Cell Cycle Inhibitory Effects of HIV and SIV Vpr and Vpx in the Yeast Schizosaccharomyces Pombe

VIROLOGY 230, 103–112 (1997) ARTICLE NO. VY978459

Cell Cycle Inhibitory Effects of HIV and SIV Vpr and Vpx in the Yeast Schizosaccharomyces pombe

CHENGSHENG ZHANG, COLIN RASMUSSEN,*,†,‡,1 and LUNG-JI CHANG

Department of Medical Microbiology and Immunology, *Department of Anatomy and Cell Biology, †Department of Biochemistry, and ‡Department of Oncology, University of Alberta, Edmonton, Alberta, Canada T6G 2H7 Received November 25, 1996; returned to author for revision December 24, 1996; accepted January 23, 1997

The Vpr gene of human immunodeficiency virus type 1 and type 2 (HIV-1, HIV-2) and simian immunodeficiency virus (SIV) encodes a small nuclear protein which is virion-associated and assists nuclear transport of the preintegration complex. Expression of HIV-1 Vpr has been shown to induce differentiation and prevent proliferation of human cells. HIV-1 Vpr has also been shown to arrest cell growth and cause morphological defects in yeast. In contrast, the Vpx gene of HIV-2 and SIV, which shares sequence homology with Vpr, does not seem to inhibit proliferation of human cells. It has been suggested that the cell cycle arrest effect of Vpr and Vpx is species and cell-type dependent. In this study, we have taken advantage of a conditional expression system to characterize the growth inhibitory effects of Vpr and Vpx of HIV-1, HIV-2, and SIV in the fission yeast Schizosaccharomyces pombe. Our results show that both Vpr and/or Vpx of HIV-1, HIV-2, and SIV arrest cell growth in S. pombe, and HIV-1 Vpr is more cytotoxic than HIV-2 or SIV Vpr or Vpx. Flow cytometry analysis indicated

that yeast cells cease proliferating with DNA contents indicative of arrest in G1 and G2 , with some cells showing signs of overreplication of DNA. While the observed cell cycle arrest phenotype was not identical to that observed in mammalian cells, there were similarities of growth arrest phenotype caused by Vpr and Vpx in yeast and mammalian cells. Specifically,

the observation that yeast and mammalians cell both arrest in G2 with reduced p34/cdc2 kinase activity indicates that Vpr and Vpx interact with conserved target(s) in yeast and mammalian cells. The ability to use genetic analysis to elucidate the mechanisms involved makes S. pombe an excellent model system in which to study the effects of Vpr and Vpx on cellular function. ᭧ 1997 Academic Press

INTRODUCTION of either Vpr or Vpx (Franchini and Reitz, 1994; Subbra- manian and Cohen, 1994; Tristem et al., 1992). HIV-1/ The lentiviruses, human immunodeficiency virus type 1 SIVcpz , SIVmad , and SIVsyk contain the Vpr gene only. HIV- (HIV-1) and type 2 (HIV-2), and simian immunodeficiency 2/SIVsm/SIVmac contains both Vpr and Vpx, whereas SIVagm virus (SIV), have been identified as the etiologic agents encodes Vpx only. Since the Vpr and Vpx proteins are of human acquired immunodeficiency syndrome (AIDS) found in mature virions, it has been thought they play a and simian AIDS, respectively (Levy, 1995). HIV-1, HIV- role in the early phase of the viral life cycle (Aldrovandi 2, and SIV contain, in addition to the gag, pol, and env and Zack, 1996; Cohen et al., 1990; Levy, 1995; Yu et al., structural genes, small open reading frames encoding 1990). Recent studies suggest that Vpr and the matrix the accessory proteins Tat, Rev, Nef, Vpr and/or Vpx, protein of HIV-1 are required for nuclear migration of the Vpu, and Vif (Vaishnav and Wong-Staal, 1991). These preintegration complex (Bukrinsky et al., 1993; Hein- genes are highly conserved between HIV-1, HIV-2, and zinger et al., 1994). Vpr has also been reported to prevent SIV and have been found to play important regulatory establishment of chronically infected HIV-1 producer cell roles during viral replication (Subbramanian and Cohen, lines (Planelles et al., 1996; Rogel et al., 1995). This is 1994; Trono, 1995). While these accessory proteins have consistent with an earlier report which showed that HIV- been shown to be dispensable for virus replication in 1 Vpr expression could prevent cell division and induce vitro, animal model studies of the SIVmac virus suggest differentiation of a rhabdomyosarcoma cell line (Levy et these proteins are important in virus replication and al., 1993). More recent studies have shown that HIV-1 pathogenesis in vivo (Aldrovandi and Zack, 1996; Desro- Vpr can arrest the cell cycle in G2 phase in mammalian siers, 1990; Gibbs et al., 1995; Lang et al., 1993; Trono, cells, possibly via inhibition of p34/cdc2 kinase activity 1995). (Bartz et al., 1996; He et al., 1995; Jowett et al., 1995; The Vpr and Vpx genes are related, with all five groups Paxton et al., 1993; Planelles et al., 1996; Re et al., 1995). of primate lentiviruses containing at least one homologue HIV-1 Vpr has also been reported to arrest cell growth of yeast (Macreadie et al., 1995; Zhao et al., 1996). In 1 To whom correspondence and reprint requests should be ad- addition, HIV-2 and SIV Vpr have been shown to cause dressed. Fax: (403) 492-7660. cell cycle arrest in mammalian cells, although the effects

0042-6822/97 $25.00 103 Copyright ᭧ 1997 by Academic Press All rights of reproduction in any form reserved.

