestica 92,10330-312 cv. 'Granny Smith cv. 'Royal Gala cv. 'Fuji cv. 'Braeburn 6 7 8 s O U.S. Patent Apr. 1, 2014 Sheet 6 of 15 US 8,686,125 B2

Figure 6

U.S. Patent Apr. 1, 2014 Sheet 8 of 15 US 8,686,125 B2

Figure 8

(a ) Name Microsat Repcat unit Number of repeat units -1704 +1 R Repeat (Native) R Repeats - 1750 Repeats Synthesised Repeats

Repeats (Native)

Hill Repeat -- spatial substitution

2.00 - McMYBO 1.75 -- McMYBO + McHH3 150

1.25

1.00

0.75

0.50

0.25 U.S. Patent Apr. 1, 2014 Sheet 9 Of 15 US 8,686,125 B2

Figure 9a

MicroSat R1 Name

U.S. Patent Apr. 1, 2014 Sheet 10 of 15 US 8,686,125 B2

Figure 9b

(b) 1...so () (ii)

- MMYBO 1.25 - Mid-8

OO

s

s

25 s O --- i.e.

R. RAa RAb Rac Rad R. RAa RAb RAC Rad Rs R&Aa RAb R8At R8Ad Ra reAa RAb R8Ac. R&Ad R1:LUC Reporter R.LUC Reporter U.S. Patent Apr. 1, 2014 Sheet 11 of 15 US 8,686,125 B2

Figure 10

MMYB10R1

6 MidMYB10Rs CB02 41 Na Dra

R 1 6

PcMYB10(GP) U.S. Patent Apr. 1, 2014 Sheet 12 of 15 US 8,686,125 B2

Figure 11

MOR6

20 -

1OO

0.80 -- &

OSO --

0.40 -

0.20 U.S. Patent Apr. 1, 2014 Sheet 13 of 15 US 8,686,125 B2

50 GP3-3 pear promoter GGTGTTGAGG GGGAGTGTTG AAGATCA ACA CCAGCCCAA TGGTGTTTGT MdMYB10 Promoter (short) 100 GP3-3 pear promoter CCATGGACAA MdMYB10 Promoter (short) 150 GP3-3 pear promoter TACCAAACTT CAACTTCCTC Md"YB10 Promoter (short) . . . ATGAGCT CACCCTG. . . 15 2OO GP3-3 pear promoter GAACTAGTTTA GAA. . GIANTG GTGGGIAGAT GGCATCCICA . . . CCATCTG MdMYB10 Promoter (short) . AACACGTGG GAACCGGCCC GTTTGTAACC GACTGAGATA GGTCCGGTTC 20 25 O GP3-3 pear promoter TATCAATTAA GAAGACTAAG TGAGAGTGAG AAGTAGGAGT AGTCTTGTGA Md MYB10 Promoter short) ATTTCTTAA AAACCC. AAC ACCCGCTAG '''CTA'''I''A' AAACGGGCC 251 3OO GP3-3 pear promoter GGAGTGTGAG TGGTCTAAAG TTTGTCTCTA GAAAGAGTGA GTGTCATAGC Md MYB10 Promoter short) GGTCTG. . . G 'CCCTCCAAC TTGAGCCCG GCTCGACTT. GTGCCCACTC 301 350 GP3-3 pear promoter TCAAATAGT GTCTTTGAGA GTTTGTGTGC TATAATATTT TGTGAGTTAA Md MYBlO Promoter (short) CTAAACTAAA CCATATAAAA ACCAAGAT. . . . TTCCCTTT TCTTCTTTCA 351 400 GP3 – 3 pear promoter TACAAGTAAT TGTTTACTTG TGTTGTCTCT CCAACACTTG TGTTAAAGTT MdMYB10 Promoter (short) CACATATCAC GTTACTTTC CAACAACAAT TCAACAATCA CAACAAA. . . 40 450 GP3-3 pear promoter GTGTACTCTA AGTTTTCCCC AACATATATC ACTTCACTAA TAAAGACAAC MdMYB10 Promoter (short) . . . TAATCAA CCA TCAAG ATCATATATC ACGTCACTAA TAAAGACAAC 451. 5OO GP3-3 pear promoter CTTCGTAAGG GTTGCCGTAG TTCTCTACTT GAAATCCAAT TATCTAGCAT MdMYB10 Promoter (short) CTTCACAAGG GTTGTCGTAG TTCTCTACTG GAAATCCAAT TGTCTAGCAT 5 O1. 55 O GP3-3 pear promoter TGTAACCCTA AGTTACAGAC ACAAACATAA ACTTGAGCAA CTTCTATGCA Md MYB10 Promoter (short) TGAACCCTA AGTTACAGAC ACAAACATAA ACTTGAGCAA CTTCTATGCA 551 6OO GP3-3 pear promoter TAAGAATCTA GGGTTTCAGA CTAACT CAA GGAACCTAAC AAGAAATAAT McMYB10 Promoter (short) TAAGAATCTG GGGTTTTGGA CTAACTCAAC AGAACCTAAC AAGAAATAAT 6O1 650 GP3-3 pear promoter ATCC. GGACC GCT. AACGAT GCATCCAATC GAAGACAAGG TTTCGGAC. A Md MYB10 Promoter (short ATTCTGGACC GCTTAACG. GAATCCAA C GAAGACAAGG TTTCGGACCA 651 7 OO GP3-3 pear promoter CTCAACGGAA CAAATAAGGG AAAAGGATAT AAACCACTCA ACGAAGTTCA Md MYB10 Promoter (short) CTCAACGGAA CAAATAAGGG AAAGGGATAT AAACCATTCA ACGAAATCCA Figure 12-1 U.S. Patent Apr. 1, 2014 Sheet 14 of 15 US 8,686,125 B2

701. 750 GP3-3 pear promoter TCTCTAGAAT ACGTATAGTC ... CCCAATACG GATAACCAA GTGAGAACA MdMYB10 Promoter (short) TCTTTAGAAT ACGCATAGTC TCCCAATACG GATTAACCAA GTGAGAACAT 751. 8OO GP3-3 pear promoter ACACCATCTA ATAGCATGGT CCGCAAGAT AGATAACTAG GTAGGACCAC MdMYB10 Promoter (short) ACGCCATCTG ATAGCGTGGT CCCGCAAGAC AGATAACCAA GTAGGACCAC 8O 850 GP3-3 pear promoter CGATGGTATA ATGTGACCAA GTAAGTAGTG ACCCTAAATG TAGATTAACC MdMYB10 Promoter (short) CGATGGTATA ATGTGACCAA GTAAGCAGTG ACCCTAAATG TAGATTAACC

851 900 GP3-3 pear promoter AAGTGGAGT AAATTTAGAA TGCATATGCA CCCTACCCCC CCAAGACAGA MdMYBl() Promoter (short) ACATCCAGTT AAATTA. . . A 901 950 GP3-3 pear promoter CTAACCAGGC AGAACCATAT TTCCTTAATG McMYB10 Promoter (short) 951 OOO GP3-3 pear promoter CAGATTGACA AGGCGGAACC ACCTATGAAA ATAATGTAAC TAGGTAGGGC MdMYB10 Promoter (short) ------CA AGGCTGAACC ACCTATGAAA ATAATGAA.

1001 O5 O GP3-3 pear promoter CCGACGAATA TCTATTGCCT GAAATCTTAG GAGAGAATTC TTGCTCTAGG MdMYB10 Promoter (short) ------GCCT GAAATCTTAG GAGAGAATTC T GCTCTAGG 1051 1100 GP3-3 pear promoter GGACAAATGA TTTTCGTATG CCTAAGTATT TTTTATTTAG TGACAGTAAA McMYB10 Promoter (short) GGACAAATGA TTTTCCTATG CCTAAGTGTT TTTT. . . TAG TGACAGTAAA 11 O1 150 GP3-3 pear promoter CTAAGATTTG AGTACAGAGA CATTAACTGA GATTGACTCT TGTGAAAGCT MdMYB10 Promoter (short) CTAAGATTTG AGTACAGAGA CATTAACGA GATTGACTCT TGTGAAAGCT 1151 2OO GP3-3 pear promoter TAGTGAGG AAGCACTTAG GCCAATTATA TTGAGCAATG TGTTAGGTGT MdMYB10 Promoter (short) TAGTGAGTTG AAGCACGTAG GCCAATTATA TTGAGCAATG TGTTAGGTGT 12 Ol 1250 GP3-3 pear promoter AGCGCTAAA CTTCCGTAGG AGTTTTTTAC AACAAGATAG TGGGGGTGCC MdMYB10 Promoter (short) AGCGCTAAA CTTCCGTAGG AGTTTTGTAC AGCAATATAG TGGGGGTGCC 125. 13OO GP3-3 pear promoter GCAAAATGCA GACAGTAGCA ATAAATTACG GGCTAGGATT ATCTCCCCTC MdMYB10 Promoter (short) GCAAAATGCA GACAGTAGCA ATAAATTACG GGCTAGGATT TTCTCCTCTT 3OI 350 GP3-3 pear promoter CTTTTTTGT TCCATTCCAT CCCTTCCTCT CACATTCCT ATTTTGTCTT MdMYB10 Proinoter (short) TTTTTTTCGT TCCAT ICCAT CCATTCCTCT CACATTTTT ATTTTGTCTT 1351. 14 OO GP3-3 pear promoter TCTTTTTCTA AAAAAAATTA ATATAAGATG TTGATATAGC TTAACCGGGA MdMYB10 Promoter (short) TCTCTTTCTA TAAAAAATTA ATATAAGATG TAAGTAAC TTGACCGTGA 14 O1 1 450 GP3-3 pear promoter CCCTTCAAAT AAGAGGGCAA GGAACAAGAC GAAAAAAAAA ACACAGCAAG MdMYB10 Promoter (short) CTATTCAAAT AGGAGGGGAA TGAAGAAGAG GGAAAAAAA. - - - - - GG. . . 1451 1500 GP3-3 pear promoter GAAGAAGAGG AAAAAAAAAA AAAAAGAGAG GGAAGAGATT TTACTTTATA Figure 12-2 U.S. Patent Apr. 1, 2014 Sheet 15 of 15 US 8,686,125 B2

15 Ol 1550 GP3-3 pear promoter AATTACAAGC AGACACTTTT TGTTTTTTTT TTTTTTGAC AAGGAGAAGC MdMYB10 Promoter (short) AATTACAAGC AAACACTTT - - - - - TTTTT TTTTTTTGAC AAGCAGAAGC 1551 1600 GP3-3 pear promoter AAACAAACAC TTGAAAAAGC AGCGAAAGCA GGCTAAAGGT ATCTTATGGT MdMYB10 Promoter (short) AAACAAACAC TTGAAAAAGC AGCGAAAGCA TGATAAAGGT ATCTTATGGT

1601 650 GP3-3 pear promoter GGTCAAAGAT GTGTCTTGTA ACTAGTTACA CGATTCTGCC TTCACATTCA MdMYE10 Promoter (short) GGTCAAAGAT GTGTGTTGTA ACTAGTTACA CGATTCTCCA TTCACATTCA

1651 17 OO GP3-3 pear promoter TAGAATGTGC TTTTGAATAT TATATTACAG CTAGAGAATT TGATGTCTTA MdMYB10 Promoter (short) TAGAATGTGC TTTTGAATAT TATATTACAG CTACAGAATT TTATCCCCTG

1701 1750 GP3-3 pear promoter CCA...... a w A. TGTTGTCGTG CAGAAATGTC AGCTTTCTA MdMYB10 Promoter (short) GGA','TGATTT CCCTTGTCAA TGTTCTCCTG CAGAAATGT AGCTTTTCTA 175 1800 G23-3 pear promoter TATATAGCGT GTGTGT...... ATTT CACAAGTTAG ACCGCTAGCT MdVYB10 Promoter (short) TATATCGAGT GTGTGTGTCT CTCTGTATTT CACAAGTTAG ACTGGTAGCT

1801 1850 GP3-3 pear promoter AATAACAACT GTTGAAATGT TTCAAACGTG TCACTGTTC CTTCTGTGGA MdMYBl0 Promoter (short) AATAACAACT CTTGGAATGT TTTAAACTTG TCAGTGTTTG CTTCTGTGGA

1851 1900 GP3-3 pear promoter TATCAGACAT GCACGTCACT GGCCTTGGAA GATTAATTAG TCCGATGGTA MdMY Blo Promoter (short) TATCAGACAT GCACGTCACT GGCCTTGTAA GATTAATTAG GCCGATGGTA

1901 1950 GP3-3 pear promoter TCCATAGCGT TAACGTCATG GCAAACACAC TCTA AATATA TATATATATA MdMYB10 Promoter (short) TCCATAGCGT TAATGTCATG GCAAACACAC TCTAATTATA TAT. . A. . . .

- 1951 2000 GP3-3 pear promoter TAATGGTAGC TAGGTGTCTT TCTGGAGT ATGAAGTGGG TAGCAGGCAA Md MYB10 Promoter (short) ... ATGGTAGC TAGGTGTCTT TCTGGAGTGT ATGAAGTGGG TAGCAGGCAA

2001 2O38 GP3-3 pear promoter AAGATAAGCT AAGTTTAGCT GCTAGCAGAT ACGAGATG Md MYB10 Promoter (short) AAGAATAGCT AAGCTTAGCT GCTAGCAGAT AAGAGATG

