Fumonisin Production and Toxic Capacity in Airborne Black Aspergilli

CORE Metadata, citation and similar papers at core.ac.uk

Provided by SZTE Publicatio Repozitórium - SZTE - Repository of Publications

Toxicology in Vitro 53 (2018) 160–171

Contents lists available at ScienceDirect

Toxicology in Vitro

journal homepage: www.elsevier.com/locate/toxinvit

☆ Fumonisin production and toxic capacity in airborne black Aspergilli T Daniela Jakšića, Sándor Kocsubéb, Ottó Bencsikb, Anita Kecskemétib, András Szekeresb, ⁎ Dubravko Jelićc, Nevenka Kopjard, Csaba Vágvölgyib, János Vargab, Maja Šegvić Klarića,

a Department of Microbiology, Faculty of Pharmacy and Biochemistry, University of Zagreb, Schrottova 39, 10000 Zagreb, Croatia b Department of Microbiology, Faculty of Science and Informatics, University of Szeged, H-6726 Szeged, Közép fasor 52, Hungary c Fidelta Ltd., Prilaz baruna Filipovića 29, 10000 Zagreb, Croatia d Mutagenesis Unit, Institute for Medical Research and Occupational Health, Ksaverska cesta 2, 10000 Zagreb, Croatia

ARTICLE INFO ABSTRACT

Keywords: This study presents the distribution of fumonisin (FB)-producing and non-producing airborne Aspergilli (Nigri)in Airborne fungi apartments (AP), basements (BS) and a grain mill (GM) in Croatia, and their cytotoxic, immunomodulation and A. welwitschiae genotoxic potency in comparison with FB1 and FB2. Concentration of black Aspergilli was 260-fold higher in GM A. tubingensis than in living environment with domination of A. tubingensis and A. welwitschiae.FB2- but not FB1- was conﬁrmed Fumonisins via HPLC-MS and detection of fum1 and fum8 genes for one isolate of A. niger (0.015 μg/mL) and 8/15 isolates of Cytotoxicity A. welwitschiae (0.128–13.467 μg/mL). After 24 h, both FB and FB were weakly cytotoxic (MTT assay) to DNA damage 1 2 human lung A549 cells and THP-1 macrophage-like cells. In THP-1 cells FB1 but not FB2 provoked a higher

increase of IL-8, TNF-α and IL-1β (ELISA). In A549 cells DNA damaging eﬀect of FB1 was slightly higher than

that of FB2 (Comet assay). In THP-1 macrophage-like cells A. tubingensis and A. piperis evoked immunomodulatory eﬀects which corresponded to their cytotoxicity (IC50 = 0.228–0.323 mg/mL); A. welwitschiae,

A. tubingensis and A. piperis exerted cytotoxic (IC50 = 0.214–0.460 mg/mL) and genotoxic eﬀects in A549 cells.

Presumably, secondary metabolites other than FB2 may have contributed to the toxicity of black Aspergilli.

1. Introduction Since their discovery, fumonisins have been considered mycotoxins mainly produced by Fusarium species (Logrieco et al., 2003). The B

The Aspergillus section Nigri comprises several species widely dis- group of fumonisins (FB1,FB2, and FB3) is frequently detected in maize tributed in the environment. These species deserve special attention and maize-based foods. The toxicological properties of FB1 as the major regarding their inﬂuence on human and animal health: 1) from the group of fumonisins in Fusaria have been extensively studied. The

agricultural point of view, members of the section Nigri occur as plant consumption of FB1 causes species-specific toxicological effects in ani- pathogens and cause spoilage of various foodstuffs including grains, mals including leukoencephalomalacia in horses and pulmonary oe- fruits, vegetables, cotton, nuts, meat and dairy products (Perrone et al., dema in swine. It is a hepatotoxic, nephrotoxic, carcinogenic and im- 2007; Varga et al., 2011); 2) in biotechnology some species are used for munosuppressive agent in laboratory animals that has been associated the production of organic acids, hydrolytic enzymes, and fermented with human oesophageal carcinoma in southern Africa and China

foods (Hong et al., 2013; Samson et al., 2007); 3) in medical mycology (JECFA, 2001). Based on the structural similarities of FB1–3, a group increasing numbers of infections caused by black Aspergilli are re- provisional maximum tolerable daily intake (PMTDI) of 2 μg/kg b.w.

ported, particularly otomycosis and keratomycosis in tropical and per day for FB1–3 was established (EFSA, 2014). semitropical regions (Kredics et al., 2008; Szigeti et al., 2012a, 2012b); In Fusarium species, fum genes encode enzymes involved in the 4) from the toxicological point of view black Aspergilli are able to biosynthetic pathway of FBs. Cluster genes fum1 and fum8 encode a produce mycotoxins including fumonisin isomers and ochratoxin A polyketide synthase and an R-oxoamine synthase, respectively, which

(OTA), which are mainly introduced into organisms by contaminated are responsible for the synthesis of the FB1–3 carbon backbone food (Samson et al., 2007; Samson et al., 2004; Varga et al., 2011), but (Alexander et al., 2009; Proctor et al., 2006; Seo et al., 2001). Other fum can also be taken in via inhalation. genes (e.g., fum2, fum3, fum6, fum10, fum13, fum14) encode enzymes

☆ During the execution of the experimental work for this paper, we were struck by the unexpected demise of Professor János Varga. We dedicate this paper to the memory of our beloved friend and colleague. ⁎ Corresponding author. E-mail address: [email protected] (M. Šegvić Klarić).

https://doi.org/10.1016/j.tiv.2018.08.006 Received 1 January 2018; Received in revised form 11 June 2018; Accepted 10 August 2018 Available online 24 August 2018 0887-2333/ © 2018 Elsevier Ltd. All rights reserved. š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171 that catalyse the addition or reduction of functional groups along the 25 °C ± 0.2 °C, followed by subculturing of black Aspergilli on Czapek carbon backbone and their inactivation results in the production of FB2 Yeast Agar (CYA) and Malt Extract Agar (MEA) at 25 °C in the dark for or FB3 only (Alexander et al., 2009). seven days (Samson et al., 2010). Morphological identifications were Frisvad et al. (2007) first reported on FB2 production in black As- carried out according to the literature (Samson et al., 2007, 2010), pergilli and since then research on fumonisin production and the gene while species identification was performed by sequencing a part of the cluster required for fumonisin isomer biosynthesis in black Aspergilli calmodulin gene published previously in Varga et al. (2014). has been increasing. So far fumonisin production has been confirmed in only two species, A. niger and A. welwitschiae (formerly A. awamori) 2.3. Preparation of extracts for fumonisin analysis (Palumbo et al., 2013; Perrone et al., 2011a; Varga et al., 2011; Varga et al., 2010). The research of fum genes orthologues in A. niger genome A. welwitschiae (N = 15), A. tubingensis (N = 10), A. luchuensis revealed the presence of the polyketide synthase (fum1), hydroxylase (N = 4), A. piperis (N = 1) and A. niger (N = 1) isolates were cultivated (fum3, fum6, fum15), dehydrogenase (fum7), aminotransferase (fum8), on Czapek yeast autolysate (CYA) agar in darkness at 25 °C ± 0.2 °C for acyl-CoA synthase (fum10), carbonyl reductase (fum13), condensation- 7 days. The extraction procedure included extracting 4 CYA agar plugs domain protein (fum14), ABC transporter (fum19), and transcription (in a diameter of 6 mm) with 1 mL of 75% methanol (Frisvad et al., factor (fum21) genes and absence of fum2 gene (Pel et al., 2007; Susca 2007). The extracts were centrifuged at 10,000 g for 10 min, super- et al., 2014). The absence of fum2 in A. niger, which encodes for natants were collected and transferred to clean vials. Prior to LC/MS monooxygenase that catalyses the hydroxylation of the fumonisin analysis, the prepared extracts were filtered through 0.45 μm filters and backbone at C-10, results in the production of FB2,FB4 and FB6, but the transferred to microvials. absence of FB1 and FB3 synthesis (Månsson et al., 2010; Proctor et al., 2006). The presence of fum1 and fum8 genes was already been pre- 2.4. HPLC and MS parameters viously shown essential for the production of FB2 in black Aspergilli (Susca et al., 2014, 2010). However, one study revealed the production The extracts were analysed by HPLC-MS technique as described by of FB1 in black Aspergilli recovered from dried vine fruits which was Bartók et al. (2010), with minor modifications. The applied modular confirmed by HPLC-MS analysis of the extracts (Varga et al., 2010). HPLC system (Shimadzu, Japan) was equipped with a DGU-14A va- Although black Aspergilli are common airborne fungi, the dis- cuum degasser, LC-10 CE pump, Merck Hitachi L-7200 autosampler, tribution and species diversity of this group in indoor air is poorly in- Shimadzu CTO-10AS column thermostat, and SCL-10A system con- vestigated and is usually referred as to merely A. niger. Recently, we troller and coupled with the 2010A MS (Shimadzu, Japan). The whole were the first to report on the diversity of black Aspergillus species HPLC-MS system was controlled by LCMSsolution (ver. 3.60.361) isolated from living (apartments, basements) and occupational (grain software. Separations were performed on a YMC-Pack J'sphere ODS mill) air in Croatia and five species were determined by morphological H80 (YMC Europe GmbH, Dinslaken, Germany) (50 mm × 2.1 mm, and molecular methods (calmodulin gene sequence, CaM), including A. 4 μm) HPLC column thermostated at 35 °C. The mobile phase consisted luchuensis, A. niger, A. piperis, A. tubingensis, and A. welwitschiae (Varga of H2O (A) and MeCN (B) supplemented each with 0.1% (v/v) formic et al., 2014). The aim of this study was to check their ability to produce acid with a flow rate of 0.2 mL/min. The gradient elution was started the FB1 and FB2 and confirm that by the production capacity accom- with 15% B, which was increased linearly after 1 mi to 40% for 4 min panied by the presence of fum1 and fum8 genes. Since black Aspergilli and maintained at this value for 10 min; then, the B ratio was raised up were common in the mixture of airborne fungi in the occupational and to 95% for 2 min and this value was maintained for 6 min; then it was living environment, we believed it was justified to explore the toxic dropped down to the initial 15% in 2 min and remained constant until properties of FB-producing and FB-non-producing Aspergilli micro- pressure stabilized. The run time was 38 min. The MS instrument was extracts in comparison with single FB1 and FB2. This was carried out equipped with an ESI source and operated in positive ion mode using using human lung adenocarcinoma A549 cells and macrophages de- nitrogen as both the nebulizing gas (1.5 L/min) and the drying gas rived from human leukemic monocyte THP-1 cells as experimental (0.2 bar). Positive ions were acquired in selected ion monitoring mode models. (event time, 0.2 s; detector voltage, 1.5 kV), while the voltages of the interface, curved desolvatation line (CDL) and Q-array were 4.5 kV, 2. Materials and methods 25 V and 25 V, respectively, and the CDL and heat block temperatures 250 °C and 200 °C, respectively. During the measurements, the proto- + 2.1. Chemicals nated molecular ions ([M + H] )ofFB1 (m/z 722) and FB2 (m/z 706) were recorded, and their amount found in the samples was calculated