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology 104 ZHANG, RASMUSSEN, AND CHANG

of HIV-2 and SIV Vpr were not as pronounced as that of HIV-2ROD Vpr HIV-1 Vpr. In fact, Vpx from HIV-2 and SIVmac did not 5؅ primer CTCTCTCATATGGCTGAAGCACCAACA induce cell cycle arrest in monkey CV-1 or human HeLa 3؅ primer AAACGGATCCTTATTGCATGTTTCTAGG and 293 cells (Marzio et al., 1995; Planelles et al., 1996). HIV-2ROD Vpx The yeast S. pombe has been widely used as a model 5؅ primer CTCTCTCATATGACAGACCCCAGAGAG to study the role of a variety of genes in the control of 3؅ primer AAACGGATCCTTAGACCAGACCTGGAGG cell proliferation in eukaryotic cells (Draetta et al., 1987; Nurse, 1994). Therefore, we reasoned that if expression All PCR products were subcloned into pGEM7Zf(/) of Vpr and Vpx proteins in fission yeast could produce and sequenced to ensure that no errors had occurred observable phenotypes, it would provide us with an in during amplification. The fragments were then excised vivo model system with which to study the effects of by digestion with NdeI and BamHI and subcloned into these proteins on cell function, especially cell prolifera- the expression plasmid pREP41. The expression plasmid tion, and the molecular mechanisms involved. In this re- pREP41 contains the nmt1 promoter which is repressed port, we have studied the effect of HIV-1 Vpr, HIV-2 Vpr/ in the presence of thiamine (Maundrell, 1990). After liga- Vpx, and SIV-Vpr/Vpx expression on cell cycle progres- tion into pREP41, each construct was sequenced to en- sion in S. pombe. We have found that expression of HIV- sure that the orientation and translation start sites were 1 Vpr in fission yeast blocks cell proliferation with cells correct. arrested predominantly in the G1 and G2 phases of the cell cycle. In addition HIV-1 Vpr expression was cytotoxic Culture and transformation of S. pombe with cell viability rapidly declining in the presence of The yeast strains used in this study were SP130 (h-, HIV-1 Vpr. In addition, although Vpr expression induced ade6-210, leu1-32) and cdc2-1w and cdc2-3w (Rasmus- polyploidy in yeast as in mammalian cells, the cytotoxic sen and Rasmussen, 1994). The growth medium was effects in yeast contrasted with previous studies in hu- minimal medium (MM) with or without the supplements man T cell lines where Vpr expression was found to be of leucine, adenine, and uracil according to the selection cytostatic rather than cytotoxic (Bartz et al., 1996). Fur- requirements of each particular strain. Standard culture ther, although SIV Vpx has been reported to be noncyto- conditions and techniques were used as described (Mor- static in mammalian cells (Paxton et al., 1993; Planelles eno et al., 1991). Strains containing pREP41-based ex- et al., 1996), expression of either HIV-2 Vpr/Vpx or SIV- pression plasmids were routinely grown in medium con- Vpr/Vpx resulted in yeast cell arrest. However, the effect taining 1 mM thiamine–HCl to repress nmt1-dependent on cell viability was not as pronounced as with HIV-1 transcription. To permit expression from the nmt1 pro- Vpr. Expression of the Tat protein produced none of moter, cells were washed with sterile water and then these phenotypes, indicating that the effects are specific reinoculated into MM lacking thiamine–HCl. Transfor- to Vpr and Vpx. Thus, these studies indicate that S. mation of S. pombe was carried out by the lithium acetate pombe may be a useful model system with which to procedure as described elsewhere (Moreno et al., 1991). study the processes through which Vpr and Vpx affect cellular function. Western blot analysis of Vpr and Vpx expression

MATERIALS AND METHODS Protein extracts were prepared as described previously (Moreno et al., 1991). For Western blot analysis, Plasmid construction protein concentrations of extracts were quantified using The following primer combinations were used to pro- the DC Protein Assay (Bio-Rad). Ten micrograms of produce Vpr and Vpx fragments for ligation into the pREP41 tein from each sample was applied to a 10–20% gradient Tricine–SDS–PAGE gel (NOVEX, Canada). After electro- .expression vector. All are listed in the 5؅-3؅ direction phoresis, the proteins were transferred to nitrocellulose

HIV-1NL4-3 Vpr membranes (Schleicher and Schuell). Filters were air- 5؅ primer GAGGACATAGGAACAAGCC dried then blocked with 10% dried milk in TBST (50 mM 3؅ primer CCCGGATCCTAGGATCTACTGGCTCC Tris, pH 7.5, 150 mM NaCl, 0.3% Tween-20) for 1 hr at

HIV-1NL4-3 Tat room temperature. Filters were then incubated with the 5؅ primer CTCTCTCATATGGAGCCAGTAGATCCT primary antibody (rabbit anti-HIV-1 Vpr, rabbit anti-HIV-1 3؅ primer AAACGGATCCCTAATCGTACGGATCTGT Tat, rabbit anti-SIV Vpr, or rabbit anti-SIV Vpx) at 1:500

SIVMAC239 Vpr to 1:1000 dilution at 4Њ overnight. This was followed by an 5؅ primer CAGAGGACATATGGAAGAAAGACCTCC incubation with an HRP-conjugated secondary antibody -3؅ primer CCCGGATCCCATGCTTCTAGAGGGCGG (Amersham, NA 9340, 1:2000 dilution) at room tempera

SIVMAC239 Vpx ture for 1 hr. After washing the filter, the antibody was 5؅ primer CAGAGGACATATGTCAGATCCCAGGGA localized using ECL Western Blotting Detection Reagents .(3؅ primer CCCGGATCCTTATGCTAGTCCTGGAGG (Amersham Life Science

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology INHIBITION OF YEAST CELL CYCLE BY VPR AND VPX 105