Figure 12-3 US 8,686,125 B2 1. 2 CHMERIC PROMOTERS COMPRISING Genetic manipulation of such traits in apple, and these and MYB1OREPEATELEMENT AND METHODS other traits in other species, is limited by the availability of FOR REGULATING PLANT GENE promoters capable of appropriately controlling the expres EXPRESSION sion of genes of interest. It is therefore an object of the present invention to provide TECHNICAL FIELD a promoteruseful for controlling gene expression inapple and other plants and/or at least to provide a useful choice. The present invention relates to polynucleotides for regu lating gene expression in plants, and uses thereof. SUMMARY OF THE INVENTION 10 BACKGROUND ART In the first aspect the invention provides a method for producing a chimeric promoter polynucleotide capable of An important for goal for agriculture is to produce plants controlling transcription of an operably linked polynucle with beneficial agronomic traits. Recent advances in genetic otide in a plant cell or plant, wherein the method comprises manipulation provide the tools to transform plants with poly 15 combining: nucleotide sequences of interest and to express Such a) at least one sequence motif comprising a sequence with at sequences within the transformed plants. This has led to the least 70% identity to SEQID NO:1, 11 or 12, and development of plants capable of expressing pharmaceuticals b) another polynucleotide sequence. and other chemicals, plants with increased pest resistance, In a preferred embodiment the method comprises combin increased stress tolerance and many other beneficial traits. 1ng: It is often desirable to control expression of a polynucle a) at least two sequence motifs, each comprising a sequence otide of interest, in a particular tissue, at a particular devel with at least 70% identity to any one of SEQID NO:1, 11 or opmental stage, or under particular conditions, in which the 12, and polynucleotide is not normally expressed. The polynucle b) another polynucleotide sequence. otide of interest may encode a protein or alternatively may be 25 The chimeric promoter polynucleotide more preferably intended to effect silencing of a corresponding target gene. produced by combining: Plant promoter sequences are useful in genetic manipula a) at least three, more preferably at least four, more preferably tion for directing expression of polynucleotides in transgenic at least five, more preferably at least six, and most preferably plants. To achieve this, a genetic construct is often introduced at least seven sequence motifs, each comprising a sequence into a plant cell or plant. Typically Such constructs include a 30 with at least 70% identity to any one of SEQID NO: 1, 11 or plant promoter operably linked to the polynucleotide 12, and sequence of interest. Such a promoter need not normally be b) another polynucleotide sequence. associated with the gene of interest. Once transformed, the Preferably at least one of the sequence motifs in a) com promoter controls expression of the operably linked poly prises a sequence with at least 70% identity to the sequence of nucleotide of interest thus leading to the desired transgene 35 SEQID NO: 1. expression and resulting desired phenotypic characteristics in Preferably at least one motif ina) comprises the sequence the plant. of SEQID NO: 41. Promoters used in genetic manipulation are typically Preferably at least one motif ina) comprises the sequence derived from the 5' un-transcribed region of genes and contain of SEQID NO: 42. regulatory elements that are necessary to control expression 40 In one embodiment at least one sequence motif in a) com of the operably linked polynucleotide. Promoters useful for prises the sequence of SEQID NO: 1. plant biotechnology can be classified depending on when and In another embodiment at least one sequence motif in a) where they direct expression. For example promoters may be comprises the sequence of SEQID NO: 11. tissue specific or constitutive (capable of transcribing In another embodiment at least one sequence motif in a) sequences in multiple tissues). Other classes of promoters 45 comprises the sequence of SEQID NO: 12. include inducible promoters that can be triggered by external The chimeric promoter may comprise several of the motifs stimuli such as environmental and chemical stimuli. ina) as defined above. The motifs within the promoter may all Often a relatively high level of expression of the trans be the same, or may be a combination of different motifs as formed sequence of interest is desirable. This is often defined above. achieved through use of viral promoter sequences such as the 50 In another embodiment at least one of the sequence motifs Cauliflower Mosaic Virus 35S promoter. In some circum is interrupted by at least one of the other sequence motifs. stances it may be more preferable to use a plant derived In a further embodiment the sequence motif ina) is part of promoter rather than a promoter derived from a microorgan a promoter polynucleotide sequence that naturally occurs in a ism. It may also be preferable in some circumstances to use a plant. promoter derived from, or produced from sequences derived 55 In a further embodiment the polynucleotide in b) is a pro from, the species to be transformed. moter polynucleotide sequence. It would be beneficial to have a variety of promoters avail In a further embodiment the polynucleotide in b) is a pro able in order to ensure that transgenes are transcribed at an moter polynucleotide sequence that naturally occurs in a appropriate level in the right tissues, and at an appropriate plant. stage of growth or development. 60 In a preferred embodiment both the sequence motif in a) The apple (Malus species) is a major fruit species grown in and the polynucleotide, or promoter polynucleotide in b) New Zealand and other temperate climates throughout the naturally occur in plants world. Valuable traits that may be improved by genetic Preferably the sequence motif ina) and the polynucleotide manipulation of apple include: fruit flavour, fruit colour, con in b) naturally occur in the same species, or interfertile spe tent of health promoting components (such as anthocyanins 65 C1GS. and flavanoids) in fruit, stress tolerance/resistance, pest tol Preferably the sequence motif ina) and the polynucleotide erance/resistance and disease tolerance/resistance. in b) naturally occur in the same promoter. US 8,686,125 B2 3 4 In this embodiment a further copy, or copies, of a motif a) at least one sequence motif comprising a sequence with at with at least 70% identity to SEQID NO:1, 11 or 12, that is least 70% identity to SEQID NO:1, 11 or 12 present in a naturally occurring promoter polynucleotide, b) another polynucleotide sequence. may be added to the naturally occurring promoter polynucle In a preferred embodiment the chimeric promoter poly otide to produce the chimeric promoter polynucleotide. nucleotide comprises at least two sequence motifs compris In an alternative embodiment one or more motifs with at ing a sequence with at least 70% identity to SEQID NO: 1, 11 least 70% identity to SEQID NO:1, 11 or 12, that are natu or 12. rally occurring in plant promoters, may be added to a different The chimeric promoter polynucleotide more preferably naturally occurring promoter. comprises at least three, more preferably at least four, more The motif or motifs with at least 70% identity to SEQ ID 10 preferably at least five, more preferably at least six, and most NO:1, 11 or 12, may be naturally occurring in different spe preferably at least seven sequence motifs comprising a cies, or different promoters, and may be combined with a sequence with at least 70% identity to SEQID NO: 1, 11 or promoter from one of the same species, or from a different 12. species. 15 Preferably at least one of the sequence motifs comprises a In one embodiment the naturally occurring promoter poly sequence with at least 70% identity to the sequence of SEQID nucleotide in b) comprises a sequence with at least 70% NO: 1. identity to SEQID NO:13. Preferably at least one motif ina) comprises the sequence In a further embodiment the naturally occurring promoter of SEQID NO: 41. polynucleotide comprises the sequence of SEQID NO:13. Preferably at least one motif ina) comprises the sequence In one embodiment the chimeric promoter is produced by of SEQID NO: 42. combining: In one embodiment at least one sequence motif comprises a) the sequence of SEQID NO:14, and the sequence of SEQID NO: 1. b) the sequence of SEQID NO:8. In another embodiment at least one sequence motif com In one embodiment the chimeric promoter is produced by 25 prises the sequence of SEQID NO: 11. combining: In another embodiment at least one sequence motif com prises the sequence of SEQID NO: 12. a) the sequence of SEQID NO:14, and The chimeric promoter may comprise several of the motifs b) the sequence of SEQID NO:13. ina) as defined above. The motifs within the promoter may all In one embodiment the chimeric promoter is produced by 30 be the same, or may be a combination of different motifs as combining: defined above. a) the sequence of SEQID NO:14, and In another embodiment at least one of the sequence motifs b) the sequence of SEQID NO:36. is interrupted by at least one of the other sequence motifs. In one embodiment the chimeric promoter is produced by 35 In a further embodiment the sequence motif ina) is part of combining: a promoter polynucleotide sequence that naturally occurs in a plant. a) the sequence of SEQID NO:14, and In a further embodiment the polynucleotide in b) is a pro b) the sequence of SEQID NO:38. moter polynucleotide sequence. In a further embodiment the chimeric promoter polynucle 40 In a further embodiment the polynucleotide in b) is a pro otide comprises a sequence with at least 70% identity to SEQ moter polynucleotide sequence that naturally occurs in a ID NO:15. plant. In a further embodiment the chimeric promoter polynucle In a preferred embodiment both the sequence motif in a) otide comprises the sequence of SEQID NO:15. and the polynucleotide in b) naturally occur in plants In a further embodiment the chimeric promoter polynucle 45 Preferably the sequence motif ina) and the polynucleotide otide comprises a sequence with at least 70% identity to SEQ in b) naturally occur in the same species, or interfertile spe ID NO:37. C1GS. In a further embodiment the chimeric promoter polynucle Preferably the sequence motif ina) and the polynucleotide otide comprises the sequence of SEQID NO:37. in b) naturally occur in the same promoter. 50 In this embodiment the chimeric promoter may comprise In a further embodiment the chimeric promoter polynucle the naturally occurring promoter with an additional inserted otide comprises a sequence with at least 70% identity to SEQ copy, or copies, of a motif with at least 70% identity to SEQ ID NO:39. ID NO: 1, 12 or 13 that is present in the naturally occurring In a further embodiment the chimeric promoter polynucle promoter polynucleotide. otide comprises the sequence of SEQID NO:39. 55 In an alternative embodiment the chimeric promoter may In a further embodiment the chimeric promoter polynucle comprise a naturally occurring promoter, with an additional otide comprises a sequence with at least 70% identity to SEQ inserted copy or copies of a motif with at least 70% identity to ID NO:40. SEQ ID NO: 1, 12 or 13 that is not present in the naturally occurring promoter polynucleotide. In a further embodiment the chimeric promoter polynucle 60 The motif or motifs comprising a sequence with at least otide comprises the sequence of SEQID NO:40. 70% identity to SEQ ID NO:1, 11 or 12, may be naturally In a further aspect the invention provides a chimeric pro occurring in different species, or different promoters, and moter produced by the method of the invention. may have been combined with a promoter from one of the In a further aspect the invention provides a chimeric pro same species, or from a different species. moter polynucleotide capable of controlling transcription of 65 In one embodiment the naturally occurring promoter poly an operably linked polynucleotide in a plant cell or plant, nucleotide comprises a sequence with at least 70% identity to wherein the promoter polynucleotide comprises: SEQID NO:13. US 8,686,125 B2 5 6 In a further embodiment the naturally occurring promoter Preferably at least one of the sequence motifs of the chi polynucleotide comprises the sequence of SEQID NO:13. meric promoter polynucleotide in its natural environment is In one embodiment the chimeric promoter comprises: endogenously associated with the MYB transcription factor. a) the sequence of SEQID NO:14, combined with Preferably the chimeric promoter is positively regulated by b) the sequence of SEQID NO:8. the MYB transcription factor. In one embodiment the chimeric promoter comprises: Preferably the chimeric promoter polynucleotide is a) the sequence of SEQID NO:14, combined with capable of controlling transcription of an operably linked b) the sequence of SEQID NO:13. polynucleotide sequence constitutively in Substantially all In one embodiment the chimeric promoter comprises: tissues of a plant. a) the sequence of SEQID NO:14, combined with 10 More preferably the promoter polynucleotide is capable of b) the sequence of SEQID NO:36. controlling transcription of an operably linked polynucle In one embodiment the chimeric promoter comprises: otide sequence in any plant, plant cell, or plant tissue in which a) the sequence of SEQID NO:14, combined with the MYB transcription factor is expressed. b) the sequence of SEQID NO:38. 15 The MYB transcription factor may be naturally expressed In a further embodiment the chimeric promoter polynucle in the plant or may be expressed in the plant through genetic otide comprises a sequence with at least 70% identity to SEQ manipulation of the plant. ID NO:15. In a further aspect the invention provides a genetic con In a further embodiment the chimeric promoter polynucle struct comprising a chimeric promoter polynucleotide of the otide comprises the sequence of SEQID NO:15. invention. In a further embodiment the chimeric promoter polynucle In one embodiment the chimeric promoter polynucleotide otide comprises a sequence with at least 70% identity to SEQ is operably linked to a polynucleotide sequence to be ID NO:37. expressed. In a further embodiment the chimeric promoter polynucle In a further aspect the invention provides a vector compris otide comprises the sequence of SEQID NO:37. 25 ing a genetic construct of the invention. In a further embodiment the chimeric promoter polynucle In a further aspect the invention provides a host cell trans otide comprises a sequence with at least 70% identity to SEQ formed with the chimeric promoter polynucleotide of the ID NO:39. invention. In a further embodiment the chimeric promoter polynucle In a further aspect the invention provides a plant cell or 30 plant transformed with the chimeric promoter polynucleotide otide comprises the sequence of SEQID NO:39. of the invention. In a further embodiment the chimeric promoter polynucle In a further aspect the invention provides a plant cell or otide comprises a sequence with at least 70% identity to SEQ plant transformed with a genetic construct of the invention. ID NO:40. In one embodiment the plant cell or plant is also trans In a further embodiment the chimeric promoter polynucle 35 formed with a polynucleotide or genetic construct for otide comprises the sequence of SEQID NO:40. expressing a MYB transcription factor that modulates expres In a further embodiment the chimeric promoter polynucle sion of the chimeric promoter polynucleotide of the inven otide is modulated by a MYB transcription factor. tion. In a further embodiment the chimeric promoter polynucle In a further embodiment the plant cell or plant naturally otide is positively modulated, or activated, or up-regulated by 40 expresses the MYB transcription factor. the MYB transcription factor. In a further embodiment the MYB transcription factor Preferably the MYB transcription factor comprises an comprises an amino acid sequence with at least 70% identity R2R3 DNA binding domain. to the sequence of any one of SEQID NO: 6, 17, 32 and 34. Preferably the MYB transcription factor comprises a Preferably the MYB transcription factor comprises the sequence with at least 70% identity to the sequence of SEQID 45 sequence of any one of SEQID NO: 6, 17, 32 and 34. NO: 6. In a further embodiment the MYB transcription factor Preferably the MYB transcription factor comprises the comprises an amino acid sequence with at least 70% identity sequence of SEQID NO: 6. to the sequence of SEQID NO: 6. Preferably the MYB transcription factor comprises a Preferably the MYB transcription factor comprises the sequence with at least 70% identity to the sequence of SEQID 50 sequence of SEQID NO: 6. NO: 17. In a further embodiment the MYB transcription factor Preferably the MYB transcription factor comprises the comprises an amino acid sequence with at least 70% identity sequence of SEQID NO: 17. to the sequence of SEQID NO: 17. Preferably the MYB transcription factor comprises a Preferably the MYB transcription factor comprises the sequence with at least 70% identity to the sequence of SEQID 55 sequence of SEQID NO: 17. NO:32. In a further embodiment the MYB transcription factor Preferably the MYB transcription factor comprises the comprises an amino acid sequence with at least 70% identity sequence of SEQID NO:32. to the sequence of SEQID NO:32. Preferably the MYB transcription factor comprises a Preferably the MYB transcription factor comprises the sequence with at least 70% identity to the sequence of SEQID 60 sequence of SEQID NO:32. NO: 34. In a further embodiment the MYB transcription factor Preferably the MYB transcription factor comprises the comprises an amino acid sequence with at least 70% identity sequence of SEQID NO:34. to the sequence of SEQID NO. 34. Preferably the chimeric promoter polynucleotide is up Preferably the MYB transcription factor comprises the regulated by the gene product of the gene with which at least 65 sequence of SEQID NO:34. one of the sequence motifs of the chimeric promoter poly In a further aspect the invention provides a method for nucleotide is endogenously associated. producing a plant cell or plant with modified expression of at US 8,686,125 B2 7 8 least one polynucleotide, the method comprising transforma In a further embodiment the MYB transcription factor tion of the plant cell or plant with a chimeric promoter poly comprises a sequence with at least 70% identity to the nucleotide of the invention sequence of SEQID NO: 6. In one embodiment the plant cell or plant is transformed Preferably the MYB transcription factor comprises the with a genetic construct of the invention. 5 sequence of SEQID NO: 6. In a further embodiment the plant cell or plant is also In a further embodiment the MYB transcription factor transformed with a polynucleotide or genetic construct comprises a sequence with at least 70% identity to the capable of expressing a MYB transcription factor that modu sequence of SEQID NO: 17. lates expression of the chimeric promoter polynucleotide of Preferably the MYB transcription factor comprises the 10 sequence of SEQID NO: 17. the invention. In a further embodiment the MYB transcription factor In a further embodiment the plant cell or plant naturally comprises a sequence with at least 70% identity to the expresses the MYB transcription factor. sequence of SEQID NO:32. In a further embodiment the MYB transcription factor Preferably the MYB transcription factor comprises the comprises an amino acid sequence with at least 70% identity 15 sequence of SEQID NO:32. to the sequence of any one of SEQID NO: 6, 17, 32 and 34. In a further embodiment the MYB transcription factor Preferably the MYB transcription factor comprises the comprises a sequence with at least 70% identity to the sequence of any one of SEQID NO: 6, 17, 32 and 34. sequence of SEQID NO:34. In a further embodiment the MYB transcription factor Preferably the MYB transcription factor comprises the comprises a sequence with at least 70% identity to the sequence of SEQID NO:34. sequence of SEQID NO: 6. In a further aspect the invention provides a plant cell or Preferably the MYB transcription factor comprises the plant produced by a method of the invention. sequence of SEQID NO: 6. In a further aspect the invention provides a seed, propagule, In a further embodiment the MYB transcription factor progeny, part, fruit or harvested material of a plant, of the comprises a sequence with at least 70% identity to the 25 invention. sequence of SEQID NO: 17. Preferably the seed, propagule, progeny, part, fruit or har Preferably the MYB transcription factor comprises the Vested material of the plant comprises a chimeric promoter sequence of SEQID NO: 17. polynucleotide of the invention. In a further embodiment the MYB transcription factor The naturally occurring sequences that may be used to comprises a sequence with at least 70% identity to the 30 produce the chimeric promoter polynucleotide of the inven sequence of SEQID NO:32. tion may be derived from any species. Preferably the MYB transcription factor comprises the In one embodiment the naturally occurring sequence, is sequence of SEQID NO:32. derived from a plant species. In a further embodiment the MYB transcription factor In a further embodiment the naturally occurring sequence, comprises a sequence with at least 70% identity to the 35 is derived from a gymnosperm plant species. sequence of SEQID NO:34. In a further embodiment the naturally occurring sequence, Preferably the MYB transcription factor comprises the is derived from an angiosperm plant species. sequence of SEQID NO:34. In a further embodiment the naturally occurring sequence, It will be appreciated by those skilled in the art that, the is derived from a from dicotyledonous plant species. chimeric promoter polynucleotide of the invention may be 40 In a further embodiment the naturally occurring sequence, transformed into the plant to control expression of a poly is derived from a monocotyledonous plant species. nucleotide that is operably linked to the promoter prior to The polypeptide encoded by the polynucleotide to be transformation. expressed in a construct of the invention, may be derived from Alternatively the promoter polynucleotide may be trans any species and/or may be produced synthetically or recom formed into the genome of the plant without an operably 45 binantly. linked polynucleotide, but the promoter may control expres In one embodiment the polypeptide is derived from a plant sion of an endogenous polynucleotide, typically adjacent to species. the insert site, and typically, to the 3' end of the inserted In a further embodiment the polypeptide is derived from a promoter polynucleotide. gymnosperm plant species. In a further aspect of the invention provides a method for 50 Inafurther embodiment the polypeptide is derived from an producing a plant cell or plant with a modified phenotype, the angiosperm plant species. method comprising the stable incorporation into the genome In a further embodiment the polypeptide is derived from a of the plant, of a chimeric promoter polynucleotide of the from dicotyledonous plant species. invention In a further embodiment the polypeptide is derived from a In one embodiment the plant cell or plant is transformed 55 monocotyledonous plant species. within a genetic construct of the invention. The MYB transcription factor that regulates the chimeric In a further embodiment the plant cell or plant is also promoter polynucleotide of the invention may be derived transformed with a genetic construct for expressing a MYB from any species and/or may be produced synthetically or transcription factor that modulates expression of the chimeric recombinantly. promoter polynucleotide of the invention. 60 In one embodiment the MYB transcription factor, is In a further embodiment the plant cell or plant naturally derived from a plant species. expresses the MYB transcription factor. In a further embodiment the MYB transcription factor, is In a further embodiment the MYB transcription factor derived from a gymnosperm plant species. comprises an amino acid sequence with at least 70% identity In a further embodiment the MYB transcription factor, is to the sequence of any one of SEQID NO: 6, 17, 32 and 34. 65 derived from an angiosperm plant species. Preferably the MYB transcription factor comprises the In a further embodiment the MYB transcription factor, is sequence of any one of SEQID NO: 6, 17, 32 and 34. derived from a from dicotyledonous plant species. US 8,686,125 B2 9 10 In a further embodiment the MYB transcription factor, is caroliniana, Prunus cerasifera, Prunus cerasus, Prunus derived from a monocotyledonous plant species. choreiana, Prunus coconilia, Prunus cyclaimina, Prunus The plant cells and plants, of the invention, or produced by davidiana, Prunus debilis, Prunus domestica, Prunus dulcis, the methods of the invention, may be derived from any spe Prunusemarginata, Prunus fasciculata, Prunus ferganensis, cies. Prunus fordiana, Prunus fremontii, Prunus fruticosa, Prunus In one embodiment the plant cell or plant, is derived from geniculata, Prunus glandulosa, Prunus gracilis, Prunus a gymnosperm plant species. gravana, Prunus hortulana, Prunus ilicifolia, Prunus incisa, In a further embodiment the plant cell or plant, is derived Prunus jacquemontii, Prunus japonica, Prunus kuramica, from an angiosperm plant species. Prunus laurocerasus, Prunus leveilleana, Prunus lusitanica, In a further embodiment the plant cell or plant, is derived 10 Prunus maackii, Prunus mahaleb, Prunus mandshurica, Pru from a from dicotyledonous plant species. nus maritima, Prunus maximowiczii, Prunus mexicana, Pru In a further embodiment the plant cell or plant, is derived nus microcarpa, Prunus mira, Prunus mume, Prunus munso from a monocotyledonous plant species. niana, Prunus nigra, Prunus nipponica, Prunus padus, Preferred plant species (from which the naturally occurring Prunus pensylvanica, Prunus persica, Prunus petunnikowii, sequence and variants, polypeptides and variants, MYB tran 15 Prunus prostrata, Prunus pseudocerasus, Prunus pumila, Scription factor and variants, and plant cells and plants may be Prunus rivularis, Prunus Salicina, Prunus Sargentii, Prunus derived) include fruit plant species selected from a group sellowii, Prunus serotina, Prunus Serrulata, Prunus Sibirica, comprising but not limited to the following genera: Malus, Prunus Simonii, Prunus spinosa, Prunus spinulosa, Prunus Pyrus Prunis, Rubus, Rosa, Fragaria, Actinidia, Cydonia, subcordata, Prunus Subhirtella, Prunus takesimensis, Pru Citrus, and Vaccinium. nus tenella, Prunus texana, Prunus tomentosa, Prunus Particularly preferred fruit plant species are: Malus domes tSchonoski, Prunus umbellata, Prunus verecunda, Prunus tica, Pyrus communis, Actidinia deliciosa, A. Chinensis, A. virginiana, Prunus webbii, PrunusXyedoensis, Prunus Zippe eriantha, A. arguta and hybrids of the four Actinidia species, liana, Prunus sp. BSP-2004-1, Prunus sp. BSP-2004-2, Pru Fragaria ananassa and Prunis persica. nus sp. EB-2002, Amelanchier alnifolia, Amelanchier Preferred plants also include vegetable plant species 25 arborea, Amelanchier asiatica, Amelanchier bartramiana, selected from a group comprising but not limited to the fol Amelanchier Canadensis, Amelanchier clusickii, Amelanchier lowing genera: Brassica, Lycopersicon and Solanum. fernaldii, Amelanchier florida, Amelanchier humilis, Particularly preferred vegetable plant species are: Lycoper Amelanchier intermedia, Amelanchier laevis, Amelanchier sicon esculentum and Solanum tuberosum. lucida, Amelanchier mantucketensis, Amelanchier pumila, Preferred plants also include crop plant species selected 30 Amelanchier quinti-martii, Amelanchier sanguinea, Amelan from a group comprising but not limited to the following chier stolonifera, Amelanchier utahensis, Amelanchier wie genera: Glycine, Zea, Hordeum and Oryza. gandii, Amelanchierxneglecta, Amelanchier bartramianax Particularly preferred crop plant species include Glycine Amelanchier sp. dentata, Amelanchier sp. dentata, max, Zea mays and Oryza sativa. Amelanchier sp. erecta, Amelanchier sp. erectaxAmelan Preferred plants also include those of the Rosaceae family. 35 chier laevis, Amelanchier sp. serotina, Aria alnifolia, Aro Preferred Rosaceae genera include Exochorda, Maddenia, nia prunifolia, Chaenomeles cathayensis, Chaenomeles spe Oemleria, Osmaronia, Prinsepia, Prunus, Maloideae, ciosa, Chamaeme spilus alpina, Cornus domestica, Amelanchier, Aria, Aronia, Chaenomeles, Chamaeme spilus, Cotoneaster apiculatus, Cotoneaster lacteus, Cotoneaster Cornus, Cotoneaster; CrataegusOsmaronia, Prinsepia, Pru pannosus, Crataegus azarolus, Crataegus columbiana, Cra nus, Maloideae, Amelanchier, Aria, Aronia, Chaenomeles, 40 taegus crus-galli, Crataegus curvisepala, Crataegus laevi Chamaemespilus, Cornus, Cotoneaster, Crataegu, Cydonia, gata, Crataegus mollis, Crataegus monogyna, Crataegus Dichotomanthes, Docynia, Docyniopsis, Eriobotrya, Eriolo nigra, Crataegus rivularis, Crataegus Sinaica, Cydonia bus, Heteromeles, Kagemeckia, Lindleya, Malacomeles, oblonga, Dichotomanthes tristanicarpa, Docynia delavavi, Malus, Mespilus, Osteomeles, Peraphyllum, Photinia, Docyniopsis tschonoski, Eriobotrya japonica, Eriobotrya Pseudocydonia, Pyracantha, Pyrus, Rhaphiolepis, Sorbus, 45 prinoides, Eriolobus trilobatus, Heteromeles arbutifolia, Stranvaesia, Torminalis, Vauquelinia, Rosoideae, Acaena, Kagemeckia angustifolia, Kagemeckia Oblonga, Lindleya Acomastylis, Agrimonia, Alchemilla, Aphanes, Aremonia, mespiloides, Malacomeles denticulata, Malus angustifolia, Bencomia, Chamaebatia, Cliffortia, Coluria, Cowania, Dali– Malus asiatica, Malus baccata, Malus coronaria, Malus barda, Dendriopoterium, Dryas, Duchesnea, Erythrocoma, doumeri, Malus florentina, Malus floribunda, Malus fisca, Fallugia, Filipendula, Fragaria, Geum, Hagenia, Horkelia, 50 Malus halliana, Malus homanensis, Malus hupehensis, Malus Ivesia, Kerria, Leucosidea, Marcetella, Margyricarpus, ioensis, Malus kansuensis, Malus mandshurica, Malus Novosieversia, Onco stylus, Polylepis, Potentilla, Rosa, micromalus, Malus niedzwetzkyana, Malus Ombrophilia, Rubus, Sanguisorba, Sarcopoterium, Sibbaldia, Sieversia, Malus Orientalis, Malus pratti, Malus prunifolia, Malus Taihangia, Tetraglochin, Waldsteinia, Rosaceae incertae punila, Malus Sargentii, Malus sieboldii, Malus sieversii, sedis, Adenostoma, Aruncus, Cercocarpus, Chamaebatiaria, 55 Malus Sylvestris, Malus toringoides, Malus transitoria, Chamaerhodos, Gillenia, Holodiscus, Lyonothamnus, Neil Malus trilobata, Malus tschonoskii, MalusXdomestica, lia, Neviusia, Physocarpus, Purshia, Rhodotypos, Sorbaria, MalusXdomesticaxMalus sieversii, MalusXdomesticaXPyrus Spiraea and Stephanandra. communis, Malus xiaojinensis, Malus yunnanensis, Malus Preferred Rosaceae species include Exochorda giraldii, sp., Mespilus germanica, Osteomeles anthyllidifolia, Exochorda racemosa, Exochorda, Exochorda giraldii, Exo 60 Osteomeles Schwerinae, Peraphyllum ramosissimum, Pho chorda racemosa, Exochorda serratifolia, Maddenia hypo tinia fraseri, Photinia pyrifolia, Photinia serrulata, Photinia leuca, Oemleria cerasiformis, Osmaronia cerasiformis, Prin villosa, Pseudocydonia sinensis, Pyracantha coccinea, Pyra sepia sinensis, Prinsepia uniflora, Prunus alleghaniensis, cantha fortuneana, Pyrus calleryana, Pyrus caucasica, Prunus americana, Prunus andersonii, Prunus angustifolia, Pyrus communis, Pyrus elaeagrifolia, Pyrus hybrid cultivar, Prunus apetala, Prunus argentea, Prunus armeniaca, Prunus 65 Pyrus pyrifolia, Pyrus salicifolia, Pyrus ussuriensis, PyrusX avium, Prunus bifrons, Prunus brigantina, Prunus bucha bretschneideri, Rhaphiolepis indica, Sorbus americana, Sor rica, Prunus buergeriana, Prunus campanulata, Prunus bus aria, Sorbus aucuparia, Sorbus Californica, Sorbus com US 8,686,125 B2 11 12 mixta, Sorbus hupehensis, Sorbus scopulina, Sorbus sibirica, rvi, Rosa hugonis, Rosa hybrid cultivar, Rosa inodora, Rosa Sorbus torminalis, Stranvaesia davidiana, Torminalis clusii, jundzillii, Rosa laevigata, Rosa laxa, Rosa luciae, Rosa maja Vauquelinia Californica, Vauquelinia corymbosa, Acaena lis, Rosa marretii, Rosa maximowicziana, Rosa micrantha, anserinifolia, Acaena argentea, Acaena Caesiglauca, Rosa mollis, Rosa montana, Rosa moschata, Rosa movesii, Acaena cylindristachya, Acaena digitata, Acaena echinata, 5 Rosa multibracteata, Rosa multiflora, Rosa initida, Rosa Odo Acaena elongata, Acaena eupatoria, Acaena fissistipula, rata, Rosa palustris, Rosa pendulina, Rosa persica, Rosa Acaena inermis, Acaena laevigata, Acaena latebrosa, phoenicia, Rosa platyacantha, Rosa primula, Rosa pseudos Acaena lucida, Acaena macrocephala, Acaena magellanica, cabriuscula, Rosa roxburghii, Rosa rubiginosa, Rosa rugosa, Acaena masafuerana, Acaena montana, Acaena multifida, Rosa Sambucina, Rosa sempervirens, Rosa sericea, Rosa ser Acaena novaezelandiae, Acaena ovalifolia, Acaena pinnati 10 tata, Rosa setigera, Rosa Sherardii, Rosa Sicula, Rosa spino fida, Acaena splendens, Acaena subincisa, Acaenaxanse sissima, Rosa stellata, Rosa stylosa, Rosa subcanina, Rosa rovina, Acomastylis elata, Acomastylis rossii, Acomastylis subcollina, Rosa sufiulta, Rosa tomentella, Rosa tomentosa, Sikkimensis, Agrimonia eupatoria, Agrimonia nipponica, Rosa tunquinensis, Rosa villosa, Rosa virginiana, Rosa Agrimonia parviflora, Agrimonia pilosa, Alchemilla alpina, wichurana, Rosa willmottiae, Rosa woodsii, Rosaxdama Alchemilla erythropoda, Alchemilla japonica, Alchemilla 15 scena, Rosaxfortuniana, Rosaxmacrantha, Rosa xanthina, mollis, Alchemilla vulgaris, Aphanes arvensis, Aremonia Rosa sp., Rubus alceifolius, Rubus allegheniensis, Rubus agrimonioides, Bencomia brachystachya, Bencomia cau alpinus, Rubus amphidasys, Rubus arcticus, Rubus argutus, data, Bencomia existipulata, Bencomia sphaerocarpa, Rubus assamensis, Rubus australis, Rubus bifrons, Rubus Chamaebatia foliolosa, Cliffortia burmeana, Cliffortia caesius, Rubus caesiusXRubus idaeus, Rubus Canadensis, cuneata, Cliffortia dentata, Cliffortia graminea, Cliffortia Rubus canescens, Rubus caucasicus, Rubus chamaemorus, heterophylla, Cliffortianitidula, Cliffortia odorata, Cliffortia Rubus corchorifolius, Rubus Crataegifolius, Rubus cuneifo ruscifolia, Cliffortia sericea, Coluria elegans, Coluria lius, Rubus deliciosus, Rubus divaricatus, Rubus ellipticus, geoides, Cowania Stansburiana, Dalibarda repens, Dendrio Rubus flagellaris, Rubus fruticosus, Rubus geoides, Rubus poterium menendezii, Dendriopoterium pulidoi, Dryas glabratus, Rubus glaucus, Rubus gunnianus, Rubus hawaien drummondii, Dryas Octopetala, Duchesnea chrysantha, 25 sis, Rubus hawaiensisXRubus rosifolius, Rubus hispidus, Duchesnea indica, Erythrocoma triflora, Fallugia paradoxa, Rubus hochstetterorum, Rubus humulifolius, Rubus idaeus, Filipendula multijuga Filipendula purpurea, Filipendula Rubus lambertianus, Rubus lasiococcus, Rubus leucodermis, ulmaria, Filipendula vulgaris, Fragaria chiloensis, Fragaria Rubus lineatus, Rubus macraei, Rubus maximiformis, Rubus daltoniana, Fragaria gracilis, Fragaria grandiflora, minusculus, Rubus moorei, Rubus multibracteatus, Rubus Fragaria inumae, Fragaria moschata, Fragaria nilgerren 30 neomexicanus, Rubus nepalensis, Rubus messensis, Rubus sis, Fragaria nipponica, Fragaria nubicola, Fragaria Orien inivalis, Rubus niveus, Rubus nubigenus, Rubus Occidentalis, talis, Fragaria pentaphylla, Fragaria vesca, Fragaria vir Rubus odoratus, Rubus palmatus, Rubus parviflorus, Rubus giniana, Fragaria viridis, Fragariaxananassa, Fragaria sp. parvifolius, Rubus parvus, Rubus pectinellus, Rubus pedatus, CFRA 538, Fragaria sp., Geum andicola, Geum borisi, Rubus pedemontanus, Rubus pensilvanicus, Rubus phoenico Geum bulgaricum, Geum calthifolium, Geum chiloense, 35 lasius, Rubus picticaulis, Rubus pubescens, Rubus rigidus, Geum geniculatum, Geum heterocarpum, Geum macrophyl Rubus robustus, Rubus roseus, Rubus rosifolius, Rubus sanc lum, Geum montanum, Geum reptans, Geum rivale, Geum tus, Rubus sapidus, Rubus saxatilis, Rubus setosus, Rubus schofieldii, Geum speciosum, Geum urbanum, Geum vernum, spectabilis, Rubus sulcatus, Rubus tephrodes, Rubus trian Geum sp. Chase 2507 K, Hagenia abyssinica, Horkelia thus, Rubus tricolor, Rubus trifidus, Rubus trilobus, Rubus cuneata, Horkelia fisca, Ivesia gordoni, Kerria japonica, 40 trivialis, Rubus ulmifolius, Rubus ursinus, Rubus urticifolius, Leucosidea sericea, Marcetella maderensis, Marcetella Rubus vigorosus, Rubus sp. JPM-2004, Sanguisorba albi moquiniana, Margyricarpus pinnatus, Margyricarpus Seto flora, Sanguisorba alpina, Sanguisorba ancistroides, San sus, Novosieversia glacialis, Oncostylus cockaynei, Oncostly guisorba annua, Sanguisorba Canadensis, Sanguisorba fili lus leiospermus, Polylepis australis, Polylepis besseri, Polyl formis, Sanguisorba hakusanensis, Sanguisorba japonensis, epis crista-galli, Polylepis hieronymi, Polylepis incana, 45 Sanguisorba minor; Sanguisorba obtusa, Sanguisorba offici Polylepis lanuginosa, Polylepis multijuga, Polylepis nalis, Sanguisorba parviflora, Sanguisorba stipulata, San neglecta, Polylepis pauta, Polylepis pepei, Polylepis quadri guisorba tenuifolia, Sarcopoterium spinosum, Sibbaldia juga, Polylepis racemosa, Polylepis reticulata, Polylepis procumbens, Sieversia pentapetala, Sieversia pusilla, rugulosa, Polylepis sericea, Polylepis subsericans, Polylepis Taihangia rupestris, Tetraglochin cristatum, Waldsteinia tarapacana, Polylepis tomentella, Polylepis weberbaueri, 50 fragarioides, Waldsteinia geoides, Adenostoma fasciculatum, Potentilla anserina, Potentilla arguta, Potentilla bifurca, Adenostoma sparsifolium, Aruncus dioicus, Cercocarpus Potentilla chinensis, Potentilla dickinsii, Potentilla erecta, betuloides, Cercocarpus ledifolius, Chamaebatiaria millefo Potentilla fragarioides, Potentilla fruticosa, Potentilla lium, Chamaerhodos erecta, Gillenia stipulata, Gillenia tri indica, Potentilla micrantha, Potentilla multifida, Potentilla foliata, Holodiscus discolor, Holodiscus microphyllus, nivea, Potentilla norvegica, Potentilla palustris, Potentilla 55 Lyonothamnus floribundus, Neillia afinis, Neillia gracilis, peduncularis, Potentilla reptans, Potentilla salesoviana, Neillia sinensis, Neillia sparsiflora, Neillia thibetica, Neillia Potentilla stenophylla, Potentilla tridentata, Rosa abietina, thyrsiflora, Neillia uekii, Neviusia alabamensis, Physocarpus Rosa abyssinica, Rosa acicularis, Rosa agrestis, Rosa alba, alternans, Physocarpus amurensis, Physocarpus capitatus, Rosa albax Rosa corymbifera, Rosa altaica, Rosa arkansana, Physocarpus malvaceus, Physocarpus monogynus, Physo Rosa arvensis, Rosa banksiae, Rosa beggeriana, Rosa 60 carpus opulifolius, Purshia tridentata, Rhodotypos scandens, blanda, Rosa bracteata, Rosa brunonii, Rosa caesia, Rosa Sorbaria arborea, Sorbaria sorbifolia, Spiraea betulifolia, Californica, Rosa canina, Rosa Carolina, Rosa Chinensis, Spiraea Cantoniensis, Spiraea densiflora, Spiraea japonica, Rosa cinnamomea, Rosa columnifera, Rosa corymbifera, Spiraea nipponica, Spiraeaxvanhouttei, Spiraea sp., Stepha Rosa cymosa, Rosa davurica, Rosa dumalis, Rosa ecae, Rosa nandra chinensis, Stephanandra incisa and Stephanandra eglanteria, Rosa elliptica, Rosa fedtschenkoana, Rosa foe 65 tanakae. tida, Rosa foliolosa, Rosa gallica, Rosa gallicaxRosa dune Particularly preferred Rosaceae genera include: Malus, torum, Rosa gigantea, Rosa glauca, Rosa helenae, Rosa hen Pyrus, Cydonia, Prunus, Eriobotrya, and Mespilus. US 8,686,125 B2 13 14 Particularly preferred Rosaceae species include: Malus entirety. However the chimeric promoter may be constructed domestica, Malus Sylvestris, Pyrus communis, Pyrus pyrifo from naturally occurring sequences that are recombined. lia, Pyrus bretschneideri, Cydonia Oblonga, Prunus salicina, The term “recombine' as used herein means refers to any Prunus cerasifera, Prunus persica, Eriobotrya japonica, method of joining polynucleotides. The term includes end to Prunus dulcis, Prunus avium, Mespilus germanica and Pru end joining, and insertion of one sequence into another. The nus domestica. term is intended to encompass includes physical joining tech A particularly preferred Rosaceae genus is Malus. niques such as Sticky-end ligation and blunt-end ligation. The A particularly preferred Malus species is Malus domestica. chimeric promoter polynucleotide sequence, or elements Particularly preferred Malus species/cultivars include thereof, may also be artificially, or recombinantly synthesised Malus sieversii 93.051 G01-048, Malus aldenhamii, Malus 10 to contain the recombined sequences. pumila Niedzwetzkyana, Malus xdomestica cv. 