Research Collection Journal Article Long-read sequencing of benthophilinae mitochondrial genomes reveals the origins of round goby mitogenome re-arrangements Author(s): Gutnik, Silvia; Walser, Jean-Claude; Adrian-Kalchhauser, Irene Publication Date: 2019-01-08 Permanent Link: https://doi.org/10.3929/ethz-b-000317088 Originally published in: Mitochondrial DNA Part B: Resources 4(1), http://doi.org/10.1080/23802359.2018.1547133 Rights / License: Creative Commons Attribution 4.0 International This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use. ETH Library Mitochondrial DNA Part B Resources ISSN: (Print) 2380-2359 (Online) Journal homepage: https://www.tandfonline.com/loi/tmdn20 Long-read sequencing of benthophilinae mitochondrial genomes reveals the origins of round goby mitogenome re-arrangements Silvia Gutnik, Jean-Claude Walser & Irene Adrian-Kalchhauser To cite this article: Silvia Gutnik, Jean-Claude Walser & Irene Adrian-Kalchhauser (2019) Long-read sequencing of benthophilinae mitochondrial genomes reveals the origins of round goby mitogenome re-arrangements, Mitochondrial DNA Part B, 4:1, 408-409, DOI: 10.1080/23802359.2018.1547133 To link to this article: https://doi.org/10.1080/23802359.2018.1547133 © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. Published online: 08 Jan 2019. Submit your article to this journal Article views: 78 View Crossmark data Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=tmdn20 MITOCHONDRIAL DNA PART B: RESOURCES 2019, VOL. 4, NO. 1, 408–409 https://doi.org/10.1080/23802359.2018.1547133 ARTICLE Long-read sequencing of benthophilinae mitochondrial genomes reveals the origins of round goby mitogenome re-arrangements Silvia Gutnika, Jean-Claude Walserb and Irene Adrian-Kalchhauserc aBiozentrum, Department Growth & Development, University of Basel, Basel, Switzerland; bGenetic Diversity Centre Zurich, ETH Zurich, Zurich, Switzerland;cProgram Man-Society-Environment, Department of Environmental Sciences, University of Basel, Basel, Switzerland ABSTRACT ARTICLE HISTORY Genetic innovation may be linked to evolutionary success, and indeed, the invasive round goby mito- Received 7 September 2018 chondrial genome sequence carries two novel features not previously described in Benthophilinae. Accepted 2 November 2018 First, the round goby mitochondrial genome carries a rearrangement of the tRNA cluster Ile-Glu-Met. KEYWORDS Second, the round goby mitochondrial genome features a 1250 bp non-coding sequence insertion Neogobius melanostomus; downstream of the D-loop region. In this publication, we test where in the goby phylogeny the novel mitogenome; D-loop; tRNA arrangement first arose and whether the sequence insertion is associated with invasive popula- transfer RNA; phylogeny tions only or a genuine feature of the species. We sequence native and invasive populations in Europe and North America, and show that all round gobies carry the sequence insertion. By sequencing the tRNA cluster in selected Gobiidae, we show that the tRNA arrangement arose at the root of the Benthophilinae species radiation. Introduction In this publication, we trace the phylogenetic origin of these two novel features. We test (a) whether the novel tRNA Recently, two novel mitochondrial genome features were arrangement first arose in the round goby, or originated ear- reported in the round goby (Adrian-Kalchhauser et al. 2017). lier in the goby phylogeny, and (b) whether the sequence The round goby is an invasive, small, benthic Ponto-Caspian insertion is a universal feature present in all round gobies fish species. It is native to the Black and Caspian Sea and their tributaries, and belongs to one of three tribes within or an anomaly associated with certain invasive populations the family of Benthophilinae (Neilson and Stepien 2009a). only. To locate the origin of the tRNA re-arrangement, we Many species of this family have colonized rivers and coasts compared existing and newly sequenced tRNA cluster outside the native range in Europe and North America arrangements in 10 gobiid species (5 members of the (Kornis et al. 2012; Roche et al. 2013). However, the round Benthophilinae, and 5 members of other gobiid families). To goby Neogobius melanostomus is the most successful invader determine whether the non-coding insert is a genuine fea- among them (Hirsch et al. 2015). ture of the species Neogobius melanostomus or an anomaly Genetic innovation may be linked to evolutionary success, associated with the Swiss invasive population, we analyzed a and indeed, the round goby mitochondrial genome sequence 7.5 kb region of the mitochondrial genome using Oxford carries two novel features. First, the round goby mitochon- Nanopore long read technology in individuals from the drial genome carries a rearrangement of the tRNA cluster native region and from three globally distributed between the ND1 and ND2 genes. In gobies generally, the invaded sites. cluster contains tRNA Isoleucine (forward orientation), tRNA Glutamine (reverse orientation) and tRNA Methionine (for- ward orientation), without any spacer sequence. In the round Materials and methods goby, the position of tRNA Isoleucine and tRNA Glutamine Origin of the round goby Gln-Ile-Met tRNA are swapped to yield the sequence Gln (rev) Ile (fw) Met (fw), rearrangment and tRNA genes are separated by up to 42 nucleotides of noncoding spacer sequence. Second, the round goby mito- Representative goby species were chosen for analysis based chondrial genome features a 1250 bp non-coding sequence on previous phylogenetic analyses (Neilson and Stepien insertion downstream of the D-loop region. The insert bears 2009a) to cover major branches of the Benthophilinae and only minimal similarities to D-loop repeats or any known sister groups. Sequences of Ponticola kessleri, Odontobutis sequence, and is flanked on both sides by potentially func- obscura and Gillichthys mirabilis were available at NCBI tional genes for tRNA Phenylalanine. (Sequence accession numbers: NC_025638.1, KT438552.1 and CONTACT Irene Adrian-Kalchhauser [email protected] University of Basel, Vesalgasse 1, 4051 Basel, Switzerland. ß 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MITOCHONDRIAL DNA PART B: RESOURCES 409 NC_012906.1, respectively). Sequences of Neogobius fluviatilis, acknowledgements). Samples were shipped as tissue samples Babka gymnotrachelus, Proterorhinus semilunaris, Zosterisessor in ethanol. ophiocephalus and Gobius niger were generated de novo in DNA isolations were done as described above. Then, a 7.5 this study. kb fragment of the mitochondrial genome spanning Tissue samples were obtained from collaborators (see Cytochrome b, the control region, and the region coding for acknowledgements) and shipped in 100% EtOH. DNA was 12S and 16S ribosomal RNA (Figure 2) was amplified using V isolated with standard phenol-chloroform extraction and pre- the LongAmp R Taq2xMastermix (New England Biolabs) with cipitation in the following way: tissues were lysed in ATL lysis forward primer SG082 (CCACCAACCCCAACAATAAG) and buffer from the DNeasy Blood & Tissue kit from QIAGEN reverse primer SG083 (AAGCATAGTCAAGGGGAGGAG) accord- according to the manufacturer’s instruction. For each 25 mg ing to the manufacturer’s instructions. PCR cycling conditions of tissue, 180 mL lysis buffer and 20 mL Proteinase K were were 94 C for 30 sec, followed by 35 cycles of amplification used. After lysis, residual debris was removed by centrifuga- with 94 C for 30 sec, 62.5 C for 1 min, 65 C for 7 min, fol- tion at 4 C for 10 min at 13,000 g in an Eppendorf lowed by an elongation step at 65 C for 10 min and a final Centrifuge 5423R. Then, proteins were removed by two 4 C step. Amplicon size was controlled by agarose gel rounds of phenol-chloroform-isoamylalcohol extraction electrophoresis. (25:24:1; Roth) and one round of chloroform extraction. DNA Then, samples were prepared for long-range sequencing was precipitated by adding 1/10 volume of sodium acetate with MinION technology (Oxford Nanopore). In a first step, (3 M, pH 5.2), and 2.5 volumes of 100% ethanol, incubating PCR reactions were cleaned using a 1:1 ratio of Agencourt m at À80 C for several hours, and centrifuging at 13,000 g for AMPure XP beads (Beckman Coulter) and eluted with 50 L 30 min in an Eppendorf Centrifuge 5423R. DNA pellets were of ddH2O. Then, samples were dA-tailed using the NEBNext washed by centrifugation in the presence of 1 ml of 70% dA-Tailing Module (New England Biolabs) according to the ‘ ’ EtOH for 10 min and then dried and dissolved in 100 mL protocol 1D PCR barcoding (96) genomic DNA (SQK-LSK108) using 45 mL DNA, 7 mL buffer, 3 mL Ultra II End-prep enzyme, ddH2O. DNA concentrations were measured using a TM 5 mL ddH2O, and incubated for 5 min at 20 C and 5 min at NanoDrop 2000 spectrophotometer. A 1850 bp fragment containing the genes for tRNAs Gln, Ile 65 C in a PCR machine. Residual nucleotides were removed and Met (Figure 1) was amplified using primers by cleaning with Agencourt AMPure XP beads (Beckman m fragment1_fw_mtGenome (CCCGATTCCGATATGACCAAC) and Coulter) as above. Half of the beads were eluted with 10 L of the respective barcode adaptor from the PCR 96 barcoding SG015 (CCACAGGTAAAATGGCTGAG) for Babka gymnotrachelus Kit (Oxford Nanopore) (instead of water; to reduce sample and Proterorhinus semilunaris,andprimersSG006 (ATGAGTGCGA volume and save enzyme in the next step), the other half GCCTCCTACC) and SG015 (see above) for Neogobius fluviatilis, was kept as backup. 10 mL of Blunt/TA Ligase Master Mix Proterorhinus semilunaris, Zosterisessor ophiocephalus and Gobius (New England Biolabs) was added and samples were incu- niger. The PCR mix was as follows: 14.4 mLddHO, 2 mL10Â 2 bated for 30 min at RT.