Flow cytometry 18, and 24 hr), an aliquot of culture was harvested, cell The cell samples for flow cytometry were prepared density determined, and approximately 200 cells from as described previously (Alfa et al., 1992). Briefly, yeast each sample were plated onto thiamine-plus plate. The cultures were grown at 30Њ overnight to a density of 1 1 plates were incubated at 30Њ for 4–6 days prior to count- 107 cells/ml and cells were collected by centrifugation. ing colonies. The cells were fixed with 70% ethanol and kept at 4Њ until use. For FACS analysis, an aliquot of the fixed cells RESULTS (about 3 1 106) was collected and washed once with 1 Construction of thiamine-conditional Vpr and Vpx ml of 50 mM sodium citrate (pH 7.0). The cells were expression plasmids resuspended in 0.5 ml, 50 mM sodium citrate containing 0.1 mg/ml RNaseA, and incubated in a 37Њ water bath To engineer the Vpr and Vpx expression vectors, we for 2 hr. After incubation, 0.5 ml 50 mM sodium citrate amplified the Vpr gene of the clone HIV-1NL4-3 and the containing 2 mg/ml propidium iodide was added to the Vpr and Vpx genes of HIV-2ROD and SIVMAC239 by PCR. cells. The DNA content was determined by FACScan The PCR products were subcloned into pGEM7Zf(/) and analysis and the data was analyzed using the CellFit sequenced to ensure there were no errors due to the program (Becton–Dickinson). PCR. Each fragment was then excised by digestion with NdeI and BamHI and cloned into the plasmid pREP41, Histone H1 kinase assay 3؅ to the thiamine-repressible nmt1 promoter. pREP41 The yeast protein extract was made as described contains the S. cerevisiae LEU2 gene which comple- above. Cells were lysed using glass beads in a lysis ments the leu1-32 mutation of S. pombe. These plasmids buffer composed of 25 mM Tris, pH 8.0, 10 mM MgCl2 , were transformed into the S. pombe strain SP130 (which 15 mM EGTA, 0.1% Triton X-100, 0.1 mM NaF, 60 mM b- carries the leu1-32 mutation) and transformants were se- glycerophosphate, 15 mMp-nitrophenylphosphate, 0.1 lected by their ability to grow on minimal medium lacking mM Na orthovanadate, 0.1 mM PMSF, 1 mg/ml leupeptin, leucine. The medium also contained thiamine to prevent 10 mg/ml soybean trypsin inhibitor, 1 mg/ml aprotinin, 10 expression of Vpr or Vpx in case their presence was mg/ml TPCK. Immulon-2 plates (Fisher Scientific) were lethal to S. pombe. coated with a solution of 5 mg p13, purified as described previously (Rasmussen and Rasmussen, 1994) in 100 HIV-1 Vpr, HIV-2 Vpr/Vpx, and SIV Vpr/Vpx arrest ml, 50 mM sodium carbonate buffer, pH 9.6, and then S. pombe proliferation incubated at room temperature overnight. The wells were washed once with PBS, then blocked with PBS con- To determine if expression of either Vpr or Vpx would taining 3% BSA for 1 hr at room temperature. To prepare affect cell proliferation of S. pombe, yeast cells containing samples for assay, 200 mg of total protein were mixed the Vpr or Vpx expression plasmids were grown on me- with an equal volume of PBS containing 1% BSA. The dium with or without thiamine. When grown on MM / final volume was approximately 100–250 ml. The assay thiamine (which prevents expression), normal size yeast samples were added to the p13-coated microwells and colonies were formed from yeast cells transformed with incubated at room temperature with slow constant shak- either the empty pREP41 vector, HIV-1 tat, HIV-1 Vpr, HIV- ing for at least 5 hr. The cells were washed three times 2 Vpr or Vpx, and SIV Vpr or Vpx (Fig. 1A). On plates lacking with PBS / 0.2% Triton X-100 and then washed once thiamine (which permits expression), control yeast cells with kinase assay buffer (50 mM Tris, pH 7.4, 10 mM transformed with the control plasmid formed normal size

MgCl2 ,1mMDTT, plus protease and phosphatase inhibi- colonies. However, there were no colonies formed by yeast tors as in the extraction buffer). To start the assay, 100 expressing HIV-1 Vpr and smaller than normal colonies ml of assay buffer containing 8.3 mg histone H1, 10 mM formed by yeast expressing SIV Vpr or Vpx (Fig. 1B), or ATP, 2.5 mCi [g32P]ATP was added to each well and then HIV-2 Vpr or Vpx (not shown). These results suggest that the microtiter plate was incubated for 30 min at 30Њ. The Vpr and Vpx inhibit cell proliferation in S. pombe, and the reaction was stopped by adding 35 mlof21SDS–PAGE lack of colonies observed when HIV-1 Vpr was expressed sample buffer. Fifteen microliters was spotted onto 3MM suggested that the presence of this protein had a more paper, incubated for 10 min in 10% TCA and 40 mM pronounced effect on cell proliferation. sodium pyrophosphate, washed three times with 5% Because both Vpr and Vpx caused arrested growth, TCA, followed by a brief rinse in 95% ethanol. The filters each strain was characterized to examine the effect on were air dried and quantified by liquid scintillation spec- cell proliferation kinetics. Exponentially growing cells cul- trometry. tured in MM / thiamine were washed in sterile water and inoculated into fresh MM //0 thiamine at a density Viability assays of 1 1 105 cells/ml. Cell numbers were then determined Cells were grown in thiamine-plus or thiamine-minus at various times. The normal generation time of SP130 medium at 30Њ. At different time points (0, 6, 9, 12, 15, cells at 30Њ in minimal medium is about 3 hr. The genera-

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology 106 ZHANG, RASMUSSEN, AND CHANG

at different time points and HIV-1 Vpr or SIV Vpr or Vpx expression was detected by Western blot as described under Materials and Methods. The immunoblot results indicated that Vpr and Vpx could be detected within 9 hr after switching cells into medium lacking thiamine, and the levels of expression were constant for at least 24 hr (Fig. 3). Since cell proliferation rates showed difference beginning at 9 hr, these results indicate that the arrest of cell proliferation we observed is coincident with Vpr or Vpx expression. When examined by phase microscopy, cells express-