'Prairiefire, Typically the chimeric promoter is synthesised by methods MalusXdomestica cv. 'Geneva, Malus sieversii 92.103 well known to those skilled in the art. However the chimeric 30-312. A particularly preferred Malus cultivar is MalusXdomes promoter will contain the sequences as herein defined or tica niedwetzkyana. 15 specified, that are not normally found together in nature. Another preferred Rosaceae genus is Pyrus. When a chimeric promoter of the invention comprises a Particularly preferred Pyrus species include Pyrus call particular element or motif, this means that the element or ervana, Pyrus Caucasica, Pyrus communis, Pyrus elaeagri motifmay be found within the chimeric promotersequence or folia, Pyrus hybrid cultivar, Pyrus pyrifolia, Pyrus salicifolia, at either end of the chimeric promoter sequence. Pyrus ussuriensis, PyrusXbretschneideri. A "naturally occurring sequence, promoter or promoter A particularly preferred Pyrus species is Pyrus communis. element, is one that is found in at least one species in nature. Another preferred genus is Fragaria. The term “derived from with respect to plants or a par Preferred Fragaria species include Fragaria daltoniana, ticular type of plant, means the same as a sequence naturally Fragaria gracilis, Fragaria grandiflora, Fragaria inumae, occurring in those plants or that plant. Fragaria moschata, Fragaria nilgerrensis, Fragaria nip 25 The term “sequence motif as used herein means a stretch ponica, Fragaria nubicola, Fragaria Orientalis, Fragaria of nucleotides. Preferably the stretch of nucleotides is con pentaphylla, Fragaria vesca, Fragaria virginiana, Fragaria tiguous. viridis, Fragariaxananassa, Fragaria sp. CFRA 538. The term “MYB transcription factor is a term well under Particularly preferred Fragaria species are Fragariax stood by those skilled in the art to refer to a class of transcrip ananassa, Fragaria chiloensis and Fragaria vesca. 30 tion factors characterised by a structurally conserved DNA binding domain consisting of single or multiple imperfect DETAILED DESCRIPTION repeats. The term “A MYB transcription with an R2R3DNA bind In this specification where reference has been made to ing domain is a term well understood by those skilled in the patent specifications, other external documents, or other 35 art to refer to MYB transcription factors of the two-repeat Sources of information, this is generally for the purpose of class. providing a context for discussing the features of the inven The term “modified with respect to a plant with “modified tion. Unless specifically stated otherwise, reference to such expression” or a “modified phenotype' means modified rela external documents is not to be construed as an admission that tive to the same plant, or plant of the same type, in the Such documents, or Such sources of information, in any juris 40 non-transformed State. diction, are prior art, or form part of the common general Polynucleotides and Fragments knowledge in the art. The term “polynucleotide(s).' as used herein, means a Definitions single or double-stranded deoxyribonucleotide or ribonucle The term "comprising as used in this specification and otide polymer of any length but preferably at least 15 nucle claims means "consisting at least in part of'; that is to say 45 otides, and include as non-limiting examples, coding and when interpreting statements in this specification and claims non-coding sequences of a gene, sense and antisense which include “comprising, the features prefaced by this sequences complements, exons, introns, genomic DNA, term in each statementall need to be present but other features cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, can also be present. Related terms such as "comprise and ribozymes, recombinant polypeptides, isolated and purified “comprised are to be interpreted in similar manner. 50 naturally occurring DNA or RNA sequences, synthetic RNA However, in preferred embodiments comprising can be and DNA sequences, nucleic acid probes, primers and frag replaced with consisting. mentS. The term "chimeric' as used herein, with respect to the A "fragment of a polynucleotide sequence provided chimeric promoter polynucleotide of the invention, means herein is a Subsequence of contiguous nucleotides that is comprised of sequences that are “recombined. Preferably 55 preferably at least 15 nucleotides in length. The fragments of the sequences that are “recombined are not found together in the invention preferably comprises at least 20 nucleotides, nature. more preferably at least 30 nucleotides, more preferably at Typically the chimeric promoter is comprised of sequence least 40 nucleotides, more preferably at least 50 nucleotides elements that are present in naturally occurring promoters. and most preferably at least 60 contiguous nucleotides of a For example, one or more of the sequence elements present in 60 polynucleotide of the invention. A fragment of a polynucle a naturally occurring promoter may be duplicated or multi otide sequence can be used in antisense, gene silencing, triple plied, in the context of a naturally occurring promoter, to helix or ribozyme technology, or as a primer, a probe, produce a chimeric promoter of the invention. The naturally included in a microarray, or used in polynucleotide-based occurring promoter may be the same promoter as the selection methods. sequence elements, or may be from a different promoter. 65 The term “fragment” in relation to promoter polynucle Preferably the chimeric promoterpolynucleotide sequence otide sequences is intended to include sequences comprising of the invention is not found in naturally occurring plants in its cis-elements and regions of the chimeric promoterpolynucle US 8,686,125 B2 15 16 otide sequence capable of regulating expression of a poly era or species, means that the sequence has the same sequence nucleotide sequence to which the fragment is operably linked. as a polynucleotide or polypeptide sequence found naturally Preferably fragments of promoter polynucleotide in that genera or species. The sequence, derived from a par sequences of the invention comprise at least 46, more prefer ticular genera or species, may therefore be produced syntheti ably at least 69, more preferably at least 92, more preferably cally or recombinantly. at least 115, more preferably at least 138, more preferably at Variants least 150, more preferably at least 200, more preferably at As used herein, the term “variant” refers to polynucleotide least 300, more preferably at least 400, more preferably at or polypeptide sequences different from the specifically iden least 500, more preferably at least 600, more preferably at tified sequences, wherein one or more nucleotides or amino least 700, more preferably at least 800, more preferably at 10 least 900, more preferably at least 1000, more preferably at acid residues is deleted, substituted, or added. Variants may least 1100, more preferably at least 1200, more preferably at be naturally occurring allelic variants, or non-naturally occur least 1300, more preferably at least 1400, more preferably at ring variants. Variants may be from the same or from other least 1500, more preferably at least 1600 and most preferably species and may encompass homologues, paralogues and at least 1700 contiguous nucleotides of the specified poly 15 orthologues. In certain embodiments, variants of the inven nucleotide. Fragments of the chimeric promoter polynucle tive polynucleotides and polypeptides possess biological otide sequences can be used to control expression of an oper activities that are the same or similar to those of the inventive ably linked polynucleotide in a transgenic plant cells or polynucleotides or polypeptides. The term “variant' with plants. reference to polynucleotides and polypeptides encompasses The term “primer' refers to a short polynucleotide, usually all forms of polynucleotides and polypeptides as defined having a free 3'OH group, that is hybridized to a template and herein. used for priming polymerization of a polynucleotide comple Polynucleotide Variants mentary to the template. Such a primer is preferably at least 5, Variant polynucleotide sequences preferably exhibit at more preferably at least 6, more preferably at least 7, more least 50%, more preferably at least 51%, more preferably at preferably at least 9, more preferably at least 10, more pref 25 least 52%, more preferably at least 53%, more preferably at erably at least 11, more preferably at least 12, more preferably least 54%, more preferably at least 55%, more preferably at at least 13, more preferably at least 14, more preferably at least 56%, more preferably at least 57%, more preferably at least 15, more preferably at least 16, more preferably at least least 58%, more preferably at least 59%, more preferably at 17, more preferably at least 18, more preferably at least 19, least 60%, more preferably at least 61%, more preferably at more preferably at least 20 nucleotides in length. 30 least 62%, more preferably at least 63%, more preferably at The term “probe' refers to a short polynucleotide that is least 64%, more preferably at least 65%, more preferably at used to detect a polynucleotide sequence, that is complemen least 66%, more preferably at least 67%, more preferably at tary to the probe, in a hybridization-based assay. The probe least 68%, more preferably at least 69%, more preferably at may consist of a “fragment of a polynucleotide as defined least 70%, more preferably at least 71%, more preferably at herein. Preferably such a probe is at least 5, more preferably 35 least 72%, more preferably at least 73%, more preferably at at least 10, more preferably at least 20, more preferably at least 74%, more preferably at least 75%, more preferably at least 30, more preferably at least 40, more preferably at least least 76%, more preferably at least 77%, more preferably at 50, more preferably at least 100, more preferably at least 200, least 78%, more preferably at least 79%, more preferably at more preferably at least 300, more preferably at least 400 and least 80%, more preferably at least 81%, more preferably at most preferably at least 500 nucleotides in length. 40 least 82%, more preferably at least 83%, more preferably at Polypeptides and Fragments least 84%, more preferably at least 85%, more preferably at The term “polypeptide', as used herein, encompasses least 86%, more preferably at least 87%, more preferably at amino acid chains of any length but preferably at least 5 least 88%, more preferably at least 89%, more preferably at amino acids, including full-length proteins, in which amino least 90%, more preferably at least 91%, more preferably at acid residues are linked by covalent peptide bonds. The 45 least 92%, more preferably at least 93%, more preferably at polypeptides may be purified natural products, or may be least 94%, more preferably at least 95%, more preferably at produced partially or wholly using recombinant or synthetic least 96%, more preferably at least 97%, more preferably at techniques. The term may refer to a polypeptide, an aggregate least 98%, and most preferably at least 99% identity to a of a polypeptide Such as a dimer or other multimer, a fusion specified polynucleotide sequence. Identity is found over a polypeptide, a polypeptide fragment, a polypeptide variant, 50 comparison window of at least 20 nucleotide positions, more or derivative thereof. preferably at least 50 nucleotidepositions, more preferably at A "fragment of a polypeptide is a Subsequence of the least 100 nucleotide positions, more preferably at least 200 polypeptide that performs a function that is required for the nucleotide positions, more preferably at least 300 nucleotide biological activity and/or provides three dimensional struc positions, more preferably at least 400 nucleotide positions, ture of the polypeptide. The term may refer to a polypeptide, 55 more preferably at least 500 nucleotide positions, more pref an aggregate of a polypeptide such as a dimer or other mul erably at least 600 nucleotide positions, more preferably at timer, a fusion polypeptide, a polypeptide fragment, a least 700 nucleotide positions, more preferably at least 800 polypeptide variant, or derivative thereof capable of perform nucleotide positions, more preferably at least 900 nucleotide ing the above enzymatic activity. positions, more preferably at least 1000 nucleotide positions, The term "isolated as applied to the polynucleotide or 60 more preferably at least 1100 nucleotidepositions, more pref polypeptide sequences disclosed herein is used to refer to erably at least 1200 nucleotide positions, more preferably at sequences that are removed from their natural cellular envi least 1300 nucleotidepositions, more preferably at least 1400 ronment. An isolated molecule may be obtained by any nucleotidepositions, more preferably at least 1500 nucleotide method or combination of methods including biochemical, positions, more preferably at least 1600 nucleotide positions, recombinant, and synthetic techniques. 65 more preferably at least 1700 nucleotide positions and most The term "derived from with respect to a polynucleotide preferably over the entire length of the specified polynucle or polypeptide sequence being derived from a particular gen otide sequence. For the 23 bp motifs in the chimeric promot US 8,686,125 B2 17 18 ers of the invention, or used in the methods of the invention, expect to see Such a match by chance in a database of a fixed identity is preferably found over the whole 23 nucleotide reference size containing random sequences. The size of this positions. database is set by default in the bl2seq program. For small E Polynucleotide sequence identity can be determined in the values, much less than one, the E value is approximately the following manner. The Subject polynucleotide sequence is probability of Such a random match. compared to a candidate polynucleotide sequence using Variant polynucleotide sequences preferably exhibit an E BLASTN (from the BLAST suite of programs, version 2.2.5 value of less than 1x10' more preferably less than 1x10'. November 2002) in bl2seq (Tatiana A. Tatusova, Thomas L. more preferably less than 1x10', more preferably less than Madden (1999), "Blast 2 sequences—a new tool for compar 1x10', more preferably less than 1x10, more preferably ing protein and nucleotide sequences. FEMS Microbiol Lett. 10 174:247-250), which is publicly available on the internet less than 1x10', more preferably less than 1x10', more from NCBI. The default parameters of bl2seq are utilized preferably less than 1x10, more preferably less than except that filtering of low complexity parts should be turned 1x10' and most preferably less than 1x10' when com off. pared with any one of the specifically identified sequences. The identity of polynucleotide sequences may be exam 15 Alternatively, variant polynucleotides of the present inven ined using the following unix command line parameters: tion hybridize to a specified polynucleotide sequence, or bl2seq -i nucleotideseq 1 - nucleotideseq2 -F F-p blastin complements thereof under stringent conditions. The parameter -FF turns off filtering of low complexity The term “hybridize under stringent conditions, and sections. The parameter-p selects the appropriate algorithm grammatical equivalents thereof, refers to the ability of a for the pair of sequences. The bl2seq program reports polynucleotide molecule to hybridize to a target polynucle sequence identity as both the number and percentage of iden otide molecule (such as a target polynucleotide molecule tical nucleotides in a line “Identities='. immobilized on a DNA or RNA blot, such as a Southern blot Polynucleotide sequence identity may also be calculated or Northern blot) under defined conditions oftemperature and over the entire length of the overlap between a candidate and salt concentration. The ability to hybridize under stringent Subject polynucleotide sequences using global sequence 25 hybridization conditions can be determined by initially alignment programs (e.g. Needleman, S. B. and Wunsch, C. hybridizing under less stringent conditions then increasing D. (1970).J. Mol. Biol. 48,443-453). A full implementation of the stringency to the desired stringency. the Needleman-Wunsch global alignment algorithm is found With respect to polynucleotide molecules greater than in the needle program in the EMBOSS package (Rice, P. about 100 bases in length, typical stringent hybridization Longden, I. and Bleasby, A. EMBOSS: The European 30 conditions are no more than 25 to 30°C. (for example, 10°C.) Molecular Biology Open Software Suite, Trends in Genetics below the melting temperature (Tm) of the native duplex (see June 2000, vol 16, No 6. pp. 276-277) which can be obtained generally, Sambrook et al., Eds, 1987, Molecular Cloning. A from hgmp.mrc.ac.uk/Software/EMBOSS on the worldwide Laboratory Manual, 2nd Ed. Cold Spring Harbor Press: web. The European Bioinformatics Institute server also pro Ausubel et al., 1987, Current Protocols in Molecular Biology, vides the facility to perform EMBOSS-needle global align 35 Greene Publishing). Tm for polynucleotide molecules greater ments between two sequences online at http:/www.ebi.ac.uk/ than about 100 bases can be calculated by the formula emboss/align/. Tm=81.5+0.41% (G+C-log (Na+). (Sambrook et al., Eds, Alternatively the GAP program, which computes an opti 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. mal global alignment of two sequences without penalizing Cold Spring Harbor Press; Bolton and McCarthy, 1962, terminal gaps, may be used to calculate sequence identity. 40 PNAS 84:1390). Typical stringent conditions for polynucle GAP is described in the following paper: Huang, X. (1994) otide of greater than 100 bases in length would be hybridiza On Global Sequence Alignment. Computer Applications in tion conditions such as prewashing in a solution of 6xSSC, the Biosciences 10, 227-235. 0.2% SDS: hybridizing at 65° C., 6xSSC, 0.2% SDS over Sequence identity may also be calculated by aligning night; followed by two washes of 30 minutes each in 1xSSC, sequences to be compared using Vector NTI version 9.0, 45 0.1% SDS at 65° C. and two washes of 30 minutes each in which uses a Clustal W algorithm (Thompson et al., 1994, 0.2xSSC, 0.1% SDS at 65° C. Nucleic Acids Research 24, 4876-4882), then calculating the With respect to polynucleotide molecules having a length percentage sequence identity between the aligned sequences less than 100 bases, exemplary Stringent hybridization con using Vector NTI version 9.0 (Sep. 2, 2003 (C.1994-2003 ditions are 5 to 10° C. below Tm. On average, the Tm of a InforMax, licenced to Invitrogen). 50 polynucleotide molecule of length less than 100 bp is reduced Polynucleotide variants of the present invention also by approximately (500/oligonucleotide length) C. encompass those which exhibit a similarity to one or more of With respect to the DNA mimics known as peptide nucleic the specifically identified sequences that is likely to preserve acids (PNAS) (Nielsen et al., Science. 1991 Dec. 6; the functional equivalence of those sequences and which 254(5037): 1497-500) Tm values are higher than those for could not reasonably be expected to have occurred by random 55 DNA-DNA or DNA-RNA hybrids, and can be calculated chance. Such sequence similarity with respect to polynucle using the formula described in Giesen et al., Nucleic Acids otides may be determined using the publicly available bl2seq Res. 1998 Nov. 1; 26(21):5004-6. Exemplary stringent program from the BLAST suite of programs (version 2.2.5 hybridization conditions for a DNA-PNA hybrid having a November 2002) from NCBI via the internet. length less than 100 bases are 5 to 10° C. below the Tm. The similarity of polynucleotide sequences may be exam 60 Variant polynucleotides such as those in constructs of the ined using the following unix command line parameters: invention encoding proteins to be expressed, also encom bl2seq -i nucleotideseq 1 - nucleotideseq2 -F F-p thlastX passes polynucleotides that differ from the specified The parameter -FF turns off filtering of low complexity sequences but that, as a consequence of the degeneracy of the sections. The parameter-p selects the appropriate algorithm genetic code, encode a polypeptide having similar activity to for the pair of sequences. This program finds regions of simi 65 a polypeptide encoded by a polynucleotide of the present larity between the sequences and for each Such region reports invention. A sequence alteration that does not change the an “Evalue” which is the expected number of times one could amino acid sequence of the polypeptide is a “silent variation'. US 8,686,125 B2 19 20 Except for ATG (methionine) and TGG (tryptophan), other Suitable global sequence alignment programs for calculating codons for the same amino acid may be changed by art rec polypeptide sequence identity. ognized techniques, e.g., to optimize codon expression in a Sequence identity may also be calculated by aligning particular host organism. sequences to be compared using Vector NTI version 9.0, Polynucleotide sequence alterations resulting in conserva which uses a Clustal W algorithm (Thompson et al., 1994, tive Substitutions of one or several amino acids in the encoded Nucleic Acids Research 24, 4876-4882), then calculating the polypeptide sequence without significantly altering its bio percentage sequence identity between the aligned polypep logical activity are also contemplated. A skilled artisan will tide sequences using Vector NTI version 9.0 (Sep. 2, 2003 be aware of methods for making phenotypically silent amino (C1994-2003 InforMax, licenced to Invitrogen). acid substitutions (see, e.g., Bowie et al., 1990, Science 247, 10 Polypeptide variants of the present invention also encom 1306). pass those which exhibit a similarity to one or more of the Variant polynucleotides due to silent variations and con specifically identified sequences that is likely to preserve the servative Substitutions in the encoded polypeptide sequence functional equivalence of those sequences and which could may be determined using the publicly available bl2Seq pro 15 not reasonably be expected to have occurred by random gram from the BLAST suite of programs (version 2.2.5 No chance. Such sequence similarity with respect to polypep vember 2002) from NCBI on the internet and via the tblastx tides may be determined using the publicly available bl2seq algorithm as previously described. program from the BLAST suite of programs (version 2.2.5 Polypeptide Variants November 2002) from NCBI via the internet. The similarity The term “variant' with reference to polypeptides encom of polypeptide sequences may be examined using the follow passes naturally occurring, recombinantly and synthetically ing unix command line parameters: produced polypeptides. Variant polypeptide sequences pref bl2seq -i peptideseq 1 - peptideseq2 -F F-p blastp erably exhibit at least 50%, more preferably at least 51%, Variant polypeptide sequences preferably exhibit an E more preferably at least 52%, more preferably at least 53%, value of less than 1x10 more preferably less than 1x10, more preferably at least 54%, more preferably at least 55%, 25 more preferably less than 1x10', more preferably less than more preferably at least 56%, more preferably at least 57%, 1x10', more preferably less than 1x10, more preferably more preferably at least 58%, more preferably at least 59%, less than 1x10°, more preferably less than 1x10', more more preferably at least 60%, more preferably at least 61%, preferably less than 1x10", more preferably less than more preferably at least 62%, more preferably at least 63%, 1x10, more preferably less than 1x10', more preferably more preferably at least 64%, more preferably at least 65%, 30 more preferably at least 66%, more preferably at least 67%, less than 1x107, more preferably less than 1x10, more more preferably at least 68%, more preferably at least 69%, preferably less than 1x10' and most preferably 1x10' more preferably at least 70%, more preferably at least 71%, when compared with any one of the specifically identified more preferably at least 72%, more preferably at least 73%, Sequences. more preferably at least 74%, more preferably at least 75%, 35 The parameter-F F turns off filtering of low complexity more preferably at least 76%, more preferably at least 77%, sections. The parameter-p selects the appropriate algorithm more preferably at least 78%, more preferably at least 79%, for the pair of sequences. This program finds regions of simi more preferably at least 80%, more preferably at least 81%, larity between the sequences and for each Such region reports more preferably at least 82%, more preferably at least 83%, an “Evalue” which is the expected number of times one could more preferably at least 84%, more preferably at least 85%, 40 expect to see Such a match by chance in a database of a fixed more preferably at least 86%, more preferably at least 87%, reference size containing random sequences. For Small E more preferably at least 88%, more preferably at least 89%, values, much less than one, this is approximately the prob more preferably at least 90%, more preferably at least 91%, ability of such a random match. more preferably at least 92%, more preferably at least 93%, Conservative substitutions of one or several amino acids of more preferably at least 94%, more preferably at least 95%, 45 a described polypeptide sequence without significantly alter more preferably at least 96%, more preferably at least 97%, ing its biological activity are also included in the invention. A more preferably at least 98%, and most preferably at least skilled artisan will be aware of methods for making pheno 99% identity to a sequences of the present invention. Identity typically silent amino acid Substitutions (see, e.g., Bowie et is found over a comparison window of at least 20 amino acid al., 1990, Science 247, 1306). positions, preferably at least 50 amino acid positions, more 50 Constructs, Vectors and Components thereof preferably at least 100 amino acid positions, and most pref The term “genetic construct” refers to a polynucleotide erably over the entire length of a polypeptide of the invention. molecule, usually double-stranded DNA, which may have Polypeptide sequence identity can be determined in the inserted into it another polynucleotide molecule (the insert following manner. The Subject polypeptide sequence is com polynucleotide molecule) such as, but not limited to, a cDNA pared to a candidate polypeptide sequence using BLASTP 55 molecule. A genetic construct may contain a promoter poly (from the BLAST suite of programs, version 2.2.5 Novem nucleotide Such as a chimeric promoter polynucleotide of the ber 2002) in bl2seq, which is publicly available via the invention including the necessary elements that permit tran internet from NCBI. The default parameters of bl2seq are scribing the insert polynucleotide molecule, and, optionally, utilized except that filtering of low complexity regions should translating the transcript into a polypeptide. The insert poly be turned off. 60 nucleotide molecule may be derived from the host cell, or Polypeptide sequence identity may also be calculated over may be derived from a different cell or organism and/or may the entire length of the overlap between a candidate and be a synthetic or recombinant polynucleotide. Once inside the Subject polynucleotide sequences using global sequence host cell the genetic construct may become integrated in the alignment programs. EMBOSS-needle (available at http:/ host chromosomal DNA. The genetic construct may be linked www.ebi.ac.uk/emboss/align/) and GAP (Huang, X. (1994) 65 to a VectOr. On Global Sequence Alignment. Computer Applications in The term “vector” refers to a polynucleotide molecule, the Biosciences 10, 227-235.) as discussed above are also usually double stranded DNA, which is used to transport the US 8,686,125 B2 21 22 genetic construct into a host cell. The vector may be capable Mol. Biol. January; 45(1): 75-92.). Other plant promoters are of replication in at least one additional host system, such as E. known to those skilled in the art and are described in the coli. scientific literature. The term "expression construct” refers to a genetic con The applicants have isolated promoter polynucleotide struct that includes the necessary elements that permit tran sequences from apple and pear and identified a sequence scribing the insert polynucleotide molecule, and, optionally, motif, and variants thereof, in Such promoters which strongly translating the transcript into a polypeptide. influence the activity of Such promoters. The applicants have An expression construct typically comprises in a 5' to 3' shown that when the sequence motif is added to a promoter, direction: the activity of that promoter is altered, and the promoter a) a promoter, Such as a chimeric promoter polynucleotide 10 becomes more positively regulated by certain MYB tran sequence of the invention, functional in the host cell into Scription factors resulting in a significant increase in expres which the construct will be transformed, sion driven by the promoter. b) the polynucleotide to be expressed, and The invention provides a method for producing chimeric c) a terminator functional in the host cell into which the 15 promoters comprising the sequence motif, or motifs, and construct will be transformed. variants thereof. The invention also provides such chimeric The term “coding region' or “open reading frame' (ORF) promoters and variants thereof. The invention provides refers to the sense Strand of a genomic DNA sequence or a genetic constructs and vectors comprising the chimeric pro cDNA sequence that is capable of producing a transcription moter polynucleotide sequences, and transgenic plant cells product and/or a polypeptide under the control of appropriate and transgenic plants comprising the chimeric promoterpoly regulatory sequences. The coding sequence is identified by nucleotide sequence, genetic constructs, or vectors of the the presence of a 5' translation start codon and a 3’ translation invention. stop codon. When inserted into a genetic construct, a "coding The invention provides the opportunity to produce novel sequence' is capable of being expressed when it is operably promoters with desirable activity. The invention also provides linked to promoter and terminator sequences. 25 the opportunity to alter the activity of existing promoters by The term “operably-linked' means that the sequenced to be adding or inserting the sequence motifs, or variant thereof, to expressed is placed under the control of regulatory elements Such existing promoters. Such novel or modified chimeric that include promoters, tissue-specific regulatory elements, promoters may be regulated by certain MYB transcription temporal regulatory elements, enhancers, repressors and ter factors. In this way expression of sequences operably linked 30 to the chimeric promoters may be expressed in a desirable minators. way and may be individually or co-ordinately regulated by The term “noncoding region' includes to untranslated the MYB transcription factors. The MYB transcription fac sequences that are upstream of the translational start site and tors may be naturally expressed or may be expressed follow downstream of the translational stop site. These sequences ing genetic transformation. are also referred to respectively as the 5' UTR and the 3' UTR. 35 The invention also provides methods for producing plants These sequences may include elements required for tran with modified gene expression and modified phenotype. The Scription initiation and termination and for regulation of invention further provides plants produced by the methods of translation efficiency. The term “noncoding also includes the invention. intronic sequences within genomic clones. Methods for Isolating or Producing Polynucleotides Terminators are sequences, which terminate transcription, 40 The polynucleotide molecules of the invention can be iso and are found in the 3' untranslated ends of genes downstream lated by using a variety of techniques known to those of of the translated sequence. Terminators are important deter ordinary skill in the art. By way of example, such polynucle minants of mRNA stability and in some cases have been otides can be isolated through use of the polymerase chain found to have spatial regulatory functions. reaction (PCR) described in Mullis et al., Eds. 1994 The The term “promoter refers to a polynucleotide sequence 45 Polymerase Chain Reaction, Birkhauser, incorporated herein capable of regulating or driving the expression of a poly by reference. The polynucleotides of the invention can be nucleotide sequence to which the promoter is operably linked amplified using primers, as defined herein, derived from the in a cell, or cell free transcription system. Promoters may polynucleotide sequences of the invention. comprise cis-initiator elements which specify the transcrip Further methods for isolating polynucleotides of the inven tion initiation site and conserved boxes such as the TATA box, 50 tion, or useful in the methods of the invention, include use of and motifs that are bound by transcription factors. all or portions, of the polynucleotides set forth herein as Examples of naturally occurring promoters which may be hybridization probes. The technique of hybridizing labeled used, in whole or in part, in production of the chimeric pro polynucleotide probes to polynucleotides immobilized on moters of the invention include: the promoter of the tobacco Solid Supports such as nitrocellulose filters or nylon mem MYB10 gene (R2R3-MYB-153: Rushton et al 2008, Plant 55 branes, can be used to screen the genomic. Exemplary hybrid Physiol. 2008 10.1104/pp. 107.114041); the promoter of the ization and wash conditions are: hybridization for 20 hours at Arabidopsis gene AtMYB75 (Borevitz et al., 2000, Plant Cell 65° C. in 5.0xSSC, 0.5% sodium dodecyl sulfate, 1xDen 12, 2383-2394); the promoter of the Vitamin C tran?ferase hardt’s solution; washing (three washes of twenty minutes gene (Lainget al., 2007, PNAS, May 2007: 104: 9534-9539); each at 55°C.) in 1.0xSSC, 1% (w/v) sodium dodecyl sulfate, the promoter of the Banyuls gene (Xie et al., 2003, Science. 60 and optionally one wash (for twenty minutes) in 0.5xSSC, 1% 2003 Jan. 17; 299(5605):396-9; Albert et al., 1997); the pro (w/v) sodium dodecyl sulfate, at 60° C. An optional further moter of the MdTT2 gene (Genbank No. DQ267900); the wash (for twenty minutes) can be conducted under conditions promoter of the Arabidopsis. At TT2 gene (Nesi et al., 2001, of 0.1xSSC, 1% (w/v) sodium dodecyl sulfate, at 60° C. Plant Cell 13, 2099-2114); the promoter of the Arabidopsis The polynucleotide fragments of the invention may be AtFT gene (Kardailsky et al 1999, SCIENCE Volume 286 65 produced by techniques well-known in the art such as restric Page 1962); and the promoters of fruit oxidosqualene-triter tion endonuclease digestion, oligonucleotide synthesis and penoid cyclases genes (Husselstein-Muller et al., 2001, Plant PCR amplification. US 8,686,125 B2 23 24 Apartial polynucleotide sequence may be used, in methods ment to a reporter or other polynucleotide and measuring well-known in the art to identify the corresponding full length reporter activity or polynucleotide expressions in plants. polynucleotide sequence and/or the whole gene/and/or the Some of such techniques are described in the Examples sec promoter. Such methods include PCR-based methods, tion of this specification. 5'RACE (Frohman MA, 1993, Methods Enzymol. 