FB1 and FB2 standards, methanol (MeOH) and formic acid were by an external standard method using six calibration levels within the purchased from Sigma-Aldrich Ltd. (Budapest, Hungary). Acetonitrile concentration range of 15.688 ng/mL to 502 ng/mL (FB1) and (MeCN) was obtained from VWR International Ltd. (Debrecen, 15.625 ng/mL to 500 ng/mL (FB2) dissolved in MeCN/H2O 50/50 (v/v). Hungary). HPLC grade water with a resistivity of 18 MΩ was produced The equations of the resulted calibration curves were 2 by ultraﬁltration with a Millipore Milli-Q Gradient A10 water pur- y = 14.82537× + 18.98403; R = 0,997 (FB1) and 2 iﬁcation system (Merck Ltd., Budapest, Hungary). y = 14.03072× + 156.9180; R = 0,998 (FB2).

2.2. Sample collection 2.5. PCR detection of fum1 and fum8 genes

Airborne fungi were collected over a one-year period (2012) in two- The isolated genomic DNA (Varga et al., 2014) was diluted to < month intervals at a grain mill (GM) situated near Zagreb, Croatia, and 1.000 ng and used as template DNA for fumonisin biosynthetic gene in residential locations which included two apartments (AP) and two speciﬁc PCR reactions. Part of polyketide synthase and R-oxoamine basements (BS) as well as outdoor air (ODA). Locations, dynamic and synthase genes (fum1 and fum8, respectively; Alexander et al., 2009; conditions of sampling were described in detail in Jakšić Despot and Proctor et al., 2006; Seo et al., 2001) were ampliﬁed in 20 μL volume

Šegvić Klarić (2014). Briefly, each two-month interval 20 samples were containing 10× DreamTaq Buffer (with 1.5mM MgCl2) (Thermo Sci- taken at each indoor location and 10 samples outdoors, the total entific, USA), 0.2 mM dNTPs, 0.2 μmol of primers (Table 1), 1U number of samples was 420. Airborne fungi were sampled using an DreamTaq DNA Polymerase (Thermo Scientific), nuclease free water Airsampler Mas-100 Eco and dichloran 18% glycerol agar (DG-18) and template DNA. Amplifications were performed in Termocycler T- plates (Samson et al., 2010). The plates were incubated at 100 (BioRad, Budapest, Hungary), while the PCR cycling protocol

161 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

Table 1 and by standard calibration curves. The PCR primers used for the detection of fum genes.

Primers Sequence Gene Reference 2.6.4. Alkaline comet assay 5 fum1-F2 TGGCGATTGGTCGTCCAGGTCT fum1 (Palumbo et al., 2013) A549 cells were seeded in 6-well plates (3 × 10 cells per well). fum1-R2 GCCACCGATGTCCACAAGCGAA After 24 h, the cell medium was replaced with the treatment: FB1 and vnF1 TTCGTTTGAGTGGTGGCA fum8 (Susca et al., 2014) FB2 (10 and 100 μM each), black Aspergilli extracts (0.1 mg/mL) and vnR3 CAACTCCATASTTCWWGRRAGCCT control medium (with and without 0.1% DMSO) for 24 h. The comet assay was carried out according to Singh et al. (1988) with minor modifications. After 24 h of treatment, the cells were washed, scraped consisted of 35 cycles and included an initial denaturation at 95 °C for with rubber, and resuspended in 300 μL of phosphate buffer (pH 7.4). 2 min in the first and 20 s in the following runs, annealing at 56 °C for Aliquots of 20 μL of this suspension were mixed with 100 μL 0.5% low 20 s; elongation at 72 °C for 40 s and 2 mins for the final elongation. The melting point agarose-LMP (in Ca-and Mg-free PBS) and 100 μLof amplification products were analysed by electrophoresis on 2% agarose agarose-cell suspension was spread onto a fully frosted slide pre-coated gels using fluorescent dye GR Green (Excellgen, Budapest, Hungary). with 1% normal melting point tagarose- NMP (in sterile destiled water). After 1 h of lysis at 4 °C, denaturation for 20 min and electrophoresis for 2.6. Cytotoxicity, immunomodulation and genotoxicity of Aspergilli 20 min at 25 V and 300 Microgels were neutralized and then stained extracts and single FB1 and FB2 with ethidium bromide (20 μg/mL) per slide for 10 min. Slides were scored using an image analysis system (Comet assay IV, Perceptive in- 2.6.1. Cell culture and treatment struments Ltd., UK) connected to a fluorescence microscope (Leitz, Human lung adenocarcinoma cells A549 and human leukaemia Germany). All of the experiments were performed in duplicate, and in monocytes THP-1 (European Collection of Cell Cultures, UK) were each experiment images of 200 randomly selected cells (100 cells from 2 fl grown in 75 cm asks in RPMI supplemented with 2 mM glutamine, each of the two replicate slides) were measured. Only comets with a μ 10% heat-inactivated FBS, penicillin (100 IU/mL; 1 IUE 67.7 g/mL) defined head were scored. As a reliable measure of genotoxicity, we μ and streptomycin (100 g/mL) at 37 °C in 5% CO2. Stock solutions of used tail length and the percentage of DNA in the comet tail (or tail FB2 and FB1 (1 mg/mL) were prepared in sterile water and dried fungal intensity) (Collins, 2004). extracts were prepared in 100% DMSO. The final concentrations of FBs and fungal extracts as well as DMSO were obtained by dilution with the culture medium. 2.7. Statistics

μ 2.6.2. MTT proliferation assay The results of the MTT test, comet assay (tail length- m; tail in- MTT proliferation test was used to test the cell viability of A549 tensity- % of tail DNA) and concentration of cytokines (% of control) cells and macrophage-like THP-1 cells as described previously (Jakšić were presented as mean ± standard error of mean (SEM). Normality of Despot et al., 2016). Briefly, the differentiation of THP-1 cells into the data distribution was tested by Kolmogorov-Smirnov test; One-way- macrophages was performed using phorbol 12-myristate 13-acetate ANOVA was applied for normally distributed data followed by Sidak (PMA) (20 nm/well). Prior to the experiment, Aspergilli extracts dis- post-test, while for non-normally distributed data Kruskal- Wallis test solved in DMSO were diluted with culture medium and the final mass was applied followed by Dunn's multiple comparison test. P < 0.05 fi concentrations ranged from 0.1 to 0.8 mg/mL. DMSO (up to 1%) was was considered statistically signi cant for all calculations. To obtain the fi used as the control that did not alter cell viability. The A549 (104 cells/ IC50 from the results of MTT assay, non-linear dose-response tting was well) and macrophage-like THP-1 cells (5 × 104 cells/well) were grown applied using y = A1 + (A2-A1)/(1 + 10^((LOGx0-x)*p)) equation. in a 96-well flat-bottom microplate in RPMI 1640 medium supple- Two-way ANOVA followed by Sidak's multiple comparison test were fi ff mented with 10% of FBS. Upon 24 h treatment with FBs (10–150 μM) or used for testing the signi cance of di erence in the toxic response of two cell lines to black Aspergilli extracts. with Aspergilli extracts (0.1–0.8 mg/mL) of FB2-producing and FB2- non-producing strains, the concentration that inhibits growth in 50% of cells (IC50) was determined. Following treatment, the medium was re- 3. Results moved and 100 μL of MTT-tetrazolium salt reagent diluted in RPMI without FBS (0.5 mg/mL) was added into each well. After 3 h of in- 3.1. Occurrence of airborne black Aspergilli cubation, the medium was replaced with 100 μL of DMSO to dissolve formazan (product of metabolised MTT reagent), and cells were in- The abundance of airborne Aspergillus species from the section Nigri cubated at room temperature on a rotary shaker for 15 min. The ab- in occupational (GM), and living (AP and BS) environments as well as sorbance was measured using a microplate reader (Labsystem iEMS, outdoor air (ODA) in the six periods of sampling is presented in Table 2. fi type 1404) at a wavelength of 540 nm. All tests were performed in ve The proportion of black Aspergilli in the total number of viable airborne replicates and results were expressed as percentage of control. fungi regardless of location and period of sampling was low (0.05–4.4%), with mean absolute concentrations ranging from 1 at AP/ 2.6.3. Measurement of cytokine concentration BS to 800 CFU/m3 at GM and mean estimated concentration ranging THP-1 cells were seeded on 24-well cell culture plates (1 × 106 cells from 22.5 to 1550 CFU/m3 at GM. The mean absolute concentrations of per well) and differentiated for 24 h with 40 nM PMA. Cells were black Aspergilli were approximately 10 times higher in the GM com- treated with FB1 and FB2 (10 and 100 μM each) as well as black pared to the levels detected in the living indoor environment (AP and Aspergilli extracts (0.1 mg/mL) for 24 h. Cell medium was harvested BS) and outdoor air. Black Aspergilli peaked in May (GM), when the and frozen at −80 °C until analysis. estimated concentration (probable viable number) rise up to 5 × 103 Concentrations of IL-1β, IL-6, IL-8 and TNF-α were determined in CFU/m3, while in the remainder of the sampling periods, the estimated harvested cell medium by DuoSet ELISA kits (R&D systems, USA) ac- levels were below 500 CFU/m3. The recovery of aspergilli (Nigri) from cording to instructions provided by the manufacturer and as described samples taken both indoors (AP and BS) and outdoors was poor; the elsewhere (Hulina et al., 2017). Cytokines concentrations were calcu- maximum absolute concentrations were below 100 CFU/m3, except in lated from measured optical densities determined at 450 nm, using a the AP in March (140 CFU/m3). Additionally, black Aspergilli were microplate reader (En Vision® Multilabel Plate Reader, Perkin Elmer) detected outdoors only in warmer months (July and September).

