DOCSLIB.ORG

DNA Repair Pathway Profiling and Microsatellite Instability in Colorectal Cancer Jinshengyu,1, 6 Mary A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DNA Repair Pathway Profiling and Microsatellite Instability in Colorectal Cancer Jinshengyu,1, 6 Mary A Human Cancer Biology DNA Repair Pathway Profiling and Microsatellite Instability in Colorectal Cancer JinshengYu,1, 6 Mary A. Mallon,2 Wanghai Zhang,1, 6 Robert R. Freimuth,1,4 Sharon Marsh,1, 6 Mark A.Watson,4,6 PaulJ. Goodfellow,2,3,6 andHowardL.McLeod1,3,5,6 Abstract Background: The ability to maintain DNA integrity is a critical cellular function. DNA repair is conducted by distinct pathways of genes, many of which are thought to be altered in colorectal cancer. However, there has been little characterization of these pathways in colorectal cancer. Method: By using the TaqMan real-time quantitative PCR, RNA expression profiling of 20 DNA repair pathway genes was done in matched tumor and normal tissues from 52 patients with Dukes’C colorectal cancer. Results: The relative mRNA expression level across the 20 DNA repair pathway genes varied considerably, and the individual variability was also quite large, with an 85.4 median fold change in the tumor tissue genes and a 127.2 median fold change in the normal tissue genes. Tumor- normal differential expression was found in 13 of 20 DNA repair pathway genes (only XPA had a lower RNA level in the tumor samples; the other 12 genes had significantly higher tumor levels, all P < 0.01). Coordinated expression of ERCC6, HMG1, MSH2,andPOLB (RS z 0.60) was observed in the tumor tissues (all P < 0.001). Apoptosis index was not correlated with expression of the 20 DNA repair pathway genes. MLH1 and XRCC1 RNA expression was correlated with microsatellite instability status (P = 0.045 and 0.020, respectively). An inverse correlation was found between tumor MLH1 RNA expression and MLH1 DNA methylation (P =0.003). Conclusion: Our study provides an initial characterization of the DNA repair pathways for understanding the cellular DNA damage/repair system in human colorectal cancer. DNA repair is an important process to maintain the integrity resistance to platinum-based drugs has also been associated of DNA sequence. It seems to contribute to tumorigenesis and with altered expression in base excision repair, NER, or MMR is also a mechanism for tumor resistance to chemotherapy (3, 5–7). (1, 2). Cellular repair of DNA is composed of several distinct In the DNA repair system, the translesional synthetic DNA pathways, which includes reversion repair, base excision repair, polymerases POLB and POLH are paradoxically associated with nucleotide excision repair (NER), mismatch repair (MMR), and DNA damage recognition protein HMG1 (8, 9). HMG1 binds DNA double-strand break repair (1, 3, 4). Of these DNA repair preferentially to the platinated fork-like synthetic DNA and pathways, NER is a multistep process capable of removing a inhibits the translesional synthesis, which is in contrast to the variety of DNA distorting lesions from prokaryotic and function of POLB and POLH. Furthermore, defects in DNA eukaryotic genomes. In eukaryotic cells, the process requires mismatch repair system can result in low resistance/high >30 proteins to perform the different steps (1), i.e., recognition sensitivity of tumor cells to radiation or platinum drug–based of DNA damage, single-strand incisions and excision of the chemotherapy (10, 11), and an active MMR system can also lesion-containing DNA fragment, and DNA repair synthesis/ lead to tumor cell death via the formation of futile cycles of ligation. It has been shown that loss of function of several DNA translesional synthesis past cisplatin-DNA adducts followed repair genes is associated with increasing cancer risk, and the by removal of the newly synthesized DNA (7, 