FIG. 1. Expression of Vpr and Vpx inhibits cell growth in S. pombe. S. pombe transformed with pREP41, pREP41-HIV-1-Vpr, pREP41-SIV- Vpr, or pREP41-SIV-Vpx were plated onto MM agar with ot without thiamine and incubated at 30Њ for 3–6 days. The plates are labeled as follows: (1) pREP41-SIV-Vpr; (2) pREP41; (3) pREP41-HIV-1-Vpr; (4) pREP41-SIV-Vpr. (A) Cells grown in the presence of thiamine (repressing conditions). (B) Cells grown in the absence of thiamine (expressing conditions). tion time of HIV-1 Vpr-, HIV-2, and SIV Vpr- or Vpx- condi- tionally expressing strains grown in the presence of thiamine (i.e., not expressing) was similar to that of the wild- type strain as expected (Figs. 2B and 2C). However, in the absence of thiamine, expression of HIV-1 Vpr caused a complete arrest of cell proliferation within 9–12 hr (Fig. 2A), whereas cells expressing HIV-2 Vpr or Vpx (Fig. 2B), or SIV Vpr or Vpx (Fig. 2C), showed a reduced rate of proliferation starting at 9 hr and eventual cessation of proliferation by 30 hr after switching to conditions that permit expression. The growth kinetics of cells expressing HIV-1 Tat was the same in medium with or without FIG. 2. Growth kinetics of cells expressing Vpr or Vpx. Cells were thiamine (Fig. 2A), indicating that the effects on cell prolif- grown in liquid MM with or without thiamine at 30Њ. An aliquot of the cell culture was collected every 3 hr and cell density determined. The eration were specific to Vpr and Vpx proteins and not initial cell innoculum was 1 1 105 cells/ml. (A) Growth kinetics of SP130 due to simply expressing viral proteins. cells alone, cells containing the Tat expression plasmid (//0 thiamine), Western blot analysis of Vpr and Vpx expression and cells containing the HIV-1 Vpr expression plasmid (//0 thiamine). (B) Growth kinetics of cells containing the HIV-2 Vpr or Vpx expression To confirm the correlation between cell growth arrest plasmids (//0 thiamine). (C) Growth kinetics of cells containing the and Vpr or Vpx expression, yeast extracts were prepared SIV Vpr or Vpx expression plasmids (//0 thiamine).

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology INHIBITION OF YEAST CELL CYCLE BY VPR AND VPX 107

cycle but permits cell growth to continue, similar to previously described cell division cycle (cdc) mutants.

Expression of HIV-1 Vpr is lethal in S. pombe Since expression of Vpr and Vpx arrested cell proliferation in S. pombe, we were interested in determining whether there were additional effects on cell viability. To address this, expression of HIV-1 Vpr, HIV-2, and SIV Vpr or Vpx was induced by growth in minimal medium lacking thiamine for different lengths of time. Cells were then plated onto MM / thiamine medium to again repress Vpr or Vpx expression. As a control, cells were treated FIG. 3. Western blot analysis of Vpr and Vpx expression. Cells grown in MM were harvested at different times following shift to thiamine- in the same way except they remained in MM / thiamine free medium. Total protein extracts were prepared and protein levels for all parts of the experiment. The number of viable determined by Western blot analysis. Data are shown for HIV-1 Vpr, cells was determined by counting the number of colonies SIV Vpr, and SIV Vpx. Similar induction kinetics were observed for HIV- formed. 1 Tat expression (not shown). The results show that cells expressing HIV-1 Vpr rapidly lose viability, with essentially no viable cells re- ing HIV-1 Vpr, HIV-2 Vpr, Vpx, or SIV Vpr showed an maining after 15 hr in thiamine-free medium (Fig. 5). This increased cell length (Fig. 4). Staining of nuclei with pro- corresponds to about 6 hr of Vpr expression. In contrast, pidium iodide indicated that arrested cells contain a sin- expression of Vpr or Vpx from HIV-2 or SIV showed much gle nucleus (not shown). These data suggest that expres- less of a cytotoxic effect on S. pombe than did expression sion of Vpr or Vpx proteins arrests the nuclear division of HIV-1 Vpr. After 24 hr of incubation, about 50% of the

FIG. 4. Morphology of cells expressing Vpr or Vpx. Exponentially growing cells grown in MM / thiamine were used to inoculate MM with or without thiamine. Cells were incubated for a further 18 hr, and then collected and fixed for microscopic examination. The samples were as follows: (A) HIV-1 Vpr cells / thiamine. SIV-Vpr and -Vpx cells have an identical phenotype in medium containing thiamine (repressing conditions) and so are not shown. (B) HIV-1 Vpr cells 0 thiamine. (C) SIV Vpr cells 0 thiamine. (D) SIV Vpx cells 0 thiamine.

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology 108 ZHANG, RASMUSSEN, AND CHANG

t Å 6 hr, HU was added to the culture. At t Å 10 hr, cells were washed in sterile water and inoculated into medium lacking HU and thiamine to release them from the S- phase block, but maintain Vpr or Vpx expression. At t Å 20 hr samples were taken and prepared for flow cytometry. To establish that the HU treatment results in cell cycle arrest, a sample of HIV-1 Vpr cells was taken at t Å 10 hr (i.e., 4 hr in HU), prior to removal of the HU (Fig. 7A). As a control for recovery from the HU treatment, cells containing the HIV-1 Vpr expression vector were grown in the presence of thiamine for the entire experi- FIG. 5. Viability of cells expressing Vpr or Vpx. Cells were grown in ment, which included a 10-hr recovery period after re- MM with or without thiamine at 30Њ. An aliquot of cells was collected moval of the HU (Fig. 7B). The results show that the and 200 cells plated onto MM agar containing thiamine. Visible colo- control cells, in which Vpr expression was repressed, nies were counted after 3–6 days and the data shown in the graph. were able to recover from HU treatment and progress The control sample is cells containing the HIV-1 Vpr expression plasmid grown on plates containing thiamine (repressing conditions). through the cell cycle establishing a normal, predominantly G2/M distribution of cells (compare Figs. 6C and cells were still viable (Fig. 5). These data indicate that expression of HIV-1 Vpr in S. pombe is lethal, while expression of HIV-2 or SIV Vpr or Vpx has a less severe, although significant effect on cell survival.

