DOCSLIB.ORG

Egr2 and Egr3 in Regulatory T Cells Cooperatively Control Systemic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Egr2 and Egr3 in Regulatory T Cells Cooperatively Control Systemic Egr2 and Egr3 in regulatory T cells cooperatively PNAS PLUS control systemic autoimmunity through Ltbp3-mediated TGF-β3 production Kaoru Moritaa, Tomohisa Okamuraa,b,1, Mariko Inouea, Toshihiko Komaia, Shuzo Teruyaa, Yukiko Iwasakia, Shuji Sumitomoa, Hirofumi Shodaa, Kazuhiko Yamamotoa,b, and Keishi Fujioa,1 aDepartment of Allergy and Rheumatology, Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan; and bMax Planck–University of Tokyo Center for Integrative Inflammology, The University of Tokyo, 4-6-1 Komaba, Meguro-ku, Tokyo 153-8505 Japan Edited by Shimon Sakaguchi, WPI Immunology Frontier Research Center, Osaka University, Osaka, Japan, and approved November 11, 2016 (received for review July 11, 2016) Systemic lupus erythematosus (SLE) is a prototypical autoimmune treatment, additional approaches for regulating B-cell hyperactivity disease characterized by multiorgan inflammation induced by auto- are needed. antibodies. Early growth response gene 2 (Egr2), a transcription Regulatory T-cell (Treg) subsets play a major role in the main- factor essential for T-cell anergy induction, controls systemic auto- tenance of immune homeostasis and the prevention of auto- immunity in mice and humans. We have previously identified a immunity (4). The most extensively studied Treg subset is + + − + + + + + + subpopulation of CD4 regulatory T cells, CD4 CD25 LAG3 cells, CD4 CD25 Foxp3 Tregs (CD25 Tregs) (5). The CD25 Tregs that characteristically express both Egr2 and LAG3 and control mice exhibit their suppressive function mainly by expressing CTLA4 β model of lupus via TGF- 3 production. However, due to the mild and CD25 on their cell surface (6). We previously reported phenotype of lymphocyte-specific Egr2-deficient mice, the presence + − − + + CD4 CD25 Foxp3 LAG3 Tregs (LAG3 Tregs), which ex- of an additional regulator has been speculated. Here, we show that ert their suppressive activities via IL-10 production in a Foxp3- Egr2 and Egr3 expressed in T cells cooperatively prevent humoral + immune responses by supporting TGF-β3 secretion. T cell-specific independent manner (7). In contrast to CD25 Tregs, high-affinity interactions with peptide/MHC ligands expressed in the thymus Egr2/Egr3 double-deficient (Egr2/3DKO) mice spontaneously devel- + are not required for the development of LAG3 Tregs. oped an early onset lupus-like disease that was more severe than in + + + T cell-specific Egr2-deficient mice. In accordance with the observation Accumulating evidence has shown that CD4 CD25 Foxp3 + that CD4+CD25−LAG3+ cells from Egr2/3DKO mice completely lost CXCR5 Tregs called follicular regulatory T (Tfr) cells directly the capacity to produce TGF-β3, the excessive germinal center reac- control GC responses and humoral immunity. However, there is tion in Egr2/3DKO mice was suppressed by the adoptive transfer of + − + WT CD4 CD25 LAG3 cells or treatment with a TGF-β3–expressing Significance vector. Intriguingly, latent TGF-β binding protein (Ltbp)3 expression INFLAMMATION maintained by Egr2 and Egr3 was required for TGF-β3 production IMMUNOLOGY AND + − + Transcription factors early growth response gene 2 (Egr2) and from CD4 CD25 LAG3 cells. Because Egr2 and Egr3 did not demon- Egr3 have long been regarded as negative regulators of T-cell strate cell intrinsic suppression of the development of follicular activation. Egr2 is also known as a susceptibility gene for sys- helper T cells, Egr2- and Egr3-dependent TGF-β3 production by + − + temic lupus erythematosus characterized by dysregulated CD4 CD25 LAG3 cells is critical for controlling excessive B-cell humoral immune responses to autoantigens. Previously, we responses. The unique attributes of Egr2/Egr3 in T cells may provide reported that Egr2-expressing CD4+CD25-LAG3+ regulatory an opportunity for developing novel therapeutics for autoantibody- T cells regulate lupus pathogenesis via production of TGF-β3. mediated diseases including SLE. However, the role of Egr2 and Egr3 in the regulation of hu- moral immunity is unclear. Here we report that Egr2 and Egr3 β Egr2 | Egr3 | TGF- 3 | systemic lupus erythematosus | regulatory T cell regulate germinal center reactions by promoting TGF-β3 pro- duction from regulatory T cells. Egr2 and Egr3 induce the ex- ntibodies play critical roles in protecting us from infectious pression of latent TGF-β binding protein 3 (Ltbp3), which is Athreats. Effective humoral immune responses depend on required for TGF-β3 secretion. These findings suggest that Egr2 germinal center (GC) reactions. Follicular B cells encounter anti- and Egr3 in T cells may be potential novel therapeutic targets gen in the GC and receive T-cell help to differentiate into memory for autoantibody-mediated autoimmune diseases. B cells and long-lived plasma cells that produce high-affinity anti- bodies (1). However, aberrant humoral immune responses against Author contributions: K.M., T.O., K.Y., and K.F. designed research; K.M., T.O., M.I., T.K., S.T., self-antigens lead to the development of autoimmune diseases. Y.I., S.S., and H.S. performed research; K.M., T.O., M.I., T.K., S.T., Y.I., S.S., H.S., and K.F. contributed new reagents/analytic tools; K.M., T.O., K.Y., and K.F. analyzed data; and K.M., Indeed, suggestive clinical symptoms and the detection of autoan- T.O., K.Y., and K.F. wrote the paper. tibodies in patient sera are essential diagnostic elements. Systemic Conflict of interest statement: K.Y. received financial support or fees from AbbVie, Astellas, lupus erythematosus (SLE) is regarded as a prototypic autoimmune BMS, Daiichi-Sankyo, Mitsubishi Tanabe, Pfizer, Sanofi, Santen, Takeda, Teijin, Boehringer disease with loss of immune tolerance to nucleic acid antigens. Ingelheim, Chugai, Eisai, Ono, Taisho Toyama, UCB, ImmunoFuture, Asahi Kasei, and Antinuclear antibodies (ANAs), which are autoantibodies against Janssen. K.F. received financial support or fees from Astellas, BMS, Daiichi-Sankyo, Mitsubishi Tanabe, Pfizer, Santen, Takeda, Chugai, Eisai, Taisho Toyama, UCB, and Janssen. nuclear components, including dsDNA, are frequently found in The remaining authors declare no competing financial interests. patients with SLE (2). The importance of B cells in the patho- This article is a PNAS Direct Submission. genesis of SLE is further confirmed by the fact that anti–Bcell– Freely available online through the PNAS open access option. activating factor (BAFF) monoclonal antibody (Belimumab) was Data deposition: The sequence reported in this paper has been deposited in the GenBank approved by the Food and Drug Administration for treatment of database (accession no. NM_008520.2). SLE in 2011 (3). BAFF is a transmembrane protein member of the 1To whom correspondence may be addressed. Email: [email protected] or tomohisa- TNF ligand superfamily, and its overexpression is associated with [email protected]. both murine lupus and human SLE. However, as a sizeable pro- This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. portion of patients with SLE remain refractory to Belimumab 1073/pnas.1611286114/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1611286114 PNAS | Published online November 30, 2016 | E8131–E8140 Downloaded by guest on September 24, 2021 little evidence regarding the contributions of other Treg pop- development of a mild form of systemic autoimmunity at nearly ulations to humoral immune tolerance. Recently, we have reported 1yofage(8).ToinvestigatetheroleofEgr2andEgr3in + that LAG3 Tregs (7) regulate humoral immunity and lupus dis- T cells, we constructed a mouse strain in which both Egr2 and ease in MRL-Faslpr/lpr (MRL/lpr) mice via TGF-β3 production (8). Egr3 were deleted specifically in T cells. First, we established loxP- Although TGF-β1 is well known for its antiinflammatory effects flanked alleles encoding Egr3 (Egr3fl/fl)mice(Fig. S1A). Egr3fl/fl (9), we have previously revealed the regulatory activity of TGF-β3 mice and Egr2 floxed (Egr2fl/fl) mice (23) were then crossed with + + on humoral immune responses. LAG3 Tregs, which characteris- mice transgenic for Cd4-Cre mice to obtain Egr3fl/flEgr2fl/fl Cd4- + tically express the transcription factor early growth response gene Cre [Egr2 and Egr3 double conditional knockout (Egr2/3DKO)] 2 (Egr2), were identified as Foxp3-independent Tregs that produce mice. When efficiency of the Cre-mediated recombination in T high amounts of IL-10, and forced expression of Egr2 in naïve cells was evaluated in initial breedings (Fig. S1 B–D), Egr2 and T cells induced IL-10 and LAG3 expression (7). Furthermore, we Egr3 expression was abrogated in naïve T cells, but not in B cells, and our collaborators have also shown that polymorphisms in derived from Egr2/3DKO mice. Egr2/3DKO mice exhibited a EGR2 influence SLE susceptibility (10). Intriguingly, lymphocyte- statistically significant decrease in survival compared with WT specific Egr2-deficient mice develop a mild lupus-like autoimmune and Egr2CKO mice (Fig. 1A). Egr2/3DKO mice generated phenotype (11). These studies suggest that the expression of Egr2 higher concentrations of anti-dsDNA autoantibodies in their se- + in LAG3 Tregs contributes to the control of SLE pathogenesis. rum and progressive proteinuria (Fig. 1 B and C), which are the Egr2, a member of the Egr family, is a C2H2-type zinc finger hallmark features of SLE in humans (24). Antibodies to dsDNA transcription factor that was first identified as a major regulator of were also detected with the Crithidia luciliae immunofluorescence myelination and hindbrain development (12, 13). Egr2 deficiency tests (Fig. S2A). Egr2/3DKO mice also had inflammatory der- results in perinatal or neonatal death due to respiratory or feeding matitis, which was not observed in WT and Egr2CKO mice. Be- deficits (12). Recent studies have focused on the role of Egr2 in ginning at ∼16 wk of age, Egr2/3DKO mice developed skin immune responses and revealed that Egr2 is essential for full in- inflammation on their backs that was accompanied by hair loss duction of T-cell clonal anergy (14, 15). Egr2 has long been (Fig.
Load more

Recommended publications
  • Activated Peripheral-Blood-Derived Mononuclear Cells
    Transcription factor expression in lipopolysaccharide- activated peripheral-blood-derived mononuclear cells Jared C. Roach*†, Kelly D. Smith*‡, Katie L. Strobe*, Stephanie M. Nissen*, Christian D. Haudenschild§, Daixing Zhou§, Thomas J. Vasicek¶, G. A. Heldʈ, Gustavo A. Stolovitzkyʈ, Leroy E. Hood*†, and Alan Aderem* *Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103; ‡Department of Pathology, University of Washington, Seattle, WA 98195; §Illumina, 25861 Industrial Boulevard, Hayward, CA 94545; ¶Medtronic, 710 Medtronic Parkway, Minneapolis, MN 55432; and ʈIBM Computational Biology Center, P.O. Box 218, Yorktown Heights, NY 10598 Contributed by Leroy E. Hood, August 21, 2007 (sent for review January 7, 2007) Transcription factors play a key role in integrating and modulating system. In this model system, we activated peripheral-blood-derived biological information. In this study, we comprehensively measured mononuclear cells, which can be loosely termed ‘‘macrophages,’’ the changing abundances of mRNAs over a time course of activation with lipopolysaccharide (LPS). We focused on the precise mea- of human peripheral-blood-derived mononuclear cells (‘‘macro- surement of mRNA concentrations. There is currently no high- phages’’) with lipopolysaccharide. Global and dynamic analysis of throughput technology that can precisely and sensitively measure all transcription factors in response to a physiological stimulus has yet to mRNAs in a system, although such technologies are likely to be be achieved in a human system, and our efforts significantly available in the near future. To demonstrate the potential utility of advanced this goal. We used multiple global high-throughput tech- such technologies, and to motivate their development and encour- nologies for measuring mRNA levels, including massively parallel age their use, we produced data from a combination of two distinct signature sequencing and GeneChip microarrays.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • A Web-Platform for Analysis of Host Factors Involved in Viral Infections Discovered by Genome Wide Rnai Screen
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2017 vhfRNAi: A web-platform for analysis of host factors involved in viral infections discovered by genome wide RNAi screen Anamika Thakur#, Abid Qureshi# and Manoj Kumar* Bioinformatics Centre, Institute of Microbial Technology, Council of Scientific and Industrial Research, Sector 39A, Chandigarh-160036, India #Equal contribution * To whom correspondence should be addressed. Tel, 91-172-6665453; Fax, 91-172- 2690585; 91-172-2690632; Email, [email protected] Supplementary Tables Table S1: Statistics of unique and duplicate host factors in each virus Table S2: Table denoting genes common among different viruses Table S3: Statistics of GWAS analysis Table S1. Statistics of unique and duplicate host factors in each virus S. No. Virus Unique-Entries Duplicate-Entries 1. Adeno-associated virus (AAV) 926 533 2. Avian influenza virus (AIV) 0 11 3. Borna disease virus (BDV) 14 20 4. Dengue virus 2 (DEN-2) 27 13 5. Hepatitis C virus (HCV) 236 213 6. Human immunodeficiency virus 1 (HIV) 1388 857 7. Human parainfluenza virus 3 (HPIV-3) 0 27 8. Human herpesvirus 1 (HSV-1) 34 38 9. Influenza A virus (IAV) 700 513 10. Lymphocytic choriomeningitis virus (LCMV) 0 54 11. Marburgvirus (MARV) 0 11 12. Poliovirus (PV) 3340 1035 13. Rotavirus (RV) 347 175 14. Sendai virus (SeV) 32 27 15. Sindbis virus (SIV) 70 41 16. Vaccinia virus (VACV) 482 296 17. Vesicular stomatitis virus (VSV) 9 78 18. West Nile virus (WNV) 313 137 Table S1. Statistics of unique host factors for each virus having overlapping and unique factors in different viruses Non-overlap – Overall- S.
    [Show full text]
  • Identification of Hair Shaft Progenitors That Create a Niche for Hair Pigmentation
    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Identification of hair shaft progenitors that create a niche for hair pigmentation Chung-Ping Liao,1 Reid C. Booker,1 Sean J. Morrison,2,3,4,5,6 and Lu Q. Le1,4,5 1Department of Dermatology, 2Department of Pediatrics, 3Children’s Research Institute, 4Simmons Comprehensive Cancer Center, 5Hamon Center for Regenerative Science and Medicine, 6Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA Hair differentiates from follicle stem cells through progenitor cells in the matrix. In contrast to stem cells in the bulge, the identities of the progenitors and the mechanisms by which they regulate hair shaft components are poorly understood. Hair is also pigmented by melanocytes in the follicle. However, the niche that regulates follicular melanocytes is not well characterized. Here, we report the identification of hair shaft progenitors in the matrix that are differentiated from follicular epithelial cells expressing transcription factor KROX20. Depletion of Krox20 lin- eage cells results in arrest of hair growth, confirming the critical role of KROX20+ cells as antecedents of structural cells found in hair. Expression of stem cell factor (SCF) by these cells is necessary for the maintenance of differen- tiated melanocytes and for hair pigmentation. Our findings reveal the identities of hair matrix progenitors that regulate hair growth and pigmentation, partly by creating an SCF-dependent niche for follicular melanocytes. [Keywords: stem cell factor (SCF); hair pigmentation; hair shaft progenitor cell; hair follicle stem cell; hair matrix; KROX20] Supplemental material is available for this article.
    [Show full text]
  • The YAP/HIF-1Α/Mir-182/EGR2 Axis Is Implicated in Asthma Severity
    Zhou et al. Cell Biosci (2021) 11:84 https://doi.org/10.1186/s13578-021-00560-1 Cell & Bioscience RESEARCH Open Access The YAP/HIF-1α/miR-182/EGR2 axis is implicated in asthma severity through the control of Th17 cell diferentiation Jing Zhou1, Ning Zhang2, Wei Zhang1, Caiju Lu1 and Fei Xu1* Abstract Background: Asthma is a heterogeneous chronic infammatory disease of the airway, involving reversible airfow limitation and airway remodeling. T helper 17 (Th17) cells play an important role in the pathogenesis of allergic asthma. However, there is limited understanding of the signaling pathways controlling Th17 cell diferentiation in asthma. The aim of this study was to investigate if the Yes-associated protein (YAP)/hypoxia inducible factor-1α (HIF-1α)/microRNA-182 (miR-182)/early growth response 2 (EGR2) axis is involved in mediating Th17 cell diferentia- tion and disease severity in asthma. Methods: The study included 29 pediatric patients with asthma, 22 healthy volunteers, ovalbumin-induced murine asthma models, and mouse naive CD4+ T cells. The subpopulation of Th17 cells was examined by fow cytometry. The levels of interleukin-17A were determined by enzyme linked immunosorbent assay. Chromatin immunoprecipitation- quantitative polymerase chain reaction assays and dual-luciferase reporter gene assays were performed to examine interactions between HIF-1α and miR-182, and between miR-182 and EGR2. Results: YAP, HIF-1α, and miR-182 were upregulated but EGR2 was downregulated in human and mouse peripheral blood mononuclear cells from the asthma group. Abundant expression of YAP and HIF-1α promoted miR-182 expres- sion and then inhibited EGR2, a target of miR-182, thus enhancing Th17 diferentiation and deteriorating asthma and lipid metabolism dysfunction.
    [Show full text]
  • Gene Expression Profiling in the Striatum of Per2ko Mice Exhibiting
    Original Article Biomol Ther 29(2), 135-143 (2021) Gene Expression Profiling in the Striatum of Per2 KO Mice Exhibiting More Vulnerable Responses against Methamphetamine Mikyung Kim1,2,†, Se Jin Jeon3,†, Raly James Custodio1, Hyun Jun Lee1, Leandro Val Sayson1, Darlene Mae D. Ortiz1, Jae Hoon Cheong4,* and Hee Jin Kim1,* 1Uimyung Research Institute for Neuroscience, Department of Pharmacy, Sahmyook University, Seoul 01795, 2Department of Chemistry Life Science, Sahmyook University, Seoul 01795, 3School of Medicine and Center for Neuroscience Research, Konkuk University, Seoul 05029, 4School of Pharmacy, Jeonbuk National University, Jeonju 54896, Republic of Korea Abstract Drug addiction influences most communities directly or indirectly. Increasing studies have reported the relationship between circa- dian-related genes and drug addiction. Per2 disrupted mice exhibited more vulnerable behavioral responses against some drugs including methamphetamine (METH). However, its roles and mechanisms are still not clear. Transcriptional profiling analysis in Per2 knockout (KO) mice may provide a valuable tool to identify potential genetic involvement and pathways in enhanced behav- ioral responses against drugs. To explore the potential genetic involvement, we examined common differentially expressed genes (DEGs) in the striatum of drug naïve Per2 KO/wild-type (WT) mice, and before/after METH treatment in Per2 KO mice, but not in WT mice. We selected 9 common DEGs (Ncald, Cpa6, Pklr, Ttc29, Cbr2, Egr2, Prg4, Lcn2, and Camsap2) based on literature research. Among the common DEGs, Ncald, Cpa6, Pklr, and Ttc29 showed higher expression levels in drug naïve Per2 KO mice than in WT mice, while they were downregulated in Per2 KO mice after METH treatment.
    [Show full text]
  • Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals
    animals Review Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals Mohammadreza Mohammadabadi 1 , Farhad Bordbar 1,* , Just Jensen 2 , Min Du 3 and Wei Guo 4 1 Department of Animal Science, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman 77951, Iran; [email protected] 2 Center for Quantitative Genetics and Genomics, Aarhus University, 8210 Aarhus, Denmark; [email protected] 3 Washington Center for Muscle Biology, Department of Animal Sciences, Washington State University, Pullman, WA 99163, USA; [email protected] 4 Muscle Biology and Animal Biologics, Animal and Dairy Science, University of Wisconsin-Madison, Madison, WI 53558, USA; [email protected] * Correspondence: [email protected] Simple Summary: Skeletal muscle mass is an important economic trait, and muscle development and growth is a crucial factor to supply enough meat for human consumption. Thus, understanding (candidate) genes regulating skeletal muscle development is crucial for understanding molecular genetic regulation of muscle growth and can be benefit the meat industry toward the goal of in- creasing meat yields. During the past years, significant progress has been made for understanding these mechanisms, and thus, we decided to write a comprehensive review covering regulators and (candidate) genes crucial for muscle development and growth in farm animals. Detection of these genes and factors increases our understanding of muscle growth and development and is a great help for breeders to satisfy demands for meat production on a global scale. Citation: Mohammadabadi, M.; Abstract: Farm-animal species play crucial roles in satisfying demands for meat on a global scale, Bordbar, F.; Jensen, J.; Du, M.; Guo, W.
    [Show full text]
  • Features of Mirna Binding Sites in Mrnas of Bos Taurus ZNF Family Transcription Factors
    ICBMB 2016 International Conference on Biochemistry and Molecular Biology 27-29 April 2016, Venice, Italy Best Western Hotel Bologna Hall Tercicore Via Piave, 214, 30171 Venezia Mestre, Venezia VE, Italy Features of miRNA binding sites in mRNAs of Bos taurus ZNF family transcription factors Aigul Alybayeva1*, Raigul Niyazova1, Bernard Faye2, and Anatoly Ivashchenko1 1al-Farabi KazNU, Almaty, Kazakhstan, *[email protected]. 2CIRAD-ES Campus International de Baillarguet, 34398 Montpellier Cedex 1, France Abstract: miRNA binding sites in the mRNA nucleotide sequences of 247 transcription factor (TF) genes of Bos taurus ZNF family was established. miRNAs binding sites are located in the 5'UTRs, CDSs and 3'UTRs of mRNAs. miRNA binding sites in mRNAs were selected with the value ΔG/ΔGm equal or greater than 85%. miR-574 was identified from 749 Bos taurus miRNAs, it has binding sites with mRNAs of KLF7, SNAI2, WIZ, ZFP1, ZFP91-1, ZNF175, ZNF6772, ZSCAN29-1 genes. The value ΔG/ΔGm varied from 85 to 95%. The starts of miR-574 binding sites with mRNAs of KLF7, ZFP91-1, ZNF6772 genes are located through two nucleotides. miR-574 binding sites are located in the 3'UTR. miR-1260b has binding sites with mRNAs of 29 genes (BCL11B-1, CTCF-1, DPF2-1, EGR3, FEZF2, PRDM13, PRDM14, PRDM6, SALL1, SP6-2, SP8, WIZ, ZFX-1, ZFX-2, ZKSCAN1, ZNF219, ZNF335, ZNF341, ZNF384, ZNF48, ZNF513, ZNF618-1, ZNF653, ZNF668, ZNF746, ZNF75, ZNF805, ZNF774, ZSCAN20-1) which are located in the 3'UTRs, CDSs and 5'UTRs. The value ΔG/ΔGm varied from 85 to 91%. The starts of miR- 1260b binding sites in mRNAs of ZNF618-1 target gene are located through one nucleotide in the 5'UTR and with mRNAs of ZNF384, BCL11B-1 genes through three nucleotides in the CDSs.
    [Show full text]