162 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

Table 2 Abundance of black Aspergilli in indoor and outdoor air for each sampling period.

Period of sampling Grain mill (GM) Apartment (AP) Basement (BS) Outdoor air (ODA)

CFU/m3 % CFU/m3 % CFU/m3 % CFU/m3 %

Mean ± SD Range Mean ± SD Range Mean ± SD Range Mean ± SD Range

Absolute Estimated⁎ Absolute Estimated⁎

January 40 ± 52 263 ± 339 0–100 0–657 0.15 1 ± 4.5 0–20 0.62 1 ± 4 0–20 0.14 ––– March 20 ± 52 131 ± 344 0–200 0–1314 0.05 8 ± 31 0–140 4.40 –––––– May 240 ± 260 1550 ± 1730 0–800 0–5256 0.90 1 ± 4 0–20 0.08 –––––– July 30 ± 57 197 ± 375 0–200 0–1314 0.08 –––1±5 0–20 0.10 2 ± 6 0–20 0.10 September 50 ± 124 302 ± 809 0–400 0–2628 0.35 8 ± 19 0–80 1.73 1 ± 4 0–20 0.10 4 ± 8 0–20 0.47 November 20 ± 52 22.5 ± 59 0–200 0–225 0.32 1 ± 4.5 0–20 0.45 3 ± 7 0–20 0.25 –––

%: mean concentration of black Aspergilli / mean concentration of total airborne fungi⁎⁎ × 100. –: not detected. ⁎ The probable number of viable particles calculated from Feller's formula (Pr]N 1/N + 1/N-1 + 1/N-2 + 1/N-r + 1), given by the manufacturer (Merck KgaA, Darmstadt, Germany; Pr = probable statistical total; r = Number of cfu counted; N = total number of holes in the sampling head). ⁎⁎ Mean concentration of total airborne fungi adopted from Jakšić Despot and Šegvić Klarić (2014).

3.2. The ability of black Aspergilli to produce fumonisins plug test also present these genes, except one strain of A. welwitschiae that yielded an amplicon from fum8, but not from fum1. Two strains of

Among the identified isolates of black Aspergilli, which include A. A. welwitschiae produced approximately 10 μg/mL of FB2; three isolates welwitschiae (N = 15), A. tubingensis (N = 10), A. luchuensis (N = 4), A. produced FB2 in amounts between 3 and 8 μg/mL; and three isolates piperis (N = 1) and A. niger (N = 1), FB2 was quantified in 8 out of 15 produced FB2 at concentrations below 1 μg/mL. The weakest producer isolates of A. welwitschiae and the A. niger isolate. FB1 was not detected was A. niger (0.015 μg/mL) with an FB2 level near to the lowest level of in any sample (Table 3; Fig. 1). Among A. welwitschiae isolates that calibration. FB2 was not found at a detectable level in the isolates be- produced FB2, seven isolates were recovered from the GM and one from longing to the A. tubingensis, A. luchuensis and A. piperis species and the the AP samples, while the A. niger isolate was originated from the living absence of amplification of fum1 and fum8 support that these isolates area BS. Molecular screening for the presence of fum1 and fum8 genes are not FB2 producing fungi. revealed that the majority of the isolates that produced FB2 in the agar

Table 3

PCR screening of fum genes in fumonisin B2 producing and non-producing black Aspergilli.

Species Isolate code Sampling site Detected FB1 Detected FB2 fum1 fum8

(3 agar plugs) (3 agar plugs)

μg/mL μg/mL

A. tubingensis MFBF AN10927B Grain mill nd nd −− A. tubingensis MFBF AN10928B Grain mill nd nd −− A. tubingensis MFBF AN10868A Grain mill nd nd −− A. tubingensis MFBF AN11053A Grain mill nd nd −− A. tubingensis MFBF AN11053B Grain mill nd nd −− A. tubingensis MFBF AN11054B Grain mill nd nd −− A. tubingensis MFBF AN11119A Grain mill nd nd −− A. tubingensis MFBF AN10856A Apartment nd nd −− A. tubingensis MFBF AN10862A Apartment nd nd −− A. tubingensis MFBF AN11058B Outdoor air nd nd −− A. luchuensis MFBF AN10927A Grain mill nd nd −− A. luchuensis MFBF AN11054A Grain mill nd nd −− A. luchuensis MFBF AN11133A Apartment nd nd + − A. luchuensis MFBF AN11000B Outdoor air nd nd −− A. welwitschiae MFBF AN10868B Grain mill nd nd + + A. welwitschiae MFBF AN10924B Grain mill nd 13.467 + + A. welwitschiae MFBF AN10925A Grain mill nd 7.991 + + A. welwitschiae MFBF AN10925B Grain mill nd 0.128 + + A. welwitschiae MFBF AN10926A Grain mill nd 5.762 + + A. welwitschiae MFBF AN10926B Grain mill nd 10.476 + + A. welwitschiae MFBF AN10929A Grain mill nd 0.290 + + A. welwitschiae MFBF AN10929B Grain mill nd 0.156 + + A. welwitschiae MFBF AN11113A Grain mill nd nd + − A. welwitschiae MFBF AN10545 Apartment nd nd + + A. welwitschiae MFBF AN11060A Apartment nd 3.988 − + A. welwitschiae MFBF AN11061B Apartment nd nd + − A. welwitschiae MFBF AN11062A Apartment nd nd + − A. welwitschiae MFBF AN 11139 B Basement nd nd + + A. welwitschiae MFBF AN 11140 B Basement nd nd + − A. niger MFBF AN 11066 B Basement nd 0.015 + + A. piperis MFBF AN 11119 B Grain mill nd nd + −

163 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

Fig. 1. Extracted ion chromatograms at m/z = 706 corresponding to FB2 in FB2-producing black Aspergilli. (For interpretation of the references to color in this ﬁgure legend, the reader is referred to the web version of this article.)

3.3. Cytotoxic effects Unlike FBs, black Aspergilli extracts of FB2-producers and non- producers were more cytotoxic for both cell lines (Table 4; Fig. 3). FB2 The MTT test revealed that both FB1 and FB2 were weakly cytotoxic content in A. welwitschiae (0.09–0.76 μMofFB2) and A. niger to A549 cells and macrophages derived from THP-1 cells; although all (0.000088–0.0007 μMofFB2) extract dilutions (0.1–0.8 mg/mL) was of the applied concentrations of single FBs (10–150 μM) significantly between one to five orders of magnitude lower that the lowest con- affected cell viability compared to control at 24 h of exposure. centration of single FB2 (10 μM) used in the MTT test. Considering the Nevertheless none of them was sufficient to induce a reduction calculated IC50 of extract mass concentrations, A. welwitschiae was the of > 50% in the cell metabolic activity (IC50) of A549 or THP1 cell lines most cytotoxic to A549 cells, followed by A. tubingensis and A. piperis. (Fig. 2). THP-1 macrophage-like cells were more sensitive to FBs than According to IC50 values, the last two exerted similar cytotoxic potency A549 cells, particularly to FB1; the viability of THP-1 macrophage-like in both cell lines (Table 4). The dose-response for A. niger and A. lu- cells dropped to 60% after exposure to the highest concentration of FB1. chuensis extracts in both cell lines was similar and the calculated IC50

Fig. 2. Survival of A549 cells (A) and THP-1 macrophage like cells (B) after 24 h of treatment with single FB1 and FB2 measured by MTT test. Each data point represents mean ± SEM of cell viability (% of control, control = 100% of cell viability) for FB1 and FB2 concentrations ranging from 10 to 150 μM. All treatments both in A549 and THP-1 cells were signiﬁcantly diﬀerent compared to control (*c, P < 0.05).