Vpr and Vpx arrest the cell cycle at two points In order to determine the point of cell cycle arrest in Vpr or Vpx expressing cells, we used flow cytometry to determine the DNA content in control cells or cells expressing Vpr or Vpx. The flow cytometry controls included nitrogen starvation, which arrests cells predominantly in

G1 and glucose starvation, which arrests cells predominantly in G2 (Figs. 6A and 6B). Control HIV-1 Vpr cells grown in the presence of thiamine shown the normal distribution DNA contents with most cells being in the

G2 phase of the cell cycle (Fig. 6C). Cells containing the HIV-1 Vpr or SIV Vpr or Vpx expression vectors, and grown in the absence of thiamine for 18 hr, showed cells with DNA contents characteristic of both G1 , and G2/M cells, indicating that Vpr and Vpx expression blocks cell cycle progression at two distinct points (Figs. 6D–6F). In addition, cells expressing HIV-1 Vpr also showed signs of extra DNA replication as evidenced by the peak of cells with DNA contents in excess of the G2/M peak (Fig. 6D). This effect was not observed in cells expressing SIV Vpr or SIV Vpx (Figs. 6E and 6F). Because we observed evidence of yeast cells accumu- lated not only in G2/M but also in the G1 phase of cell FIG. 6. Flow cytometric analysis of Vpr and Vpx expressing cells. cycle, we wanted to determine if Vpr or Vpx expression Cells were grown as indicated below prior to preparation for flow prevents progression through S phase. To do this we cytomtery as described under Materials and Methods. The position of the 1N (G1 DNA content) and 2N (G2 DNA content) peaks are shown established a culture of cells in which Vpr or Vpx expres- by the gray bars. Controls for 1N and 2N peaks are shown in parts A sion had just reached maximal levels (which normally and B. The control for exponentially growing S. pombe (plasmid con- takes 9 hr under the conditions we have used in this taining cells grown in thiamine containing medium) is shown in C. study), and which had been grown for 4 hr in the pres- Experimental cultures (D–F) were washed in sterile water then placed ence of hydroxyurea (HU) in order to arrest cells in early into thiamine-free MM for 18 hr prior to preparation for flow cytometry. (A) HIV-1 Vpr cells grown in nitrogen limiting medium (enriches for G1 S-phase. To do this, cells containing the HIV-1 Vpr or cells). (B) HIV-1 Vpr cells grown in glucose limiting medium (enriches SIV Vpr or Vpx vectors were switched to thiamine-free for G2 cells). (C) HIV1 Vpr / thiamine. (D) HIV1 Vpr 0 thiamine. (E) medium at t Å 0 hr to permit Vpr or Vpx expression. At SIV Vpr 0 thiamine. (F) SIV Vpx 0 thiamine.

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology INHIBITION OF YEAST CELL CYCLE BY VPR AND VPX 109

in S. pombe, we asked whether p34/cdc2 activity was inhibited by either Vpr or Vpx expression. To test this, H1 kinase assays were carried out as described under Materials and Methods to measure p34/cdc2 kinase activity in control cells and cells expressing HIV-1 Vpr or SIV Vpr or Vpx. The expression of HIV-1 Vpr or SIV Vpr or Vpx caused similar decreases in p34/cdc2 kinase activity (Fig. 8). These results also suggest that the cell cycle arrest we have observed is associated with a loss of p34/cdc2 kinase activity. The activity of p34/cdc2 in S. pombe is positively regulated by the cdc25 protein phosphatase, and negatively regulated by the wee1 and mik1 kinases (Nurse, 1994). Since we observed a decrease in p34/cdc2 activity in cells expressing Vpr or Vpx, we wondered whether mutants of p34/cdc2, which fail to respond correctly to either cdc25 or wee1/mik1, might be resistant to Vpr expression. The HIV-1 Vpr expression plasmid was transformed into three p34/cdc2 mutant strains, one which fails to respond to cdc25 (cdc2-3w), and one which fails to respond to wee1 (cdc2-1w), and the third in which the mik1 gene has been deleted (cdc2-1w, Dmik1). The results showed that these three mutants, like strains with a normal cdc2 gene, were growth arrested by HIV-1 Vpr expression (Fig. 9). Similar results were observed by transformation of these mutant yeast with HIV-2 Vpr or Vpx FIG. 7. Effect of Vpr or Vpx expression on cell cycle progression after hydroxyurea synchronization. Cells were grown in the presence and SIV Vpr or Vpx (data not shown), indicating that Vpr or absence of thiamine and synchronized in S phase with hydroxyurea or Vpx does not act directly through any of these cdc2 as described under Materials and Methods. Cells cycle progression regulators. following removal of hydroxyurea was monitored by flow cytometry. As described, the timing of HU removal and shifting to thiamine-free medium were coordinated so that the onset of expression of the Vpr or DISCUSSION Vpx proteins (which takes 9 hr) preceded removal of HU by 1 hr. Cells were incubated a further 10 hr following removal of HU. (A) HIV-1 Vpr In the present study we have found that expression of cells / thiamine after 4 hr in HU (early S phase arrest). (B) HIV-1 Vpr HIV-1 Vpr or HIV-2 and SIV Vpr or Vpx results in cell cells / thiamine, 10 hr after removal of HU (control for ability to recover cycle arrest in the yeast S. pombe. In addition, expression from HU treatment and resume cell cycle progression). (C) HIV-1 Vpr of HIV-1 Vpr results in a rapid loss of viability. These cells 0 thiamine, 10 hr after removal of HU. (D) SIV Vpr cells 0 thiamine, 10 hr after removal of HU. (E) SIV Vpx cells 0 thiamine, 10 hr after removal of HU.

7B). In contrast, cells allowed to express HIV-1 Vpr or SIV Vpr or Vpx had a significant fraction of the population with DNA contents indicative of cells either in G1 or very early S phase (Figs. 7C–7E), suggesting that the presence of Vpr or Vpx attenuates progression through S- phase.

Suppression of p34/cdc2 kinase activity in yeast expressing HIV-1 Vpr or SIV Vpr or Vpx FIG. 8. Effect of Vpr and Vpx expression of p34/cdc2 kinase activity. The primary regulators of G1/S and G2/M progression Cell extracts were prepared from exponentially growing cells. Samples in eukaryotic cells are the cyclin-dependent kinases are indicated along the y-axis. Samples listed as ‘‘0 thiamine’’ were (cdks) of which p34/cdc2 of S. pombe is the prototype intially grown in medium containing thiamine, harvested by centrifuga- (Broek et al., 1991; Nurse, 1994). In mammalian cells this tion, washed in sterile water, then reinoculated in MM lacking thiamine and incubated for 15 hr prior to preparing extracts. H1 kinase assays enzyme is apparently inactivated by the expression of were performed as described under Materials and Methods. The level HIV-1 Vpr (He et al., 1995; Re et al., 1995). Since p34/ of activity in SP130 cells alone was set as 100% and all samples are cdc2 is required for both the G1/S and G2/M transitions scaled relative to this level.