218:340 Methods for Identifying Variants 56) and hybridization-based method, computer/database Physical Methods based methods. Further, by way of example, inverse PCR Variant polynucleotides may be identified using PCR permits acquisition of unknown sequences, flanking the poly based methods (Mullis et al., Eds. 1994 The Polymerase nucleotide sequences disclosed herein, starting with primers Chain Reaction, Birkhauser). based on a known region (Triglia et al., 1998, Nucleic Acids 10 Alternatively library screening methods, well known to Res 16,8186, incorporated herein by reference). The method those skilled in the art, may be employed (Sambrook et al., uses several restriction enzymes to generate a Suitable frag Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold ment in the known region of a polynucleotide. The fragment Spring Harbor Press, 1987). When identifying variants of the is then circularized by intramolecular ligation and used as a probe sequence, hybridization and/or wash stringency will PCR template. Divergent primers are designed from the 15 typically be reduced relatively to when exact sequence known region. Promoter and flanking sequences may also be matches are sought. isolated by PCR genome walking using a GenomeWalkerTM Computer-Based Methods kit (Clontech, Mountain View, Calif.), following the manu Polynucleotide and polypeptide variants may also be iden facturers instructions. In order to physically assemble full tified by computer-based methods well-known to those length clones, standard molecular biology approaches can be skilled in the art, using public domain sequence alignment utilized (Sambrook et al., Molecular Cloning: A Laboratory algorithms and sequence similarity search tools to search Manual, 2nd Ed. Cold Spring Harbor Press, 1987). sequence databases (public domain databases include Gen It may be beneficial, when producing a transgenic plant bank, EMBL, Swiss-Prot, PIR and others). See, e.g., Nucleic from a particular species, to transform such a plant with a Acids Res. 29: 1-10 and 11-16, 2001 for examples of online sequence or sequences derived from that species. The benefit 25 resources. Similarity searches retrieve and align target may be to alleviate public concerns regarding cross-species sequences for comparison with a sequence to be analyzed transformation in generating transgenic organisms. Addition (i.e., a query sequence). Sequence comparison algorithms use ally when down-regulation of a gene is the desired result, it scoring matrices to assign an overall score to each of the may be necessary to utilise a sequence identical (or at least alignments. highly similar) to that in the plant, for which reduced expres 30 An exemplary family of programs useful for identifying sion is desired. For these reasons among others, it is desirable variants in sequence databases is the BLAST suite of pro to be able to identify and isolate orthologues of a particular grams (version 2.2.5 November 2002) including BLASTN, gene in several different plant species. Variants (including BLASTP, BLASTX, tRLASTN and tBLASTX, which are orthologues) may be identified by the methods described. publicly available from NCBI via the internet or from the The promoter sequences disclosed may be further charac 35 National Center for Biotechnology Information (NCBI), terized to identify other fragments, such as cis-elements and National Library of Medicine, Building 38A, Room 8N805, regions, capable of regulating to expression of operably Bethesda, Md. 20894 USA. The NCBI server also provides linked sequences, using techniques well-known to those the facility to use the programs to Screen a number of publicly skilled in the art. Such techniques include 5' and/or 3' deletion available sequence databases. BLASTN compares a nucle analysis, linker Scanning analysis and various DNA footprint 40 otide query sequence against a nucleotide sequence database. ing techniques (Degenhardt et al., 1994 Plant Cell:6(8) 1123 BLASTP compares an amino acid query sequence against a 34, Directed Mutagenesis: A Practical Approach IRL Press protein sequence database. BLASTX compares a nucleotide (1991)). Fragments include truncated versions of longer pro query sequence translated in all reading frames against a moter sequences which may terminate (at the 3' end) at or protein sequence database. tBLASTN compares a protein close to the transcriptional start site. Methods for identifying 45 query sequence against a nucleotide sequence database the transcription start site of a promoter are well-known to dynamically translated in all reading frames. tBLASTX com those skilled in the art (discussed in Hashimoto et al., 2004, pares the six-frame translations of a nucleotide query Nature Biotechnology 22, 1146-1149). sequence against the six-frame translations of a nucleotide The techniques described above may be used to identify a sequence database. The BLAST programs may be used with fragment that defines essential region of the promoter that is 50 default parameters or the parameters may be altered as able to confer the desired expression profile. The essential required to refine the screen. region may function by itself or may be fused to a core The use of the BLAST family of algorithms, including promoter to drive expression of an operably linked polynucle BLASTN, BLASTP, and BLASTX, is described in the pub otide. lication of Altschulet al., Nucleic Acids Res. 25: 3389-3402, The core promoter can be any one of known core promoters 55 1997. such as the Cauliflower Mosaic Virus 35S or 19S promoter The “hits” to one or more database sequences by a queried (U.S. Pat. No. 5,352,605), ubiquitin promoter (U.S. Pat. No. sequence produced by BLASTN, BLASTP, BLASTX, 5,510,474) the IN2 core promoter (U.S. Pat. No. 5,364,780) tBLASTN, thBLASTX, or a similar algorithm, align and iden or a Figwort Mosaic Virus promoter (Gruber, et al. “Vectors tify similar portions of sequences. The hits are arranged in for Plant Transformation' Methods in Plant Molecular Biol 60 order of the degree of similarity and the length of sequence ogy and Biotechnology) et al. eds. CRC Press pp. 89-119 overlap. Hits to a database sequence generally represent an (1993)). overlap over, only a fraction of the sequence length of the Promoter fragments can be tested for their utility in driving queried sequence. expression in any particular cell or tissue type, or at any The BLASTN, BLASTP, BLASTX, tRLASTN and particular developmental stage, or in response to any particu 65 tBLASTX algorithms also produce “Expect values for lar stimulus by techniques well-known to those skilled in the alignments. The Expect value (E) indicates the number of hits art. Techniques include operably-linking the promoter frag one can "expect to see by chance when searching a database US 8,686,125 B2 25 26 of the same size containing random contiguous sequences. Host cells comprising genetic constructs, such as expres The Expect value is used as a significance threshold for deter sion constructs, of the invention are useful in methods well mining whether the hit to a database indicates true similarity. known in the art (e.g. Sambrook et al., Molecular Cloning: A For example, an E value of 0.1 assigned to a polynucleotide Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987: hit is interpreted as meaning that in a database of the size of 5 Ausubel et al., Current Protocols in Molecular Biology, the database screened, one might expect to see 0.1 matches Greene Publishing, 1987) for recombinant production of over the aligned portion of the sequence with a similar score polypeptides. Such methods may involve the culture of host simply by chance. For sequences having an Evalue of 0.01 or cells in an appropriate medium in conditions Suitable for or less over aligned and matched portions, the probability of conducive to expression of a polypeptide of the invention. finding a match by chance in that database is 1% or less using 10 The expressed recombinant polypeptide, which may option the BLASTN, BLASTP. BLASTX, tRLASTN or tRLASTX ally be secreted into the culture, may then be separated from algorithm. the medium, host cells or culture medium by methods well Multiple sequence alignments of a group of related known in the art (e.g. Deutscher, Ed., 1990, Methods in Enzy sequences can be carried out with CLUSTALW (Thompson, mology, Vol 182, Guide to Protein Purification). J. D., Higgins, D. G. and Gibson, T. J. (1994) CLUSTALW. 15 Methods for Producing Plant Cells and Plants Comprising improving the sensitivity of progressive multiple sequence Constructs and Vectors alignment through sequence weighting, positions-specific The invention further provides plant cells which comprise gap penalties and weight matrix choice. Nucleic Acids a genetic construct of the invention, and plant cells modified Research, 22:4673-4680, internet address igbmc.u.strasbg.fr/ to alter expression of a polynucleotide or polypeptide. Plants BioInfo/ClustalW/Top or TCOFFEE (Cedric Notredame, comprising Such cells also form an aspect of the invention. Desmond G. Higgins, Jaap Hering a, T-Coffee: A novel Methods for transforming plant cells, plants and portions method for fast and accurate multiple sequence alignment, J. thereof with polynucleotides are described in Draper et al., Mol. Biol. (2000) 302: 205-217)) or PILEUP, which uses 1988, Plant Genetic Transformation and Gene Expression. A progressive, pairwise alignments. (Feng and Doolittle, 1987. Laboratory Manual, Blackwell Sci. Pub. Oxford, p. 365: Pot J. Mol. Evol. 25, 351). 25 rykus and Spangenburg, 1995, Gene Transfer to Plants. Pattern recognition software applications are available for Springer-Verlag, Berlin.; and Gelvin et al., 1993, Plant finding motifs or signature sequences. For example, MEME Molecular Biol. Manual. Kluwer Acad. Pub. Dordrecht. A (Multiple Em for Motif Elicitation) finds motifs and signature review of transgenic plants, including transformation tech sequences in a set of sequences, and MAST (Motif Alignment niques, is provided in Galun and Breiman, 1997, Transgenic and Search Tool) uses these motifs to identify similar or the 30 Plants. Imperial College Press, London. same motifs in query sequences. The MAST results are pro The following are representative publications disclosing vided as a series of alignments with appropriate statistical genetic transformation protocols that can be used to geneti data and a visual overview of the motifs found. MEME and cally transform the following plant species: Rice (Alam et al., MAST were developed at the University of California, San 1999, Plant Cell Rep. 18, 572); apple (Yao et al., 1995, Plant Diego. 35 Cell Reports 14, 407-412); maize (U.S. Pat. Nos. 5,177,010 PROSITE (Bairoch and Bucher, 1994, Nucleic Acids Res. and 5,981,840); wheat (Ortiz et al., 1996, Plant Cell Rep. 15, 22,3583; Hofmann et al., 1999, Nucleic Acids Res. 27, 215) 1996,877); tomato (U.S. Pat. No. 5,159,135): potato (Kumar is a method of identifying the functions of uncharacterized et al., 1996 Plant J. 9, 821); cassava (Li et al., 1996 Nat. proteins translated from genomic or cDNA sequences. The Biotechnology 14, 736): lettuce (Michelmore et al., 1987, PROSITE database available via the internet at expasy.org/ 40 Plant Cell Rep. 6,439); tobacco (Horschet al., 1985, Science prosite contains biologically significant patterns and profiles 227, 1229); cotton (U.S. Pat. Nos. 5,846,797 and 5,004,863); and is designed so that it can be used with appropriate com perennial ryegrass (Bajaj et al., 2006, Plant Cell Rep. 25. putational tools to assign a new sequence to a known family of 651); grasses (U.S. Pat. Nos. 5,187,073, 6,020,539); pepper proteins or to determine which known domain(s) are present mint (Niu et al., 1998, Plant Cell Rep. 17, 165); citrus plants in the sequence (Falquet et al., 2002, Nucleic Acids Res. 30. 45 (Pena et al., 1995, Plant Sci. 104, 183); caraway (Krens et al., 235). Prosearch is a tool that can search SWISS-PROT and 1997, Plant Cell Rep. 17, 39); banana (U.S. Pat. No. 5,792, EMBL databases with a given sequence pattern or signature. 935); soybean (U.S. Pat. Nos. 5,416,011; 5,569,834; 5,824, Methods for Producing Constructs and Vectors 877: 5,563,04455 and 5,968,830); pineapple (U.S. Pat. No. The genetic constructs of the present invention comprise 5,952,543); poplar (U.S. Pat. No. 4,795,855); monocots in one or more polynucleotide sequences of the invention and/or 50 general (U.S. Pat. Nos. 5,591,616 and 6,037,522); brassica polynucleotides encoding polypeptides disclosed, and may (U.S. Pat. Nos. 5,188,958; 5.463,174 and 5,750,871); and be useful for transforming, for example, bacterial, fungal, cereals (U.S. Pat. No. 6,074,877); pear (Matsuda et al., 2005, insect, mammalian or particularly plant organisms. The Plant Cell Rep. 24(1):45-51); Prunus (Ramesh et al., 2006, genetic constructs of the invention are intended to include Plant Cell Rep. 25 (8):821-8; Song and Sink 2005, Plant Cell expression constructs as herein defined. 55 Rep. 2006: 25(2): 117-23; Gonzalez Padilla et al., 2003, Plant Methods for producing and using genetic constructs and Cell Rep. 22(1):38-45); strawberry (Oosumi et al., 2006, vectors are well known in the art and are described generally Planta.; 223(6):1219-30; Folta et al., 2006, Planta. 2006 Apr. in Sambrook et al., Molecular Cloning: A Laboratory 14; PMID: 16614818), rose (Liet al., 2003, Planta. 218(2): Manual, 2nd Ed. Cold Spring Harbor Press, 1987; Ausubel et 226-32), and Rubus (Graham et al., 1995, Methods Mol. Biol. al., Current Protocols in Molecular Biology, Greene Publish 60 1995; 44:129-33). Transformation of other species is also ing, 1987). contemplated by the invention. Suitable methods and proto Methods for Producing Host Cells Comprising Constructs cols for transformation of other species are available in the and Vectors scientific literature. The invention provides a host cell which comprises a Methods for Genetic Manipulation of Plants genetic constructor vector of the invention. Host cells may be 65 A number of strategies for genetically manipulating plants derived from, for example, bacterial, fungal, insect, mamma are available (e.g. Birch, 1997, Ann Rev Plant Phys Plant Mol lian or plant organisms. Biol. 48, 297). For example, strategies may be designed to US 8,686,125 B2 27 28 increase expression of a polynucleotide?polypeptide in a plant cell, organ and/or at a particular developmental stage s' GATCTA 3 3 CTAGAT 5" (antisense Strand) wherefwhen it is normally expressed or to ectopically express (coding strand) a polynucleotide/polypeptide in a cell, tissue, organ and/or at 3 CUAGAU S" mRNA 5' GAUCUCG 3' antisense RNA a particular developmental stage which/when it is not nor mally expressed. Strategies may also be designed to increase Genetic constructs designed for gene silencing may also expression of a polynucleotide/polypeptide in response to include an inverted repeat. An inverted repeat is a sequence external stimuli. Such as environmental stimuli. Environmen that is repeated where the second half of the repeat is in the tal stimuli may include environmental stresses such as complementary Strand, e.g., mechanical (such as herbivore activity), dehydration, Salinity 10 and temperature stresses. The expressed polynucleotide? 5 - GATCTA . TAGATC-3' polypeptide may be derived from the plant species to be transformed or may be derived from a different plant species. 3 - CTAGAT . ATCTAG-5 Transformation strategies may be designed to reduce 15 The transcript formed may undergo complementary base expression of a polynucleotide/polypeptide in a plant cell, pairing to form a hairpinstructure. Usually a spacer of at least tissue, organ or at a particular developmental stage which/ 3-5bp between the repeated region is required to allow hair when it is normally expressed or to reduce expression of a pin formation. polynucleotide/polypeptide in response to an external Another silencing approach involves the use of a small stimuli. Such strategies are known as gene silencing strate antisense RNA targeted to the transcript equivalent to an g1eS. miRNA (Llave et al., 2002, Science 297, 2053). Use of such small antisense RNA corresponding to polynucleotide of the Genetic constructs for expression of genes in transgenic invention is expressly contemplated. plants typically include promoters, such as promoter poly The term genetic construct as used herein also includes nucleotides of the invention, for driving the expression of one 25 small antisense RNAs and other such polynucleotides useful or more cloned polynucleotide, terminators and selectable for effecting gene silencing. marker sequences to detect presence of the genetic construct Transformation with an expression construct, as herein in the transformed plant. defined, may also result in gene silencing through a process Exemplary terminators that are commonly used in plant known as sense suppression (e.g. Napoli et al., 1990, Plant transformation genetic construct include, e.g., the cauliflower 30 Cell 2, 279; de Carvalho Niebel et al., 1995, Plant Cell, 7, mosaic virus (CaMV) 35S terminator, the Agrobacterium 347). In some cases sense Suppression may involve over tumefaciens nopaline synthase or octopine synthase termina expression of the whole or a partial coding sequence but may tors, the Zea mays Zin gene terminator, the Oryza sativa also involve expression of non-coding region of the gene, ADP-glucose pyrophosphorylase terminator and the such as an intron or a 5' or 3' untranslated region (UTR). 35 Chimeric partial sense constructs can be used to coordinately Solanum tuberosum PI-II terminator. silence multiple genes (Abbott et al., 2002, Plant Physiol. Selectable markers commonly used in plant transformation 128(3): 844-53; Jones et al., 1998, Planta 204: 499-505). The include the neomycin phophotransferase II gene (NPT II) use of Such sense Suppression strategies to silence the expres which confers kanamycin resistance, the aadA gene, which sion of a sequence operably-linked to promoter of the inven confers spectinomycin and Streptomycin resistance, the phos 40 tion is also contemplated. phinothricin acetyltransferase (bar gene) for Ignite (AgrEvo) The polynucleotide inserts in genetic constructs designed and Basta (Hoechst) resistance, and the hygromycin phos for gene silencing may correspond to coding sequence and/or photransferase gene (hpt) for hygromycin resistance. non-coding sequence, such as promoter and/or intron and/or Use of genetic constructs comprising reporter genes (cod 5' or 3' UTR sequence, or the corresponding gene. ing sequences which express an activity that is foreign to the 45 Other gene silencing strategies include dominant negative host, usually an enzymatic activity and/or a visible signal approaches and the use of ribozyme constructs (McIntyre, (e.g., luciferase, GUS, GFP) which may be used for promoter 1996, Transgenic Res, 5, 257) expression analysis in plants and plant tissues are also con Pre-transcriptional silencing may be brought about templated. The reporter gene literature is reviewed in Her through mutation of the gene itself or its regulatory elements. rera-Estrella et al., 1993, Nature 303, 209, and Schrott, 1995, 50 Such mutations may include point mutations, frameshifts, In: Gene Transfer to Plants (Potrykus, T., Spangenbert. Eds) insertions, deletions and Substitutions. Springer Verlag. Berline, pp. 325-336. Plants Gene silencing strategies may be focused on the gene itself The term “plant' is intended to include a whole plant or any or regulatory elements which effect expression of the part of a plant, propagules and progeny of a plant. 55 The term propagule means any part of a plant that may be encoded polypeptide. “Regulatory elements’ is used here in used in reproduction or propagation, either sexual or asexual, the widest possible sense and includes other genes which including seeds and cuttings. interact with the gene of interest. A “transgenic’’ or transformed plant refers to a plant Genetic constructs designed to decrease or silence the which contains new genetic material as a result of genetic expression of a polynucleotide?polypeptide may include an 60 manipulation or transformation. The new genetic material antisense copy of a polynucleotide. In such constructs the may be derived from a plant of the same species as the polynucleotide is placed in an antisense orientation with resulting transgenic of transformed plant or from a different respect to the promoter and terminator. species. A transformed plant includes a plant which is either An “antisense' polynucleotide is obtained by inverting a stably or transiently transformed with new genetic material. polynucleotide or a segment of the polynucleotide so that the 65 The plants of the invention may be grown and eitherself-ed transcript produced will be complementary to the mRNA or crossed with a different plant strain and the resulting transcript of the gene, e.g., hybrids, with the desired phenotypic characteristics, may be US 8,686,125 B2 29 30 identified. Two or more generations may be grown. Plants R=native promoter from Malus domestica Royal Gala. resulting from Such standard breeding approaches also form R native promoter from MalusXpumila var. niedzwetz part of the present invention. kvana. FIG. 8 shows the number of repeat units affects the trans BRIEF DESCRIPTION OF THE DRAWINGS activation rate. (a) Cartoon (not drawn to scale) of the differ ent promoters with repeat units ranging from Zero (R) to six FIG. 1 shows the promoter polynucleotide sequence of (R). The two native promoters from apple are marked, R as SEQID NO: 5, showing the position of the repeat motifs (1, from Malus xdomestica Royal gala and R6 from Malus x 2, 3A, 3B, 4, 5 and 6), the microsatellite (microsat) and pumila var. niedzwetzkyana. The position of the repeat units several restriction enzyme sites. 10 (in black) relative to the microsatellite (grey diagonal box) is FIG.2 shows a schematic representation of the MdMYB10 shown. R+ is differentiated with grey vertical shading to R promoter from the white-fleshed cultivar with a single represent the Substituted sequence replacing the spatial effect repeat motif (1) and the microsatelite (MS). The figure also of the minisatellite. (b) Results of R to R promoters co shows Schematic representation of the structure and location infiltrated with 35S:MdMYB10 alone (lightgrey bars) and 15 with 35S:MdMYB10 and 35SMdbHLH3 (dark grey bars). of the additional repeat unit composed of repeat units 2, 3a, Error bars shown are means-S.E. of 6 replicate reactions. 3b. 4, 5 and 6 found in the promoter of the red-fleshed cultivar FIG.9 shows identification of areas of the promoter critical R, relative to the promoter from the white-fleshed cultivar. to transactivation by deletion study. (a) Cartoon (not drawn to Example phenotypes for the Md MYB10R and R promoter scale) of the different promoter deletions of R, (i) and R. versions are shown to the left, Malusxdomestica Royal Gala (ii), denoted as Aa-Ad. Deleted areas are shown in white with (i) and MalusXdomestica niedzwetzkyana (ii). dotted lines and the relative positions of the repeat unit R to FIG.3 shows the portion of the sequence (SEQIDNO:4) of the microsatellite and minisatellite are displayed. (b) Corre the promoter from the red-fleshed apple cultivar including sponding data from promoter deletion studies with luciferase repeat motifs 1, 2, 3a, 3b, 4, 5 and 6 and the microsatellite fusions of R, (i) and (ii), and R., (iii) and (iv), co-infiltrated region 25 with MidMYB10, (i) and (iii) respectively (pale grey bars) and FIG. 4 shows trans-activation of the promoters from white with Md MYB10 and MdbHLH3, (ii) and (iv) respectively fleshed (R) and red-fleshed (R) cultivars by the Md MYB10 (dark grey bars). Error bars shown are means-S.E. of 6 rep gene in transient tobacco transformation assays. Both pro licate reactions. moters were infiltrated with and without Md MYB10. Error FIG. 10 shows a schematic representation of the cloning of bars shown are S.E. of the means of 6 replicate experiments. 30 the minsatellite repeat unit (copies 1-6) from the apple FIG. 5 shows that amplification of a PCR product compris MdMYB10R promoter (Md MYB10 long) into the MYB10 ing the minsatellite motifserves as a marker that distinguishes promoter from pear (PcMYB10(GP)) to produce the chimeric white-fleshed and red-fleshed apple cultivars. A total of 87 promoter PcMYB10R(GP-R6). The Md MYB10 promoter cultivars were screened using the PCR primer pair described from white-fleshed apple (Md MYB10 short) is included in 35 the figure for reference. The position of the restriction sites in Example 3. PCR products were separated on 0.9% agarose (DraI and BsgI) and PCR priming sites (CB02 and RE161) is gels and stained with ethidium bromide. The figure shows the also shown. PCR amplification obtained over a subset of 10 apple variet FIG. 11 shows the effect of MdMYB10 genomic and 35S: ies. Two alleles were found: a 496 bp fragment corresponding PcMYB10 constructs on luciferase reporter gene driven by to the promoter of SEQID NO: 5, which was only present in 40 PcMYB10 promoter containing or not the Md MYB10-pro red flesh varieties (lanes 1-6) and was absent in white-fleshed moter R6 repeats. Activity is expressed as a ratio of the varieties (lanes 7-10), and a 392 bp allele present in both types Luciferase (LUC) to the CaMV35s-Renilla (REN) activities. of fruit. Red-fleshed varieties: 1: open-pollinated (OP) Malus Error bars represent the standard error (SE) for 4 replicates. Mildew Immune Seedling 93.051 G01-048; 2. M.xpur All the promoter sequences were fused to the luciferase purea Aldenhamensis; 3. M. pumila var. niedzwetzkyana, 4: 45 reporter and are abbreviated as follows: DFR, Arabidopsis M. Prairifire: 5: OP M. pumila var. niedzwetzkyana DFR promoter. Md10s, Md MYB10 R1 promoter. Md10R6, Geneva; 6: OP M.xdomestica Pomme Grise 92.103 Md MYB10 R6 promoter; Pc10S, PcMYB10R1 promoter 30-312; 7: M.xdomestica ‘Granny Smith, 8: M.xdomestica and Pc10R6, PcMYB10R6 promoter. The transcription factor 'Royal Gala, 9: M.xdomestica Fuji; 10: M.xdomestica constructs are all driven by the CaMV35S promoter and areas Braeburn. 50 follows: Md M10, Md MYB10: PcM10, PcMYB10; b33, FIG. 6 shows the native apple promoter containing the MdbHLH33 and b2, Arabidopsis thaliana bHLH2. minisatellite induces ectopic anthocyanin accumulation. (a) FIGS. 12-1, 12-2 and 12-3 shows an alignment between the Shading shows that red colouration has developed around the sequences of the MYB10 promoters from white-fleshed apple infiltration site in the leaves of Nicotiana tabacum 8 days after and pear (SEQID NO:43 and SEQID NO:13, respectively) transient transformation with R:Md MYB10 (i) and 35S: 55 and highlights with, underlining, the conserved 23 bp repeat Md MYB10 (ii) but not with R. All three were co-infiltrated motif. with 35S:MdbHLH3. (b) Regenerating Royal Gala apple cal FIG. 13 shows that other MYB10 sequences can transac lus transformed with R:MdMYB10. R-native promoter tivate the R6:Md MYB10 promoterina Dual Luciferase Tran from Malus domestica Royal Gala. Renative promoter sient Assay in Tobacco. Leaves of N. benthamiana were infil from Malusxpumila var. niedzwetzkyana. 60 trated with pMd MYB10R1-LUC or pMdMYB10R6-LUC FIG. 7 shows the interaction of the native apple promoters promoterfusions on their own or coinfiltrated with 35S:MYB and Md MYB10 in the dual luciferase transient tobacco and bHLH as indicated. Luminescence of LUC and REN was assays. To compare the transactivation activity of the apple measured 3 days later and expressed as a ratio of LUC to promoters to 35S, these were co-infiltrated with the RandR REN. Error bars are the SE for 4 replicate reactions. promoter-luciferase fusions. The results provide a measure 65 FIG. 14 shows a schematic representation of the strategy for the potential activity of the apple promoters and they show for cloning the apple R6 domain into the PcMYB10, AtPAP1 a significant increase in the case of the Re-driven Md MYB10. and VitG2 promoters. The R6 domain was amplified from the US 8,686,125 B2 31 32 Red Field R6:Md MYB10 allele, digested with DraI and The sequence of the MdMYB10 polypeptide is shown in inserted in the PeMYB10, AtPAP1 and VitC2 promoters driv SEQID NO: 6. The polynucleotide sequence (cDNA) encod ing the Luciferase reporter gene at the indicated restriction ing the Md MYB10 polypeptide is shown in SEQID NO: 7. sites. Each blue shaded box represents a 23 bp-single repeat, By comparing the sequences of the promoters from white and each smaller light box represents the relative position of 5 fleshed and red-fleshed apple cultivars the applicants identi the microsatellite region. fied a 23-base pair sequence motif found in both promoters. In FIG. 15 shows that MidMYB10 combined with b H3 the promoter from the white-fleshed cultivar, the motif is transactivates other MYB10 chimeric promoter fusions con present as a single copy (with a 1 bp difference versus the taining copies of the 23 bp repeat count. A. Leaves of N. motif in the promoter from the red-fleshed cultivar). In the benthamiana were coinfiltrated with the MYB promoter 10 promoter from the red-fleshed cultivar the motif is present at fusions from apple, pear and Arabidopsis, either containing a corresponding position, but in addition, the motif is dupli cated in five tandem repeats to form a minisatellite repeat unit. the apple R6 domain or not, and the Md MYB10/bHLH3 The sequence of the repeat motif is shown in SEQID NO: transcription factors. B. Leaves were infiltrated with the pear 1. MYB10 promoter or the AtPAP1 promoter, either containing 15 The sequence of the minisatellite unit comprising five cop or not the R6 domain, and their corresponding MYB/bHLH ies of the repeat motif is shown in SEQID NO: 2. co-factors. Luminescence of LUC and REN was measured 3 FIG. 1 shows the sequence of the promoter from the red days later and expressed as a ratio of LUC to REN. Error bars fleshed variety as shows the position of the repeated motifs. are the SE for 4 replicate reactions. The minisatellite unit precedes a di-nucleotide microsatellite FIG. 16 shows that Md MYB10 together with bHLH3 found in both promoters. transactivates the VitC2 promoters containing the apple R6 The sequence of the microsatellite is shown in SEQID NO: domain in a Dual Luciferase Transient Assay. Leaves of N. 3. benthamiana were coinfiltrated with the VitG2 promoter FIG. 2 shows a schematic representation of promoter from fusions from kiwifruit, either containing the apple R6 domain the white-fleshed cultivar and shows the relative position and or not, and the Md MYB10 transcription factor alone or com 25 structure of the additional minisatellite repeat unit found in bined to bHLH3. In each case the presence of the R6 domain the promoter of the red-fleshed cultivar. Minisatellites, simi is associated to a high level of transactivation of the promoter lar to these, have been shown to have an effect on transcrip fusion. Luminescence of LUC and REN was measured 3 days tional regulation in humans (Kominato et al., (1997). J. Biol. later and expressed as a ratio of LUC to REN. Error bars are Chem. 272,25890, Lew et al., (2000). Proc. Natl. Acad. Sci. the SE for 4 replicate reactions. 30 U.S.A. 97. 12508 and to produce phenotypic alteration in FIG. 17 is a schematic representation of the R6 motif Saccharomyces cerevisiae (Verstrepen et al., (2005) Nat. amplified by CB02 and RE 161 primers. Also shown in boxes Genet. 37,986). is the position of each 23 bp repeat motif R1-R6, and the position of the Dral restriction site. The sequence is also given Example 2 in SEQID NO:44. 35 Demonstration of Regulation of Expression of EXAMPLES Operably Linked Polynucleotide Sequences by the Promoter Polynucleotides of the Invention The invention will now be illustrated with reference to the following non-limiting examples. 40 Dual Luciferase Assay of Transiently Transformed Tobacco Leaves Example 1 The promoter sequences for MdMYB10 from the red fleshed and white-fleshed cultivars (SEQ ID NOs: 4 and 5 Isolation of the Full Length Md MYB10 Promoter respectively) were separately inserted into the cloning site of Polynucleotides from White-Fleshed and 45 pGreen 0800-LUC (Hellens et al., 2005, R. P. Hellens, A. C. Red-Fleshed Apple Cultivars, and Identification of Allan, E. N. Friel E. N. K. Bolitho, K. Grafton, M. D. Temple Additional Elements within the Promoter from the ton, S. Karunairetnam, W. A. Laing, Plant Methods 1:13). In Red-Fleshed Cultivar the same construct, a luciferase gene from Renilla (REN), under the control of a 35S promoter, provided an estimate of Isolation of Genomic DNA 50 the extent of transient expression. Activity is expressed as a Genomic DNA was isolated from the leaves of a white ratio of LUC to REN activity. The promoter-LUC fusion was fleshed apple cultivar (Malus domestica Royal Gala) and used in transient transformation by mixing 100 ul of Agro from the leaves of a red-fleshed apple cultivar (Malusxpumila bacterium strain GV3101 (MP90) transformed with the niedwetzkyana) using a Qiagen DNeasy Plant Mini Kit, reporter cassette with or without another Agrobacterium cul according to the manufacturers instructions (Qiagen, Valen 55 ture (900 ul) transformed with a cassette containing cia, Calif.). MdMYB10 fused to the 35S promoter. Nicotiana tabacum Promoter Isolation Samsun plants were grown until at least 6 leaves were avail A 1.7-1.8Kb region of the upstream regulatory region of able for infiltration with Agrobacterium. A 10 ul loop of the Md MYB10 gene was isolated from the DNA of both the confluent bacterium were resuspended in 10 ml of infiltration white-fleshed and the red-fleshed cultivar by PCR genome 60 media (10 mM MgCl2, 0.5 uMacetosyringone), to an ODoo walking using a GenomeWalkerTM kit (Clontech, Mountain of 0.2, and incubated at room temperature without shaking for View, Calif.), following the manufacturers instructions. 2 h before infiltration. Approximately 150 ul of this Agrobac The isolated promoters were sequenced by standard tech terium mixture was infiltrated at six points into a young leaf of niques. The sequence of the promoter from the red-fleshed N. tabacum and transient expression was analysed 3 days cultivar is shown in SEQ ID NO: 5. The sequence of the 65 after inoculation. Six technical replicates of 3 mm (Oleaf discs promoter from the white-fleshed cultivar is shown in SEQID were excised from each plant using a leaf hole-punch and NO: 8. buffered in Phosphate Buffer Saline (PBS). Plate-based US 8,686,125 B2 33 34 assays were conducted using a Berthold Orion Microplate Genomic DNA samples from several red-fleshed and Luminometer (Berthold Detection Systems, Oak Ridge, white-fleshed apple cultivars listed in the Table 1 below were Tenn., USA) according to the manufacturer's specifications supplied by Charles J Simon and Philip Forsline, Agricultural for the dual luciferase assay, using the Dual Glow assay Research Services USDA. reagents (Promega, Madison, Wis.) for firefly luciferase and 5 Apple genomic DNA from 19 cultivars was amplified Renilla luciferase. Luminescence was calculated using Sim plicity version 4.02 software (Berthold Detection Systems). using a pair of PCR primers located in the MidMYB10 pro The results, as shown in FIG. 4, show that the promoter moter (forward: 5'-GGAGGGGAATGAAGAAGAGG-3'- (R) from the red-fleshed cultivar containing the minisatellite SEQ ID NO: 9; reverse: 5'-TCCACAGAAGCAAACACT repeat unit drives expression of the operably linked sequence GAC-3 SEQID NO: 10). PCR reactions were carried out in encoding luciferase at 7 times the level of expression driven 10 16.5 ul volume containing 1xPCR buffer mix (Invitrogen, by the promoter (R) from the white-fleshed cultivar (from Carlsbad, Calif.), 1.3 mM MgCl, 100 uM of each dNTP, which the minisatellite repeat unit is absent) when the 0.72% formamide, 10uMofeach primer, 0.5U of Platinum(R) MdMYB10 protein is also expressed. This result demon Taq DNA polymerase (Invitrogen) and 2ng of genomic DNA. strates the significance of the extra sequence present in R PCR amplifications were performed in a Hybaid PCR promoter (including additional copies of the repeat motif) 15 Express Thermal Cycler (Thermo Electron Corporation, from the red-fleshed variety. Waltham, Mass.) with conditions as follows: 94°C. for 2 min The results also show that co-expression of the MdMYB10 45 sec followed by 40 cycles at 94° C. for 55 sec, 55° C. for transcription factor results in a 10-fold increase in expression 55 and 72°C. for 1 min 39 sec, and a final elongation at 72° of the luciferase sequence that is operably linked to the pro C. for 10 min. The PCR products obtained were cloned using moter (R) from the red-fleshed cultivar. The effect of the TOPO TA Cloning R kit (Invitrogen). Four clones were Md MYB10 from the white-fleshed cultivar is much Smaller. sequenced for each PCR product. The sequences were This result shows that the promoter polynucleotide of the aligned using Vector NTI (Invitrogen). invention is positively regulated by the MYB transcription Association of the Minisatellite with the Red-Fleshed Pheno factor Md MYB10. type 25 Previously we have shown that Md MYB10 is linked to the Example 3 red flesh and red foliage phenotype in apple (Chagné et al. 2007, BMC Genomics, 8,212). Further, PCR amplification of The Presence of the Minisatellite Unit in the the promoter region from red and white-fleshed varieties con Promoter of the Invention is Consistently Associated sistently showed that the R minisatellite was amplified in all with Red-Flesh in Naturally Occurring Red-Fleshed the red phenotypes (FIG.3). We determined the association of Apple Varieties the repeat motif with the red-fleshed phenotype by sequenc ing the region encompassing the minisatellite motif over 19 Minisatellite Region PCR Amplification and Sequencing diverse apple varieties (11 red and 8 white flesh: Table 1). A The fruit flesh (cortex) of most apple cultivars is white or number of sequence variations were found in the upstream off-white in colour. The skin is usually green or red, the skin 35 region, but only the minisatellite polymorphism is perfectly reddening in response to developmental, hormonal and light associated with the elevated accumulation of anthocyanins signals (Ubi et al., 2006, Plant Sci. 170, 571). There are, that causes red flesh and red foliage. The same region was however, a number of high anthocyanin, red-fleshed apples, PCR-amplified from a further set of 68 white-fleshed apple including Malusxpunila niedzwetzkyana, originating from cultivars and wild accessions taken from two collections of the wild-apple forests of Khazakhstan. 40 Malus species, and in each case the product corresponding to In apple, anthocyanin accumulation is specifically regu the minisatellite motif was absent (data not shown). All the lated by MdMYB10, with Md MYB10 transcript levels white-fleshed versions tested contained only the R version greatly elevated in red-fleshed varieties (Espley et al., 2007, whilst the red-fleshed versions contained both RandR or R Plant J. 49, 414). only. TABLE 1.

Flesh GT SNP Minisatellite ATSNP Accession colour POS 81 motif PoS 448

Maius X domestica Babine * Re G:G R1:R6 A:T Maius X domestica *Okanagan'* Re G:G R1:R6 A:T Maius X domestica Simcoe Re G:G R6R6 T:T Maius X domestica Socan* Re G:T R1:R6 A:T Maius marriorensis Formosa Re G:T R:R6 A:T Maius Sieversii 629319 Re G:G R6R6 T:T Malus sieversii FORM 35 (33-01)* Re G:T R:R6 A:T Maius Sieversii O1P22* Re G:G R6R6 T:T Maius sieversii 3563.q* Re G:G R6R6 T:T Maius Aidenhamii Re T:T R1:R6 A:T Maius X domestica 91.136 B6-77 Re G:T R1:R6 A:T Maius X domestica Close White G:T R:R A:T Maius X domestica Mr Fitch White T:T R1:R1 A:A Maius X domestica Guldborg White G:T R1:R1 A:T Maius X domestica Alkmene White T:T R1:R1 A:A Maius X domestica Red Melba White T:T R1:R1 A:A Maius X domestica Rae Ime White G:G R1:R1 T:T Maius X domestica Lady Williams' White T:T R1:R1 A:A US 8,686,125 B2 35 36 TABLE 1-continued

Flesh GT SNP Minisatellite ATSNP Accession colour POS 81 motif PoS 448 Maius X domestica “Granny Smith White G:T R:R Association test (r) O.185 1 “R” refers to the absence of the minisatellite unit as found in the promoter from the white-fleshed Royal Gala cultivar, “R” refers to the presence of the minisatellite unit as found in the promoter from the red-fleshed Maius X purniia niedwetzkyana cultivar,

Given that the single repeat unit is present in the promoter cants repeated the assay from Example 2, replacing the 35S from the white-fleshed, the presence of additional repeat units promoter with either the R or R promoters. Results indi in the promoter from the red-fleshed cultivar are likely to cated that the high transcript abundance of MdMYB10 driven account for the known increased expression level of 15 by the R promoter enables transactivation of the reporter, MdMY10 and resulting anthocyanin accumulation red particularly when the reporter is fused to R. (FIG. 7). The fleshed apple cultivars. results show a similar level of activity to the 35S promoter. With the R. luciferase fusion, R:MdMYB10 appears to exert Example 4 stronger transactivation than 35S:MdMYB10. The R:Md MYB10 fusion did not influence transactivation to the same Expression of the Md MYB10 Transcription Factor eXtent. Driven by the Promoter of the Invention Results in Anthocyanin Production in Transiently Transformed Example 6 Tobacco 25 The Number of Copies of the 23 bp Repeat Unit Previous studies have shown that when Md MYB10 was Influences Transcription fused to 35S and co-infiltrated into N. tabacum with a 35S driven co-factor bHLH, a high level of anthocyanin pigmen A series of constructs were built, using standard molecular tation could be detected at the infiltration site (Espley et al. biology techniques, to test the effect on transcription of the 2007. The Plant Journal 49, 414-427). The applicants there 30 number of 23 bp repeat units present in the upstream region. fore infiltrated Nicotiana tabacum with Agrobacterium sus These constructs were based on the native promoter pensions of MdMYB10 driven by the R and R promoter sequences but with repeat units ranging from one (R) to six sequences. R is the native promoter from Malus domestica (R) and were fused to the luciferase reporter as above (FIG. Royal Gala. R is the native promoter from Malusxpumila 8a). To test the spatial effect that the presence of the minisat var. niedzwetzkyana. When Re:MdMYB10 was co-infiltrated 35 ellite sequence might exert on other non-identified motifs, a with 35S:MdbHLH3 a similar level of colouration was further construct (R+) was built where the minisatellite achieved as with 35S:Md MYB10 (FIG. 6A). The applicants sequence from R was replaced with non-specific DNA of the were unable to detect anthocyanin accumulation with the same length from a cloning vector (Promega, Madison, Wis., R:Md MYB10 infiltration, with or without 35S:MdbHLH3. USA). The results indicate a correlation between the number To investigate the properties of the R promoter in apple, 40 of repeat units and the activation of the promoter (FIG. 8b). the applicants transformed Royal Gala with MdMYB10 When co-infiltrated with 35S:MdMYB10 there is basal activ cDNA driven by either the R or R promoters. Whilst the R1 ity from both R and R+ and an increasing activation from R promoter is found in Royal Gala Re is not. It has previously to R. There are numerous examples of the relationship been shown that when Royal Gala is transformed with 35S: between the anthocyanin-regulating MYB and bHLH co MdMYB10, red callus is produced which regenerates to pro 45 factors and it has previously been shown the dependency of duce red plants (Espley et al., 2007. The Plant Journal 49, MdMYB10 on a co-factor bHLH in transient assays (Espley 414-427). The applicants observed a similar callus phenotype et al., 2007, The Plant Journal 49, 414-427). In this assay, when Royal Gala is transformed with R:Md MYB10, with activation for both the R and R promoters is enhanced with bright red areas on regenerating callus (FIG. 6B). However, the addition of 35S:MdbHLH3 for all the constructs tested. whilst 35S:MdMYB10 was capable of driving anthocyanin 50 accumulation in the transformed callus in the absence of light, Example 7 we noted that the R:MdMYB10 transformants required light for the induction of pigmentation. No Sustained pigmentation Deletion Analysis of the Promoter of the Invention was seen on regenerating apple callus transformed with Emphasises the Importance of the Minisatellite R:MdMYB10. Similarly, callus transformed with an empty 55 Region, Containing Multiple Copies of the 23 bp vector cassette showed no pigmentation. Repeat Unit, in Enhancing Transcription Example 5 To define the upstream region directly responsible for tran Scriptional enhancement, both versions of the native pro Expression of the Md MYB10 Transcription Factor 60 moter (R and Re) were subjected to various sequence dele Driven by the Promoter of the Invention Can tion treatments (FIG. 9a). The five versions for each native Transactivate Reporter Gene Expression at a Level promoter were fused to luciferase and co-infiltrated into Similar or Higher than CaMV35S Promoter Driven tobacco with 35S:MdMYB10, +/-35S:MdbHLH3. Expression of the Md MYB10 Transcription Factor When the deletion versions of R:LUC were infiltrated 65 with just 35S:Md MYB10, luciferase activity was barely To further investigate the effect of the promoter on detectable and significantly lower than the native non-deleted MdMYB10 transcript and predicted protein levels, the appli version (FIG.9b). Only when 35S:MdbHLH3 was co-infil US 8,686,125 B2 37 38 trated with 35S:MdMYB10 did luminescence rise above 5'-ACCCTGAACACGTGGGAACCG-3' (SEQ ID NO: 24) background. Although there is a putative bHLH binding and 5'-GCTAAGCTTAGCTGCTAGCAGATAAGAG-3' domain at the 5' end of the isolated promoter region, when this (SEQID NO: 25) and cloned into the multi-cloning region of was deleted (RAa) there was still a significant increase in pGreen 0800-LUC. R. and R promoter fragments were LUC:REN ratio with co-infiltration of the bHLH, suggesting 5 cloned in as native promoter sequences whilst changes to the that there may be an alternative site for bHLH binding. The repeat frequency for the R. R. and Ra promoter fragments R:LUC deletions were less affected than R with activity were synthesised (Geneart AG, Regensburg, Germany) and halved for RAa and RAb and a lesser reduction with RAc. cloned into R using the restriction enzymes Spel and Dra. With the restoration of the putative bHLH binding domain on An inverse PCR approach was used for the R+ construct with both RAc and RAc, there is an increase in activity when 10 35S:MdbHLH3 is co-infiltrated. the inclusion of unique restriction sites (BamHI and SacI) for In this assay, the Re:LUC promoters appeared to show a the cloning of non-specific DNA (from pCEMT Easy, lesser dependence on the bFILH for increased activity Promega, Madison, Wis., USA) using the primers 5'- although this may be due to saturation or depletion of one or GGATCCTTCTGCACGACAACATTGACAA-3' (SEQ ID NO: 26) and 5'- other of the co-infiltrated transcription factors. For both R. Ad 15 and RAdithere was barely detectable activity, with or without GAGCTCATGTTAGCTTTTCTATATATCGA-3' (SEQ ID the bHLH, confirming the requirement of the 3' region for NO: 27). The pSAK construct for 35S:Md MYB10 and 35S: transactivation. The data Suggests that the R promoter can MdbHLH3 was as previously described (Espley et al., 2007, still activate luciferase transcription in truncated form (500 The Plant Journal 49, 414-427) whilst the promoter bp) whereas the corresponding version of R (RAb) cannot. sequences were substituted for the R and R:MdMYB10 Experimental Procedures versions. All constructs were verified by DNA sequencing. Isolation of Md MYB10 Upstream Promoter Region Transactivation Analysis Using Transformed Tobacco Leaves For isolation of the upstream promoter region, genomic The promoter sequences for Md MYB10 were inserted into DNA was extracted from Malusxdomestica Sciros (Pacific the cloning site of pGreen 0800-LUC (Hellens et al., 2005, RoseTM, derived from a cross between Gala and Splen 25 Plant Methods 1, 13). In the same construct, a luciferase gene dour). Nested primers were designed to the coding region of from Renilla (REN), under the control of a 35S promoter, Md MYB10; primary 5'-CACTTTCCCTCTCCATGAATCT provided an estimate of the extent of transient expression. CAAC-3 (SEQ ID NO: 18), and secondary 5'-CAG Activity is expressed as a ratio of LUC to REN activity. The GTTTTCGTTATATCCCTCCATCTC-3 (SEQIDNO:19). A promoter-LUC fusions were used in transient transformation 1.7 Kb region of upstream DNA, immediately adjacent to the 30 by mixing 100 ul of Agrobacterium strain GV3101 (MP90) transcription start site was isolated from the genomic DNA by transformed with the reporter cassette with or without another PCR genome walking using a GenomeWalkerTM kit (Clon Agrobacterium culture(s) (900 ul)transformed with a cassette tech, Mountain View, Calif., USA), following the manufac containing MYB10 fused to the 35S, R1 or R6 promoters and turers instructions. Genomic DNA was subsequently isolated MdbHLH3 fused to the 35S promoter. Nicotiana tabacum from MalusXdomestica Granny Smith, MalusXdomestica 35 Samsun plants were grown until at least 6 leaves were avail Royal Gala and Malusxpumila var. niedzwetzkyana using able for infiltration with Agrobacterium. A 10 ul loop of forward and reverse primers 5'-ACCCTGAACACGTGG confluent bacterium were re-suspended in 10 ml of infiltra GAACCG-3 (SEQID NO: 20) and 5'-GCTAAGCTTAGCT tion media (10 mM MgCl2, 0.5 LM acetosyringone), to an GCTAGCAGATAAGAG-3 (SEQ ID NO: 21) respectively. OD' of 0.2, and incubated at room temperature without The PCR products were cloned using the TOPO TA Clon 40 shaking for 2 h before infiltration. Approximately 150 ul of ingR) kit (Invitrogen, Carlsbad, Calif., USA) and the this Agrobacterium mixture was infiltrated at six points into a sequences aligned using Vector NTI (Invitrogen). young leaf of N. tabacum. Transient expression was analysed Minisatellite Region PCR Amplification and Sequencing three days after inoculation. Six technical replicates of 3 mm Apple genomic DNA from 19 cultivars was amplified Ø leaf discs were excised from each plant using a leafhole using a pair of PCR primers located in the MYB10 promoter 45 punch and buffered in Phosphate Buffer Saline (PBS). Plate (forward: 5'-GGAGGGGAATGAAGAAGAGG-3 SEQ ID based assays were conducted using a Berthold Orion Micro NO: 22); reverse: 5'-TCCACAGAAGCAAACACTGAC-3' plate Luminometer (Berthold Detection Systems, Oak Ridge, SEQID NO:23). PCR reactions were carried out in 16.5ul Tenn., USA) according to the manufacturer's specifications volume containing 1xPCR buffer mix (Invitrogen), 1.3 mM for the dual luciferase assay, using the Dual Glow assay MgCl, 100 uM of each dNTP, 0.72% formamide, 10 uM of 50 reagents (Promega) for firefly luciferase and renilla each primer, 0.5 U of Platinum Taq DNA polymerase (Invit luciferase. Luminescence was calculated using Simplicity rogen) and 2ng of genomic DNA. PCR amplifications were version 4.02 software (Berthold Detection Systems). performed in a Hybaid PCR Express Thermal Cycler Induction of Anthocyanin Pigmentation in Tobacco (Thermo Electron Corporation, Waltham, Mass., USA) with N. tabacum were grown as previously mentioned and conditions as follows: 94°C. for 2 min 45 sec followed by 40 55 maintained in the glasshouse for the duration of the experi cycles at 94° C. for 55 sec, 55° C. for 55 sec and 72° C. for 1 ment. Agrobacterium cultures were incubated as for the dual min 39 sec, and a final elongation at 72°C. for 10 min. The luciferase assay and separate strains containing the PCR products obtained were cloned using the TOPO TA MdMYB10 gene fused to either the 35S, R, or R promoter Cloning R kit (Invitrogen). Four clones were sequenced for sequences and the MdbHLH3 gene fused to the 35S promoter each PCR product. The sequences were aligned using Vector 60 were mixed (500 ul each) and infiltrated into the abaxial leaf NTI (Invitrogen). surface. Six separate infiltrations were performed into N. Plasmid Construction tabacum leaves (two plants per treatment) and changes in Luciferase reporter constructs were derivatives of pCreen colour were observed over an eight day period. To control for 0800-LUC (Hellens et al. 2005, Plant Methods 1, 13) in leaf-to-leaf variability, at least 2 leaves were infiltrated, and which the promoter sequence for the native MidMYB10 pro 65 each leaf included positive (Agrobacterium cultures contain moter or the deletion fragments were inserted. Native pro ing 33S:MdMYB10+35S:MdbHLH3) and negative (Agro moter sequences were PCR amplified using the primers bacterium with empty vector) controls. US 8,686,125 B2 39 40 Transformation of Apple The high degree of conservation between these three The binary vector pSAK277 containing the Md MYB10 sequences, and their conserved position within the promoters, cDNA driven by the R or R promoters was transferred into from three different sources, strongly suggest that each of the Agrobacterium tumefaciens strain GV3101 by the freeze three sequences perform the same function. thaw method. Transgenic Malus domestica Royal Gala plants were generated by Agrobacterium-mediated transfor Example 9 mation of leaf pieces, using a method previously reported (Yao et al. 1995, Plant Cell Reports, 14, 407-412). Production of a Chimeric Promoter with Altered Activity by Insertion of Copies of a Repeated Motif Example 8 10 from the Md MYB10 Promoter from Red-Fleshed Apple into the PcMYB10 Promoter from Pear Isolation of the PcMYB10 Promoter from Pear and Identification of a Sequence Motif Analogous to the Introduction Repeat MotifFound in Apple MdMYB10 Promoters MdMYB10 controls the accumulation of anthocyanin in 15 apple. Transient experiments described in the Examples Isolation of the MYB10 Promoter from Pear above have shown that the MYB10 protein is able to auto Genomic DNA was isolated from the leaves of a pear regulate its own promoter leading to a high level of expression cultivar (Pyrus communis Williams Bon Chretien) using a of a Luciferase reporter gene driven by the long version of Qiagen DNeasy Plant Mini Kit, according to the manufactur MdMYB10 promoter (which includes the 6 repeats of a puta ers instructions (Qiagen, Valencia, Calif.). Promoter tive transcription factor binding site), when co-infiltrated sequences were isolated by PCR using the primers RE 158 with bHLH33 transcription factor. The applicants have now (5'-ACCCTGAACACGTGGGAACCG-3', SEQID NO: 28) introduced the 6 repeats into the greenpear MYB10 promoter and RE159 (5'-CTCTTATCTGCTAGCAGCTAAGCT controlling luciferase reporter gene and assessed the reporter TAGC-3', SEQID NO: 29). 25 activity in presence of PcMYB10 and Md MYB10TFs. By comparing the sequences of the MYB10 promoter from Materials and Methods apple (Example 1) and pear, the applicants identified pres The green pear MYB10 promoter (SEQ ID NO: 13) was ence of a 23 bp motif, in the pear promoter, very similar to that cloned in the pGreen0800LUC vector. The R6 region (SEQ found in apple MYB10 proteins. ID NO: 14) of the Md MYB10 promoter was amplified using An alignment of the MYB10 promoter from the white 30 primers CB02F/RE161, digested by Dra1 and cloned in the fleshed apple and from pear, highlighting the 23 bp motif with PcMYB10 promoter at the blunted Bsg1 site (see FIG. 10) to underligning, is shown in FIG. 12. produce the recombinant chimeric promoter of SEQID NO: Both the apple and pear promoters showed some positional 15. conservation with the R1 repeat being at position -220 (from All the constructs (including MdMYB10 genomic, 35S: the ATG site) in apple and position-227 in pear. Similarly, the 35 position of the microsatellite appeared to be conserved with PcMYB10, AtbHLH2 and bHLH33 and the different LUC the microsatelite in apple starting at position -253 and in pear reporter constructs: DFR-LUC, Md MYB10short-LUC, at -259. Md MYB10long-LUC, PcMYB10short-LUC, PcMYB10R6 The applicants identified three versions of the 23 bp ele LUC) were transformed into GV3101 bp electroporation and ment, from white-fleshed apple, red-fleshed apple and pear, 40 used to infiltrate Nicotiana benthaniana leaves as described as summarized in Table 2 below. previously (Hellens at al. 2005, Plant Methods 1, 13). After 5 days, leaf discs were collected and Firefly luciferase (LUC) TABLE 2 and remillia luciferase (REN) activities were measured on a luminometer using the Dual GlowTM reagents (PROMEGA). Comparison of 23 bp motifs from apple and pear, 45 Results highlighting variable positions Apple and pear MYB10 constructs, in presence of SEQ bHLH33 and bHLH2 respectively, strongly activate the DFR, ID NO Sequence Species found in MdMYB10R6 and PcMYB10R6 promoters, and only 1 gttagacitggtagctattaacaa white-fleshed apple, slightly activate MdMYB10R1 and PcMYB10R1 promoters. red-fleshed apple 50 The introduction of the apple R6 repeats in the pear promoter leads to a 6-fold increase in the luciferase activity in presence 11 gttagacitggtagotaataacaa white-fleshed apple of the 35S:PcMYB10 construct and an 8-fold increase in 12 gttagaccggtagctaataacaa pear presence of the MdMYB10 genomic construct.

55 Example 10 Percent identity between the sequences is shown in Table 3 below. The MdMYB10 Promoter Containing 6 Copies of the 23 bp Repeat Unit is Activated by Several R2R3 TABLE 3 Transcription Factor Sequences 60 Percent identity between 23 bp motifs from apple and pear Introduction SEQID NO: 1 SEQID NO: 11 SEQ ID NO: 12 The effect of three MYB10 sequences (from pear Pe MYB10), strawberry FaMYB10 and Arabidopsis PAP1) SEQID NO: 1 100% 96% 91% SEQID NO: 11 100% 96% on two versions of the MdMYB10 promoter, R1 and R6, SEQID NO: 12 100% 65 which contain 1 and 6 repeats of the 23 base pair repeat unit respectively, was measured using the transient transformation assay, described in previous examples, in tobacco. US 8,686,125 B2 41 42 Materials and Methods Materials and Methods R1 and R6 versions of MdMYB10 native promoter are as The Md MYB10 R1 and R6 promoters are as described in described previously (Espley et al., 2009, Plant Cell 21, 168 Example 10.4.6 Kb of PcMYB10 promoter (SEQID NO: 13) 183). The R1 and R6 Md MYB10 promoters fused to the sequence was amplified from William Bon Chretien (WBC) luciferase reporter are as described in Example 2. pear genomic DNA, 1.9 Kb of AtPAP1 (AtMYB75, MdMYB10 and bHLH3 coding sequences have been AT1G56650) promoter sequence (SEQ ID NO: 36) was cloned in the pSAK binary vector as described previously amplified from Arabidospis genomic DNA and cloned in the (Espley et al., 2007, The Plant Journal 49, 414-427). The pGreen 0800-LUC vector (Hellens et al., 2005, Plant Meth genomic coding sequence of PCMYB10 has been isolated ods 1, 13). The R6 domain was amplified from the Red Field from WBC pear genomic DNA and cloned in the pGreen II 10 R6:MdMYB10 native promoter described previously (Espley 0029 62-SK vector under the control of the 35S promoter. AtbHLH2 (EGL3, Atlg63650) coding sequence has been et al., 2009, Plant Cell 21, 168-183), using primers CB02 isolated from Arabidopsis cDNA and cloned in the pHEX 5'-TGCAGAAATGTTAGACTGGTAGCTATTAAC-3' binary vector under the control of the 35S promoter. (SEQ ID NO: 30) and RE161 5'-CCAGTGACGTGCAT FaMYB10 coding sequence (SEQID NO: 33) has been iso 15 GTCTGATATCC-3' (SEQID NO: 31). PCR fragment con lated from Fragaria ananassa (garden Strawberry) cDNA and taining the R6 motif (as shown in FIG. 17) was digested with cloned in the pGreen II 0029 62-SK binary vector under the Dra1, gel purified and blunt-cloned in the PCMYB10 and control of the 35S promoter (Gleave, 1992, Plant Mol Biol 20, AtPAP1 promoters at the BsgI and HindIII sites respectively 1203-1207). Md MYB8 coding sequence has been isolated to produce pPcMYB10R6-LUC and patPAP1R6-LUC con from Malus domestica Royal Gala mature fruit clNA and StructS. cloned in the pART277 binary vector (Gleave, 1992, (Gleave, The sequence of the PcMYB10/R6 chimeric promoter is 1992, Plant Mol Biol 20, 1203-1207). The coding sequences shown in SEQID NO: 15. The sequence of the AtPAP1/R6 for AtPAP1 (Accession No. CAB09230), AtbHLH2 (Acces chimeric promoter is shown in SEQID NO:37. sion No. Q9CAD0) and MdbHLH3 (Accession No. MdMYB10 and bHLH3 coding sequences have been CN934367) were also cloned upstream of the CaMV35 pro 25 cloned in the pSAK binary vector as described previously moter as described for MdMYB10 here and in Example 2. (Espley et al., 2007, The Plant Journal 49, 414-427). The The promoter sequences for MYB10 were inserted into the genomic coding sequence of PCMYB10 has been isolated cloning site of pGreen 0800-LUC (Hellens et al., 2005, Plant from WBC pear genomic DNA and cloned in the pGreen II Methods 1, 13) to control the expression of the LUC reporter 0029 62-SK vector under the control of the 35S promoter. gene. In the same construct, a luciferase gene from REN. 30 AtbHLH2 (EGL3, Atlg63650) coding sequence has been under the control of a 35S promoter, provided an estimate of isolated from Arabidopsis cDNA and cloned in the pHEX the extent of transient expression. Activity is expressed as a binary vector under the control of the 35S promoter. ratio of LUC to REN activity. The promoter-LUC fusions Expression of the reporter genes under each promoter con were used in transient transformation of Nicotiana benthami struct in the presence of the transcription factor constructs ana. 0.1 mL of Agrobacterium tumefaciens strain GV3101 35 was tested in the transient assay as described in previous (MP90) transformed with the promoter-LUC cassette, was examples. mixed with 0.45 mL of two other Agrobacterium cultures Results transformed with the 35S:MYB and 35S:bHLH constructs The results are shown in FIG. 15. The results indicate that respectively. Infiltration of N. benthamiana leaf and chemi the presence of the R6 motif in the pear and the Arabidopsis luminescence measurement areas described previously (Esp 40 promoters leads to an increase in luciferase activity when ley et al., 2007, The Plant Journal 49, 414-427). apple MYB10 and bHLH3 are co-infiltrated (FIG.3). Similar Results results were obtained when these promoters are co-infiltrated The results are shown in FIG. 13. The results from the assay with their corresponding MYB10 orthologs (i.e. pear pro indicate that the presence of the R6 motif in the apple MYB10 moter infiltrated with PcMYB10/bHLH2 and Arabidospis promoter leads to a large increase (7 to 12-fold) in luciferase 45 promoter infiltrated with AtPAP1/bHLH2). These results activity in presence of the different MYB10 sequences when show that functional chimeric promoters can be produced by co-infiltrated with bHLH co-factor. No significant increase in combining copies of the 23 bp repeat unit with naturally luciferase activity was measured in presence of the Md MYB8 occurring R2R3 transcription factor (MYB10) promoters. transcription factor (FIG. 13). These results show that the The results also demonstrate autoregulation of the chimeric presence of the R6 motif confers the ability for the 50 promoters by the product encoded by the gene with which the MdMYB10 promoter to be regulated by MdMYB10 and natural promoters are currently associated (i.e. the MYB10 other R2R3MYBs (PcMYB10, FaMYB10 and PAP1). transcription factor). Example 11 Example 12 55 Chimeric Promoters Produced by Combining Copies Production of a Functional Chimeric Promoter by of the 23 bp Repeat Unit and Naturally Occurring Combining Multiple Copies of the 23 bp Repeat Unit MYB10 Promoters with an Unrelated Naturally Occurring Promoter, and Demonstration of Regulation of the Chimeric Introduction 60 Promoter by R2R3MYB Transcription Factors To demonstrate production of functional chimeric promot ers in the invention, the R6 domain from the apple MYB10 Introduction promoter was introduced in the pear MYB10 (see SEQ ID The apple R6 motif was introduced into the promoter NO: 13) and Arabidopsis PAP1 (see SEQ ID NO:36) pro region of the VitC2 gene of A. eriantha 221 bp upstream of the moters, 275 bp and 489 bp upstream of the ATG respectively 65 5'UTR (694 bp upstream of the ATG) (FIG. 14) and the (FIG. 15), and these constructs were assayed by the transient construct was assayed as described in previous examples, in luminescent assay in tobacco. tobacco. VitC2 is a GDP-L-galactose guanyltransferase US 8,686,125 B2 43 44 found to be a rate limiting step in ascorbic acid biosynthesis MdMYB10 and bHLH3 coding sequences have been cloned (Bulley et al., 2009, J Exp Bot 60, 765-778). in the pSAK binary vector as described previously (Espley et Materials and Methods al., 2007, The Plant Journal 49, 414-427). 2.1 Kb of VitC2 promoter sequence (SEQID NO:38) was Expression of the reporter genes under each promoter con amplified from Actinidia eriantha genomic DNA (Laing et struct in the presence of the transcription factor constructs al., 2007, Proc Natl Acad Sci USA 104, 9534-9539), and was tested in the transient assay as described in previous cloned in the pGreen 0800-LUC vector (Hellens et al., 2005, examples. Plant Methods 1, 13). The R6 domain (SEQ ID NO: 14) was Results amplified from the Red Field R6:MdMYB10 native pro The results are shown in FIG. 16. The results indicate that moter described previously (Espley et al., 2009, Plant Cell 21, 10 the presence of the R6 motif in the VitC2 promoter leads to a 168-183), using primers CB02 5'-TGCAGAAATGTTA significant increase in luciferase activity (up to 10-fold) when GACTGGTAGCTATTAAC-3' (SEQID NO:30) and RE161 MdMYB10 and bHLH3 are co-infiltrated (FIG.16). Interest 5'-CCAGTGACGTGCATGTCTGATATCC-3' (SEQID NO: ingly, a higher number of repeats (R12) further increases the 31). PCR fragment containing the R6 motif (as shown in FIG. 15 levelofactivation by MdMYB10 alone, although this effect is 17) was digested with Dral, gel purified and blunt-cloned into not seen when MidMYB10 and b H3 are co-infiltrated. the VitG2 promoters at the HpaI site to produce the The above Examples illustrate practice of the invention. It pVitC2R6-LUC construct. Two tandem insertions of the R6 will be appreciated by those skilled in the art that numerous motifs were cloned in the VitG2 promoter to produce variations and modifications may be made without departing pVitC2R12-LUC. The sequence of the chimeric Vit C/R6 20 from the spirit and scope of the invention. promoter is shown in SEQID NO:39. The sequence of the chimeric VitC2/R12 promoter is shown in SEQ ID NO. 40. SUMMARY OF SEQUENCES

SEQ ID NO: Sequence type Information Species 1 polynucleotide 23 bp sequence motif, version 1 Maius domestica and Maius domestica niedwetzkyana 2 polynucleotide minisatellite repeat unit, from Md MYB10 Maius domestica promoter from red-fleshed cultivar Malus x niedwetzkyana domestica niedwetzkyana, including repeat motifs 2,3A, 3B, 4, 5 and 6 3 polynucleotide microsatellite Maius domestica niedwetzkyana 4 polynucleotide region of MdMYB10 promoter from red- Maius domestica fleshed cultivar Maius X domestica niedwetzkyana niedwetzkyana including minisatellite repeat unit, microsatellite and repeat unit 1 5 polynucleotide whole Md MYB10 promoter from red- Maius domestica fleshed cultivar Maius X domestica niedwetzkyana niedwetzkyana 6 polypeptide MMYB10 Maius domestica 7 polynucleotide Md MYB10 coding region Maius domestica 8 polynucleotide whole Md MYB10 promoter from white- Maius domestica fleshed cultivar Malus domestica Royal Gala 9 polynucleotide forward primer artificial 10 polynucleotide reverse primer artifical 11 polynucleotide 23 bp sequence motif, version 2 Maius domestica 12 polynucleotide 23 bp sequence motif, version 3 Pyrus communis 13 polynucleotide whole pear PeMYB10 promoter Pyrus communis 14 polynucleotide apple minisatellite sequence that was Maius domestica inserted into pear (PcMYB10), niedwetzkyana Arabidopsis (PAP1) and kiwifruit (VitC2) broiloters 15 polynucleotide Chimeric apple?pear promoter artificia 16 polypeptide PearPCMYB10 Pyrus communis 17 polynucleotide Pear PCMYB10 coding sequence Pyrus communis 18 polynucleotide Primer artificia 19 polynucleotide Primer artificia 20 polynucleotide Primer artificia 21 polynucleotide Primer artificia 22 polynucleotide Primer artificia 23 polynucleotide Primer artificia 24 polynucleotide Primer artificia 25 polynucleotide Primer artificia 26 polynucleotide Primer artificia 27 polynucleotide Primer artificia 28 polynucleotide Primer artificia 29 polynucleotide Primer artificia 30 polynucleotide Primer artificia 31 polynucleotide Primer artificia 32 polypeptide Strawberry FaMYB10 Fragaria ananassa 33 polynucleotide Strawberry FaMYB10 coding sequence Fragaria ananassa US 8,686,125 B2 45 46 -continued SEQ ID NO: Sequence type Information Species 34 polypeptide Arabidopsis PAP1 Arabidopsis thaliana 35 polynucleotide Arabidopsis PAP1 coding sequence Arabidopsis thaliana 36 polynucleotide Arabidopsis PAP1 promoter Arabidopsis thaliana 37 polynucleotide Chimeric PAP1 R6 promoter artificial 38 polynucleotide Kiwifruit VitC2 promoter Actinidia eriantha 39 polynucleotide Chimeric VitC2 R6 promoter artificial 40 polynucleotide Chimeric VitC2 R6 promoter artificial 41 polynucleotide consensus motif artificial 42 polynucleotide consensus motif artificial

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS: 44

<210s, SEQ ID NO 1 &211s LENGTH: 23 &212s. TYPE: DNA <213s ORGANISM: Malus domestica

<4 OOs, SEQUENCE: 1 gttagactgg tagct attaa Cala 23

<210s, SEQ ID NO 2 &211s LENGTH: 118 &212s. TYPE: DNA <213s ORGANISM: Malus domestica niedwetzkykyana

<4 OOs, SEQUENCE: 2 gttagactgg tagct attaa Caagttagac tittagact ggtagctatt aacaagttag 6 O actgg tagct attaacaact ggtagctatt aacaagttag actgg tagct attaacaa 118

<210s, SEQ ID NO 3 &211s LENGTH: 13 &212s. TYPE: DNA <213s ORGANISM: Malus domestica niedwetzkyana

<4 OOs, SEQUENCE: 3

13

<210s, SEQ ID NO 4 &211s LENGTH: 172 &212s. TYPE: DNA <213s ORGANISM: Malus domestica niedwetzkyana

<4 OOs, SEQUENCE: 4 gttagactgg tagct attaa Caagttagac tittagact ggtagctatt aacaagttag 6 O actgg tagct attaacaact ggtagctatt aacaagttag actggtagot attaacaagt 12 O tagactgttgt gtgttgttgttgt attt cacaag titagactggit agct attaac aa 172

<210s, SEQ ID NO 5 &211s LENGTH: 1795 &212s. TYPE: DNA <213s ORGANISM: Malus domestica niedwetzkyana

<4 OOs, SEQUENCE: 5 taccCtgaac acgtgggaac cggc.ccgttt gta acagact gagataggit C cq9ttctatt 6 O t cittaaaaac cca acaccc.g citacgttcca tttataaacg gigt cqgtctg gtc. cct c caa 12 O

US 8,686,125 B2 49 50 - Continued

85 90 95 Arg Thr Ala Asn Ala Wall Lys Asn Tyr Trp Asn Thir Arg Lieu. Arg Ile 105 11 O

Asp Ser Arg Met Lys Thr Val Lys Asn Llys Ser Glin Glu Met Arg Glu 115 12 O 125 Thr Asn Val Ile Arg Pro Gln Pro Gln Llys Phe Asn Arg Ser Ser Trp 13 O 135 14 O

Tyr Lieu Ser Ser Lys Glu Pro Ile Lieu. Asp His Ile Glin Ser Ala Glu 145 150 155 160

Asp Leu Ser Thr Pro Pro Gln Thr Ser Ser Ser Thir Lys Asn Gly Asn 1.65 17O 17s Asp Trp Trp Glu Thir Lieu. Lieu. Glu Gly Glu Asp Thr Phe Glu Arg Ala 18O 185 19 O

Ala Tyr Pro Ser Ile Glu Lieu. Glu Glu Glu Lieu. Phe Thir Ser Phe Trp 195 2O5 Phe Asp Asp Arg Lieu. Ser Pro Arg Ser Cys Ala Asn Phe Pro Glu Gly 21 O 215 22O His Ser Arg Ser Glu Phe Ser Phe Ser Thr Asp Lieu. Trp Asn His Ser 225 23 O 235 24 O Lys Glu Glu

<210s, SEQ ID NO 7 &211s LENGTH: 729 &212s. TYPE: DNA <213s ORGANISM: Malus domestica

<4 OO > SEQUENCE: 7 atggagggat atalacgaaaa Cctgagtgtg agaaaaggtg Cctggacticg agaggaagac 6 O aatcttctica ggcagtgcgt. tgagatt cat ggagagggaa agtggaacca agttt catac 12 O aaag caggct taalacaggtg Caggaaaagt tgcagacitta gatggttgaa ttatttgaag 18O cCaaat at ca agagaggaga ctittaaagag gatgaagtag atc.ttataat tag actt cac 24 O aggcttittgg gaalacaggtg gtcattgatt gctagaagac titcCaggaag aac agcaaat 3OO gctgttgaaaa attattggaa cacticgattg cggat.cgatt Ctcgcatgala aacggtgaaa 360 aataaatcto aagaaatgag agagaccaat gtgatalagac cticago.ccca aaaattcaac agaagttcat attact taag Cagtaaagaa c caattic tag accatattoa at cagoagaa gatttalagta cqccaccaca t caacaaaga atggaaatga ttggtgggag 54 O accttgttag aaggtgagga tacttittgaa agagctgcat atcc.ca.gcat tagttagag gaagaact ct tca caagttt ttggtttgat gat.cgactgt cgc.caagat C atgcgc.caat 660 titt.cctgaag gaCatagtag aagtgaattic tcc tittagca cgg acctittg gaat cattca 72 O aaagaagaa 729

<210s, SEQ ID NO 8 &211s LENGTH: 1696 &212s. TYPE: DNA <213s ORGANISM: Malus domestica

<4 OOs, SEQUENCE: 8 accctgaaca C9tgggalacc taaccoactg agatagg to c gttctattt 6 O cittaaaaacc caacaccc.gc tatgttctat ttataaacgg gtc.cggtctg gtc.cctic caa 12 O ctittgagc cc ggct cq actt gtgcc cactic Ctaalactaaa. c catataaaa accaagattit 18O c cottt tott cit t t cacaca tat cacgtta CttitcCaa.ca acaattcaac alat Cacaa.ca 24 O US 8,686,125 B2 51 52 - Continued aataatcaac catcaagatc atatat cacg toactaataa agacaac citt cacaagggitt 3OO gtcg tagttc tictactggaa atccaattgt ctago attgt aaccctaagt tacagacaca 360 aacataaact tdagcaact t c tatgcataa gaatctgggg ttittggacta act caacaga 42O acct aacaag aaataatatt Ctggaccgct taacggaatc Caacgaagac alaggttt C9g 48O accact caac ggaacaaata agggaaaggg atataaacca ttcaacgaaa to catctitta 54 O gaatacgcat agt citcc.caa tacggattaa ccaagtgaga acatacgc.ca totgatagog 6OO tggit cocgca agacagataa C caagtagga ccaccgatgg tataatgtga C caagtaagc 660 agtgacccta aatgtagatt aacca catgg agittaaatta acaaggctga accaccitatg 72 O aaaataatgt aag cctgaaa tict taggaga gaatt Cttgc tictaggggac aaatgattitt 78O cg tatgccta agtgtttittt tagtgacagt aaactaagat ttgagtacag agacattaac 84 O tgagattgac tdttgttgaaa gCttagtgag ttgaagcacg taggc caatt at attgagca 9 OO atgtgttagg ttagcgt.ct aaact tcc.gt aggagttittg tacagcaat a tagtgggggt 96.O gcc.gcaaaat gcagacagta gcaataaatt acgggctagg attitt ct colt Ctttittttitt O2O cgttcc attc catccatt co tot cacattt tittattttgt ctittct ctitt ctataaaaaa O8O ttaatataag atgttaatgt aacttgaccg tact attca aataggaggg gaatgaagaa 14 O gagggaaaaa aaggagagaa toc tacticca taaattacaa gcaaacactt tttitttittitt 2OO tittgacaa.gc agaa.gcaaac aaa cacttga aaaag.ca.gcg aaa.gcatgat aaaggitat ct 26 O tatggtggtc. aaagatgtgt gttgtaacta gttacacgat tctgcattca catt cataga 32O atgtgcttitt gaat attata ttacagdtag agaattittat gcc ctdggat tdatttic cct 38O tgtcaatgtt gtcgtgcaga aatgttagct tttctatata t cagtgtgt gtgttgttgttgt 44 O gtattt caca agttagacitg gtagctaata acaactgttg gaatgttitta aacttgtcag SOO tgtttgct tc ttggatat c agacatgcac git cactggcc ttgtaagatt aattaggcc.g 560 atggitatcca tag.cgittaat gttcatggcaa acacacticta attatatata atggtagcta 62O ggtgtctitt C tagtgt at galagtgggta gCaggcaaaa gaatagctaa gCttagctgc 68O tagcagataa gagatg 696

<210s, SEQ ID NO 9 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer

<4 OOs, SEQUENCE: 9 ggaggggaat galagalagagg 2O

<210s, SEQ ID NO 10 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer

<4 OOs, SEQUENCE: 10 tccacagaag caaacactga c 21

<210s, SEQ ID NO 11 &211s LENGTH: 23 212. TYPE : DNA <213> ORGANISM: Malus domestica

US 8,686,125 B2 55 56 - Continued tattt cacaa gttagaccgg tagctaataa caactgttga aatgtttcaa acgtgtcact 18OO gtttgcttct gtggatat ca gacatgcacg tcactggcct tdgaagatta attagt cca 1860 tggitat coat agcgittaacg. t catggcaaa cacactictaa atatatatat atatataatg 1920 gtagct aggt gtc.tttctgg agtatgaagt ggg tagc agg caaaagataa gCtaagttta 198O gctgctagda gatacgagat g 2 OO1

<210s, SEQ ID NO 14 &211s LENGTH: 195 &212s. TYPE: DNA <213> ORGANISM: Malus domestica niedwetzkyana

<4 OOs, SEQUENCE: 14 Ctgcagaaat gttagactgg tagct attaa Caagttagac tigttagact ggtagctatt 6 O aacaagttag actggtagct attaacaact ggtagctatt aacaagttag actggtagct 12 O attaacaagt tag actgtgt gtgtgtgt at titcacaagtt agacitgg tag ct attaacaa 18O ctgttggaat gttitt 195

<210s, SEQ ID NO 15 &211s LENGTH: 2199 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: chimeric promoter

<4 OOs, SEQUENCE: 15 gagttggtgt tagggggag tittgaagat Caacaccago C caattggtg tttgttgttga 6 O agtgtaatct togccttggcc caagatggat cqaac ccatg gacaaagaaa tat coataca 12 O Catgctagaa aattictagoa aagttcaagt ttggalaca gtttagaaga atggtgagga 18O gaaggcatcc acaccatctg. tat caattaa galagact aag tagagtgag aagtaggagt 24 O agticttgttga ggagtgtgag tetctaaag tttgtcticta gaaagagtga gtgtcat agc 3OO ttcaaatagt gtc.tttgaga gtttgttgttgc tataatattt tdtgagttaa tacaagtaat 360 tgtt tacttg togttgtct ct c caac acttg tdttaaagtt gtgtacticta agtttitcc cc 42O aacatatat c actt cactaa taaagacaac ctitcqtaagg gttgcc.gtag ttct c tactt 48O gaaatccaat tat ctago at totaaccota agttacagac acaaacataa acttgagcaa. 54 O cittctatoca taagaatcta gggtttcaga ctaact caat ggaac ctaac aagaaataat 6OO atc.cggaccg Ctalacgatgc atccaatcga agacaaggtt togga cactic alacggaacaa 660 ataagggaaa aggatataaa ccact caacg aagttcatct citagaatacg tatagt ccc.c 72 O aatacggatt aaccaagtga gaa catacac catctaatag catggtcct g caagatagat 78O aact aggtag gaccaccgat ggtataatgt gaccalagtaa gtag taccc taaatgtaga 84 O ttaaccaagt gigagittaa at ttagaatgca tatgcaccct accc.ccc caa gacagactaa 9 OO cCaggcagaa ccatatgcat tcc cc caata gtgtggttcc ttaatgcaga ttgacaaggc 96.O ggalaccacct atgaaaataa ttaactagg tagggc.ccga caat at ct a ttgcctgaaa 1 O2O t cittaggaga gaattcttgc tictaggggac aaatgattitt cqtatgccta agtattttitt 108 O atttagtgac agtaaactaa gatttgagta cagagacatt aactgagatt gacticttgttg 114 O aaagct tagt gagttgaagc act taggcca attatattga gcaatgtgtt aggtgtagcg 12 OO tctaaact tc. c9taggagtt ttt tacaiaca agatagtggg ggtgcc.gcaa aatgcagaca 126 O gtag caataa attacgggct aggattat ct c coct cqttt ttttgttcca titc catc cct 132O US 8,686,125 B2 57 58 - Continued to Ctect caca ttctotattt totctttctt titt Ctaaaaa. aaattaatat aagatgttga tatagottaa ccgggaccgt tdaaataaga ggggaaggaa gaagaggaala aaaaaaagag 44 O aggaaggaag aagaggaaaa aaaaaaaaaa agagagggala gagattittac tittataaatt SOO acaa.gcagac acttitttgtt tttitttttitt tittgacaagg agaa.gcaaac aaa.cacttga 560 aaaagcagcg aaagcaggct aaaggitat ct tatggtggtc aaagatgtgt gttgtaact a gttacacgat tctgcct tca catt cataga atgtgcttitt gaat attata ttacago tag agaatttgat gtc.ttaggaa tttgtcgtg Cagaaatgtc. agcttittctg cagaaatgtt 74 O agactgg tag ctattaacaa gttagactgg ttagactggit agct attaac aagttagact ggtagctatt aacaactggit agct attaac aagttagact ggtagctatt aacaagttag 86 O actgttgttgttg tgttgtatttic acaagttaga Ctggtagcta ttaacaactg ttggaatgtt 92 O ttatatatag cgtgtgtgta titt cacaagt tag accggta gctaataa.ca actgttgaaa 98 O tgtttcaaac gtgtcactgt ttgcttctgt ggat atcaga Catgcacgt.c actggccttg gaagattaat tag to catg gtatic catag cgittaacgt.c atggcaaaca cactictaaat 21OO atatatatat atataatggit agctaggtgt Ctttctggag tatgaagtgg gtagc aggca 216 O aaagataagc taagtttagc tigctagoaga tacgagatg 2199

<210s, SEQ ID NO 16 &211s LENGTH: 244 212. TYPE : PRT <213> ORGANISM: Pyrus communis <4 OOs, SEQUENCE: 16

Met Glu Gly Tyr Asn Wall Asn Lieu. Ser Wall Arg Lys Gly Ala Trp Thr 1. 5 1O 15

Arg Glu Glu Asp Asn Lieu. Lieu. Arg Glin Ile Glu Ile His Gly Glu 2O 25 3O

Gly Trp ASn Glin Val Ser Tyr Ala Gly Lieu. Asn Arg Cys Arg 35 4 O 45

Ser Arg Glin Arg Trp Lieu. Asn Luell Llys Pro Asn. Ile Llys SO 55 6 O

Arg Gly Asp Phe Lys Glu Asp Glu Wall Asp Luell Ile Lieu. Arg Lieu. His 65 70 8O

Arg Luell Luell Gly Asn Arg Trp Ser Luell Ile Ala Arg Arg Lieu Pro Gly 85 90 95

Arg Thir Ala Asn Asp Val Lys Asn Tyr Trp Thir Arg Lieu. Arg Ile 1OO 105 11 O

Asp Ser Arg Met Lys Thr Val Lys Asn Ser Glin Glu Thir Arg Llys 115 12 O 125

Thir Asn Wall Ile Arg Pro Glin Pro Glin Phe Ile Llys Ser Ser Tyr 13 O 135 14 O

Tyr Luell Ser Ser Lys Glu Pro Ile Luell Glu His Ile Glin Ser Ala Glu 145 150 155 160

Asp Luell Ser Thir Pro Pro GLn. Thir Ser Ser Ser Thir Lys Asn Gly Asn 1.65 17O 17s

Asp Trp Trp Glu Thir Leul Phe Glu Gly Glu Asp Thr Phe Glu Arg Ala 18O 185 19 O

Ala Pro Ser Ile Glu Lieu. Glu Glu Glu Luell Phe Thir Ser Phe Trp 195 2OO 2O5

Phe Asp Asp Arg Lieu. Ser Ala Arg Ser Ala Asn. Phe Pro Glu Glu 21 O 215 22O US 8,686,125 B2 59 60 - Continued

Gly Glin Ser Arg Ser Glu Phe Ser Phe Ser Met Asp Leu Trp Asn His 225 23 O 235 24 O Ser Lys Glu Glu

<210s, SEQ ID NO 17 &211s LENGTH: 732 &212s. TYPE: DNA <213> ORGANISM: Pyrus communis <4 OOs, SEQUENCE: 17 atggagggat atalacgittaa Cttgagtgtg agaaaaggtg Cctggacticg agaggaagac 6 O aatcttctica ggcagtgcat tagattcat ggagagggaa agtggalacca agttt catac 12 O aaag caggct taalacaggtg taggalaga.gc tigcagacaaa gatggittaaa citatctgaag 18O cCaaat at ca agagaggaga ctittaaagag gatgaagtag at Cttatact tag actt cac 24 O aggcttittgg gaalacaggtg gt cattgatt gctagaagac titcCaggaag alacagcgaat 3OO gatgtgaaaa attattggta Cact.cgattg C9gat.cgatt citcgcatgaa aacggtgaaa 360 aataaatcto aagaaacgag aaagaccalat gtgataagac cticago.ccca aaaattitat C aaaagttcat attact taag cagtaaagaa ccaattic tag aaCat attca atcagcagaa gatttalagta cqccaccaca aacgt.cgt.cg tdaacaaaga acggaaatga ttggtgggag 54 O accttgttcg aaggcgagga tacttittgaa agggctgcat gtcc.cagcat tgagttagag gaagaact ct tca caagttt ttggitttgat gatcgactgt cggcaagat C atgtgccaat 660 titt cctgaag aaggacaaag tagaagtgaa ttct c ctitta gcatggacct ttggaat cat 72 O tcaaaagaag aa 732

<210s, SEQ ID NO 18 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 18 cactitt coct ct c catgaat citcaac 26

<210s, SEQ ID NO 19 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 19 caggttitt cq ttatat coct c catcto 27

<210s, SEQ ID NO 2 O &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 2O accctgaaca C9tgggalacc g 21

<210s, SEQ ID NO 21 &211s LENGTH: 28 &212s. TYPE: DNA US 8,686,125 B2 61 62 - Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 21 gctaagctta gctgctagda gataagag 28

<210s, SEQ ID NO 22 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthtetic construct: primer <4 OOs, SEQUENCE: 22 ggaggggaat galagalagagg

<210s, SEQ ID NO 23 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 23 tccacagaag caaacactga c 21

<210s, SEQ ID NO 24 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 24 accctgaaca C9tgggalacc g 21

<210s, SEQ ID NO 25 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 25 gctaagctta gctgctagda gataagag 28

<210s, SEQ ID NO 26 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 26 ggat.ccttct gcacgacaac attgacaa 28

<210s, SEQ ID NO 27 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 27 gagct catgt tagcttitt ct atatat cqa 29 US 8,686,125 B2 63 64 - Continued

<210s, SEQ ID NO 28 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 28 accctgaaca C9tgggalacc g 21

<210s, SEQ ID NO 29 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 29 citcttatctg c taggagcta agcttagc 28

<210s, SEQ ID NO 3 O &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 30 cagaaatgtt agactggtag ct attaac 28

<210s, SEQ ID NO 31 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: primer <4 OOs, SEQUENCE: 31

Ccagtgacgt gcatgtctga t at Co 25

<210s, SEQ ID NO 32 &211s LENGTH: 233 212. TYPE: PRT <213> ORGANISM: Fragaria ananassa <4 OOs, SEQUENCE: 32

Met Glu Gly Phe Gly Val Arg Lys Gly Ala Trp Thir Glu Glu Asp 1. 5 1O 15

Glu Lieu. Lieu Lys Glin Phe Ile Glu Ile His Gly Glu Gly Lys Trp His 2O 25 3O

His Val Pro Lieu Lys Ser Gly Lieu. Asn Arg Cys Arg Lys Ser 35 4 O 45

Lieu. Arg Trp Lieu. Asn Tyr Lieu Lys Pro Asn. Ile Lys Arg Gly Glu Phe SO 55 6 O

Ala Glu Asp Glu Val Asp Lieu. Ile Ile Arg Lieu. His Luell Luell Gly 65 70 7s 8O

Asn Arg Trp Ser Lieu. Ile Ala Gly Arg Lieu Pro Gly Thir Ala Asn 85 90 95

Asp Wall Lys Asn Tyr Trp Asn. Thir Tyr Glin Arg Asp Glin 1OO 105 11 O

Thir Ala Ser Tyr Ala Lys Llys Lieu Lys Wall Lys Pro Arg Glu Asn Thir 115 12 O 125 US 8,686,125 B2 65 - Continued Ile Ala Thir Ile Val Arg Pro Arg Pro Arg Thir Phe Ile Lys Arg 13 O 135 14 O

Phe Asn Phe Thr Glu Arg Tyr Ala ASn Ile Glu His Asn His Ser Glu 145 150 155 160

Wall Ser Thir Ser Ser Leu Pro Thr Glu Pro Pro Glin Thir Lieu. Glin 1.65 17O 17s

Lell Glu Asn Val Thr Asp Trp Trp Lys Asp Phe Ser Glu Asp Ser Thr 18O 185 19 O

Glu Ser Ile Asp Arg Thr Met Cys Ser Gly Lieu. Gly Lell Glu Asp His 195

Asp Phe Phe Thr Asn Phe Trp Val Glu Asp Met Lell Lell Ser Ala Ser 21 O 215 22O

Asn Asp Luell Val Asn Ile Ser Tyr Wall 225 23 O

SEQ ID NO 33 LENGTH: 702 TYPE: DNA ORGANISM: Fragaria ananassa

< 4 OOs SEQUENCE: 33 atggagggitt tCggtgttgag aaaaggtgca tggactaaag aggaagatga gctitctgaaa 6 O cagttcatcg aaatcCatgg agaaggcaaa tggcatcatg t to ct cit cala atcaggctta 12 O alacagatgca ggalaga.gctg tag actgagg tggctgaatt atttgaagcc gaat atcaag 18O agaggagagt ttgcagagga tgaagttgat ttgat catca ggctt cataa gct tctagga 24 O alacaggtggit ctittaattgc cggaagattg cCaggaagaa ctgccaatga tgttgaagaac 3OO tattggaata cittatcaaag gaaaaaggat caaaagacgg citt catacgc aaagaaactg 360 aaagttaaac CCC gagaaaa tacaatagct tacacaattg taagacct cq accacga acc ttcatcaaaa. ggttcaatitt tacagagaga tacgcaaata tagagcatala t catt cagaa gtgagttata c tagttctitt accaacagaa ccaccacaga Ctectaca att agaaaatgta 54 O actgattggit ggaaagattt Ctcagaagat agtacagaga gcattgatag aacaatgtgt tctggit cittg gtttagagga t catgactitc ttcacaaact tittgggttga agatatgcta 660 citat cq.gcaa gcaatgat ct agt caa.catc tcc tacgitat ga

<210s, SEQ ID NO 34 &211s LENGTH: 248 212. TYPE : PRT &213s ORGANISM: Arabidopsis thal iana

<4 OOs, SEQUENCE: 34 Met Glu Gly Ser Ser Lys Gly Lieu. Arg Lys Gly Ala Trp Thir Thr Glu 1. 5 1O 15

Glu Asp Ser Lieu. Lieu. Arg Glin Cys Ile Asn Lys Gly Glu Gly Lys 25 3O

Trp His Glin Val Pro Val Arg Ala Gly Lieu. Asn Arg Cys Arg Llys Ser 35 4 O 45

Arg Luell Arg Trp Lieu. Asn Tyr Lieu Lys Pro Ser Ile Arg Gly SO 55 6 O

Lys Luell Ser Ser Asp Glu Val Asp Lieu. Luell Luell Arg Lell His Arg Lieu. 65 70 7s 8O

Lell Gly Asn Arg Trp Ser Lieu. Ile Ala Gly Arg Lell Pro Gly Arg Thr 85 90 95

Ala Asn Asp Val Lys Asn Tyr Trp Asn. Thir His Lell Ser Llys His US 8,686,125 B2 67 68 - Continued

105 11 O

Glu Pro Cys Ile Llys Met Arg Asp Ile Thir Pro Ile 115 12 O 125

Pro Thir Thir Pro Ala Lieu Lys Asn Asn Wall Tyr Lys Pro Arg Pro Arg 13 O 135 14 O

Ser Phe Thir Wall Asn Asn Asp Cys Asn His Luell Asn Ala Pro Pro Llys 145 150 155 160

Wall Asp Wall Asn. Pro Pro Cys Lieu. Gly Luell ASn Ile Asn Asn Val Cys 1.65 17O 17s

Asp Asn Ser Ile Ile Tyr Asn Lys Asp Lys Asp Glin Lieu Wall 18O 185 19 O

Asn Asn Luell Ile Asp Gly Asp Asn Met Trp Luell Glu Lys Phe Lieu. Glu 195

Glu Ser Glin Glu Wall Asp Ile Lieu. Wall Pro Glu Ala Thir Thir Thr Glu 21 O 215 22O

Lys Gly Asp Thir Lieu. Ala Phe Asp Wall Asp Glin Lell Trp Ser Lieu. Phe 225 23 O 235 24 O

Asp Gly Glu Thir Wall Llys Phe Asp 245

SEO ID NO 35 LENGTH: 747 TYPE: DNA ORGANISM: Arabidopsis thaliana

< 4 OOs SEQUENCE: 35 atggagggitt C9tccalaagg gctg.cgaaaa ggtgcttgga Ctactgaaga agatagt ct c 6 O ttgaga cagt gcattaataa gtatggagaa ggcaaatggc accaagttcc tgtaagagct 12 O gggctaalacc ggtgcaggaa aagttgtaga ttalagatggit tgaactattt gaa.gc.calagt 18O atcaagagag gaaaact tag citctgatgaa gtcgatctitc ttcttcgcct t cataggctt 24 O

Ctagggaata ggtggit Cttt aattgctgga agattacctg gtcggaccgc aaatgacgt.c 3OO aagaattact ggalacact catctgagtaag aaacatgaac cgtgttgtaa gataaagatg 360 aaaaagagag acattacgcc cattcctaca acaccggcac taaaaaacaa. tgtttataag cct cqacctic gatcct tcac agittaacaac gactgcaacc atctoraatgc CCCaC Caaaa. gttgacgtta atcctic catg ccttggacitt aaCat Calata atgtttgttga caatagitatic 54 O atatacaa.ca aagataagaa gaaagaccala c tagtgaata atttgattga tggagataat atgtggittag agalaattic ct agaggaaagc Caagagg tag at attittggit t cctgaagcg 660 acgaca acag aaaaggggga caccittggct tittgacgttg atcaactittg gag totttitc 72 O gatggagaga ctgtgaaatt tdattag 747

<210s, SEQ ID NO 36 &211s LENGTH: 1023 &212s. TYPE: DNA <213> ORGANISM: Arabidopsis thaliana <4 OOs, SEQUENCE: 36 atgcttittct tagaaaatga taataaac cq gcqttittata tataagtgtt tottt ttctic 6 O ttctgtc.cag aagtaaatca ttaagaacca atatggctitt tottaalacta atc to cqtga 12 O taat Caaatc. tittgat catt citccacacaa to C catcaac aac at cqatc t cact agatg 18O

CaCCaacaat gattictaatc ggcactacta actatagaga tagttgtc.cc aaaaaaaaaa. 24 O aaaaaaacta actagagaga taaat catat t caatacatg tact atttgtt actataCtta 3OO US 8,686,125 B2 69 70 - Continued agaaaatttg tataccacta t cittaact ct taacactgaa catactatac act at cittaa 360 citcc caactic ttgtaaaaga at atctaatt ttaagaaaag acttcaaatg cittgttaaat 42O ttctagtgaa gatgcacatt ctaaaaactg gtaaaatggit aagaaaaaaa tatataaaaa 48O aatago citta ttaaaattta tat ct colt at ttct citatico aaact acacg gatgaagctt 54 O attgttatt c atccaccctt tttct caatt ctdtcc tatt tottgttgcat gaaacttctic 6OO catc.ttgtaa toggataaat catacccaaa ttttittctitt citgaaaa.cat atataccc.ga 660 acattaatta citat cqtcct ttct cota at tttgttaaga aacatgtttgtttgtttitta 72 O gtactgaaaa aggatggaga tacttgctag atcc tatgaa ccttittct ct c taggacaaa 78O t cagta acca aacaataact tagcaaatta agcacga cag ctaatacata aaatgtggat 84 O atcaaacatg cacgt.c actt cottttitt co gtcacgtgtt tittataaatt ttct cacata 9 OO ct cacact ct ctataaga cc ticcaat catt tdtgaaacca tactatatat accct ct tcc 96.O ttgaccaatt tactitat acc titt tacaatt tdtttatata ttttacgitat citat citttgt 1 O2O t cc 1023

<210s, SEQ ID NO 37 &211s LENGTH: 1227 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: Chimeric promoter

<4 OO > SEQUENCE: 37 atgcttittct tagaaaatga taataaac cq gogttittata aataagtgtt totttittctic 6 O ttctgtc.cag aagtaaatca ttaagaacca atgtggcttt tottaaacta atc to cqtga 12 O taatcaaatc tittgat catt citccacacaa toccatccac aac at catc. tcactagatg 18O caccaacaat gattictaatc ggcactacta actatagaga tagttgtc.cc aaaaaaaaaa 24 O aaaaaaacta act agagaga taaat catat t caatacatg tactatttct act at actta 3OO agaaaatttg tataccacta t cittaact ct taacactgaa catactatac act at cittaa 360 citcc caactic ttgtaaaaga at atctaatt ttaagaaaag acttcaaatg cittgttaaat 42O ttctagtgaa gatgcacatt ctaaaaactg gtaaaatggit aagaaaaaaa tatataaaaa 48O aatago citta ttaaaattta tat ct colt at ttct citatico aaact acacg gatgaagctt 54 O gtgcagaaat gttagactgg tagct attaa Caagttagac tigittagact ggtagctatt 6OO aacaagttag actggtagct attaacaact ggtagctatt aacaagttag actggtagct 660 attaacaagt tag actgtgt gtgtgttgttgt attt cacaag titagactggit agct attaac 72 O aactgttgga atgttittago ttattgtt at t catccaccc tttitt ct caa ttctgtc.cta 78O tittcttgtgc atgaaactitc. tccatcttgt aatcggataa at cataccca aattittitt ct 84 O ttctgaaaac atatat acco gaa cattaat tact atcgtc ctittct c cta attttgttaa 9 OO gaaacatgtt tttggittitt tag tactgaa aaaggatgga gat acttgct agatcct atg 96.O aaccttitt ct citctaggaca aat cagtaac caaacaataa cittagcaaat taa.gcacgac 1 O2O agctaataca taaaatgtgg at atcaaaca tdcacgt cac titcct tttitt cogt cacgtg 108 O tttittataaa ttittct caca tact cacact citctataaga cct coaatca tttgtc.cgaa 114 O accatact at atataccctic titcCttgacc aattt actta tacct tttac aatttgttta 12 OO tatattittac gitatictat ct ttgttcc 1227 US 8,686,125 B2 71 72 - Continued <210s, SEQ ID NO 38 &211s LENGTH: 213 O &212s. TYPE: DNA <213> ORGANISM: Actinidia eriantha 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (556) ... (556) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1261) . . (1261 <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1750) . . (1750 <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1754) . . (1755 <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 38 atcc caaaat atttgttcac ttagaaaatt aactgataaa ataatgcaaa citctic cttitt 6 O tgttct cotc ttittgaattig acgtgacaca tttat cittitt taattittaga taattitcgaa 12 O ttattgaaaa aaaattaaac tdttitt.ccaa ataataattt tittagaaata atgcaaataa 18O tagttttitta aactattitt c caaat attitt ttittcaaaaa taatgcatta ttaagaataa 24 O tattaaaaaa tat cittcaaa tattaaaaaa tatatttittgataaaattta ataatatata 3OO aaaataaatgaatgtttittg tttgcatalaa caatttctaa taaaatattt togcgaaaatg 360 ttitttgtttg cataaacaat ttctaataaa at attittgcg aaaatgttitt togttcgcata 42O aacaatttct gataaaattt tttgcaaaac taalacctaac acaaatgggit agcatttittg 48O cittctittaaa atcttggatt coctaaatta gacaaataaa ttgggacgga t caacattta 54 O ttitt cittctt aattWnttitc. tctaacacta caacaaaata attaaataga taagaaaaga 6OO gaaaaaggaa cittgagaacc cacccaactt ttaaacattg cagttgggtc. citt cogtacg 660 ttgcagtggit cct coacaac gtc. cacatga accacatggg C9tggittaat acaacgcacc 72 O c cact citctic tict citct citc. tct ct citcga taattgtct c cattcgcagt aaaattacca 78O aggccact cq t cocacagtg cacaccacgg ccgatccaca gcc acactica ccaat cacct 84 O citct ct ct ct citct ct ct ct agaatttatt tdttgct citt ggagcaa.cac git cactttitt 9 OO gacacgtggt gigt cqgatcc aat catct ca cqc catccaa gcact cagtt to atgtgttt 96.O gccacgtcac cacaacaatt ccaccacaaa cccaggtaaa cacaagacta acagaacctic O2O actic cqttaa togc catctitc ctdtcgctga citcgcatgaa ataccaccac ttittggaaac O8O caaacgc.cag aaaagattac tot caccalat attct citatgaacaaagaaa ttgggittatt 14 O attt attatt tacaagaaat aaatggcacc aaccalaattit aaaaagacgt citctgcagog 2OO attitt cacct cattt tattt tttgagcttt taggtgtct c gtc.cgaalacc gacgcct tct 26 O nt attatgca atttitt cact cittctittgcc ttct cagtcc cqaaatgact attitt caggc 32O alacat catag ggtgattggg ttgtttagct atgtagg tac gaaatctaala aatttgaatt 38O tgtaaagttt atgaat attt catcgcatcg agtactggcg gaatgttcac ggggittaa.ca 44 O ggatttgaac tocqtt attt Ctttcttgag taaacggacg tdgctgaata cacggacaac SOO Caattaaatg gtgtatgata titt.cgtgtgg agcaccacgc gtagaaagtg aggtgttgcg 560 t caagagcat caaataattt citcct citctic tict ct coctor ttct citat ct atatat cocc 62O caatctggcc tict cot cacc ticacc cccaa agt ct acaca gaatcaa.ccc titcatct coc 68O gcataggcct cocaaaccca cct cittct col acaatccaga cacacct cqa gtgg.ccggag 74 O US 8,686,125 B2 73 74 - Continued tittagagagn againing agag agagattitt C tott.cgatc ggggggtaala acccggtgtt 18OO tgacaagttg tag acat cac ggctataatc ggagtttctic ggcc.gct cat a catgtc.cgg 1860 tctgtacgac gcaagggttgttagt cag agcaa.ccctt cqc.cgcacgg C9gacgtggc 1920 gccttgc.cgt. C Caaggcgg tagcc cct Co gacct cotct tcc togc.cgg C9gcggt cac 198O titcgctitt ct c cqtctact a gct tattagg tittattotta cittagtgagt aatticgt.cct 2O4. O attatagttc gtaagttcat caaagatctg ttacttgatt cqt ctitt cqt togct coagtic 21OO ttggtgttitt ttgcgttittctgagttcgag 213 O

<210s, SEQ ID NO 39 &211s LENGTH: 232O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: Chimeric promoter 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (556) ... (556) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1261) . . (1261 <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1937) . . (1937) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1941) . . (1942) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1941) . . (1942) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 39 atcc caaaat atttgttcac ttagaaaatt aactgataaa ataatgcaaa citctic cttitt 6 O tgttct cotc ttittgaattig acgtgacaca tttat cittitt taattittaga taattitcgaa 12 O ttattgaaaa aaaattaaac tdttitt.ccaa ataataattt tittagaaata atgcaaataa 18O tagttttitta aactattitt c caaat attitt ttittcaaaaa taatgcatta ttaagaataa 24 O tattaaaaaa tat cittcaaa tattaaaaaa tatatttittgataaaattta ataatatata 3OO aaaataaatgaatgtttittg tttgcatalaa caatttctaa taaaatattt togcgaaaatg 360 ttitttgtttg cataaacaat ttctaataaa at attittgcg aaaatgttitt togttcgcata 42O aacaatttct gataaaattt tttgcaaaac taalacctaac acaaatgggit agcatttittg 48O cittctittaaa atcttggatt coctaaatta gacaaataaa ttgggacgga t caacattta 54 O ttitt cittctt aattWnttitc. tctaacacta caacaaaata attaaataga taagaaaaga 6OO gaaaaaggaa cittgagaacc cacccaactt ttaaacattg cagttgggtc. citt cogtacg 660 ttgcagtggit cct coacaac gtc. cacatga accacatggg C9tggittaat acaacgcacc 72 O c cact citctic tict citct citc. tct ct citcga taattgtct c cattcgcagt aaaattacca 78O aggccact cq t cocacagtg cacaccacgg ccgatccaca gcc acactica ccaat cacct 84 O citct ct ct ct citct ct ct ct agaatttatt tdttgct citt ggagcaa.cac git cactttitt 9 OO gacacgtggt gigt cqgatcc aat catct ca cqc catccaa gcact cagtt to atgtgttt 96.O gccacgtcac cacaacaatt ccaccacaaa cccaggtaaa cacaagacta acagaacctic 1 O2O actic cqttaa togc catctitc ctdtcgctga citcgcatgaa ataccaccac ttittggaaac 108 O US 8,686,125 B2 75 76 - Continued caaacgc.cag aaaagattac t ct caccaat attctictato aacaaagaaa ttgggittatt 14 O attt attatt tacaagaaat aaatggcacc aaccalaattit aaaaagacgt. Ctctgcagcg 2OO attt to acct cattt tattit tittgagcttt taggtgtctic gtc.cgaalacc gacgc ctitct 26 O nt attatgca atttitt cact cittctittgcc ttctoagtcc cgaaatgact attitt caggc 32O alacat catag ggtgattggg ttgtttagct atgtagg tac gaaatctaaa aatttgaatt tgtaaagttt atgaat attt catcgcatcg agtactggcg gaatgttcac ggggtaatgt 44 O tagactggta gct attaa.ca agittagactg gttagactgg tagat attaa Caagttagac SOO tggtagct at taacaactgg tagct attaa caagttagac tgg tagctat taacaagtta 560 gactgtgtgt gtgtgt attt Cacaagttag actgg tagct attaacaact gttggaatgt tittaac agga tittgaactico gttatttctt tottgagtaa acggacgtgg ctgaatacac ggacalaccaa ttaaatggtg tatgatattt C9tgtggagc accacgc.gta gaaagtgagg 74 O tgttgcgt.ca agagcatcaa atta atttgtc. citctgttct ct ctic cotct to totatotata tatic cc ccaa totggcct ct cct cacct ca ccc.ccaaagt ctacacagaa toaac cott C 86 O atct cocqca taggcct c co aaa.cccacct Cttct CCaCa atccagacac accticagtg 92 O gccggagttt agagagnaga ning agagaga gattittctgc titcgatcggg ggg taaalacc 98 O cggtgtttga Caagttgtag acat cacggc tataatcgga gtttcticggc cgct cataca tgtc.cggit ct gtacgacgca agggttgttgt agt cagagc aac cctt cqc cgcacggcgg 21OO

aaggcggtag C ccct Cogac citcotct tcc. tCg.ccggcgg 216 O cggit cactitc gctttctic cq tctactagot tattaggittt att cit tact t agtgagtaat 222 O tcqtcc tatt at agttcgta agttcatcaa agatctgtta cittgatt cqt ctitt cqttgc 228O tcqagt cittg gtgttttittg cgttittctga gttcgagatg 232O

<210s, SEQ ID NO 4 O &211s LENGTH: 2510 &212s. TYPE: DNA <213> ORGANISM: Artif icial Sequence 22 Os. FEATURE: 223 OTHER INFORMAT ON: Synthetic construct: Chimeric promoter 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (556) ... (556) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (126 ) . . (1261) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (21.30 ) . . (21.30) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2134 ) ... (2135) 223 OTHER INFORMAT ON: n is a, c, g, or t <4 OOs, SEQUENCE: 4 O atcc caaaat atttgttcac ttagaaaatt aactgataaa ataatgcaaa citct cottitt 6 O tgttct cotc ttittgaattg acgtgacaca tttat cittitt taattittaga taattitcgaa 12 O ttattgaaaa aaaattaaac tgtttitccaa ataataattit tittagaaata atgcaaataa 18O tagttttitta aactattitt c Caaat attitt tttitcaaaaa. taatgcatta ttaagaataa 24 O tattaaaaaa tat Cttcaaa. tattaaaaaa tatatttittg ataaaattta ataatatata 3OO aaaataaatgaatgtttittg tittgcataaa caatttctaa taaaatattt tgcgaaaatg 360

US 8,686,125 B2 79 80 - Continued

22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (8) ... (8) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (17) . . (17) <223> OTHER INFORMATION: n is a

<4 OOs, SEQUENCE: 41 gttaga Cingg tagctantaa Caa 23

<210s, SEQ ID NO 42 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: consensus motif 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (8) ... (8) 223 OTHER INFORMATION: n = c or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (17) . . (17) 223 OTHER INFORMATION: W = a or t

<4 OOs, SEQUENCE: 42 gttagacingg tagctawtaa caa 23

<210s, SEQ ID NO 43 &211s LENGTH: 1704 &212s. TYPE: DNA <213> ORGANISM: Malus domestica

<4 OOs, SEQUENCE: 43 atgagct cac cctgaacacg tdggalaccgg cc.cgtttgta accgactgag at aggtocgg 6 O ttct atttct taaaaaccca acaccc.gcta tgttctattt ataaacgggt ccggtctggit 12 O c cct coaact ttgagc.ccgg citcqacttgt gcc cact cot aalactaalacc atataaaaac 18O caagatttico Cittittcttct ttcacacata t cacgttact titcCaacaac aattcaacaa. 24 O t cacaacaaa taatcaiacca totalagat cat atat cacgt.c actaataaag acaac Cttca 3OO

Caagggttgt C9tagttctic tactggaaat c caattgtct agcattgtaa c cctaagtta 360 cagacacaaa cataaactitg agcaacttct atgcatalaga atctggggitt ttggactaac t caacagaac ctaacaagaa ataat attct ggaccgctta acggaatcca acgaaga caa ggtttcggac cact caacgg aacaaataag ggaaagggat ataalaccatt caacgaaatc 54 O catctittaga atacgcatag tot cocaata cggattalacc aagtgagaac atacgc.catc tgatagcgtg gtc.ccgcaag acagatalacc aagtaggacc accgatggta taatgtgacc 660 aagtaa.gcag taccctaaa ttagattaa C Cacatggag ttalaattaac aaggctgaac 72 O caccitatgaa aataatgtaa goctdaaatc ttaggagaga attcttgctic taggggacaa atgattitt cq tatgcc taag tdtttittitta gtgacagtaa actaagattit gagtacagag 84 O acattaactg agattgactic ttgttgaaag.c ttagtgagtt gaagcacgta ggcca attat 9 OO attgagcaat gtgttaggtg tagcgt.ctaa act tcc.gtag gagttttgta cagcaatata 96.O gtgggggtgc cgcaaaatgc agacagtagc aataa attac gggct aggat tttct cotct ttttittitt cq ttccattcca toc attcc to t cacatttitt tattttgttct ttctott tot 108 O ataaaaaatt aatataagat gttaatgtaa Cttgaccgtg act attcaaa. taggagggga 114 O atgaagaaga gggaaaaaaa ggagagaatc Ctact CCata aattacaagc aalacacttitt 12 OO US 8,686,125 B2 81 82 - Continued tttitttittitt togacaa.gcag aagcaaacaa acacttgaaa aag cagogala agcatgataa 26 O aggitat citta tdgtggtcaa agatgtgtgt tdtaactagt tacacgattic togcattcaca 32O tt catagaat gtgcttittga at attatatt acagotagag aattittatgc cctdggattg 38O attt coctitg tdaatgttgt cqtgcagaaa tottagcttt totatatatic gag tdtgtgt 44 O gtgtgtgtgt attt cacaag titagactggit agctaataac aactgttgga atgttittaaa SOO cittgtcagtg tttgcttctg toggatat cag acatgcacgt cactggcctt gtaagattaa 560 ttagg.ccgat gigtatic cata gcgittaatgt catggcaaac acactictaat tatatataat 62O ggtagctagg ttctttctg gagtgtatga agtgggtagc aggcaaaaga at agctaagc 68O ttagctgcta gcagataaga gatg 704

<210s, SEQ ID NO 44 &211s LENGTH: 245 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic construct: amplified sequence.

<4 OOs, SEQUENCE: 44 tgcagaaatgttagactggit agct attaac aagttagact ggittagactg gtagct atta 6 O acaagttaga Ctggtagcta ttaacaactg gtagct atta acaagttaga Ctggtagcta 12 O ttaacaagtt agactgttgtg tdtgtgtgta titt cacaagt tag actggta gct attaa.ca 18O actgttggaa tdttittaaac ttgtcagtgt ttgcttctgt gigatat caga catgcacgt.c 24 O actgg 245

35 The invention claimed is: 8. The method of claim 1 in which the chimeric promoter 1. A method for producing a chimeric promoter polynucle polynucleotide is produced by combining: otide capable of controlling transcription of an operably a) a sequence with at least 90% identity to the sequence of linked polynucleotide in a plant cell or plant, wherein the SEQID NO: 14, and method comprising combining: 40 b) a sequence with at least 90% identity to one of the a) at least one sequence motif consisting of a sequence with sequences of SEQID NO: 13, 36 and 38. at least 90% identity to SEQID NO: 1, 11, or 12, and 9. A chimeric promoter polynucleotide produced by the b) a promoter polynucleotide sequence, method of claim 1. wherein the chimeric promoter polynucleotide is modu 10. A chimeric promoter polynucleotide capable of con lated by a MYB transcription factor and wherein the 45 trolling transcription of an operably linked polynucleotide in Squence of the chimeric promoter polynucleotide is not a plant cell or plant, wherein the chimeric promoter poly a naturally occurring sequence. nucleotide comprises: a) at least one sequence motif consisting of a sequence with 2. The method of claim 1 in which the at least one sequence at least 90% identity to SEQID NO: 1, 11, or 12, and motif ina) consists of a sequence with at least 90% identity to 50 b) a promoter polynucleotide sequence, the sequence of SEQID NO: 1. wherein the chimeric promoter polynucleotide is modu 3. The method of claim 1 in which the at least one sequence lated by a MYB transcription factor and wherein the motif in a) consists of the sequence of SEQID NO:41. sequence of the chimeric promoter polynucleotide is not 4. The method of claim 1 in which the at least one sequence a naturally occurring sequence. motif in a) consists of the sequence of SEQID NO:42. 55 11. The chimeric promoter polynucleotide of claim 10 in 5. The method of claim 1 in which at least two sequence which the at least one sequence motif in a) consists of a motifs in a) are combined with the polynucleotide sequence sequence with at least 90% identity to the sequence of SEQID in b), and in which at least one of the sequence motifs is NO: 1. interrupted by at least one of the other sequence motifs. 60 12. The chimeric promoter polynucleotide of claim 10 in 6. The method of claim 1 in which the polynucleotide in b) which the at least one sequence motif in a) consists of the is a promoter polynucleotide sequence that naturally occurs sequence of SEQID NO:41. in a plant. 13. The chimeric promoter polynucleotide of claim 10 in 7. The method of claim 1 in which the polynucleotide in b) which the at least one sequence motif in a) consists of the is a promoter polynucleotide and comprises a sequence with 65 sequence of SEQID NO:42. at least 90% identity to one of the sequences of SEQ ID 14. The chimeric promoter polynucleotide of claim 10 in NO:13, 36 and 38. which the chimeric promoter polynucleotide comprises at US 8,686,125 B2 83 84 least two of the sequence motifs ina) and in which the at least 24. A genetic construct comprising a chimeric promoter one of the sequence motifs is interrupted by at least one of the polynucleotide of claim 10. other sequence motifs. 25. A host cell transformed with the chimeric promoter 15. The chimeric promoter polynucleotide of claim 10 in polynucleotide of claim 10. which the at least one sequence motif ina) is part of a pro- 5 moter polynucleotide sequence that naturally occurs in a 26. A plant cell or plant transformed with the chimeric plant. promoter polynucleotide of claim 10. 16. The chimeric promoter polynucleotide of claim 10 in 27. A plant cell or plant transformed with a genetic con which the promoter polynucleotide in b) is a promoter poly struct of claim 24. nucleotide sequence that naturally occurs in a plant. 28. The plant cell or plant of claim 26, that is also trans 17. The chimeric promoter polynucleotide of claim 10 in 10 formed with a polynucleotide or genetic construct for which the promoter polynucleotide comprises a sequence expressing a MYB transcription factor that modulates expres with at least 90% identity to one of the sequences of SEQID sion of the chimeric promoter polynucleotide. NO:13, 36 and 38. 29. The plant cell or plant of claim 26, which naturally 18. The chimeric promoter polynucleotide of claim 10 expresses a MYB transcription factor that modulates expres comprising: 15 sion of the chimeric promoter polynucleotide. a) a sequence with at least 90% identity to the sequence of 30. A method for producing a plant cell or plant with SEQID NO:14, and modified expression of at least one polynucleotide, the b) a sequence with at least 90% identity to one of the method comprising transformation of the plant cell or plant sequences of SEQID NO:13, 36 and 38. with the chimeric promoter polynucleotide of claim 10. 19. The chimeric promoter polynucleotide of claim 10 31. The method of claim 30, in which the plant cellor plant comprising a sequence with at least 90% identity to SEQID is also transformed with a polynucleotide or genetic construct NO:15. capable of expressing a MYB transcription factor that modu 20. The chimeric promoter polynucleotide of claim 10, lates expression of the chimeric promoter polynucleotide. 32. The method of claim 30, in which the plant cellor plant wherein the chimeric promoter polynucleotide is positively 25 modulated, or activated, or up-regulated by the MYB tran naturally expresses a MYB transcription factor that modu scription factor. lates expression of the chimeric promoter polynucleotide. 21. The chimeric promoter polynucleotide of claim 10, 33. A plant cell or plant produced by the method of claim wherein the chimeric promoter polynucleotide is capable of 30. controlling transcription of an operably linked polynucle- so 34. A seed, propagule, progeny, part, fruit or harvested otide constitutively in substantially all tissues of a plant. material of the plant of claim 26, wherein said seed, 22. The chimeric promoter polynucleotide of claim 10, propagule, progeny, part, fruit or harvested material com wherein the chimeric promoter polynucleotide is capable of prises said chimeric promoter polynucleotide. controlling transcription of an operably linked polynucle 35. A seed, propagule, progeny, part, fruit or harvested otide in any plant, plant cell, or plant tissue in which the MYB is material of a plant comprising the chimeric promoter poly transcription factor is expressed. nucleotide of claim 11, wherein said seed, propagule, prog 23. The chimeric promoter polynucleotide of claim 10 eny, part, fruit, or harvested material comprises said chimeric comprising a sequence with at least 90% identity to any one of promoter polynucleotide. SEQID NO: 15, 37, 39 and 40. UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION

PATENT NO. : 8,686,125 B2 Page 1 of 1 APPLICATION NO. : 12/992.543 DATED : April 1, 2014 INVENTOR(S) : Espley et al.

It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

On the Title Page:

The first or sole Notice should read --

Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 477 days.

Signed and Sealed this Twenty-ninth Day of September, 2015 74-4-04- 2% 4 Michelle K. Lee Director of the United States Patent and Trademark Office