164 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

Table 4 environment, are in line with reports on these species in the food in- – 3 3 The calculated IC50 of black Aspergilli extracts (0.1 0.8 mg/mL) in A549 and dustry (220.6 CFU/m ), poultry farms (101.2 CFU/m ), and a bakery 2 THP-1 macrophage-like cell lines using non-linear curve fitting (R = 0.9767). (29.5 CFU/m3)(Sharma et al., 2010). Taking into account the statistically estimated concentration of black Aspergilli (5256 CFU/m3) in the Treatment IC50 (A549) afety evaluation of certain mycotoxins in food GM, the levels of these species are 50–260 times higher compared to mg/mL (mean ± SEM) those obtained in the AP and BS. Seasonal variations of the proportion of airborne black Aspergilli in the AP (0.08–4.4%) in Zagreb are com- A. niger > 0.8 > 0.8 – A. welwitschiae 0.214 ± 0.004 > 0.8 parable to the levels of these species (2.86 6.37%) in urban homes in A. luchuensis > 0.8 > 0.8 Tekirdag city (Turkey), although Tekirdag has a borderline Mediterra- A. tubingensis 0.329 ± 0.001 0.228 ± 0.009 nean/humid subtropical climate and Zagreb is situated near the A. piperis 0.460 ± 0.011 0.323 ± 0.009 boundary of the humid continental climate (Sen and Asan, 2009). A study conducted in a school in Perth (Australia) during winter and summer revealed that black Aspergilli were common indoor species was > 0.8 mg/mL. present at similar levels in both seasons at mean concentrations between 4 and 40 times higher than in the Zagreb AP (Zhang et al., 2013). ff 3.4. Immunomodulatory e ects This comes as no surprise because Perth has a hot-summer Mediterra- nean climate, favourable for the growth of xerophilic fungi such as FB1 application resulted in the increase of all of the measured cy- black Aspergilli. A limited number of studies on the diversity and oc- β α ff tokines (IL-1 , IL-6, IL-8 and TNF- ), while the most pronounced e ect currence of indoor black Aspergilli have been published so far. The was on IL-8 (Fig. 4). An interesting pattern could be observed com- diversity of indoor black Aspergilli in Croatia from our preliminary ff β μ paring the e ect on IL-1 and IL-6. Applied at a concentration of 10 M, study was similar to other European countries including Hungary, the β ff FB1 caused the increase of IL-6, IL-1 was not di erent than the control, Netherlands, Serbia and Turkey; A. luchuensis, A. niger, A. welwitschiae ff while a ten times higher concentration of FB1 caused a reversed e ect: and A. tubingensis were detected in all of the listed countries, except for β the increase of IL-1 and the decrease of IL-6. In both cases, the con- A. niger which was not found in samples from Turkey (Varga et al., α centration of TNF- remained increased. In contrast to FB1,FB2 pro- 2014; Varga et al., 2011). Greater species diversity was obtained from fi β ff voked a signi cant decrease of IL-1 and did not have an e ect on IL-8. Thailand indoor air samples; among the 22 isolates assigned to 7 dif- fi Both FBs applied in 10-fold lower concentration signi cantly increased ferent species (including A. fijiensis, A. japonicus, A. neoniger, A. trini- IL-6. Among the extracted black Aspergilli, A. piperis and A. tubingensis dadensis, and one new species related to A. saccharolyticus), only A. niger ff fi β α had the strongest e ect causing a signi cant increase of IL-1 , TNF- and A. tubingensis matched our isolates. Also, a different composition of ff and IL-8 while the concentration of IL-6 was not di erent than the indoor black Aspergilli was reported in the samples taken in 17 US fi control. Among FB2 producers, A. niger provoked a signi cant increase states, Bermuda, Martinique and Trinidad & Tobago (Jurjević et al., α ff of TNF- only, while the other tested cytokines did not di er sig- 2012), as compared to Croatia; among 56 isolates 6 species were fi ni cantly from the control regardless of whether or not they were identified including A. aculeatus, A. fijiensis, A. floridensis, A. japonicas, treated with A. niger or A. welwitschiae. A. trinidadensis and A. uvarum. These studies, in addition to previously discussed results on levels of indoor black Aspergilli, confirm the sig- 3.5. Genotoxic effects nificant influence of climatic conditions on the distribution and occurrence of these fungi in indoor environments. Genotoxic effects were evaluated in A549 cells using alkaline comet Among the 31 isolates of black Aspergilli obtained in the present ff assay. Generally, the DNA damaging e ect of FB1 (in terms of increased study, only that identified as Aspergillus niger (1/1) and some A. wel- tail length and tail intensity) was slightly higher than that of FB2. While witschiae isolates (8/15) were shown to have the ability to produce FB2. fi no signi cant changes were observed in comet tail length, except None of the tested isolates produced FB1, which is in accordance with μ fi slightly when FB2 was applied at 100 M, a signi cant increase of tail Nielsen et al. (2015). The majority of the FB2-producer isolates (7/9) μ intensity was observed when FB1 or FB2 was applied at 10 M. originated from the GM, showing that workers in occupational indoor μ Application of 100 MFB1/FB2 resulted in a tail intensity similar to the environments of this type may be more exposed to FB2 via inhalation control sample. than people in living environments. The concentration of FB2 detected Application of black Aspergilli extracts caused a significant increase in isolates of A. welwitschiae following agar plug extraction was 600 of comet tail length in the range: A. tubingensis > A. piperis > A. times higher than that of the toxin produced by an A. niger strain. The luchuensis > A. welwitschiae > A. niger. However, only A. welwitschiae, production of FB2 in these isolates correlated with the detection of fum1 A. piperis and A. tubingensis extracts caused a significant increase of tail and fum8 genes involved in the biosynthesis of fumonisins. The results intensity, although the effect was more than twice less pronounced than of our study provide additional evidence that the dominant species and that of FB1/FB2.(Fig. 5). significant producer of FB2 among black Apergilli is A. welwitschiae. This species was also predominantly isolated from onions (Gherbawy 4. Discussion et al., 2015) and grapes in the Mediterranean Basin and California, but together with A. niger (Palumbo et al., 2013; Susca et al., 2014). These

4.1. Indoor occurrence, species diversity and FB2 production in airborne two species show many similarities in the secondary metabolism, black Aspergilli sharing biosynthetic pathways for ochratoxin A (OTA), pyranonigrin A,

tensidol B, funalenone, malformins naphtho-γ-pyrones as well as FB2 This study is the continuation of our recently published ones on (Frisvad et al., 2007; Perrone et al., 2011a; Susca et al., 2010). In this species diversity of airborne black Aspergilli in Croatia (Varga et al., study, we analysed only the production of FB2 but the biosynthesis of 2014) as well as Aspergillus species from the section Versicolores in the other secondary metabolites should not be excluded, which was sup- occupational (GM) and living (AP and BS) indoor environment over a ported by the cytotoxic assays. one year sampling period (Jakšić Despot et al., 2016). Unlike Aspergillus from the section Versicolores (0.7–55%), black Aspergilli comprised a signiﬁcantly lower proportion (0.05–4.4%) of the total airborne fungi detected in the studied indoor environment. Mean concentrations of viable black Aspergilli in the GM (20–240 CFU/m3), as a working

165 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

Fig. 3. Cytotoxicity of extracts prepared from different species assigned to section Nigri in A549 and THP-1 cells measured by MTT test. Dried extracts were dissolved in DMSO and diluted in cell culture medium (RPMI 1640) for the treatment (0.1–0.8 mg/mL). Up to 1% DMSO was used as the control. All treatments both in A549 and THP-1 cells were significantly different compared to control* (P < 0.05). The statistical significance of the same type of treatment in THP-1 compared to A549 cells is marked with an asterisk (*, P < 0.05).

4.2. Toxic potency of FBs vs. FB2-producing and non-producing black fumonisins in various cell lines, including human bronchoalveolar cells Aspergilli – Possible health risk BEAS-2B, in which the IC50 concentrations for both FB1 and FB2 were above 150 μM after 24 h of exposure (Gutleb et al., 2002; McKean et al., 4.2.1. Cytotoxicity 2006; Shier et al., 1991). The A. welwitschiae extract was the most toxic

The MTT assay revealed that both FB1 and FB2 were weakly toxic to among the extracts tested in A549 cells, but it was not cytotoxic to THP- both human lung A549 cells and THP-1 macrophage-like cells. The 1 macrophage-like cells. Taking into account that the A. welwitschiae

A549 cells were equally sensitive to the eﬀects of both FB1 and FB2, extract mass concentration that signiﬁcantly decreased cell viability while the THP-1 macrophage-like cells were more sensitive to FB1. contained FB2 at a 10-fold lower concentration than those used in FB2 These results are consistent with literature data on the cytotoxicity of individual treatment, it can be concluded that other metabolites in the

166 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

Fig. 4. Relative concentration of cytokines measured in the supernatant of THP-1 macrophage-like cells upon the treatment speciﬁed. The statistical signiﬁcance of the treatment compared to control is marked with an asterisk (*, P < 0.05) above each histogram.

extract but not FB2 contributed to the cytotoxicity of A. welwitschiae. approximately 54% of the control. It is possible that the A. niger used in Since we did not analyse the presence of OTA or other secondary me- the study of Bünger et al. (2004) was misidentified since more accurate tabolites (e.g. pyranonigrin A, tensidol B, funalenone, malformins, tools of identification have been introduced since (Perrone et al., naphtho-γ-pyrones) we can only speculate that some of them con- 2011b; Samson et al., 2007). Therefore, it is questionable whether the tributed to the cytotoxicity. Among them, malformins and naphto-y- described toxic effect belongs to the extract of A. niger or to some other pyrones exerted cytotoxic properties at nanomolar (IC50 = 130 and species from the section Nigri. 90 nM) and micromolar concentrations (IC50 < 100 μM) in human THP-1 macrophage-like cells were more susceptible to extracts of A. cancer cell lines (Huang et al., 2011; Liu et al., 2016). Apart from that, tubingensis and A. piperis than A549 cells, but the concentration of elastase production, an important virulence factor in A. fumigatus 0.8 mg/mL almost completely reduced the cell viability of both cell during respiratory system infection, was also described in black As- lines. This observation is particularly important from the aspect of re- pergilli (Kothary et al., 1984; Varga et al., 2011). Blanco et al. (2002) spiratory toxicity and/or infection in susceptible individuals. Recently, showed that A. welwitschiae (ex A. awamori) isolates possessed sig- Lamboni et al. (2016) reported on the prevalence of A. tubingensis in nificantly more intensive elastase activity in elastin lyses compared to nuts from Benin, which produced naphto-y-pyrones (auraspenones, A. niger. This may also be one of the reasons for the stronger cytotoxic fonsecinones, flavasperones), asperazine and malformins at high rates. effect of A. welwitschiae than A. niger, which was particularly expressed In addition to cytotoxic naphto-y-pyrones and malformins, asperazine in lung A549 cells. Bünger et al. (2004) showed that the extract of A. showed selective cytotoxicity against human leukaemia cells (Bugni niger at a concentration of 800 mg/mL was cytotoxic to A549 cells. In and Ireland, 2004). Recently, A. tubingensis was detected as the most our study, applied at the concentration of 0.8 mg/mL, A. niger extract common black Aspergilli after A. niger in clinical isolates of patients reduced the cell viability of both A549 cells and THP-1 macrophages to with chronic respiratory diseases, including cystic fibrosis and chronic

167 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

Fig. 5. Genotoxicity of FB1/FB2 and black Aspergilli extracts applied in subcytotoxic concentrations determined by alkaline comet assay in A549 cells. The statistical signiﬁcance of the treatment compared to control is marked with an asterisk (*, P < 0.05) above each histogram. (For interpretation of the references to color in this ﬁgure legend, the reader is referred to the web version of this article.)

obstructive pulmonary disease (Gautier et al., 2016). Additionally, A. like cells; FB1 but not FB2 provoked higher increase of cytokines IL-8, tubingensis was presented in patients with cutaneous infections and TNF-α and IL-1β;FB2 effectively decreased the levels of IL-1β and did otomycoses (Balajee et al., 2009; Szigeti et al., 2012a, 2012b) as well as not have an effect on TNF-α and IL-8. IL-6 was significantly increased corneal infections in tropical regions (Kredics et al., 2008). A. piperis only when both FBs were applied at a 10-fold lower concentration. was reported to produce pyranonigrins, naphto-y-pyrones and aflavi- Several studies on different in vivo and in vitro models showed con- nins. Pyranonigrins and aflavinins showed insecticidal properties, but tradictory results regarding FB1 effect on cytokine release, in some pyranonigrins did not exert cytotoxicity in human cancer cell lines cases FB1 stimulated production of inflammatory cytokines, while in (Hiort et al., 2004; Wang et al., 1995), while, to the best of our some cases it exerted an inhibitory effect (Taranu et al., 2005). In the knowledge, there are no data on cytotoxic properties of aflavinins in human cell lines of the stomach and colon, FB1 caused an increase in human cell lines. the production of TNF-α and IL-1β (Mahmoodi et al., 2012)., which is in agreement with our findings. In the same study, a decrease in the production of IL-8 was observed. Also, in the human colon cell line HT-

4.2.2. Immunomodulation 29, FB1 induced a decrease in IL-8 synthesis but only after exposure to When macrophages are exposed to inflammatory stimuli they pro- LPS stimulation (Minervini et al., 2014). In lymphocytes and neu- duce cytokines including TNF-α, IL-1, IL-6, IL-8 and IL-12. Thus, we trophils obtained from the peripheral blood of healthy people and pa- ff fl explored the di erences in secretion of proin ammatory cytokines tients with breast and gastrointestinal cancers, FB1 inhibited the pro- (TNF-α, IL-1β, IL-6, IL-8) by THP-1 macrophage like cells upon ex- duction of TNF-α and G-CSF cytokines demonstrating immune posure to pure FBs or Aspergilli extracts. Endogenous pyrogen TNF-α suppression particularly in cancer patients (Odhav et al., 2008). Chiba has control of the cytokines network; it is responsible for the production et al. (2007) suspected that FB1-induced an increase of TNF-α and IL-6 fi α of IL-1, IL-6 and IL-8. De ciency of TNF- in experimental animals in mice mast cells as a result of FB1-inhibited synthesis of ceramide. promoted cancer (Suganuma et al., 1999). Similarly to TNF, IL-1β is Inhibition of ceramide synthesis and disruption of membrane phos- fl also produced at the early stage of in ammation and macrophages are pholipids have been indicated as the key mechanisms of FB1 toxicity β the main source of this cytokine. IL-1 is synthesized as a leaderless and our obtained immunomodulatory effects of FB1 may be the result of precursor, cleaved by inflammasome-activated caspase-1 and released changes in the expression of cell surface markers important in immune by autophagy from macrophages. This cytokine has a beneficial role of cell communication (Odhav et al., 2008). To the best of our knowledge, fi mediating an immune response against the pathogenic in ltration, but no data on the immunomodulatory effect of FB2 has yet been published. it can also promote the pathogenesis of tissue damage that leads to Based on the chemical structure similarities between FB1 and FB2,as chronic inflammation (Eder, 2009). IL-6 is a pleiotropic cytokine well as the known inhibition of ceramide synthesis, we expected a si- showing both proinflammatory and antiinflammytory activities but in milar immunomodulatory effect in THP-1 like macrophages. Surpris- fl fl chronic in ammation it is rather proin ammatory. The synthesis of this ingly, FB2 significantly increased only the production of IL-6, unlike FB1 cytokine is induced by IL-1 and TNF-α (Duque and Descoteaux, 2014). significantly decreased IL-1β, and exerted a much weaker effect on

IL-8 is a monocyte- and macrophage-derived cytokine that serves as TNF-α and IL-8 than FB1. We can only surmise that these events are chemoatractant of neutrophils to the site of infection or injury and its probably linked to the weaker cytotoxicity of FB2 for THP-1 like mac- secretion from macrophages can be stimulated with TNF-α,a IL-1β or rophages. Among black Aspergilli, only A. piperis and A. tubingensis lipopolysaccharide (Carré et al., 1991). Our results showed that FBs evoked a signiﬁcant increase in the production of IL-1β, IL-8 and TNF- exerted a diﬀerent immunomodulatory pattern in THP-1 marcophage-

168 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

α, but not IL-6. The inflammatory effect of A. piperis and A. tubingensis FB1 led to extensive lipid peroxidation (Abado-Becognee et al., 1998; extracts corresponded to their cytotoxic potential in THP-1-like mac- Kouadio et al., 2005), which ended with the formation of mal- rophages. The effect on cytokine signalling is best studied in Aspergillus ondialdehyde, known as a potent cross-linking agent (Abel and fumigatus as the most common fungal pathogen in humans, while data Gelderblom, 1998). Considering that in the present study we did not on different black Aspergilli are scarce. IL-1β and TNF are induced in apply special modifications of the comet assay, our assumption re- alveolar macrophages in response to A. fumigatus antigens and in garding the involvement of cross-links in overall primary DNA damage monocytes in response to Aspergilli conidia and hyphae (Park and measured after exposure to FBs has to be proven in future studies, and Mehrad, 2009). It was shown that only live but not heat-inactivated A. to obtain an unambiguous answer regarding the possible cross-linking niger could evoke the secretion of IL-1β and IL-6 in MPI macrophages potential of FBs and/or their metabolites, further investigations are (Chacko, 2016), which is in agreement with our results of no significant needed. cytokine release induced by A. niger extract, that could also be linked to All extracts of black Aspergilli significantly increased tail length, but its low cytotoxic potential in THP-1-like macrophages. The difference in only A. welwitschiae, A. piperis and A. tubingensis provoked a marked the immunomodulatory pattern of black Aspergilli extracts is hard to increase of tail intensity, which corresponded to the cytotoxic potential explain but it cannot be linked to the production of FB2; it is more likely of the extracts in A549 cells. To our knowledge, this is the first report on that the previously discussed metabolites contribute to both the cyto- the toxic potential of different Aspergillius species from the section Nigri toxicity and immunomodulation in THP-1-like macrophages. to reveal significant species-related differences in toxic effects in A549 cells and THP-1-like macrophages. 4.2.3. Genotoxicity Considering a similar pattern of FBs-induced DNA damage in A549 5. Conclusions cells obtained by the alkaline comet assay, we can assume that these toxins share the same mechanism of genotoxicity. However, in the in- The statistically estimated concentration of black Aspergilli (up to terpretation of the alkaline comet assay results, one has to take into 5×103 CFU/m3) in the grain mill, dominated by A. welwitschiae and A. account that often there is no simple association between the amount of tubingensis, showed a potential health risk for workers, because these primary DNA damage caused by exposure to a particular chemical and concentrations were up to 260-folds higher than in residential en- the biological effects of that damage. Based on the knowledge gathered vironments. in several in vitro and in vivo studies, FB1 induces a dose-dependent Among black Aspergilli, only A. welwitschiae and A. niger produced increase of genotoxicity expressed as increased comet's tail intensity or FB2, which was also confirmed with the presence of fum1 and fum8 increase in micronuclei formation, and oxidative stress has been im- genes involved in FB production. FB2 did not exert cytotoxic properties plicated as one of the mechanisms involved in DNA damage (Domijan in human lung adenocarcinoma A549 cells and THP-1 macrophage-like et al., 2006; Galvano et al., 2002a, 2002b; Peraica et al., 2008). We cells, which means that FB2 alone did not contribute to the cytotoxic found that both FBs evoked a significant increase in the tail intensity of potential of the black Aspergilli. Extracts of A. welwitschiae, A. tu- A549 cells when applied at a lower concentration, but without sig- bingensis and A. piperis exerted a more pronounced cytotoxic and gen- nificant changes in tail length values, which is in accordance with otoxic effects in A549 cells than A. niger and A. luchuensis. In THP-1 previous studies. In a previous comet assay study, Ehrlich et al. (2002) macrophage-like cells, only A. tubingensis and A. piperis evoked cyto- observed a dose-dependent genotoxic effects of FB1 in HepG2 cells at toxic and immunmodulatory effects. Secondary metabolites including concentrations ≥25 μg/mL. Since FB1 has clastogenic potential per se, naphto-y-pyrones malformins and asperazine as well as elastase activity and could lead to the disturbance of the cellular oxidative-antioxidative might contribute to the toxicity of the extracts, but the combined effects equilibrium, DNA instability observed at the lower FBs concentrations of these metabolites should be explored in future studies. In future tested might be associated with the formation of simple types of DNA studies, it would be extremely useful to explore the combined effects of lesions as single strand breaks and alkali labile sites, which could be black Aspergilli secondary metabolites and enzymes to clarify their sensitively detected by the alkaline comet assay. Furthermore, the ob- interactions in toxic action and possible involvement in chronic reserved difference in the response of comet parameters is not surprising spiratory diseases. because as the level of damage increases so does the relative intensity of staining of DNA in the tail, rather than tail length which consists of an Acknowledgements increasing number of relaxed DNA loops (Collins et al., 2008). How- ever, it is worth to mention that when FBs were applied at a higher This work was financially supported by the University of Zagreb concentration (100 μM) in A549 cells, we observed a > 3-fold lower tail (Grant No. 1126). This study forms part of the project GINOP-2.3.2-15- intensity than after treatment with 10 μM. Based on these findings, and 2016-00012, supported by the European Social Fund. This work was the fact that both FBs were weakly cytotoxic to A549 cells and decrease also supported by OTKA grant Nos. K115690 and K8407 as well as in cell viability after treatment with 10 and 100 μM was not sig- through András Szekeres, who received support through the new na- nificantly different, we conclude that at least a part of the genotoxic tional excellence program of the Hungarian Ministry of Human effects at the higher tested concentrations could be related to the for- Capacities. mation of more complex DNA lesions as cross-links (both inter- and intrastrand) and possibly DNA-protein adducts. References Cross-linking (DNA–DNA and DNA–protein) is the only-known mechanism which contributes to an actual decrease in DNA migration Abado-Becognee, K.T.A., Fleurat-Lessard, F., Shier, W.T., Badria, F., Ennamany, R., in the comet assay (Tice et al., 1997). Cross-linking obstructs the DNA Creppy, E.E., 1998. Cytotoxicity of fumonisin B1: implication of lipid peroxidation and inhibition of protein and DNA syntheses. Arch. Toxicol. 72, 233–236. uncoiling during alkaline denaturation, which retards the migration of Abel, S., Gelderblom, W.C.A., 1998. Oxidative damage and fumonisin B 1 -induced DNA fragments during electrophoresis. Interstrand cross-links espe- toxicity in primary rat hepatocytes and rat liver in vivo. 131, 121–131. cially can lead to a tighter binding of the DNA core (Fairbairn et al., Alexander, N.J., Proctor, R.H., McCormick, S.P., 2009. Genes, gene clusters, and biosynthesis of trichothecenes and fumonisins in Fusarium. Toxin Rev. 28, 198–215. 1995). As known, (Miyamae et al., 1997), cells with DNA cross-linking https://doi.org/10.1080/15569540903092142. lesions frequently show no increased or even decreased DNA migration Balajee, S.A., Kano, R., Baddley, J.W., Moser, S.A., Marr, K.A., Alexander, B.D., Andes, D., in the alkaline comet assay. Our results agree well with those ob- Kontoyiannis, D.P., Perrone, G., Peterson, S., Brandt, M.E., Pappas, P.G., Chiller, T., fi servations and suggest cross-linking as a possible mechanism of geno- 2009. Molecular identi cation of aspergillus species collected for the transplant-associated infection surveillance network. J. Clin. Microbiol. 47, 3138–3141. https:// toxicity. Based on the available literature, FBs alone did not contribute doi.org/10.1128/Jcm.01070-09. to the formation of cross-links, but at increasing concentrations at least Bartók, T., Tölgyesi, L., Szekeres, A., Varga, M., Bartha, R., Szécsi, Á, Bartók, M.,

169 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

Mesterházy, A., 2010. Detection and characterization of twenty-eight isomers of fu- mycotoxins in food, FAO food and nutrition paper. monisin B1 (FB1) mycotoxin in a solid rice culture infected with Fusarium verti- Jurjević, Z., Peterson, S.W., Stea, G., Solfrizzo, M., Varga, J., Hubka, V., Perrone, G., cillioides by reversed-phase high-performance liquid chromatography/electrospray 2012. Two novel species of Aspergillus section Nigri from indoor air. IMA Fungus 3, ionization time-of-flight and ion trap mass spectrometry. Rapid Commun. Mass 159–173. https://doi.org/10.5598/imafungus.2012.03.02.08. Spectrom. 24, 35–42. https://doi.org/10.1002/rcm.4353. Kothary, M.H., Chase, T., MacMillan, J.D., 1984. Correlation of elastase production by Blanco, J.L., Hontecillas, R., Bouza, E., Blanco, I., Pelaez, T., Muñoz, P., Perez Molina, J., some strains of Aspergillus fumigatus with ability to cause pulmonary invasive as- Garcia, M.E., 2002. Correlation between the elastase activity index and invasiveness pergillosis in mice. Infect. Immun. 43, 320–325. of clinical isolates of Aspergillus fumigatus. J. Clin. Microbiol. 40, 1811–1813. Kouadio, J.H., Mobio, A., Baudrimont, I., Moukha, S., 2005. Comparative study of cy- https://doi.org/10.1128/JCM.40.5.1811-1813.2002. totoxicity and oxidative stress induced by deoxynivalenol, zearalenone or fumonisin Bugni, T.S., Ireland, C.M., 2004. Marine-derived fungi: a chemically and biologically B1 in human intestinal cell line Caco-2. Toxicology 213, 56–65. https://doi.org/10. diverse group of microorganisms. Nat. Prod. Rep. 21, 143–163. https://doi.org/10. 1016/j.tox.2005.05.010. 1039/b301926h. Kredics, L., Varga, J., Antala, Z., Samson, R.A., Sandor, K., Narendranc, V., Bhaskard, M., Bünger, J., Westphal, G., Mönnich, A., Hinnendahl, B., Hallier, E., Müller, M., 2004. Manoharane, C., Csaba, V., Manikandanc, P., 2008. Black aspergilli in tropical in- Cytotoxicity of occupationally and environmentally relevant mycotoxins. Toxicology fections Black aspergilli in tropical infections. Rev. Med. Microbiol. 19, 65–78. 202, 199–211. https://doi.org/10.1016/j.tox.2004.05.007. https://doi.org/10.1097/MRM.0b013e3283280391. Carré, P.C., Mortenson, R.L., King, T.E., Noble, P.W., Sable, C.L., Riches, D.W., 1991. Lamboni, Y., Nielsen, K.F., Linnemann, A.R., Gezgin, Y., Hell, K., Nout, M.J.R., Smid, E.J., Increased expression of the interleukin-8 gene by alveolar macrophages in idiopathic Tamo, M., van Boekel, M.A.J.S., Hoof, J.B., Frisvad, J.C., 2016. Diversity in secondary pulmonary fibrosis. A potential mechanism for the recruitment and activation of metabolites including mycotoxins from strains of Aspergillus section Nigri isolated neutrophils in lung fibrosis. J. Clin. Invest. 88, 1802–1810. https://doi.org/10.1172/ from raw cashew nuts from Benin, West Africa. PLoS One 11, e0164310. https://doi. JCI115501. org/10.1371/journal.pone.0164310. Chacko, S., 2016. Comparison of pro-inflammatory cytokines (IL-6, IL- 1α and IL – 1β) Liu, Y., Wang, M., Wang, D., Li, X., Wang, W., Lou, H., Yuan, H., 2016. Malformin A 1 released by MPI and MARCO (− / –) knockout cells when stimulated by heat killed promotes cell death through induction of apoptosis, necrosis and autophagy in fungi- Candida albicans and Aspergillus niger. Plymouth Student Sci. 9, 4–23. prostate cancer cells. Cancer Chemother. Pharmacol. 77, 63–75. https://doi.org/10. Collins, Andrew R., 2004. The comet assay for DNA damage and repair: principles, ap- 1007/s00280-015-2915-4. plications, and limitations. Mol. Biotechnol. 26 (3), 249–261. https://doi.org/10. Logrieco, A., Bottalico, A., Mulé, G., Moretti, A., Perrone, G., 2003. Epidemiology of 1385/MB:26:3:249. (Humana Press). toxigenic fungi and their associated mycotoxins for some Mediterranean crops. Eur. J. Collins, A.R., Oscoz, A.A., Giovannelli, L., Brunborg, G., Gaiva, I., Kruszewski, M., Smith, Plant Pathol. https://doi.org/10.1023/A:1026033021542. C.C., 2008. The comet assay: topical issues. 23, 143–151. https://doi.org/10.1093/ Mahmoodi, M., Alizadeh, A.M., Sohanaki, H., Rezaei, N., Amini-Najafi, F., 2012. Impact mutage/gem051. of fumonisin B1 on the production of inflammatory cytokines by gastric and colon Domijan, A.-M., Zeljezić, D., Kopjar, N., Peraica, M., 2006. Standard and Fpg-modified cell lines. Iran J. Allergy Asthma Immunol. 11, 165–173. comet assay in kidney cells of ochratoxin A- and fumonisin B(1)-treated rats. Månsson, M., Klejnstrup, M.L., Phipps, R.K., Nielsen, K.F., Frisvad, J.C., Gotfredsen, C.H., Toxicology 222, 53–59. https://doi.org/10.1016/j.tox.2006.01.024. Larsen, T.O., 2010. Isolation and NMR characterization of fumonisin b2 and a new Duque, G.A., Descoteaux, A., 2014. Macrophage cytokines: involvement in immunity and fumonisin B6 from aspergillus niger. J. Agric. Food Chem. 58, 949–953. https://doi. infectious diseases. 5, 1–12. https://doi.org/10.3389/fimmu.2014.00491. org/10.1021/jf902834g. Eder, C., 2009. Mechanisms of interleukin-1 b release. Immunobiology 214, 543–553. McKean, C., Tang, L., Billam, M., Tang, M., Theodorakis, C.W., Kendall, R.J., Wang, J.S., https://doi.org/10.1016/j.imbio.2008.11.007. 2006. Comparative acute and combinative toxicity of aflatoxin B1 and T-2 toxin in EFSA, 2014. Evaluation of the increase of risk for public health related to a possible animals and immortalized human cell lines. J. Appl. Toxicol. 26, 139–147. https:// temporary derogation from the maximum level of deoxynivalenol, zearalenone and doi.org/10.1002/jat.1117. fumonisins for maize and maize products European Food Safety Authority. EFSA J. Minervini, F., Garbetta, A., Antuono, I.D., Cardinali, A., Antonio, N., Lucantonio, M., 12123699, 1–61. https://doi.org/10.2903/j.efsa.2014.3699. Visconti, A., 2014. Toxic mechanisms induced by fumonisin b 1 mycotoxin on human Ehrlich, V., Darroudi, F., Uhl, M., Steinkellner, H., Zsivkovits, M., 2002. Fumonisin B 1 is intestinal cell line 115–123. doi:https://doi.org/10.1007/s00244-014-0004-z. genotoxic in human derived hepatoma (HepG2) cells. Mutagenesis 17, 257–260. Miyamae, Y., Zaizen, K., Ohara, K., Mine, Y., 1997. Detection of DNA lesions induced by Fairbairn, D.W., Olive, P.L., Neill, K.L.O., 1995. The c o m e t assay: a comprehensive chemical mutagens by the single cell gel electrophoresis (Comet) assay. 1. review. Mutat. Res. 339, 37–59. Relationship between the onset of DNA damage and the characteristics of mutagens. Frisvad, J.C., Smedsgaard, J. orn, Samson, R.A., Larsen, T. homas O., Thrane, U. lf, 2007. Mutat. Res. 393, 99–106. Fumonisin B2 production by Aspergillus niger. J. Agric. Food Chem. 55, 9727–9732. Nielsen, K.F., Frisvad, J.C., Logrieco, A., 2015. Letter to the Editor: “Analyses of Black https://doi.org/10.1021/jf0718906. Aspergillus Species of Peanut and Maize for Ochratoxins and Fumonisins,” A Galvano, F., Campisi, A., Russo, A., Galvano, G., Palumbo, M., Renis, M., Barcellona, M.L., Comment on: J. Food Prot. 77(5):805–813 (2014). J. Food Prot. 78, 6–12. https:// Perez-Polo, J.R., Vanella, A., 2002a. DNA damage in astrocytes exposed to fumonisin doi.org/10.4315/0362-028X.78.1.6. B1. Neurochem. Res. 27, 345–351. https://doi.org/10.1023/A:1014971515377. Odhav, B., Adam, J.K., Bhoola, K.D., 2008. Modulating effects of fumonisin B1 and Galvano, F., Russo, A., Cardile, V., Galvano, G., Vanella, A., Renis, M., 2002b. DNA da- ochratoxin A on leukocytes and messenger cytokines of the human immune system. mage in human fibroblasts exposed to fumonisin B1. Food Chem. Toxicol. 40, 25–31. Int. Immunopharmacol. 8, 799–809. https://doi.org/10.1016/j.intimp.2008.01.030. https://doi.org/10.1016/S0278-6915(01)00083-7. Palumbo, J.D., O'Keeffe, T.L., Gorski, L., 2013. Multiplex PCR analysis of fumonisin Gautier, M., Ollivier, C.L., Cassagne, C., Reynaud-Gaubert, M., Dubus, J., Hendrickx, M., biosynthetic genes in fumonisin-nonproducing Aspergillus niger and A. awamori Gomez, C., Piarroux, R., 2016. Aspergillus tubingensis: a major filamentous fungus strains. Mycologia 105, 277–284. https://doi.org/10.3852/11-418. found in the airways of patients with lung disease. Med. Mycol. 1–12. https://doi. Park, S.J., Mehrad, B., 2009. Innate immunity to Aspergillus species. Clin. Microbiol. Rev. org/10.1093/mmy/myv118. 22, 535–551. https://doi.org/10.1128/CMR.00014-09. Gherbawy, Y., Elhariry, H., Kocsube, S., Bahobial, A., Deeb, B.E., Altalhi, A., Varga, J., Pel, H.J., de Winde, J.H., Archer, D.B., Dyer, P.S., Hofmann, G., Schaap, P.J., Turner, G., Vagvolgyi, C., 2015. Molecular characterization of black Aspergillus species from de Vries, R.P., Albang, R., Albermann, K., Andersen, M.R., Bendtsen, J.D., Benen, onion and their potential for ochratoxin a and fumonisin b2 production. Foodborne J.A.E., van den Berg, M., Breestraat, S., Caddick, M.X., Contreras, R., Cornell, M., Pathog. Dis. 12, 414–423. https://doi.org/10.1089/fpd.2014.1870. Coutinho, P.M., Danchin, E.G.J., Debets, A.J.M., Dekker, P., van Dijck, P.W.M., van Gutleb, A.C., Morrison, E., Murk, A.J., 2002. Cytotoxicity assays for mycotoxins produced Dijk, A., Dijkhuizen, L., Driessen, A.J.M., D'Enfert, C., Geysens, S., Goosen, C., Groot, by Fusarium strains: a review. Environ. Toxicol. Pharmacol. 11, 309–320. G.S.P., de Groot, P.W.J., Guillemette, T., Henrissat, B., Herweijer, M., van den Hiort, J., Maksimenka, K., Reichert, M., Perović-Ottstadt, S., Lin, W.H., Wray, V., Steube, Hombergh, J.P.T.W., van den Hondel, C.A.M.J.J., van der Heijden, R.T.J.M., van der K., Schaumann, K., Weber, H., Proksch, P., Ebel, R., Müller, W.E.G., Bringmann, G., Kaaij, R.M., Klis, F.M., Kools, H.J., Kubicek, C.P., van Kuyk, P.A., Lauber, J., Lu, X., 2004. New natural products from the sponge-derived fungus Aspergillus niger. J. Nat. van der Maarel, M.J.E.C., Meulenberg, R., Menke, H., Mortimer, M.A., Nielsen, J., Prod. 67, 1532–1543. https://doi.org/10.1021/np030551d. Oliver, S.G., Olsthoorn, M., Pal, K., van Peij, N.N.M.E., Ram, A.F.J., Rinas, U., Hong, S.-B., Lee, M., Kim, D.-H., Varga, J., Frisvad, J.C., Perrone, G., Gomi, K., Yamada, Roubos, J.A., Sagt, C.M.J., Schmoll, M., Sun, J., Ussery, D., Varga, J., Vervecken, W., O., Machida, M., Houbraken, J., Samson, R.A., 2013. Aspergillus luchuensis, an in- van de Vondervoort, P.J.J., Wedler, H., Wösten, H.A.B., Zeng, A.-P., van Ooyen, dustrially important black Aspergillus in East Asia. PLoS One 8, e63769. https://doi. A.J.J., Visser, J., Stam, H., 2007. Genome sequencing and analysis of the versatile cell org/10.1371/journal.pone.0063769. factory Aspergillus niger CBS 513.88. Nat. Biotechnol. 25, 221–231. https://doi.org/ Huang, H.-B., Xiao, Z., Feng, X., Huang, C., Zhu, X., Ju, J., Li, M., Lin, Y., Liu, L., She, Z., 10.1038/nbt1282. 2011. Cytotoxic naphtho- g -pyrones from the mangrove endophytic fungus Peraica, M., Ljubanovi, D., Domijan, A., 2008. The effect of a single dose of fumonisin B 1 Aspergillus tubingensis (GX1-5E). Helv. Chim. Acta 94, 1732–1740. on rat kidney. Croat. Chem. Acta 81, 119–124. Hulina, A., Grdić Rajković, M., Jakšić Despot, D., Jelić, D., Dojder, A., Čepelak, I., Perrone, G., Susca, A., Cozzi, G., Ehrlich, K., Varga, J., Frisvad, J.C., Meijer, M., Noonim, Rumora, L., 2017. Extracellular Hsp70 induces inflammation and modulates LPS/ P., Mahakamchanakul, W., Samson, R.A., 2007. Biodiversity of Aspergillus species in LTA-stimulated inflammatory response in THP-1 cells. Cell Stress Chaperones 1–12. some important agricultural products. Stud. Mycol. 59, 53–66. https://doi.org/10. https://doi.org/10.1007/s12192-017-0847-0. 3114/sim.2007.59.07. Jakšić Despot, D., Šegvić Klarić, M., 2014. A year-round investigation of indoor airborne Perrone, G., Stea, G., Epifani, F., Varga, J., Frisvad, J.C., Samson, R.A., 2011a. Aspergillus fungi in Croatia. Arh Hig Rada Toksikol 209–218. https://doi.org/10.2478/10004- niger contains the cryptic phylogenetic species A. awamori. Fungal Biol. 115, 1254-65-2014-2483. 1138–1150. https://doi.org/10.1016/j.funbio.2011.07.008. Jakšić Despot, D., Kocsubé, S., Bencsik, O., Kecskeméti, A., Szekeres, A., Vágvölgyi, C., Perrone, G., Stea, G., Epifani, F., Varga, J., Frisvad, J.C., Samson, R.A., 2011b. Aspergillus Varga, J., Šegvić Klarić, M., 2016. Species diversity and cytotoxic potency of airborne niger contains the cryptic phylogenetic species A. awamori. Fungal Biol. 115, sterigmatocystin-producing Aspergilli from the section Versicolores. Sci. Total 1138–1150. https://doi.org/10.1016/j.funbio.2011.07.008. Environ. 562, 296–304. https://doi.org/10.1016/j.scitotenv.2016.03.183. Proctor, R.H., Plattner, R.D., Desjardins, A.E., Busman, M., Butchko, R.A.E., 2006. Joint FAO/WHO Expert Committee on Food Additives., 2001. Safety evaluation of certain Fumonisin production in the maize pathogen Fusarium verticillioides: genetic basis of

170 š ć D. Jak i et al. Toxicology in Vitro 53 (2018) 160–171

naturally occurring chemical variation. J. Agric. Food Chem. 54, 2424–2430. https:// A., 2014. Variation in the fumonisin biosynthetic gene cluster in fumonisin-producing doi.org/10.1021/jf0527706. and nonproducing black aspergilli. Fungal Genet. Biol. 73, 39–52. https://doi.org/10. Samson, R.A., Houbraken, J.A.M.P., Kuijpers, A.F.A., Frank, J.M., Jens, C., Lyngby, D.-K., 1016/j.fgb.2014.09.009. 2004. New ochratoxin A or sclerotium producing species in Aspergillus section Nigri. Szigeti, G., Kocsubé, S., Dóczi, I., Bereczki, L., Vágvölgyi, C., Varga, J., 2012a. Molecular Stud. Mycol. 50, 45–61. identification and antifungal susceptibilities of black Aspergillus isolates from oto- Samson, R.A., Noonim, P., Meijer, M., Houbraken, J., Frisvad, J.C., Varga, J., 2007. mycosis cases in Hungary. Mycopathologia 174, 143–147. https://doi.org/10.1007/ Diagnostic tools to identify black Aspergilli. Stud. Mycol. 59, 129–145. https://doi. s11046-012-9529-8. org/10.3114/sim.2007.59.13. Szigeti, G., Sedaghati, E., Mahmoudabadi, A.Z., Naseri, A., Kocsubé, S., Vágvölgyi, C., Samson, R.a., Houbraken, J., Thrane, U., Frisvad, J.C., Andersen, B., 2010. Food and Varga, J., 2012b. Species assignment and antifungal susceptibilities of black aspergilli Indoor Fungi. CBS Laboratory Manual Series. CBS-KNAW Fungal Biodiversity Centre, recovered from otomycosis cases in Iran. Mycoses 55, 333–338. https://doi.org/10. Utrecht, The Netherlands. 1111/j.1439-0507.2011.02103.x. Sen, B., Asan, A., 2009. Fungal flora in indoor and outdoor air of different residential Taranu, I., Marin, D.E., Bouhet, S., Pascale, F., Bailly, J., Miller, J.D., Pinton, P., Oswald, houses in Tekirdag City (Turkey): seasonal distribution and relationship with climatic I.P., 2005. Mycotoxin fumonisin B1 alters the cytokine profile and decreases the factors. Environ. Monit. Assess. 151, 209–219. https://doi.org/10.1007/s10661-008- vaccinal antibody titer in pigs. Toxicol. Sci. 84, 301–307. https://doi.org/10.1093/ 0262-1. toxsci/kfi086. Seo, J. a, Proctor, R.H., Plattner, R.D., 2001. Characterization of four clustered and Tice, R.R., Yager, J.W., Andrews, P., Crecelius, E., 1997. Effect of hepatic methyl donor coregulated genes associated with fumonisin biosynthesis in Fusarium verticillioides. status on urinary excretion and DNA damage in B6C3Fl mice treated with sodium Fungal Genet. Biol. 34, 155–165. https://doi.org/10.1006/fgbi.2001.1299. arsenite. Mutat. Res. 386, 315–334. Sharma, D., Dutta, B.K., Singh, A.B., 2010. Exposure to indoor fungi in different working Varga, J., Kocsubé, S., Suri, K., Szigeti, G., Szekeres, a., Varga, M., Tóth, B., Bartók, T., environments: a comparative study. Aerobiologia (Bologna). 26, 327–337. https:// 2010. Fumonisin contamination and fumonisin producing black Aspergilli in dried doi.org/10.1007/s10453-010-9168-9. vine fruits of different origin. Int. J. Food Microbiol. 143, 143–149. https://doi.org/ Shier, W.T., Abbas, H.K., Mirocha, C.J., 1991. Toxicity of the mycotoxins fumonisins B1 10.1016/j.ijfoodmicro.2010.08.008. and B2 and Alternaria alternata f. Sp. lycopersici toxin (AAL) in cultured mammalian Varga, J., Frisvad, J.C., Kocsubé, S., Brankovics, B., Tóth, B., Szigeti, G., Samson, R.A., cells. Mycopathologia 116, 97–104. Varga, A., Frisvad, A., 2011. New and revisited species in Aspergillus section Nigri Singh, N.P., McCoy, M.T., Tice, R.R., Schneider, E.L., 1988. A simple technique for Extrolite analysis. Stud. Mycol. 69, 1–17. https://doi.org/10.3114/sim.2011.69.01. quantitation of low levels of DNA damage in individual cells. Exp. Cell Res. 175, Varga, J., Kocsube, S., Szigeti, G., Baranyi, N., Vagvlogyi, C., Despot, D.J., Magyar, D., 184–191. https://doi.org/10.1016/0014-4827(88)90265. Meijer, M., Samson, R.A., Klaric, M.S., 2014. Occurrence of black Aspergilli in indoor Suganuma, M., Okabe, S., Marino, M.W., Sakai, A., Sueoka, E., Fujiki, H., 1999. Advances environments of six countries. Arh. Hig. Rada Toksikol. 65, 219–223. https://doi. in brief essential role of tumor necrosis factor ␣ (TNF- ␣) in tumor promotion as re- org/10.2478/10004-1254-65-2014-2450. vealed by TNF- ␣ -deficient mice. 1, 4516–4518. Wang, H., Gloer, J.B., Wicklow, D.T., Dowd, P.F., 1995. Aflavinines and other anti- Susca, A., Proctor, R.H., Mulè, G., Stea, G., Ritieni, A., Logrieco, A., Moretti, A., 2010. insectan metabolites from the ascostromata of Eupenicillium crustaceum and related Correlation of mycotoxin fumonisin B2 production and presence of the fumonisin species. Appl. Environ. Microbiol. 61, 4429–4435. biosynthetic gene fum8 in Aspergillus niger from grape. J. Agric. Food Chem. 58, Zhang, G., Neumeister-Kemp, H., Garrett, M., Kemp, P., Stick, S., Franklin, P., 2013. 9266–9272. https://doi.org/10.1021/jf101591x. Exposure to airborne mould in school environments and nasal patency in children. Susca, A., Proctor, R.H., Butchko, R.A.E., Haidukowski, M., Stea, G., Logrieco, A., Moretti, Indoor Built Environ. 22, 608–617. https://doi.org/10.1177/1420326X12447534.

171