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology 110 ZHANG, RASMUSSEN, AND CHANG

severe effect than HIV-1 Vpr in human 293 cells (Marzio

et al., 1995) and expression of SIVagm Vpx has a more severe effect on CV-1 cells than on HeLa cells (Planelles et al., 1996). Thus, it might initially be surprising that expression of all these proteins should affect cell proliferation in a simpler eukaryote such as S. pombe. It should, however, be noted that many of the proteins that regulate cell proliferation in yeast can be functionally comple- mented by human homologues (Moreno et al., 1991; Nurse, 1994). Thus, the ability of Vpr and Vpx proteins to affect cell proliferation might be mediated via the basic cell cycle control machinery. Our observation that p34/ cdc2 kinase activity is significantly reduced in cells expressing SIV Vpr or Vpx, which do not have the same viability loss as cells expressing HIV-1 Vpr, and which still continue to grow (resulting in elongated cdc-like cells), is consistent with this hypothesis. Furthermore, the fact that these proteins have different effects de- pending on cell type helps explain in part why we see some differences in the phenotype caused by expression of Vpr and Vpx in S. pombe. In addition, levels of expression may have a significant impact on apparent phenotype, especially given that HIV-1 Vpr appears to be cytotoxic when expressed in yeast. Expression levels may also explain the differences between our results and a previous study examining the consequences of HIV-1 Vpr expression in S. pombe (Zhao et al., 1996), since this previous study used a different version of the nmt1 promoter than we have used in the present study. The use of promoters with different transcription rates would be FIG. 9. Genetic analysis of Vpr-dependent inhibition of cell prolifera- a useful approach to clarifying this issue. tion. Strains of S. pombe with normal or a mutant cdc2 allele were The varying effects of the HIV and SIV proteins on the transformed with the pREP41-HIV-1-Vpr expression plasmid to deter- S. pombe cell cycle is also consistent with the classifica- mine if the cell cycle inhibitory effect was mediated through the known p34/cdc2 regulators, cdc25, wee1, or mik1. (A) Cells grown with thia- tion of the primate lentiviruses, in which HIV-1 and HIV- mine (repressing conditions). (B) Cells grown without thiamine (ex- 2/SIVmac have been divided into two distinct phylogenetic pressing conditions). (1) SP130 cells (normal cdc2 gene); (2) cdc2-1w lineages (Franchini and Reitz, 1994). Our finding that the (defective response to wee1); (3) cdc2-3w (defective response to HIV and SIV proteins differ with regard to how cytotoxic cdc25); (4) cdc2-1w, Dmik1 (defective response to wee1 and deletion they are in S. pombe may be a consequence of differ- of mik1). ences in their normal functions in vivo with regard to their respective roles in the viral life cycle and cellular results are consistent with previous studies in which HIV- pathogenesis, as compared to the HIV-1 Vpr protein. 1 Vpr was reported to cause cell cycle arrest in both These results are also consistent with the recent report mammalian cells and in yeast (He et al., 1995; Jowett et that SIVmac provirus lacking either Vpr or Vpx are still al., 1995; Macreadie et al., 1995; Re et al., 1995; Rogel capable of producing AIDS in rhesus monkeys, while the et al., 1995; Zhao et al., 1996). Here, we have extended Vpr/Vpx double mutant is severely attenuated in pathoge- the studies to include HIV-2 and SIV Vpr and Vpx and nicity in vivo (Gibbs et al., 1995), and with a report of demonstrate that all these lentiviral proteins inhibit yeast independent functions of HIV-2 and SIV Vpr and Vpx with cell proliferation. While HIV-2 and SIV Vpr and Vpx also respect to nuclear import and cell cycle arrest in mamma- cause cell cycle arrest, they are not as cytotoxic as HIV- lian cells (Fletcher et al., 1996). It would be interesting 1 Vpr in S. pombe. to express both SIV Vpr and Vpx coincidentally, in order Previous studies suggested that the cell cycle arrest to determine whether a more severe phenotype, analo- effects of Vpr and Vpx could be species-specific. Expres- gous to HIV-1 Vpr, is produced. These studies are cur- sion of HIV-1 Vpr in HeLa cells, which are of human rently in progress. origin, has a more severe effect than does expression in Although Vpr and Vpx have been shown to block cell CV-1 cells, which are of simian origin (Planelles et al., cycle in mammalian cells, the cytological consequences

1996). Accordingly, expression of SIVmac239 Vpr has a less of their expression are still uncertain. In contrast to a

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology INHIBITION OF YEAST CELL CYCLE BY VPR AND VPX 111 recent study suggesting that HIV-1 Vpr is primarily cyto- dramatically inactivated in human cells and in yeast ex- static in human Jurkat T cell line (Bartz et al., 1996), our pressing HIV-1 Vpr (He et al., 1995; Re et al., 1995; Zhao data demonstrates that HIV-1 Vpr is highly cytotoxic in et al., 1996). Future studies will have to address whether S. pombe, with complete loss of the ability to proliferate or not these proteins can directly affect p34/cdc2 kinase with a few hours. Neither SIV Vpr nor Vpx were this activity. cytotoxic, producing at most an approximately 50% loss The inducible yeast expression system has also been of viability. Furthermore, we do not anticipate that this is proven to be informative as we have been able to deter- due to residual Vpr since all samples contained maximal mine that HIV-1 Vpr does not act simply via cdc25, wee1, levels of Vpr at the time they were plated onto repressing or mik1, direct regulators of p34/cdc2 in S. pombe. These medium. It is not clear what the basis of this difference results may indicate that Vpr and Vpx do indeed act is, but possible explanations include differences in levels directly on p34/cdc2, that they act through a novel path- of expression and reversibility of target protein interac- way, or that multiple actions occur which cannot be re- tion. If mammalian cells arrested by Vpr do eventually solved via a simple epigenetic explanation. Other possi- lose viability, it might be reasonable to propose that Vpr ble pathways include interaction with cycling regulators plays an important role in the depletion of HIV-1-infected such as protein phosphatases type 2A (PP2A), which cells, which normally occurs in vivo. Regardless, our re- acts as an inhibitor of cell entry into mitosis (Kinoshita sults demonstrate that expression of Vpr and Vpx in S. et al., 1990) and regulates cytokinesis (Wera et al., 1995). pombe will provide a useful model system in which to Future studies should address these questions. Toward better understand the role of these proteins. that end we have recently been able to produce ex- In mammalian cells, HIV-1 Vpr and SIV Vpr have been tragenic suppressers that survive in the presence of HIV- shown to arrest the cell cycle after DNA replication, likely 1 Vpr. The isolation of the genes responsible for this in G2 phase (Bartz et al., 1996; He et al., 1995; Jowett et resistance to Vpr expression may define in vivo targets al., 1995; Re et al., 1995). In our study, we have shown of this protein, and improve our understanding of HIV that in S. pombe HIV-1 Vpr, HIV-2 Vpr or Vpx, and SIV pathogenesis.

