DOCSLIB.ORG

Long-Read Sequencing of Benthophilinae Mitochondrial Genomes Reveals the Origins of Round Goby Mitogenome Re-Arrangements

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Long-Read Sequencing of Benthophilinae Mitochondrial Genomes Reveals the Origins of Round Goby Mitogenome Re-Arrangements Research Collection Journal Article Long-read sequencing of benthophilinae mitochondrial genomes reveals the origins of round goby mitogenome re-arrangements Author(s): Gutnik, Silvia; Walser, Jean-Claude; Adrian-Kalchhauser, Irene Publication Date: 2019-01-08 Permanent Link: https://doi.org/10.3929/ethz-b-000317088 Originally published in: Mitochondrial DNA Part B: Resources 4(1), http://doi.org/10.1080/23802359.2018.1547133 Rights / License: Creative Commons Attribution 4.0 International This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use. ETH Library Mitochondrial DNA Part B Resources ISSN: (Print) 2380-2359 (Online) Journal homepage: https://www.tandfonline.com/loi/tmdn20 Long-read sequencing of benthophilinae mitochondrial genomes reveals the origins of round goby mitogenome re-arrangements Silvia Gutnik, Jean-Claude Walser & Irene Adrian-Kalchhauser To cite this article: Silvia Gutnik, Jean-Claude Walser & Irene Adrian-Kalchhauser (2019) Long-read sequencing of benthophilinae mitochondrial genomes reveals the origins of round goby mitogenome re-arrangements, Mitochondrial DNA Part B, 4:1, 408-409, DOI: 10.1080/23802359.2018.1547133 To link to this article: https://doi.org/10.1080/23802359.2018.1547133 © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. Published online: 08 Jan 2019. Submit your article to this journal Article views: 78 View Crossmark data Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=tmdn20 MITOCHONDRIAL DNA PART B: RESOURCES 2019, VOL. 4, NO. 1, 408–409 https://doi.org/10.1080/23802359.2018.1547133 ARTICLE Long-read sequencing of benthophilinae mitochondrial genomes reveals the origins of round goby mitogenome re-arrangements Silvia Gutnika, Jean-Claude Walserb and Irene Adrian-Kalchhauserc aBiozentrum, Department Growth & Development, University of Basel, Basel, Switzerland; bGenetic Diversity Centre Zurich, ETH Zurich, Zurich, Switzerland;cProgram Man-Society-Environment, Department of Environmental Sciences, University of Basel, Basel, Switzerland ABSTRACT ARTICLE HISTORY Genetic innovation may be linked to evolutionary success, and indeed, the invasive round goby mito- Received 7 September 2018 chondrial genome sequence carries two novel features not previously described in Benthophilinae. Accepted 2 November 2018 First, the round goby mitochondrial genome carries a rearrangement of the tRNA cluster Ile-Glu-Met. KEYWORDS Second, the round goby mitochondrial genome features a 1250 bp non-coding sequence insertion Neogobius melanostomus; downstream of the D-loop region. In this publication, we test where in the goby phylogeny the novel mitogenome; D-loop; tRNA arrangement first arose and whether the sequence insertion is associated with invasive popula- transfer RNA; phylogeny tions only or a genuine feature of the species. We sequence native and invasive populations in Europe and North America, and show that all round gobies carry the sequence insertion. By sequencing the tRNA cluster in selected Gobiidae, we show that the tRNA arrangement arose at the root of the Benthophilinae species radiation. Introduction In this publication, we trace the phylogenetic origin of these two novel features. We test (a) whether the novel tRNA Recently, two novel mitochondrial genome features were arrangement first arose in the round goby, or originated ear- reported in the round goby (Adrian-Kalchhauser et al. 2017). lier in the goby phylogeny, and (b) whether the sequence The round goby is an invasive, small, benthic Ponto-Caspian insertion is a universal feature present in