11). The DNA repair pathway is under the regulation of multiple cellular processes, which can be crucial determinants to the fate 1 2 3 4 Authors’ Affiliations: Departments of Medicine, Surgery, Genetics, Pathology of tumor cells exposed to DNA-damaging agents: resistance or & Immunology, and 5Molecular Biology & Pharmacology, Washington University School of Medicine and 6Siteman Cancer Center, Saint Louis, Missouri apoptosis. It has been known that TP53 is a potent mediator Received 3/6/06; revised 5/23/06; accepted 6/15/06. of cellular responses against genotoxic insults and exerts its Grant support: NIH grants U01GM63340 and P30 CA091842. effect on the DNA repair pathway in sequence-specific DNA- The costs of publication of this article were defrayed in part by the payment of page binding mode primarily at the transcriptional level (12–14). charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. In addition to its role in regulating cell cycle arrest and Note: Data from this study are deposited in the Pharmacogenetics Knowledge Base apoptosis, TP53 is also known to be involved in regulating (http://www.PharmGKB.org). DNA repair mechanisms through the induction of P53R2 (14), Requests for reprints: Howard L. McLeod, Washington University School of a ribonucleotide reductase subunit, and may also directly Medicine, 660 South Euclid Avenue-Campus Box 8069, Saint Louis, MO 63110- participate in repair by promoting annealing of ssDNAs and 1093. Phone: 314-747-5183; Fax: 314-362-3764; E-mail: [email protected]. F 2006 American Association for Cancer Research. rejoining double-stranded breaks. Other sensors or regulators doi:10.1158/1078-0432.CCR-06-0547 of the DNA repair pathway, such as ATM, ATR, and RAD9, Clin Cancer Res 2006;12(17) September 1, 2006 5104 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 29, 2021. © 2006 American Association for Cancer Research. DNA Repair in Colon Cancer involved in DNA-damage signaling (15–17), were also carcinomas in which constitutional mutations of MLH1 and included in the present study to determine any potential MSH2 are rarely found (19, 20). MSI is frequently due to MLH1 association between these regulators and tumor cell apoptosis. promoter hypermethylation (21, 22). It has been widely shown In addition, defects in the DNA mismatch repair machinery that loss of MMR protein expression in tumor tissue may can lead to instability of short tandem nucleotide repeats, correlate with MSI (23, 24). Therefore, the association between called microsatellite instability (MSI). MSI is typical of MSI status and gene expression of the DNA repair pathway is hereditary nonpolyposis colorectal cancer that accounts for important to investigate for cellular DNA repair function. 2% to 3% of all colorectal carcinomas (18), but MSI has also Most studies have been conducted to evaluate specific DNA been identified in 10% to 15% of sporadic colorectal repair genes. In this study, we have profiled the RNA expression Table 1. Gene name and primer list for RNA profiling of the DNA repair pathways Gene Description Forward primer 5¶ to 3¶ Reverse primer 5¶ to 3¶ TaqMan probe 5¶ to 3¶ symbol ATM Ataxia telangiectasia mutated GCTGAGGCAGGAGAATCTCTTG TGGAGTGCAATGGCAT GATTT CCCACAGCAACCTTCACCTCCCA ATR Ataxia telangiectasia and CCAGTGAAAGGGCATTCCA GGGTCTTGGCCTTTTCATTG CAACTTCTCCAGTTTC- Rad3 related ATTCAGTGGCGCA DDB1 Damage-specific DNA binding GTGGTGGCAAACCTACAGTATGA TCCGAGTTAGCTCCTCCACAAC AAGCGAGAGGCCACTGCAGACGACC protein 1,127 kDa excision repair cross-complementing ERCC1 Rodent repair deficiency, TACCCCTCGACGAGGATGAG CAGTGGGAAGGCTCTGTGTAGA CCTGGAGTGGCCAAGCCCTTATTCC complementation group 1 excision repair cross-complementing ERCC2 Rodent repair deficiency, TTGGCGTCCCCTACGTCTAC CTGGTCCCGCAGGTATTCC CACAGAGCCGCATTCTCAAGGCG complementation group 2, XPD excision repair cross-complementing ERCC3 Rodent repair deficiency, GGAATTTGGCTCCAGATCCA GATGAGTGGTACTCC- CCAGGCATCTCGGCGCTTTGG complementation group 3, ATGTACACAGTGT XPB excision repair cross-complementing ERCC4 Rodent repair deficiency, TTGTGGATATGCGTGAATTTCG CACGGGTTCAATGTCAATGC TGAGCTTCCATCTCTGATCCATCGTCG complementation group 4, XPF excision repair cross-complementing ERCC5 Rodent repair deficiency, ACTCACCCCTGGCTTTCCTAA GAGTCATCCACCACGGGTTT CCAGCTGTTGCCGAGGCCTACCT complementation group 5, XPG excision repair cross-complementing ERCC6 Rodent repair deficiency, ACAAGTGCAATTTTTGCAG- GCTCCAAAGGCTGGTTGAATC ATCAGATGTTCAGACACCC- complementation GAACT AAATGCCATCTAA group 6,CSB HMG1 High-mobility group TCCTGGCCTGTCCATTGG GCTTGTCATCTGCAGCAGTGTTAT CCACATCTCTCCCAG- (nonhistone chromosomal) TTTCTTCGCAACA protein 1 MLH1 Mut L homologue 1,colon CCATCCGGAAGCAGTACATATCT ATGGAGCCAGGCACTTCACT AGGAGTCGACCCTCTCAGGCCAGC cancer,nonpolyposis type 2 (Escherichia coli) MSH2 Mut S homologue 2,colon TATCAGGTGAAGAAAGGTG- GCACACTCTATTACATGC- AGCAAGCTCTGCAACATGAATCCCAA cancer,nonpolyposis TCTGTGA TTAGGGAAAT type 1 (E. coli) MSH6 Mut S homologue 6 (E. coli) GGTGCTTGTGGATGAATTAGGAA GCAAGTTCTTTAACA- TATTGCCGTCCCATCAAA- ACTGCATTTG TGTTGCAGTA POLB Polymerase (DNA directed), h TACATTGCTACAGTCTGT- TGGGATGGGTCAGGAGAACA CCATGTCACCACTGGAC- GGCAGTT TCTGCACCTCT POLH Polymerase (DNA directed), D GCATTTAGGGAGGCAGTGTCA TTCAAGGCCCTCATTGCAA AACCACGTCTCTTAGA- CTCCAAGGCCCA RAD9 RAD9 homologue A TCTTACATGATCGCCATGGAAA CCAGGTGAAAGGGAAATGGA AGCACCCGCGAGCCCTCATTG (Saccharomyces pombe) TP53 Tumor protein p53 AGACTGGGTCTCGCTTTGTTG AGGCAAAGGCTGCAGTAAGC AAGATCACGCCACTCCACTCCAGCC (Li-Fraumeni syndrome) XPA Xeroderma pigmentosum, TCTGTGATTGCCTTCTTACA- CCTTGGTATCTTGTCCT- TGGGAGCTGAGTGCTAGA- complementation group A ACAGA CAAATTTG GTAGGTGCAGA XPC Xeroderma pigmentosum, GAGAGGCTGAAGCGTCGCTA GAAGAGAGTCCACCTC- AAGAGTGAGGCAGCAG- complementation group C CTGCATCT CTCCCCACA XRCC1 X-ray repair complementing GAACACCAGGAGCCTCCTGAT AAGAAGTGCTTGCCCTGGAA TGCCAGTCCCTGAGCTCCCAGATTT defective repair
Load more

Recommended publications
  • Structure and Function of the Human Recq DNA Helicases
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2005 Structure and function of the human RecQ DNA helicases Garcia, P L Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-34420 Dissertation Published Version Originally published at: Garcia, P L. Structure and function of the human RecQ DNA helicases. 2005, University of Zurich, Faculty of Science. Structure and Function of the Human RecQ DNA Helicases Dissertation zur Erlangung der naturwissenschaftlichen Doktorw¨urde (Dr. sc. nat.) vorgelegt der Mathematisch-naturwissenschaftlichen Fakultat¨ der Universitat¨ Z ¨urich von Patrick L. Garcia aus Unterseen BE Promotionskomitee Prof. Dr. Josef Jiricny (Vorsitz) Prof. Dr. Ulrich H ¨ubscher Dr. Pavel Janscak (Leitung der Dissertation) Z ¨urich, 2005 For my parents ii Summary The RecQ DNA helicases are highly conserved from bacteria to man and are required for the maintenance of genomic stability. All unicellular organisms contain a single RecQ helicase, whereas the number of RecQ homologues in higher organisms can vary. Mu- tations in the genes encoding three of the five human members of the RecQ family give rise to autosomal recessive disorders called Bloom syndrome, Werner syndrome and Rothmund-Thomson syndrome. These diseases manifest commonly with genomic in- stability and a high predisposition to cancer. However, the genetic alterations vary as well as the types of tumours in these syndromes. Furthermore, distinct clinical features are observed, like short stature and immunodeficiency in Bloom syndrome patients or premature ageing in Werner Syndrome patients. Also, the biochemical features of the human RecQ-like DNA helicases are diverse, pointing to different roles in the mainte- nance of genomic stability.
    [Show full text]
  • Paul Modrich Howard Hughes Medical Institute and Department of Biochemistry, Duke University Medical Center, Durham, North Carolina, USA
    Mechanisms in E. coli and Human Mismatch Repair Nobel Lecture, December 8, 2015 by Paul Modrich Howard Hughes Medical Institute and Department of Biochemistry, Duke University Medical Center, Durham, North Carolina, USA. he idea that mismatched base pairs occur in cells and that such lesions trig- T ger their own repair was suggested 50 years ago by Robin Holliday in the context of genetic recombination [1]. Breakage and rejoining of DNA helices was known to occur during this process [2], with precision of rejoining attributed to formation of a heteroduplex joint, a region of helix where the two strands are derived from the diferent recombining partners. Holliday pointed out that if this heteroduplex region should span a genetic diference between the two DNAs, then it will contain one or more mismatched base pairs. He invoked processing of such mismatches to explain the recombination-associated phenomenon of gene conversion [1], noting that “If there are enzymes which can repair points of damage in DNA, it would seem possible that the same enzymes could recognize the abnormality of base pairing, and by exchange reactions rectify this.” Direct evidence that mismatches provoke a repair reaction was provided by bacterial transformation experiments [3–5], and our interest in this efect was prompted by the Escherichia coli (E. coli) work done in Matt Meselson’s lab at Harvard. Using artifcially constructed heteroduplex DNAs containing multiple mismatched base pairs, Wagner and Meselson [6] demonstrated that mismatches elicit a repair reaction upon introduction into the E. coli cell. Tey also showed that closely spaced mismatches, mismatches separated by a 1000 base pairs or so, are usually repaired on the same DNA strand.
    [Show full text]
  • Open Full Page
    CCR PEDIATRIC ONCOLOGY SERIES CCR Pediatric Oncology Series Recommendations for Childhood Cancer Screening and Surveillance in DNA Repair Disorders Michael F. Walsh1, Vivian Y. Chang2, Wendy K. Kohlmann3, Hamish S. Scott4, Christopher Cunniff5, Franck Bourdeaut6, Jan J. Molenaar7, Christopher C. Porter8, John T. Sandlund9, Sharon E. Plon10, Lisa L. Wang10, and Sharon A. Savage11 Abstract DNA repair syndromes are heterogeneous disorders caused by around the world to discuss and develop cancer surveillance pathogenic variants in genes encoding proteins key in DNA guidelines for children with cancer-prone disorders. Herein, replication and/or the cellular response to DNA damage. The we focus on the more common of the rare DNA repair dis- majority of these syndromes are inherited in an autosomal- orders: ataxia telangiectasia, Bloom syndrome, Fanconi ane- recessive manner, but autosomal-dominant and X-linked reces- mia, dyskeratosis congenita, Nijmegen breakage syndrome, sive disorders also exist. The clinical features of patients with DNA Rothmund–Thomson syndrome, and Xeroderma pigmento- repair syndromes are highly varied and dependent on the under- sum. Dedicated syndrome registries and a combination of lying genetic cause. Notably, all patients have elevated risks of basic science and clinical research have led to important in- syndrome-associated cancers, and many of these cancers present sights into the underlying biology of these disorders. Given the in childhood. Although it is clear that the risk of cancer is rarity of these disorders, it is recommended that centralized increased, there are limited data defining the true incidence of centers of excellence be involved directly or through consulta- cancer and almost no evidence-based approaches to cancer tion in caring for patients with heritable DNA repair syn- surveillance in patients with DNA repair disorders.
    [Show full text]
  • Identification of Novel Pathogenic MSH2 Mutation and New DNA Repair Genes Variants: Investigation of a Tunisian Lynch Syndrome F
    Jaballah‑Gabteni et al. J Transl Med (2019) 17:212 https://doi.org/10.1186/s12967‑019‑1961‑9 Journal of Translational Medicine RESEARCH Open Access Identifcation of novel pathogenic MSH2 mutation and new DNA repair genes variants: investigation of a Tunisian Lynch syndrome family with discordant twins Amira Jaballah‑Gabteni1,3* , Haifa Tounsi1,3, Maria Kabbage1,3, Yosr Hamdi3, Sahar Elouej3,4, Ines Ben Ayed1,3, Mouna Medhioub2, Moufda Mahmoudi2, Hamza Dallali3, Hamza Yaiche1,3, Nadia Ben Jemii1,3, Affa Maaloul1, Najla Mezghani1,3, Sonia Abdelhak3, Lamine Hamzaoui2, Mousaddak Azzouz2 and Samir Boubaker1,3 Abstract Background: Lynch syndrome (LS) is a highly penetrant inherited cancer predisposition syndrome, characterized by autosomal dominant inheritance and germline mutations in DNA mismatch repair genes. Despite several genetic variations that have been identifed in various populations, the penetrance is highly variable and the reasons for this have not been fully elucidated. This study investigates whether, besides pathogenic mutations, environment and low penetrance genetic risk factors may result in phenotype modifcation in a Tunisian LS family. Patients and methods: A Tunisian family with strong colorectal cancer (CRC) history that fulfll the Amsterdam I criteria for the diagnosis of Lynch syndrome was proposed for oncogenetic counseling. The index case was a man, diagnosed at the age of 33 years with CRC. He has a monozygotic twin diagnosed at the age of 35 years with crohn disease. Forty‑seven years‑old was the onset age of his paternal uncle withCRC. An immunohistochemical (IHC) labe‑ ling for the four proteins (MLH1, MSH2, MSH6 and PMS2) of the MisMatchRepair (MMR) system was performed for the index case.
    [Show full text]
  • A Dissertation Entitled the Role of Base Excision Repair And
    A Dissertation Entitled The Role of Base Excision Repair and Mismatch Repair Proteins in the Processing of Cisplatin Interstrand Cross-Links. by Akshada Sawant Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biomedical Science Dr. Stephan M. Patrick, Committee Chair Dr. Kandace Williams, Committee Member Dr. William Maltese, Committee Member Dr. Manohar Ratnam, Committee Member Dr. David Giovannucci, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2014 Copyright 2014, Akshada Sawant This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Role of Base Excision Repair and Mismatch Repair Proteins in the Processing of Cisplatin Interstrand Cross-Links By Akshada Sawant Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biomedical Science The University of Toledo August 2014 Cisplatin is a well-known anticancer agent that forms a part of many combination chemotherapeutic treatments used against a variety of human cancers. Despite successful treatment, the development of resistance is the major limitation of the cisplatin based therapy. Base excision repair modulates cisplatin cytotoxicity. Moreover, mismatch repair deficiency gives rise to cisplatin resistance and leads to poor prognosis of the disease. Various models have been proposed to explain this low level of resistance caused due to loss of MMR proteins. In our previous studies, we have shown that BER processing of the cisplatin ICLs is mutagenic. Our studies showed that these mismatches lead to the activation and the recruitment of mismatch repair proteins.
    [Show full text]
  • Fanconi Anemia, Bloom Syndrome and Breast Cancer
    A multiprotein complex in DNA damage response network of Fanconi anemia, Bloom syndrome and Breast cancer Weidong Wang Lab of Genetics, NIA A Multi-protein Complex Connects Two Genomic Instability Diseases: Bloom Syndrome and Fanconi Anemia Bloom Syndrome . Genomic Instability: -sister-chromatid exchange . Cancer predisposition . Mutation in BLM, a RecQ DNA Helicase . BLM participates in: HR-dependent DSB repair Recovery of stalled replication forks . BLM works with Topo IIIa and RMI to Suppress crossover recombination Courtesy of Dr. Ian Hickson A Multi-protein Complex Connects Two Genomic Instability Diseases: Bloom Syndrome and Fanconi Anemia P I l o r t n o BLM IP kDa C HeLa BLAP 250 Nuclear Extract 200- BLM* FANCA* 116- TOPO IIIα* 97- BLAP 100 MLH1* BLM IP BLAP 75 * 66- RPA 70 IgG H 45- * 30- RPA32 IgG L 20- * 12- RPA14 Meetei et al. MCB 2003 A Multi-protein Complex Connects Two Genomic Instability Diseases: Bloom Syndrome and Fanconi Anemia P I A C N A F BLM IP HeLa FANCM= FAAP 250 BLAP 250 Nuclear Extract BLM* BLM* * FANCA* FANCA TOPO IIIα* TOPO IIIα* FAAP 100 BLAP 100 FANCB= FAAP 95 MLH1 FANCA IP BLM IP BLAP 75 BLAP 75 RPA70*/FANCG* RPA 70* FANCC*/FANCE* IgG H FANCL= FAAP 43 FANCF* RPA32* IgG L Meetei et al. MCB 2003 Meetei et al. Nat Genet. 2003, 2004, 2005 BRAFT-a Multisubunit Machine that Maintains Genome Stability and is defective in Fanconi anemia and Bloom syndrome BRAFT Super-complex Fanconi Anemia Bloom Syndrome Core Complex Complex 12 polypeptides 7 polypeptides FANCA BLM Helicase (HJ, fork, D-loop), fork FANCC regression, dHJ dissolution Topo IIIα Topoisomerase, FANCE dHJ dissolution FANCF BLAP75 RMI1 FANCG Stimulates dHJ dissolution.
    [Show full text]
  • DNA Repair with Its Consequences (E.G
    Cell Science at a Glance 515 DNA repair with its consequences (e.g. tolerance and pathways each require a number of apoptosis) as well as direct correction of proteins. By contrast, O-alkylated bases, Oliver Fleck* and Olaf Nielsen* the damage by DNA repair mechanisms, such as O6-methylguanine can be Department of Genetics, Institute of Molecular which may require activation of repaired by the action of a single protein, Biology, University of Copenhagen, Øster checkpoint pathways. There are various O6-methylguanine-DNA Farimagsgade 2A, DK-1353 Copenhagen K, Denmark forms of DNA damage, such as base methyltransferase (MGMT). MGMT *Authors for correspondence (e-mail: modifications, strand breaks, crosslinks removes the alkyl group in a suicide fl[email protected]; [email protected]) and mismatches. There are also reaction by transfer to one of its cysteine numerous DNA repair pathways. Each residues. Photolyases are able to split Journal of Cell Science 117, 515-517 repair pathway is directed to specific Published by The Company of Biologists 2004 covalent bonds of pyrimidine dimers doi:10.1242/jcs.00952 types of damage, and a given type of produced by UV radiation. They bind to damage can be targeted by several a UV lesion in a light-independent Organisms are permanently exposed to pathways. Major DNA repair pathways process, but require light (350-450 nm) endogenous and exogenous agents that are mismatch repair (MMR), nucleotide as an energy source for repair. Another damage DNA. If not repaired, such excision repair (NER), base excision NER-independent pathway that can damage can result in mutations, diseases repair (BER), homologous recombi- remove UV-induced damage, UVER, is and cell death.
    [Show full text]
  • Arsenic Disruption of DNA Damage Responses—Potential Role in Carcinogenesis and Chemotherapy
    Biomolecules 2015, 5, 2184-2193; doi:10.3390/biom5042184 OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Review Arsenic Disruption of DNA Damage Responses—Potential Role in Carcinogenesis and Chemotherapy Clarisse S. Muenyi 1, Mats Ljungman 2 and J. Christopher States 3,* 1 Department of Pharmacology and Toxicology, University of Louisville School of Medicine, Louisville, KY 40292, USA; E-Mail: [email protected] 2 Departments of Radiation Oncology and Environmental Health Sciences, University of Michigan, Ann Arbor, MI 48109-2800, USA; E-Mail: [email protected] 3 Department of Pharmacology and Toxicology, University of Louisville School of Medicine, Louisville, KY 40292, USA * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-502-852-5347; Fax: +1-502-852-3123. Academic Editors: Wolf-Dietrich Heyer, Thomas Helleday and Fumio Hanaoka Received: 14 August 2015 / Accepted: 9 September 2015 / Published: 24 September 2015 Abstract: Arsenic is a Class I human carcinogen and is widespread in the environment. Chronic arsenic exposure causes cancer in skin, lung and bladder, as well as in other organs. Paradoxically, arsenic also is a potent chemotherapeutic against acute promyelocytic leukemia and can potentiate the cytotoxic effects of DNA damaging chemotherapeutics, such as cisplatin, in vitro. Arsenic has long been implicated in DNA repair inhibition, cell cycle disruption, and ubiquitination dysregulation, all negatively impacting the DNA damage response and potentially contributing to both the carcinogenic and chemotherapeutic potential of arsenic. Recent studies have provided mechanistic insights into how arsenic interferes with these processes including disruption of zinc fingers and suppression of gene expression.
    [Show full text]
  • DNA Proofreading and Repair
    DNA proofreading and repair Mechanisms to correct errors during DNA replication and to repair DNA damage over the cell's lifetime. Key points: Cells have a variety of mechanisms to prevent mutations, or permanent changes in DNA sequence. During DNA synthesis, most DNA polymerases "check their work," fixing the majority of mispaired bases in a process called proofreading. Immediately after DNA synthesis, any remaining mispaired bases can be detected and replaced in a process called mismatch repair. If DNA gets damaged, it can be repaired by various mechanisms, including chemical reversal, excision repair, and double-stranded break repair. Introduction What does DNA have to do with cancer? Cancer occurs when cells divide in an uncontrolled way, ignoring normal "stop" signals and producing a tumor. This bad behavior is caused by accumulated mutations, or permanent sequence changes in the cells' DNA. Replication errors and DNA damage are actually happening in the cells of our bodies all the time. In most cases, however, they don’t cause cancer, or even mutations. That’s because they are usually detected and fixed by DNA proofreading and repair mechanisms. Or, if the damage cannot be fixed, the cell will undergo programmed cell death (apoptosis) to avoid passing on the faulty DNA. Mutations happen, and get passed on to daughter cells, only when these mechanisms fail. Cancer, in turn, develops only when multiple mutations in division-related genes accumulate in the same cell. In this article, we’ll take a closer look at the mechanisms used by cells to correct replication errors and fix DNA damage, including: Proofreading, which corrects errors during DNA replication Mismatch repair, which fixes mispaired bases right after DNA replication DNA damage repair pathways, which detect and correct damage throughout the cell cycle Proofreading DNA polymerases are the enzymes that build DNA in cells.
    [Show full text]
  • An ERCC4 Regulatory Variant Predicts Grade‐
    IJC International Journal of Cancer An ERCC4 regulatory variant predicts grade-3 or -4 toxicities in patients with advanced non-small cell lung cancer treated by platinum-based therapy Ruoxin Zhang1, Ming Jia1,2, Yuan Xu1,2, Danwen Qian1,2, Mengyun Wang1, Meiling Zhu3, Menghong Sun1,4, Jianhua Chang1,5 and Qingyi Wei 1,2,6 1 Cancer Institute, Collaborative Innovative Center for Cancer Medicine, Fudan University Shanghai Cancer Center, 270 Dong An Road, Xuhui District, Shanghai, 200032, People’s Republic of China 2 Department of Oncology, Shanghai Medical College, Fudan University Shanghai Cancer Center, 270 Dong An Road, Shanghai, 200032, People’s Republic of China 3 Department of Oncology, Xinhua Hospital affiliated to Shanghai Jiaotong University, No. 1665 Kong Jiang Road, Shanghai, 200092, People’s Republic of China 4 Department of Pathology, Fudan University Shanghai Cancer Center, 270 Dong An Road, Shanghai, 200032, People’s Republic of China 5 Department of Medical Oncology, Fudan University Shanghai Cancer Center, 270 Dong An Road, Shanghai, 200032, People’s Republic of China 6 Duke Cancer Institute, Duke University Medical Center, 10 Bryn Searle Dr., Durham, NC 27710, USA Platinum-based chemotherapy (PBC) in combination with the 3rd generation drugs is the first-line treatment for patients with advanced non-small cell lung cancer (NSCLC); however, the efficacy is severely hampered by grade 3–4 toxicities. Nucleotide excision repair (NER) pathway is the main mechanism of removing platinum-induced DNA adducts that contribute to the toxic- Cancer Epidemiology ity and outcome of PBC. We analyzed data from 710 Chinese NSCLC patients treated with PBC and assessed the associations of 25 potentially functional single nucleotide polymorphisms (SNPs) in nine NER core genes with overall, gastrointestinal and hematologic toxicities.
    [Show full text]
  • Epigenetic Regulation of DNA Repair Genes and Implications for Tumor Therapy ⁎ ⁎ Markus Christmann , Bernd Kaina
    Mutation Research-Reviews in Mutation Research xxx (xxxx) xxx–xxx Contents lists available at ScienceDirect Mutation Research-Reviews in Mutation Research journal homepage: www.elsevier.com/locate/mutrev Review Epigenetic regulation of DNA repair genes and implications for tumor therapy ⁎ ⁎ Markus Christmann , Bernd Kaina Department of Toxicology, University of Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany ARTICLE INFO ABSTRACT Keywords: DNA repair represents the first barrier against genotoxic stress causing metabolic changes, inflammation and DNA repair cancer. Besides its role in preventing cancer, DNA repair needs also to be considered during cancer treatment Genotoxic stress with radiation and DNA damaging drugs as it impacts therapy outcome. The DNA repair capacity is mainly Epigenetic silencing governed by the expression level of repair genes. Alterations in the expression of repair genes can occur due to tumor formation mutations in their coding or promoter region, changes in the expression of transcription factors activating or Cancer therapy repressing these genes, and/or epigenetic factors changing histone modifications and CpG promoter methylation MGMT Promoter methylation or demethylation levels. In this review we provide an overview on the epigenetic regulation of DNA repair genes. GADD45 We summarize the mechanisms underlying CpG methylation and demethylation, with de novo methyl- TET transferases and DNA repair involved in gain and loss of CpG methylation, respectively. We discuss the role of p53 components of the DNA damage response, p53, PARP-1 and GADD45a on the regulation of the DNA (cytosine-5)- methyltransferase DNMT1, the key enzyme responsible for gene silencing. We stress the relevance of epigenetic silencing of DNA repair genes for tumor formation and tumor therapy.
    [Show full text]
  • Expression of MSH2 and MSH6 on a Tissue Microarray in Patients with Osteosarcoma
    ANTICANCER RESEARCH 34: 6961-6972 (2014) Expression of MSH2 and MSH6 on a Tissue Microarray in Patients with Osteosarcoma THORSTEN JENTZSCH1,2, BERNHARD ROBL1, MAREN HUSMANN1, BEATA BODE-LESNIEWSKA3 and BRUNO FUCHS1 1Laboratory for Orthopedic Research, Department of Orthopedics, Balgrist University Hospital, Zürich, Switzerland; 2Division of Trauma Surgery, Department of Surgery, University Hospital Zürich, Zürich, Switzerland; 3Institute of Surgical Pathology, University Hospital Zürich, Zürich, Switzerland Abstract. Background/Aim: Reliable prognostic factors for and head (4, 5). Following neoadjuvant chemotherapy, surgical the outcome of patients with osteosarcoma (OS) remain elusive. tumor resections provide tissue specimens for the assessment We analyzed the relationship between immunohistochemical of tumor necrosis rate, histology, grading and evaluation of expression of deoxyribonucleic acid (DNA) mismatch repair tumor biomarkers before further adjuvant chemotherapy may (MMR) proteins, MutS protein homolog 2 (MSH2) and MSH6 be initiated (6-8). Despite advances in therapeutic approaches, using a tissue microarray (TMA) with respect to OS patient five-year overall survival rates have been reported as 78% (9) demographics and survival time. Materials and Methods: We and are usually lower for non-responders to chemotherapy retrieved tumor tissue specimens from bone tissue originating (10) and patients with metastasis (11, 12). from surgical primary tumor specimens of OS patients to Albeit the limited number of studies (8, 13-17) on tumor generate a TMA and stained sections with antibodies against biomarkers, these are important for treatment decisions, MSH2 and MSH6. Results: Tumor resections of 67 patients patient discrimination regarding the response to with a mean follow-up of 98 months were evaluated. MSH2 chemotherapy and the incidence of metastasis, prediction of was expressed in nine (13%), MSH6 in ten (15%) and patient survival times and patient education (18-21).
    [Show full text]