Vpr or Vpx arrested cell proliferation both at G1/S and G2/M. Since we have observed a decline in p34/cdc2 ACKNOWLEDGMENTS kinase activity in yeast cells expressing these various We thank R. Sherburne for assistance with electron microscope, P. proteins, the difference may be attributable to p34/cdc2. Dickie and Ellen Shibuya for discussing the manuscript, and A. Hudson In mammalian cells, the direct homologue of p34/cdc2, for editorial assistance. We thank Dr. J. C. Kappes for anti-HIV-1 Vpr cdc2Hs (also known as cdk1), regulates the transition and anti-HIV-2 Vpx antisera, Dr. L. O. Arthur for anti-SIV Vpx antisera, Dr. K. Peden for HIV-2 plasmid, and Dr. P. Luciw for SIV plasmid. from G2 to M phase, while G1/S progression is predomi- ROD mac239 nantly controlled by cdk2. However, in S. pombe, p34/ The following reagent was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: HIV-1BH10 cdc2 regulates both cell cycle transitions (Atherton-Fess- Vpr and HIV-2ROD Vpx antisera from Dr. L. Ratner, and HIV-1BH10 Tat ler et al., 1993; Moreno et al., 1991). Our observations antiserum from Dr. B. Cullen. This work is contributed equally by the would therefore suggest that p34/cdc2, or cdc2Hs in hu- laboratories of C. Rasmussen and L.-J. Chang. Both are Research man cells, might be the target, directly or indirectly, of Scholars of Alberta Heritage Foundation for Medical Research and Vpr and Vpx. Thus, while the observed cell cycle arrest supported by grants from National Health Research and Development Program (6609-1936-AIDS to L.-J.C.), Medical Research Council of Can- phenotypes may not be identical to that observed in ada (MT-12314 to L.-J.C.; MT-11531 to C.R.), and the AIDS Network mammalian cells, there are clear similarities of growth Research Trust Fund of Alberta (to L.-J.C.). Dr. Rasmussen is also a arrest phenotype caused by Vpr and Vpx expression in Medical Research Council of Canada Scholar. yeast and mammalian cells. Specifically, the observation that yeast and mammalians cell both arrest in G2 with REFERENCES reduced p34/cdc2 kinase activity indicates that Vpr and Aldrovandi, G. M., and Zack, J. A. (1996). Replication and pathogenicity Vpx interact with conserved target(s) in yeast and mam- of human immunodeficiency virus type 1 accessory gene mutants in malian cells. SCID-hu mice. J. Virol. 70, 1505–1511. We have also observed changes in cell size and DNA Alfa, C., Fantes, P., Hyams, J., McLeod, M., and Warbrick, E. (1992). content in Vpr and Vpx expressing S. pombe. Similar ‘‘Experiments with Fission Yeast—A Laboratory Manual.’’ Cold observation has been reported in Jurkat T cells express- Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Atherton-Fessler, S., Parker, L. L., Geahlen, R. L., and Piwnica-Worms, ing HIV-1 Vpr (Bartz et al., 1996). Increase in nuclear size H. (1993). Mechanism of p34/cdc2 regulation. Mol. Cell. Biol. 13, and ploidy have been observed in S. pombe carrying 1675–1685. mutations in the mitotic cdk’s due to decoupling S phase Bartz, S. R., Rogel, M. E., and Emerman, M. (1996). Human immunodefi- from mitosis (Broek et al., 1991; Hayles et al., 1994). The ciency virus type 1 cell cycle control: Vpr is cytostatic and mediates elongated cells and S phase staggering in yeast express- G2 accumulation by a mechanism which differs from DNA damage checkpoint control. J. Virol. 70, 2324–2331. ing Vpr or Vpx mimic the phenotype of the yeast mitotic Broek, D., Bartlett, R., Crawford, K., and Nurse, P. (1991). Involvement cdk mutants. In addition, our data are consistent with of p34/cdc2 in establishing the dependency of S phase on mitosis. previous studies in which p34/cdc2 was observed to be Nature 349, 388–393.

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology 112 ZHANG, RASMUSSEN, AND CHANG