all round gobies fish species. It is native to the Black and Caspian Sea and their tributaries, and belongs to one of three tribes within or an anomaly associated with certain invasive populations the family of Benthophilinae (Neilson and Stepien 2009a). only. To locate the origin of the tRNA re-arrangement, we Many species of this family have colonized rivers and coasts compared existing and newly sequenced tRNA cluster outside the native range in Europe and North America arrangements in 10 gobiid species (5 members of the (Kornis et al. 2012; Roche et al. 2013). However, the round Benthophilinae, and 5 members of other gobiid families). To goby Neogobius melanostomus is the most successful invader determine whether the non-coding insert is a genuine fea- among them (Hirsch et al. 2015). ture of the species Neogobius melanostomus or an anomaly Genetic innovation may be linked to evolutionary success, associated with the Swiss invasive population, we analyzed a and indeed, the round goby mitochondrial genome sequence 7.5 kb region of the mitochondrial genome using Oxford carries two novel features. First, the round goby mitochon- Nanopore long read technology in individuals from the drial genome carries a rearrangement of the tRNA cluster native region and from three globally distributed between the ND1 and ND2 genes. In gobies generally, the invaded sites. cluster contains tRNA Isoleucine (forward orientation), tRNA Glutamine (reverse orientation) and tRNA Methionine (for- ward orientation), without any spacer sequence. In the round Materials and methods goby, the position of tRNA Isoleucine and tRNA Glutamine Origin of the round goby Gln-Ile-Met tRNA are swapped to yield the sequence Gln (rev) Ile (fw) Met (fw), rearrangment and tRNA genes are separated by up to 42 nucleotides of noncoding spacer sequence. Second, the round goby mito- Representative goby species were chosen for analysis based chondrial genome features a 1250 bp non-coding sequence on previous phylogenetic analyses (Neilson and Stepien insertion downstream of the D-loop region. The insert bears 2009a) to cover major branches of the Benthophilinae and only minimal similarities to D-loop repeats or any known sister groups. Sequences of Ponticola kessleri, Odontobutis sequence, and is flanked on both sides by potentially func- obscura and Gillichthys mirabilis were available at NCBI tional genes for tRNA Phenylalanine. (Sequence accession numbers: NC_025638.1, KT438552.1 and CONTACT Irene Adrian-Kalchhauser [email protected] University of Basel, Vesalgasse 1, 4051 Basel, Switzerland. ß 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MITOCHONDRIAL DNA PART B: RESOURCES 409 NC_012906.1, respectively). Sequences of Neogobius fluviatilis, acknowledgements). Samples were shipped as tissue samples Babka gymnotrachelus, Proterorhinus semilunaris, Zosterisessor in ethanol. ophiocephalus and Gobius niger were generated de novo in DNA isolations were done as described above. Then, a 7.5 this study. kb fragment of the mitochondrial genome spanning Tissue samples were obtained from collaborators (see Cytochrome b, the control region, and the region coding for acknowledgements) and shipped in 100% EtOH. DNA was 12S and 16S ribosomal RNA (Figure 2) was amplified using V isolated with standard phenol-chloroform extraction and pre- the LongAmp R Taq2xMastermix (New England Biolabs) with cipitation in the following way: tissues were lysed in ATL lysis forward primer SG082 (CCACCAACCCCAACAATAAG) and buffer from the DNeasy Blood & Tissue kit from QIAGEN reverse primer SG083 (AAGCATAGTCAAGGGGAGGAG) accord- according to the manufacturer’s instruction. For each 25 mg ing to the manufacturer’s instructions. PCR cycling conditions of tissue, 180 mL lysis buffer and 20 mL Proteinase K were were 94 C for 30 sec, followed by 35 cycles of amplification used. After lysis, residual debris was removed by centrifuga- with 94 C for 30 sec, 62.5 C for 1 min, 65 C for 7 min, fol- tion at 4 C for 10 min at 13,000 g in an Eppendorf lowed by an elongation step at 65 C for 10 min and a final Centrifuge 5423R. Then, proteins were removed by two 4 C step. Amplicon size was controlled by agarose gel rounds of phenol-chloroform-isoamylalcohol extraction electrophoresis. (25:24:1; Roth) and one round of chloroform extraction. DNA Then, samples were prepared for long-range sequencing was precipitated by adding 1/10 volume of sodium acetate with MinION technology (Oxford Nanopore). In a first step, (3 M, pH 5.2), and 2.5 volumes of 100% ethanol, incubating PCR reactions were cleaned using a 1:1 ratio of Agencourt m at À80 C for several hours, and centrifuging at 13,000 g for AMPure XP beads (Beckman Coulter) and eluted with 50 L 30 min in an Eppendorf Centrifuge 5423R. DNA pellets were of ddH2O. Then, samples were dA-tailed using the NEBNext washed by centrifugation in the presence of 1 ml of 70% dA-Tailing Module (New England Biolabs) according to the ‘ ’ EtOH for 10 min and then dried and dissolved in 100 mL protocol 1D PCR barcoding (96) genomic DNA (SQK-LSK108) using 45 mL DNA, 7 mL buffer, 3 mL Ultra II End-prep enzyme, ddH2O. DNA concentrations were measured using a TM 5 mL ddH2O, and incubated for 5 min at 20 C and 5 min at NanoDrop 2000 spectrophotometer. A 1850 bp fragment containing the genes for tRNAs Gln, Ile 65 C in a PCR machine. Residual nucleotides were removed and Met (Figure 1) was amplified using primers by cleaning with Agencourt AMPure XP beads (Beckman m fragment1_fw_mtGenome (CCCGATTCCGATATGACCAAC) and Coulter) as above. Half of the beads were eluted with 10 L of the respective barcode adaptor from the PCR 96 barcoding SG015 (CCACAGGTAAAATGGCTGAG) for Babka gymnotrachelus Kit (Oxford Nanopore) (instead of water; to reduce sample and Proterorhinus semilunaris,andprimersSG006 (ATGAGTGCGA volume and save enzyme in the next step), the other half GCCTCCTACC) and SG015 (see above) for Neogobius fluviatilis, was kept as backup. 10 mL of Blunt/TA Ligase Master Mix Proterorhinus semilunaris, Zosterisessor ophiocephalus and Gobius (New England Biolabs) was added and samples were incu- niger. The PCR mix was as follows: 14.4 mLddHO, 2 mL10Â 2 bated for 30 min at RT.
Load more

Recommended publications
  • Article Evolutionary Dynamics of the OR Gene Repertoire in Teleost Fishes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.09.434524; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Article Evolutionary dynamics of the OR gene repertoire in teleost fishes: evidence of an association with changes in olfactory epithelium shape Maxime Policarpo1, Katherine E Bemis2, James C Tyler3, Cushla J Metcalfe4, Patrick Laurenti5, Jean-Christophe Sandoz1, Sylvie Rétaux6 and Didier Casane*,1,7 1 Université Paris-Saclay, CNRS, IRD, UMR Évolution, Génomes, Comportement et Écologie, 91198, Gif-sur-Yvette, France. 2 NOAA National Systematics Laboratory, National Museum of Natural History, Smithsonian Institution, Washington, D.C. 20560, U.S.A. 3Department of Paleobiology, National Museum of Natural History, Smithsonian Institution, Washington, D.C., 20560, U.S.A. 4 Independent Researcher, PO Box 21, Nambour QLD 4560, Australia. 5 Université de Paris, Laboratoire Interdisciplinaire des Energies de Demain, Paris, France 6 Université Paris-Saclay, CNRS, Institut des Neurosciences Paris-Saclay, 91190, Gif-sur- Yvette, France. 7 Université de Paris, UFR Sciences du Vivant, F-75013 Paris, France. * Corresponding author: e-mail: [email protected]. !1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.09.434524; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Teleost fishes perceive their environment through a range of sensory modalities, among which olfaction often plays an important role.
    [Show full text]
  • Neogobius Melanostomus (Pallas, 1814) Lacking the Black Spot on the fi Rst Dorsal fi N – a Morphometric and Meristic Comparison
    Bulletin of Fish Biology Volume 16 Nos. 1/2 31.12.2016 1-14 Neogobius melanostomus (Pallas, 1814) lacking the black spot on the fi rst dorsal fi n – a morphometric and meristic comparison Neogobius melanostomus (Pallas, 1814) ohne schwarzen Fleck auf der ersten Rückenfl osse – ein morphologischer und meristischer Vergleich Mara Roß*, Iris Woltmann & Heiko Brunken Research Group Fish Ecology, City University of Applied Sciences Bremen, Neustadtswall 30, D-28199 Bremen, Germany *Corresponding author: [email protected] Summary: In 2014 a total of 488 specimens of round gobies was captured in the lower River Weser. These specimens exhibited two distinct pigmentation patterns of the fi rst dorsal fi n. Whereas in approximately 80 % of the individuals the characteristic large oblong black spot on the posterior part of the fi rst dorsal fi n was present, it was lacking in about 20 % of the specimens. This black spot is regarded as an important feature in species identifi cation. 200 voucher specimens, 100 individuals with spot and 100 lacking the typi- cal spot, were analyzed morphologically and meristically and compared statistically. Despite some scattered differences (i.e. ratio of preventral distance/standard length, the number of mid-lateral scales and number of mid-lateral scales of the caudal fi n) the two groups broadly corresponded. The results are consistent with fi ndings from invasive N. melanostomus in Lake Erie/North America, where a similar variation in pigmentation pattern was observed. Thus we assign the specimens of gobies exhibiting morphological characteristics of round gobies but lacking the black spot on the dorsal fi n to the species N.
    [Show full text]
  • Habitat Use of Invasive Monkey Goby (Neogobius Fluviatilis) And
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Repository of the Academy's Library Hydrobiologia (2019) 846:147–158 https://doi.org/10.1007/s10750-019-04060-9 (0123456789().,-volV)( 0123456789().,-volV) PRIMARY RESEARCH PAPER Habitat use of invasive monkey goby (Neogobius fluviatilis) and pumpkinseed (Lepomis gibbosus) in Lake Balaton (Hungary): a comparison of electrofishing and fyke netting István Czeglédi . Bálint Preiszner . Zoltán Vitál . Bernadett Kern . Nóra Boross . András Specziár . Péter Takács . Tibor Erős Received: 5 February 2019 / Revised: 23 August 2019 / Accepted: 26 August 2019 / Published online: 6 September 2019 © The Author(s) 2019 Abstract Detailed knowledge on the habitat pref- assessing habitat use and population structure of erence of invasive fishes and the bias of different invasive fishes. fishing methods in determining their population dynamic parameters are essential in fisheries man- Keywords Non-native fish · agement, ecology and conservation. This study was Anthropogenic habitat degradation · conducted to determine the habitat use and length Sampling methods · Habitat preference · frequency distribution of the invasive monkey goby Large lakes and pumpkinseed in the littoral zone of Lake Balaton (Hungary) using two different sampling methods, electrofishing and fyke netting. In general, both Introduction species preferred anthropogenically modified habitat types (rip-rap shorelines and harbours) compared Biological invasions are major contributors to the loss with natural reed habitats with silty-sand bottom. of biodiversity and the homogenisation of biota Length frequency distribution data showed significant worldwide (Rahel, 2000; Clavero & Garcı´a-Berthou, between-gear differences, since electrofishing 2005; Dudgeon et al., 2006). Human activity is resulted in the capture of larger individuals in greater rapidly transforming natural ecosystems and habitats proportion than fyke nets for both species.
    [Show full text]
  • Short Communication:A Study of Food Consumption of the Deepwater
    Iranian Journal of Fisheries Sciences 15(4) 1616-1623 2016 A study of food consumption of the deepwater Goby, Ponticola bathybius (Kessler, 1877), during spring migration in the southern Caspian Sea Tajbakhsh F.1; Abdoli A.A.2*; Rajabi Maham H.3; Hashemzadeh Segherloo I.4; Kiabi B.1 Received: January 2016 Accepted: May 2016 1-Department of Marine Biology, Faculty of Biological Sciences, Shahid Beheshti University, G. C., Tehran, Iran 2-Department of Biodiversity and Ecosystem Management, Environmental Sciences Research Institute, Shahid Beheshti University, G, C, Tehran, Iran 3-Department of Zoology, Faculty of Biological Sciences, Shahid Beheshti University, G. C., Tehran, Iran 4-Department of Aquaculture, Faculty of Natural Resources and Earth Sciences, University of Shahre Kord, 115, Iran *Corresponding author's email: [email protected] Keywords: Gobiidae, Feeding strategy, Modified Costello method, Caspian Sea, Iran. Introduction great consumers of food resources and the The Gobies exhibit a main role in the considerable competitors for other species general production of the Caspian Sea due (Corkum et al., 2004). According to Miller to their species diversity and unexploited (2003), fish are as dominant prey for larger stocks. So, of the 80 fish species known specimens of P. bathybius, while from Iranian part of the Caspian Sea, 10 of Crustacea are main prey for smaller them are gobies (Abdoli et al., 2012). The specimens (Gaibova and Ragimov, 1970). deepwater goby, Ponticola bathybius Also, Kalantarian et al. (2013) found out (Kessler, 1877), Gobiidae, is a native that this fish feed mainly on N. pallasi (in species in the Caspian Sea which settles on species N.
    [Show full text]
  • Arrival of Round Goby Neogobius Melanostomus (Pallas, 1814) and Bighead Goby Ponticola Kessleri (Günther, 1861) in the High Rhine (Switzerland)
    BioInvasions Records (2013) Volume 2, Issue 1: 79–83 Open Access doi: http://dx.doi.org/10.3391/bir.2013.2.1.14 © 2013 The Author(s). Journal compilation © 2013 REABIC Short Communication Arrival of round goby Neogobius melanostomus (Pallas, 1814) and bighead goby Ponticola kessleri (Günther, 1861) in the High Rhine (Switzerland) Irene Kalchhauser*, Peter Mutzner, Philipp E. Hirsch and Patricia Burkhardt-Holm Program Man-Society-Environment, Dept. of Environmental Sciences, University of Basel, Vesalgasse 1, 4051 Basel, Switzerland E-mail: [email protected] (IK), [email protected] (PM), [email protected] (PEH), [email protected] (PBH) *Corresponding author Received: 20 July 2012 / Accepted: 31 October 2012 / Published online: 22 November 2012 Handling editor: Vadim Panov Abstract A number of Ponto-Caspian gobiid species are currently invading European coasts and freshwaters. They do not only present a nuisance to fishermen, but evidence suggests that they compete with native benthic fishes and may contribute to changes in ecosystem function. This paper reports the presence of round goby Neogobius melanostomus individuals and an established population of bighead goby Ponticola kessleri in the High Rhine. Key words: gobiidae; non-native; alien; invasion; High Rhine; Switzerland 2001) was predicted to promote westward Introduction migration of fish species (Balon et al. 1986), including Ponto-Caspian gobiids (Proterorhinus Several goby species from the Caspian and Black marmoratus). In the meantime, five of six gobiid Sea are currently spreading in European rivers. species predicted to invade the Rhine (Freyhof Ponticola kessleri (Günther, 1861; Neilson and 2003) have indeed arrived. Their dispersal Stepien 2009), Neogobius melanostomus (Pallas, appears to be facilitated by shipping, as round 1814), Proterorhinus marmoratus (Pallas, 1814), goby dispersal has followed shipping routes Neogobius fluviatilis (Pallas, 1814), and Babka (Brown and Stepien 2009; LaRue et al.
    [Show full text]
  • Ponticola Bathybius (A Goby, No Common Name) Ecological Risk Screening Summary
    Ponticola bathybius (a goby, no common name) Ecological Risk Screening Summary U.S. Fish and Wildlife Service, March 2012 Revised, August 2018 Web Version, 10/28/2019 Photo: K. Abbasi. Licensed under CC BY-SA 3.0. Available: http://eol.org/pages/215017/overview. (August 2018). 1 Native Range and Status in the United States Native Range From Froese and Pauly (2018a): “Former USSR and Asia: Caspian Sea. Restricted to brackish water habitats [Patzner et al. 2011]” According to Naseka and Bogutskaya (2009), P. bathybius is endemic to the whole Caspian Sea. Status in the United States This species has not been reported as introduced or established in the United States. This species was not found in the aquarium trade. Means of Introductions in the United States This species has not been reported as introduced or established in the United States. Remarks According to Eschmeyer et al. (2018), historical synonyms for P. bathybius include Gobius bathybius, Chasar bathybius, and Neogobius bathybius. All synonyms were used to search for information for this report. 1 2 Biology and Ecology Taxonomic Hierarchy and Taxonomic Standing From Froese and Pauly (2018b): “Animalia (Kingdom) > Chordata (Phylum) > Vertebrata (Subphylum) > Gnathostomata (Superclass) > Actinopterygii (Class) > Perciformes (Order) > Gobioidei (Suborder) > Gobiidae (Family) > Gobiinae (Subfamily) > Ponticola (Genus) > Ponticola bathybius (Species)” From Eschmeyer et al. (2018): “bathybius, Gobius […] Current status: Valid as Ponticola bathybius (Kessler 1877).” Size, Weight, and Age Range From Froese and Pauly (2018a): “Max length : 29.3 cm TL male/unsexed; [Abdoli et al. 2009]” Environment From Froese and Pauly (2018a): “Brackish; demersal; depth range ? - 198 m [Eschmeyer 1998].” From Bani et al.
    [Show full text]
  • Caspian Goby (Neogobius Caspius) Ecological Risk Screening Summary
    Caspian Goby (Neogobius caspius) Ecological Risk Screening Summary U.S. Fish and Wildlife Service, March 2012 Revised, August 2018 Web Version, 8/2/2019 Photo: K. Abbasi. Licensed under CC BY-SA 3.0. Available: http://eol.org/pages/207518/overview. (August 2018). 1 Native Range and Status in the United States Native Range From Froese and Pauly (2018): “Europe and Asia: Caspian Sea.” From Eschmeyer et al. (2018): “Distribution: Caspian Sea basin, Eurasia.” Status in the United States There are no known occurrences in the United States. It does not appear that this species is in the trade in the United States based on a search of the literature and online aquarium retailers. Means of Introductions in the United States There are no known occurrences in the United States. 1 2 Biology and Ecology Taxonomic Hierarchy and Taxonomic Standing From ITIS (2018): “Kingdom Animalia Subkingdom Bilateria Infrakingdom Deuterostomia Phylum Chordata Subphylum Vertebrata Infraphylum Gnathostomata Superclass Actinopterygii Class Teleostei Superorder Acanthopterygii Order Perciformes Suborder Gobioidei Family Gobiidae Genus Neogobius Species Neogobius caspius (Eichwald, 1831)” From Eschmeyer et al. (2018): “Current status: Valid as Neogobius caspius (Eichwald 1831). Gobiidae: Gobiinae.” Size, Weight, and Age Range From Froese and Pauly (2018): “Max length : 34.5 cm TL male/unsexed; [Berg 1965]” Environment From Froese and Pauly (2018): “Brackish; demersal.” Climate/Range From Froese and Pauly (2018): “Temperate” Distribution Outside the United States Native From Froese and Pauly (2018): “Europe and Asia: Caspian Sea.” 2 From Eschmeyer et al. (2018): “Distribution: Caspian Sea basin, Eurasia.” Introduced No known introductions. Means of Introduction Outside the United States No known introductions.
    [Show full text]
  • Ethnobiology of Georgia
    SHOTA TUSTAVELI ZAAL KIKVIDZE NATIONAL SCIENCE FUNDATION ILIA STATE UNIVERSITY PRESS ETHNOBIOLOGY OF GEORGIA ISBN 978-9941-18-350-8 Tbilisi 2020 Ethnobiology of Georgia 2020 Zaal Kikvidze Preface My full-time dedication to ethnobiology started in 2012, since when it has never failed to fascinate me. Ethnobiology is a relatively young science with many blank areas still in its landscape, which is, perhaps, good motivation to write a synthetic text aimed at bridging the existing gaps. At this stage, however, an exhaustive representation of materials relevant to the ethnobiology of Georgia would be an insurmountable task for one author. My goal, rather, is to provide students and researchers with an introduction to my country’s ethnobiology. This book, therefore, is about the key traditions that have developed over a long history of interactions between humans and nature in Georgia, as documented by modern ethnobiologists. Acknowledgements: I am grateful to my colleagues – Rainer Bussmann, Narel Paniagua Zambrana, David Kikodze and Shalva Sikharulidze for the exciting and fruitful discussions about ethnobiology, and their encouragement for pushing forth this project. Rainer Bussmann read the early draft of this text and I am grateful for his valuable comments. Special thanks are due to Jana Ekhvaia, for her crucial contribution as project coordinator and I greatly appreciate the constant support from the staff and administration of Ilia State University. Finally, I am indebted to my fairy wordmother, Kate Hughes whose help was indispensable at the later stages of preparation of this manuscript. 2 Table of contents Preface.......................................................................................................................................................... 2 Chapter 1. A brief introduction to ethnobiology......................................................................................
    [Show full text]
  • Regional Fish-Based Biostratigraphy of the Late Neogene and Pleistocene of Southeastern Europe
    Vestnik zoologii, 51(5): 375–392, 2017 DOI 10.1515/vzoo-2017-0045 UDC 551.7(82+9):567.5(47) REGIONAL FISH-BASED BIOSTRATIGRAPHY OF THE LATE NEOGENE AND PLEISTOCENE OF SOUTHEASTERN EUROPE О. М. Kovalchuk National Museum of Natural History NAS of Ukraine, B. Khmelnitsky st., 15, Kyiv, 01030 Ukraine E-mail: [email protected] Regional Fish-Based Biostratigraphy of the Late Neogene and Pleistocene of Southeastern Europe. Kovalchuk, О. М. — Th is paper presents analytical results of the study of numerous freshwater fi sh fossils from almost 40 localities in the territory of southeastern Europe. It has been established that freshwater fi shes can be regarded as parastratigraphic group suitable for biostratigraphic studies. Ten ichthyofaunal assemblages have been distinguished and characterized in the paper. Th ese assemblages represent successive developmental stages in freshwater fi sh communities within southeastern Europe during the late Miocene, Pliocene and Pleistocene. Indices of evolutionary transformations (extinction rate, origination rate, taxonomic rotation) for ichthyofaunal assemblages have been calculated, and their trend is discussed herein. Key words: freshwater fi shes, faunal assemblage, evolution, Cenozoic, Eastern Europe. Introduction Th e modern zoogeographical structure of freshwater ichthyofauna of the Northern hemisphere was formed in general terms during the late Cenozoic (Sytchevskaya, 1989). Restoration of the key stages and features of this process is impossible without a detailed study of numerous fossil remains of bony fi shes, originating from alluvial deposits of heterochronous localities. Th e historical and faunal analysis of paleoichthyological material from the south of Eastern Europe allows us tracing the temporal change in the groups of freshwater fi sh, to determine the time of appearance of individual modern taxa and their groups in the paleontological record, to fi nd out the centers of their origin and ways of distribution, as well as to indicate some regional features of the formation of their ranges in time.
    [Show full text]
  • A Dissertation Entitled Evolution, Systematics
    A Dissertation Entitled Evolution, systematics, and phylogeography of Ponto-Caspian gobies (Benthophilinae: Gobiidae: Teleostei) By Matthew E. Neilson Submitted as partial fulfillment of the requirements for The Doctor of Philosophy Degree in Biology (Ecology) ____________________________________ Adviser: Dr. Carol A. Stepien ____________________________________ Committee Member: Dr. Christine M. Mayer ____________________________________ Committee Member: Dr. Elliot J. Tramer ____________________________________ Committee Member: Dr. David J. Jude ____________________________________ Committee Member: Dr. Juan L. Bouzat ____________________________________ College of Graduate Studies The University of Toledo December 2009 Copyright © 2009 This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. _______________________________________________________________________ An Abstract of Evolution, systematics, and phylogeography of Ponto-Caspian gobies (Benthophilinae: Gobiidae: Teleostei) Matthew E. Neilson Submitted as partial fulfillment of the requirements for The Doctor of Philosophy Degree in Biology (Ecology) The University of Toledo December 2009 The study of biodiversity, at multiple hierarchical levels, provides insight into the evolutionary history of taxa and provides a framework for understanding patterns in ecology. This is especially poignant in invasion biology, where the prevalence of invasiveness in certain taxonomic groups could
    [Show full text]
  • The Round Goby (Neogobius Melanostomus):A Review of European and North American Literature
    ILLINOI S UNIVERSITY OF ILLINOIS AT URBANA-CHAMPAIGN PRODUCTION NOTE University of Illinois at Urbana-Champaign Library Large-scale Digitization Project, 2007. CI u/l Natural History Survey cF Library (/4(I) ILLINOIS NATURAL HISTORY OT TSrX O IJX6V E• The Round Goby (Neogobius melanostomus):A Review of European and North American Literature with notes from the Round Goby Conference, Chicago, 1996 Center for Aquatic Ecology J. Ei!en Marsden, Patrice Charlebois', Kirby Wolfe Illinois Natural History Survey and 'Illinois-Indiana Sea Grant Lake Michigan Biological Station 400 17th St., Zion IL 60099 David Jude University of Michigan, Great Lakes Research Division 3107 Institute of Science & Technology Ann Arbor MI 48109 and Svetlana Rudnicka Institute of Fisheries Varna, Bulgaria Illinois Natural History Survey Lake Michigan Biological Station 400 17th Sti Zion, Illinois 6 Aquatic Ecology Technical Report 96/10 The Round Goby (Neogobius melanostomus): A Review of European and North American Literature with Notes from the Round Goby Conference, Chicago, 1996 J. Ellen Marsden, Patrice Charlebois1, Kirby Wolfe Illinois Natural History Survey and 'Illinois-Indiana Sea Grant Lake Michigan Biological Station 400 17th St., Zion IL 60099 David Jude University of Michigan, Great Lakes Research Division 3107 Institute of Science & Technology Ann Arbor MI 48109 and Svetlana Rudnicka Institute of Fisheries Varna, Bulgaria The Round Goby Conference, held on Feb. 21-22, 1996, was sponsored by the Illinois-Indiana Sea Grant Program, and organized by the
    [Show full text]
  • Transposable Elements and Teleost Migratory Behaviour
    International Journal of Molecular Sciences Article Transposable Elements and Teleost Migratory Behaviour Elisa Carotti 1,†, Federica Carducci 1,†, Adriana Canapa 1, Marco Barucca 1,* , Samuele Greco 2 , Marco Gerdol 2 and Maria Assunta Biscotti 1 1 Department of Life and Environmental Sciences, Polytechnic University of Marche, Via Brecce Bianche, 60131 Ancona, Italy; [email protected] (E.C.); [email protected] (F.C.); [email protected] (A.C.); [email protected] (M.A.B.) 2 Department of Life Sciences, University of Trieste, Via L. Giorgieri, 5-34127 Trieste, Italy; [email protected] (S.G.); [email protected] (M.G.) * Correspondence: [email protected] † Equal contribution. Abstract: Transposable elements (TEs) represent a considerable fraction of eukaryotic genomes, thereby contributing to genome size, chromosomal rearrangements, and to the generation of new coding genes or regulatory elements. An increasing number of works have reported a link between the genomic abundance of TEs and the adaptation to specific environmental conditions. Diadromy represents a fascinating feature of fish, protagonists of migratory routes between marine and fresh- water for reproduction. In this work, we investigated the genomes of 24 fish species, including 15 teleosts with a migratory behaviour. The expected higher relative abundance of DNA transposons in ray-finned fish compared with the other fish groups was not confirmed by the analysis of the dataset considered. The relative contribution of different TE types in migratory ray-finned species did not show clear differences between oceanodromous and potamodromous fish. On the contrary, a remarkable relationship between migratory behaviour and the quantitative difference reported for short interspersed nuclear (retro)elements (SINEs) emerged from the comparison between anadro- mous and catadromous species, independently from their phylogenetic position.
    [Show full text]