Bukrinsky, M. I., Haggerty, S., Dempsey, M. P., Sharova, N., Adzhubei, A. C., and Azad, A. A. (1995). A domain of human immunodeficiency A., Spitz, L., Lewis, P., Goldfarb, D., Emerman, M., and Stevenson, virus type 1 Vpr containing repeated H(S/F)RIG amino acid motifs M. (1993). A nuclear localization signal within HIV-1 matrix protein causes cell growth arrest and structural defects. Proc. Natl. Acad. that governs infection of non-dividing cells. Nature 365, 666–669. Sci. USA 92, 2770–2774. Cohen, E. A., Dehni, G., Sodroski, J. G., and Haseltine, W. A. (1990). Marzio, P. D., Choe, S., Ebright, M., Knoblauch, R., and Landau, N. R. Human immunodeficiency virus vpr product is a virion-associated (1995). Mutational analysis of cell cycle arrest, nuclear localization, regulatory protein. J. Virol. 64, 3097–3099. and virion packaging of human immunodeficiency virus type 1 Vpr. Desrosiers, R. C. (1990). The simian immunodeficiency viruses. Ann. J. Virol. 69, 7909–7916. Rev. Immunol. 8, 557–578. Maundrell, K. (1990). nmt1 of fission yeast. J. Biol. Chem. 265, 10857– Draetta, G., Bizuela, L., Potashkin, J., and Beach, D. (1987). Identification 10864. of p34 and p13, human homologs of the cell cycle regulators of Moreno, S., Hayles, J., and Nurse, P. (1991). Molecular Genetic Analysis fission yeast encoded by cdc2/ and suc1/. Cell 50, 319–325. of Fission Yeast Schizosaccharomyces pombe. Methods Enzymol. Fletcher, T. M., Brichacek, B., Sharova, N., Newman, M. A., Stivahtis, 194, 795–823. G., Sharp, P. M., Emerman, M., Hahn, B. H., and Stevenson, M. (1996). Nurse, P. (1994). Ordering S phase and M phase in the cell cycle. Cell Nuclear import and cell cycle arrest functions of the HIV-1 Vpr protein 79, 547–550. are encoded by two separate genes in HIV-2/SIVsm. EMBO J. 15, Paxton, W. R., Connor, R. I., and Landau, N. R. (1993). Incorporation of 6155–6165. Vpr into human immunodeficiency virus type 1 virions: requirements Franchini, G., and Reitz, J. M. S. (1994). Phylogenesis and genetic com- for the p6 region of gag and mutational analysis. J. Virol. 67, 7229– plexity of the nonhuman primate retroviridae. AIDS Res. Human Re- 7237. troviruses 10, 1047–1060. Planelles, V., Jowett, J. B. M., Li, Q.-X., Xie, Y., Hanh, B., and Chen, I. S. Y. Gibbs, J. S., Lackner, A. A., Lang, S. M., Simon, M. A., Sehgal, P. K., (1996). Vpr-induced cell cycle arrest is conserved among primate Daniel, M. D., and Desrosiers, R. C. (1995). Progression to AIDS in lentiviruses. J. Virol. 70, 2516–2524. the absence of a gene for vpr or vpx. J. Virol. 69, 2378–2383. Rasmussen, C., and Rasmussen, G. (1994). Inhibition of G(2)/M progres- Hayles, J., Fisher, D., Woollard, A., and Nurse, P. (1994). Temporal order sion in Schizosaccharomyces pombe by a mutant calmodulin kinase of S phase and mitosis in fission yeast is determined by the state II with constitutive activity. Mol. Biol. Cell. 5(7), 785–795. of the p34/cdc2-mitotic B cyclin complex. Cell 78, 813–822. Re, F., Braaten, D., Franke, E. K., and Luban, J. (1995). Human immuno- He, J., Choe, S., Walker, R., Di Marzio, P., Morgan, D. O., and Landau, deficiency virus type 1 Vpr arrests the cell cycle in G2 by inhibiting N. R. (1995). Human immunodeficiency virus type 1 viral protein R the activation of p34/cdc2-cyclin B. J. Virol. 69, 6859–6864. (vpr) arrests cells in the G2 phase of the cell cycle by inhibiting p34/ Rogel, M. E., Wu, L. I., and Emerman, M. (1995). The human immunodefi- cdc2 kinase activity. J. Virol. 69, 6705–6711. ciency virus type 1 vpr gene prevents cell proliferation during chronic Heinzinger, N. K., Bukinsky, M. I., Haggerty, S. A., Ragland, A. M., Kewal- infection. J. Virol. 69, 882–888. ramani, V., Lee, M., Gendelman, H. E., Ratner, L., Stevenson, M., and Subbramanian, R. A., and Cohen, E. A. (1994). Molecular biology of the Emerman, M. (1994). The Vpr protein of human immunodeficiency human immunodeficiency virus accessory proteins. J. Virol. 68, 6831– virus type 1 influences nuclear localization of viral nucleic acids in 6835. nondividing host cells. Proc. Natl. Acad. Sci. USA 91, 7311–7315. Tristem, M., Marshall, C., Karpas, A., and Hill, F. (1992). Evolution of Jowett, J. B., Planelles, V., Poon, B., Shah, N. P., Chen, M.-L., and Chen, the primate lentiviruses: evidence from vpx and vpr. EMBO J. 11, L. S. (1995). The human immunodeficiency virus type 1 vpr gene 3405–3412. arrests infected cells in the G2 / M phase of the cell cycle. J. Virol. Trono, D. (1995). HIV accessory proteins: leading roles for the support- 69, 6304–6313. ing cast. Cell 82, 189–192. Kinoshita, N., Ohkura, H., and Yanagida, M. (1990). Distinct, essential Vaishnav, Y. N., and Wong-Staal, F. (1991). The biochemistry of AIDS. roles of type 1 and 2A protein phosphatases in the control of the Ann. Rev. Biochem. 60, 577–630. fission yeast cell division cycle. Cell 63, 403–415. Wera, S., Fernandez, A., Lamb, N. J. C., Turowski, P., Hemmings-Mieszc- Lang, S. M., Weeger, M., Stahl-Hennig, C., Coulibaly, C., Hunsmann, zak, M., Mayer-Jaekel, R. E., and Hemmings, B. A. (1995). Deregula- G., Muller, J., Muller-Hermelink, H., Fuchs, D., Wachter, H., Daniel, tion of translational control of the 65-kDa regulatory subunit (PR65a) M. M., Derosiers, R. C., and Fleckenstein, B. (1993). Importance of of protein phosphatase 2A leads to multinucleated cells. J. Biol. vpr for infection of Rhesus monkeys with simian immunodeficiency Chem. 270, 21374–21381. virus. J. Virol. 67, 902–912. Yu, X. F., Matsuda, M., Essex, M., and Lee, T. H. (1990). Open reading Levy, D. N., Fernandes, L. S., Williams, W. V., and Weiner, D. B. (1993). frame vpr of simian immunodeficiency virus encodes a virion-associ- Induction of cell differentiation by human immunodeficiency virus 1 ated protein. J. Virol. 64, 5688–5693. vpr. Cell 72, 541–550. Zhao, Y., Cao, J., O’Gorman, M. R. G., Yu, M., and Yogev, R. (1996). Levy, J. A. (1995). Pathogenesis of Human Immunodeficiency Virus in- Effect of human immunodeficiency virus type 1 protein R (vpr) gene fection. Microb. Rev. 57, 183–289. expression on basic cellular function of fission yeast Schizosacchar- Macreadie, I. G., Castelli, L. A., Hewish, D. R., Kirkpatrick, A., Ward, omyces pombe. J. Virol. 70, 5821–5826.

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology