Discovery and Quantitation of Protein Modifications Using Targeted Mass

Home , Hybrid mass spectrometer, Orbitrap, Thermospray

Discovery and Quantitation of Protein Modifications using Targeted Mass

Spectrometry

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of

Philosophy in the Graduate School of The Ohio State University

Jia You, M.E.

Graduate Program in Chemistry

The Ohio State University

2012

Dissertation Committee:

Dr. Michael A. Freitas, Advisor

Dr. Dehua Pei, Co-Advisor

Dr. Anne Co

Jia You

2012

Abstract

In this dissertation, efforts were focused on the development of targeted proteomic assays to elucidate differences in protein profiles present in diseases and their correlation with other molecular markers (proteins or microRNA).

In Chapter 2, a high-sensitivity TFA-free LC-MS method is described. The analysis of proteins by reversed-phase liquid chromatography (RPLC) commonly involves the use of TFA as an ion-pairing agent, even though it forms adducts and suppresses sensitivity. The presence of adducts can complicate protein molecular weight assignment especially when protein isoforms coelute as in the case of histones. To mitigate the complicating effects of TFA adducts in protein

LC-MS, TFA-free methods for protein separation optimized. Protein standards and histones were used to evaluate TFA-free separations using capillary (0.3 mm id) and nanoscale (0.1 mm id) C8 columns with the ion-pairing agents, formic acid or acetic acid. The optimized method was then used to examine the applicability of the approach for histone characterization in human cancer cell lines and primary tumor cells from chronic lymphocytic leukemia patients.

In chapter 3, a targeted mass spectrometry approach was used to examine nitration and nitrosylation of tyrosine residues on tropomyosin. A highly versatile target-driven MS/MS strategy was developed to facilitate identification and quantification of especially low abundance protein post-translational modifications. The LC-MS/MS analysis was carried out on a LTQ-Orbitrap mass spectrometer to take advantage of its high mass resolution and high mass accuracy. A recursive process was used to discover, verify and quantify all the possible nitrated and nitrosylated peptides. Measurement of nitrotyrosine and nitrosyltyrosine on Tm highlights the utility of this approach for discovering and characterizing the challenging low abundant post-translational modifications.

In Chapter 4, phosphotyrosine (pTyr) protein enrichment was used to assist the identification of new potentially druggable targets in FLT3 internal tandem duplication (FLT3 ITD) driven acute myeloid leukemia (AML). The MV4-11 cell line was used in this study because it carries the FLT3 ITD activating mutation. pTyr protein enrichment was used to characterize protein extracts from MV4-11 cells before and after treated with the tyrosine kinases inhibitor PKC412. The use of 4G10 anti-pTyr conjugated beads yielded high quality pTyr enrichment with low background. New FLT3 downstream signaling effectors were expected to be identified from pTyr immunopurified protein complex by LC-MS3 analysis, and serve as novel therapeutic targets in AML.

iii

In Chapter 5, DICER-associated or DGCR8-associated proteins were studied by

LC-MS/MS following immunoprecipitation with Flag-DICER or Flag-DGCR8.

Among the identified proteins, nucleolin (NCL), a major nucleolar protein often up-regulated in cancer, was detected and confirmed as a component of the

DROSHA-DGCR8 complex by coimmunoprecipitation experiments, as previously reported. Further research was focused on this RNA-binding protein NCL to characterize its role in miRNA biogenesis. Experimental data showed NCL regulates the biogenesis of a specific cohort of miRNAs. Since miRNA level modulation as a therapeutic approach has been considered challenging so far, these findings could have a strong clinical impact on the development of future miRNA-based anti-cancer therapies.

Dedication

This document is dedicated to my mother, Wanhong Cao.

Acknowledgments

I would like to thank my advisor, Dr. Michael. A. Freitas, for his instruction and support. His knowledge, experience and expertise helped me through my Ph.D study. Also, I appreciate him for providing me the opportunity to learn, think and work independently. The experience and training I obtained in Dr. Freitas group will benefit me greatly for the rest of my life.

I would also like to thank Dr. Dehua Pei, my co-advisor in the Department of

Chemistry. His support allowed me to pursue the research in which I felt most interested.

I want to thank the group members including Dr. Hua Xu, Dr. Liwen Wang, Dr.

Lanhao Yang, Dr. Kelly Telu, Xiaoyan Guan, Sean Harshman, Linan Wang, and

Owen Branson for their support.

I also want to thank my collaborators: Dr. John Byrd, Dr. Brandon Biesiadecki, Dr.

Guido Marcucci, and Dr. Flavia Pichiorri. Their support and help were valuable to me. Thanks are extended to their group members. Many thanks to Dr. Kari

Green-Church, Dr. Liwen Zhang and Nan Kleinholz for sharing instruments.

I also would like to thank all the professors who taught me in graduate school.

Special thanks to Dr. Susan. V. Olesik for the helpful discussion and comments on my chapter 2.

vii

Vita

July 2002 ...... B.E. Biochemical Engineering, Nanjing

University of Science & Technology,

Nanjing, China

December 2005 ...... M.E. Biochemical Engineering, Nanjing

University of Science & Technology,

Nanjing, China

September 2006 to present ...... Graduate Teaching/Research Associate,

Department of Chemistry, The Ohio State

University, Columbus, OH

Publication

You, J., Wang, L., Saji, M., Olesik, S. V., et al., High-sensitivity TFA-free LC-MS for profiling histones. Proteomics 2011, 11, 3326-3334.

Field of Study

Major Field: Chemistry

viii

Table of Contents

Abstract ...... ii Dedication ...... v Acknowledgments ...... vi Vita ...... viii Table of Contents ...... ii List of Tables ...... v List of Tables in Appendix A ...... vi List of Figures ...... viii List of Figures in Appendix A ...... xi Abbreviation List ...... xiii 1 Introduction ...... 1 1.1 Proteomics and basic proteomic technologies ...... 1 1.2 Separation of proteomic analytes by liquid chromatography ...... 4 1.3 Separation of proteins by SDS-PAGE ...... 6 1.4 Western blot ...... 7 1.5 Immunoprecipitation ...... 8 1.6 Mass spectrometry ...... 8 1.6.1 Ion sources used for proteomic analysis ...... 9 1.6.2 Mass analyzer ...... 11 1.6.3 Tandem mass spectrometry ...... 15 1.6.4 Peptide fragmentation by collision-induced dissociation ...... 17 1.7 Research goals ...... 19 2 High-sensitivity TFA-free LC-MS for profiling histones ...... 23 2.1 Introduction ...... 23 2.2 Experimental ...... 25 2.2.1 Preparation of cell lines ...... 25 2.2.2 Preparation of protein standards ...... 26 2.2.3 Extraction of histones from bovine calf thymus ...... 27 2.2.4 Extraction of histones from human cells ...... 28 2.2.5 Liquid chromatography mass spectrometry (LC-MS) ...... 28 ii

2.3 Results and discussion ...... 31 2.3.1 Effect of TFA ion-pairing agent on the ESI-MS spectra of histones 31 2.3.2 Optimization of TFA-free histone LC-MS ...... 36 2.3.3 TFA-free LC-MS analysis of protein standards ...... 46 2.3.4 Application of TFA-free LC-MS analysis ...... 48 2.4 Conclusion ...... 53 3 Targeted mass spectrometry methods for detection and quantitation of tyrosine nitration ...... 54 3.1 Introduction ...... 54 3.2 Experimental ...... 58 3.2.1 Expression of Tm ...... 58 3.2.2 Nitration of Tm tyrosine ...... 58 3.2.3 Protein electrophoresis and western blot ...... 58 3.2.4 LC-MS ...... 59 3.2.5 Protein digestion ...... 60 3.2.6 Data dependent LC-MS/MS ...... 60 3.2.7 Data dependent total reaction monitoring (DDTRM) ...... 62 3.2.8 Total reaction monitoring (TRM) ...... 62 3.2.9 Data analysis ...... 62 3.2.10 Selected ion monitoring (SIM) ...... 63 3.3 Results and discussion ...... 64 3.3.1 Overview ...... 64 3.3.2 Western blot analysis ...... 64 3.3.3 LC-MS analysis ...... 66 3.3.4 Identification nitrotyrosine and nitrosyltyrosine sites ...... 68 3.3.5 Quantification of nitrotyrosine and nitrosyltyrosine ...... 77 3.4 Conclusion ...... 92 4 Identification and validation of new drug targets in Acute Myeloid Leukemia ...... 94 4.1 Introduction ...... 94 4.2 Methods ...... 100 4.2.1 Cell culture ...... 100 4.2.2 Drug treatment ...... 100 4.2.3 Western blot and immunoprecipitation ...... 100 iii

4.2.4 In-gel tryptic digestion ...... 101 4.2.5 Data-dependent neutral loss LC-MS3 analysis...... 102 4.2.6 Transfections with siRNAs ...... 103 4.2.7 Transfections with shRNA ...... 104 4.2.8 Lentivirus production ...... 104 4.2.9 Lentiviral infection ...... 105 4.2.10 Methylcellulose-based clonogenic assay ...... 105 4.3 Results and discussion ...... 106 4.4 Conclusions ...... 121 5 Nucleolin is a key component of miRNA-processing complex and regulates the biogenesis of a cohort of miRNAs ...... 123 5.1 Introduction ...... 123 5.2 Experimental ...... 124 5.2.1 Cell lines ...... 124 5.2.2 Immunoprecipitation and western blot ...... 125 5.2.3 In-gel tryptic digestion ...... 126 5.2.4 LC-MS/MS analysis ...... 127 5.2.5 Transfections with siRNAs ...... 128 5.2.6 miRNA profiling ...... 129 5.2.7 Northern blot ...... 129 5.2.8 Bioinformatic analysis ...... 129 5.3 Results ...... 130 5.3.1 NCL is a component of the miRNA-processing complex ...... 130 5.3.2 NCL affects the expression of a specific set of miRNAs ...... 136 5.4 Conclusion ...... 145 6 Summary ...... 146 References ...... 150 Appendix A: Supporting information for chapter 3 ...... 166

List of Tables

Table 1.1 Columns used in this dissertation...... 5 Table 1.2 Comparison of mass analyzers ...... 12 Table 2.1 Linear-convex gradient for histone separation ...... 30 Table 2.2 Linear gradient for protein standard separation ...... 30 Table 2.3 Formulas of TFA adducts formed with histone H4, and their masses ...... 35 Table 2.4 Histone variants and their masses (monoisotopic and average) detected under all the experimental conditions ...... 44 Table 3.1 Summary of detected peptides containing nitrotyrosine or nitrosyltyrosine in DDA, DDTRM and TRM experiments...... 70 Table 3.2 Parameters used for target precursor ions and their target transitions in DDTRM and TRM experiments...... 74 Table 3.3 Comparison of scan numbers collected by DDA, DDTRM and TRM methods...... 80 Table 3.4 The statistical comparison of TRM and SIM...... 87 Table 4.1 Hairpin sequences used for lentivirus production...... 104 Table 5.1 Oligonucleotides used for the pull-down assay...... 125 Table 5.2 Protein identification and assignment for gel band 3, 4, 14, and 17 on Figure 5.1 by LC-MS/MS...... 133

List of Tables in Appendix A

Table A.1 Hydrophobicities of unmodified peptides...... 167 Table A.2 Product ions of 13LDKENALDR21, m/z = 537.28+2...... 172 Table A.3 Product ions of 38QLEDELVSLQK48, m/z = 651.35+2...... 173 Table A.4 Product ions of 50LKGTEDELDKYSEALK65, m/z = 613.65+3...... 174 50 65 Table A.5 Product ions of LKGTEDELDKYNO2SEALK , m/z = 628.65+3...... 175 Table A.6 Product ions of 50LKGTEDELDKYSEALKDAQEK70, m/z = 603.31+4...... 177 50 70 Table A.7 Product ions of LKGTEDELDKYNOSEALKDAQEK , m/z = 610.55+4...... 179 Table A.8 Product ions of peptide 50 70 +4 LKGTEDELDKYNO2SEALKDAQEK , m/z = 614.55 ...... 181 Table A.9 Product ions of 52GTEDELDKYSEALK65, m/z = 799.38+2...... 182 52 65 +2 Table A.10 Product ions of GTEDELDKYNOSEALK , m/z = 813.88 ...... 183 52 65 +2 Table A.11 Product ions of GTEDELDKYNO2SEALK , m/z = 821.88 ...... 184 Table A.12 Product ions of 52GTEDELDKYSEALKDAQEK70, m/z = 723.68+3...... 186 52 70 Table A.13 Product ions of GTEDELDKYNOSEALKDAQEK , m/z = 733.34+3...... 188 52 70 Table A.14 Product ions of GTEDELDKYNO2SEALKDAQEK , m/z = 738.67+3...... 190 Table A.15 Product ions of 77KATDAEADVASLNR90, m/z = 730.87+2...... 191 Table A.16 Product ions of 78ATDAEADVASLNR90, m/z = 666.82+2...... 192 Table A.17 Product ions of 91RIQLVEEELDR101, m/z = 700.38+2...... 193 Table A.18 Product ions of 92IQLVEEELDR101, m/z = 622.33+2...... 194 Table A.19 Product ions of 168KLVIIESDLER178, m/z = 657.89+2...... 195 Table A.20 Product ions of 169LVIIESDLER178, m/z = 593.84+2...... 196 Table A.21 Product ions of 214YSQKEDKYEEEIK226, m/z = 563.61+3...... 198 214 226 +3 Table A.22 Product ions of YNOSQKEDKYEEEIK , m/z = 573.27 ...... 200 214 226 +3 Table A.23 Product ions of YNO2SQKEDKYEEEIK , m/z = 578.60 ...... 202 214 226 +3 Table A.24 Product ions of YSQKEDKYNO2EEEIK , m/z = 578.60 ...... 204 214 226 Table A.25 Product ions of YNO2SQKEDKYNO2EEEIK , m/z = 593.60+3...... 206 Table A.26 Product ions of 218EDKYEEEIK226, m/z = 591.78+2...... 207 218 226 +2 Table A.27 Product ions of EDKYNOEEEIK , m/z = 606.27 ...... 208 218 226 +2 Table A.28 Product ions of EDKYNO2EEEIK , m/z = 614.27 ...... 209 vi

Table A.29 Product ions of 252SIDDLEDELYAQK264, m/z = 769.86+2...... 210 252 264 +2 Table A.30 Product ions of SIDDLEDELYNOAQK , m/z = 784.36 ...... 211 252 264 +2 Table A.31 Product ions of SIDDLEDELYNO2AQK , m/z = 792.36 ...... 212 Table A.32 Product ions of 269AISEELDHALNDMTSI284, m/z = 879.91+2...... 213 269 284 Table A.33 Product ions of AISEELDHALNDMOXTSI , m/z = 887.91+2...... 214

vii

List of Figures

Figure 1.1 Proteomic workflow used in this dissertation...... 3 Figure 1.2 Diagram of electrospray source and schematic of ESI...... 11 Figure 1.3 Diagram of an LIT mass analyzer...... 14 Figure 1.4 A face view of the orbitrap mass analyzer...... 15 Figure 1.5 CID fragmentation...... 17 Figure 1.6 Peptide fragmentation nomenclature ...... 18 Figure 2.1 Capillary LC-MS separation of bovine histones, 5 μL/min, C8 column ...... 33 Figure 2.2 Reconstructed mass spectra of histone H4 ...... 34 Figure 2.3 Capillary LC-MS chromatograms of bovine histones, 1% formic acid, C8 column ...... 37 Figure 2.4 Capillary LC-MS chromatograms of bovine histones. From (A) to (E): 1%, 0.5%, 0.4%, 0.2%, and 0.1% formic acid...... 39 Figure 2.5 Capillary LC-MS of bovine histones. (A): 0.5% formic acid, (B): 0.5% acetic acid...... 40 Figure 2.6 Nano LC-MS chromatograms of bovine histones, 1 μL/min, C8 column ...... 42 Figure 2.7 Capillary LC-MS chromatogram of protein standards ...... 47 Figure 2.8 Capillary LC-MS chromatograms of bovine histone standard, and histones extracted from B cells (one normal volunteer and seven CLL patients) ...... 51 Figure 2.9 (A) Capillary LC-MS chromatograms of bovine histone standard, and histones extracted from three human breast cancer cell lines. (B) Reconstructed mass spectra of H4 ...... 52 Figure 3.1 (A) Heptad repeat (a-b-c-d-e-f-g) amino acid sequence of mouse cardiac Tm. (B) Dimer interactions ...... 57 Figure 3.2 Reaction of peroxynitrite (ONOO-) with Tyr results in the addition of a nitro- or nitrosyl- adduct at the three position to form 3-nitrotyrosine or 3-nitrosyltyrosine...... 64 Figure 3.3 Western blot detection of 3-NT and total Tm ...... 66 Figure 3.4 LC-MS analysis on Tm treated with ONOO- at molar ratios of ONOO- to Tm as 0:1, 40:1 and 150:1...... 67 Figure 3.5 The illustration for optimizing the inclusion list...... 73 Figure 3.6 The LC elution profile for target peptides in Table 3.2...... 76 Figure 3.7 The comparison of TRM, SRM and SIM LC and MS data on peptide (214YSQKEDKYEEEIK226)...... 83 viii

Figure 3.8 The comparison of TRM, SRM and SIM experiment data on peptide (214YSQKEDKYEEEIK226)...... 84 Figure 3.9 The SIM experiment data of nitration and nitrosylation on each Tyr site...... 87 Figure 3.10 The comparison of TRM, SRM and SIM experiment data on control peptides ...... 88 Figure 4.1 Schematic of phosphoproteomic-enrichment analysis...... 97 Figure 4.2 Schematic of neutral loss MS3 characterization of phosphopeptides...... 99 Figure 4.3 4G10 pTyr western blot analysis following anti-FLT3 immunoprecipitation of protein extracts from untreated MV4- 11 cells or cells treated with 1 µM PKC412 for 1 hr...... 106 Figure 4.4 4G10 pTyr western blot analysis following 4G10 anti-pTyr immunoprecipitation of MV4-11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr...... 107 Figure 4.5 Coomassie blue staining following 4G10 anti-pTyr immunoprecipitation of MV4-11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr...... 109 Figure 4.6 MYH9 western blot following 4G10 anti-pTyr immunoprecipitation ...... 110 Figure 4.7 pTyr western blot following anti-MYH9 immunoprecipitation ...... 110 Figure 4.8 MYH9 western blot following anti-FLT3 immunoprecipitation ...... 111 Figure 4.9 FLT3 western blot following anti-MYH9 immunoprecipitation ...... 111 Figure 4.10 MYH9 and FLT3 western blot of MV4-11 cell lysate untreated/treated with 1 µM PKC412 ...... 112 Figure 4.11 MYH9 western blot demonstrating FLT3 knock-down in MV4-11 following siRNA administration and corresponding loss of MYH9...... 113 Figure 4.12 Taqman real-time PCR shows a decrease of MYH9 mRNA after FLT3 siRNA transfection in MV4-11 cells...... 114 Figure 4.13 siRNA mediated MYH9 knock-down produces a modest decrease in MYH9 levels and no change in FLT3 experssion in MV4-11 cells...... 115 Figure 4.14 Time course western blot demonstrating a reduction in phosphorylated FLT3 following transfection with MYH9 siRNA...... 116 Figure 4.15 (Top): shRNA mediated MYH9 knock down produces a modest decrease of FLT3 levels as measured by western blot. (Bottom): CO-IP demonstrates a robust loss of FLT3 phosphotyrosine with loss of MYH9 expression...... 118 Figure 4.16 Time course comparing growth rate of untransfected control MV4-11 cells with cells expressing MYH9 shRNA...... 120 Figure 4.17 Semisolid colony forming assay of MV4-11 MYH9 knock down cells...... 120

Figure 5.1 SDS-PAGE analysis of DICER-associated and DGCR8- associated proteins in HEK-293 cell extracts...... 132 Figure 5.2 (A) MassMatrix result for band 4 in Figure 5.1. (B) MassMatrix result for band 17 in Figure 5.1...... 134 Figure 5.3 Identification of NCL as a component of the microprocessor complex or pri-miRNA processing protein complex composed of DGCR8 and DROSHA in HEK-293 cells...... 135 Figure 5.4 NCL interacts with pre-miR-21 in HEK-293 cells...... 138 Figure 5.5 (A) MassMatrix result for band1 in Figure 5.4A. (B) MassMatrix result for band2 in Figure 5.4A...... 139 Figure 5.6 NCL specifically regulates the expression of specific miRNAs in HeLa cells...... 141 Figure 5.7 Effect of NCL knockdown on mature miRNA levels in HeLa cells...... 142 Figure 5.8 Effect of NCL knockdown on mature miRNA levels in HEK- 293 cells...... 143 Figure 5.9 Effect of NCL knockdown on mature miRNA levels in MCF-7 cells...... 144

List of Figures in Appendix A

Figure A.1 Linear function of retention time and hydrophobicity ...... 166 Figure A.2 The TRM, SRM and SIM experiment data of nitration and nitrosylation on tyrosine 60...... 168 Figure A.3 Calculation methods for nitrosylation level and nitration level on tyrosine 60...... 169 Figure A.4 The TRM, SRM and SIM experiment data of nitration and nitrosylation on tyrosine 214; nitration on tyrosine 221...... 170 Figure A.5 The TRM, SRM and SIM experiment data of nitration and nitrosylation on tyrosine 261...... 171 Figure A.6 MS/MS spectrum of peptide 13LDKENALDR21, m/z = 537.28+2...... 172 Figure A.7 MS/MS spectrum of peptide 38QLEDELVSLQK48, m/z = 651.35+2...... 173 Figure A.8 MS/MS spectrum of peptide 50LKGTEDELDKYSEALK65, m/z = 613.65+3...... 174 50 65 Figure A.9 MS/MS spectrum of peptide LKGTEDELDKYNO2SEALK , m/z = 628.65+3...... 175 Figure A.10 MS/MS spectrum of peptide 50LKGTEDELDKYSEALKDAQEK70, m/z = 603.31+4...... 176 Figure A.11 MS/MS spectrum of peptide 50 70 +4 LKGTEDELDKYNOSEALKDAQEK , m/z = 610.55 ...... 178 Figure A.12 MS/MS spectrum of peptide 50 70 +4 LKGTEDELDKYNO2SEALKDAQEK , m/z = 614.55 ...... 180 Figure A.13 MS/MS spectrum of peptide 52GTEDELDKYSEALK65, m/z = 799.38+2...... 182 52 65 Figure A.14 MS/MS spectrum of peptide GTEDELDKYNOSEALK , m/z = 813.88+2...... 183 52 65 Figure A.15 MS/MS spectrum of peptide GTEDELDKYNO2SEALK , m/z = 821.88+2...... 184 Figure A.16 MS/MS spectrum of peptide 52GTEDELDKYSEALKDAQEK70, m/z = 723.68+3...... 185 Figure A.17 MS/MS spectrum of peptide 52 70 +3 GTEDELDKYNOSEALKDAQEK , m/z = 733.34 ...... 187 Figure A.18 MS/MS spectrum of peptide 52 70 +3 GTEDELDKYNO2SEALKDAQEK , m/z = 738.67 ...... 189

Figure A.19 MS/MS spectrum of peptide 77KATDAEADVASLNR90, m/z = 730.87+2...... 191 Figure A.20 MS/MS spectrum of peptide 78ATDAEADVASLNR90, m/z = 666.82+2...... 192 Figure A.21 MS/MS spectrum of peptide 91RIQLVEEELDR101, m/z = 700.38+2...... 193 Figure A.22 MS/MS spectrum of peptide 92IQLVEEELDR101, m/z = 622.33+2...... 194 Figure A.23 MS/MS spectrum of peptide 168KLVIIESDLER178, m/z = 657.89+2...... 195 Figure A.24 MS/MS spectrum of peptide 169LVIIESDLER178, m/z = 593.84+2...... 196 Figure A.25 MS/MS spectrum of peptide 214YSQKEDKYEEEIK226, m/z = 563.61+3...... 197 214 226 Figure A.26 MS/MS spectrum of peptide YNOSQKEDKYEEEIK , m/z = 573.27+3...... 199 214 226 Figure A.27 MS/MS spectrum of peptide YNO2SQKEDKYEEEIK , m/z = 578.60+3...... 201 214 226 Figure A.28 MS/MS spectrum of peptide YSQKEDKYNO2EEEIK , m/z = 578.60+3...... 203 214 226 Figure A.29 MS/MS spectrum of peptide YNO2SQKEDKYNO2EEEIK , m/z = 593.60+3...... 205 Figure A.30 MS/MS spectrum of peptide 218EDKYEEEIK226, m/z = 591.78+2...... 207 218 226 Figure A.31 MS/MS spectrum of peptide EDKYNOEEEIK , m/z = 606.27+2...... 208 218 226 Figure A.32 MS/MS spectrum of peptide EDKYNO2EEEIK , m/z = 614.27+2...... 209 Figure A.33 MS/MS spectrum of peptide 252SIDDLEDELYAQK264, m/z = 769.86+2...... 210 252 264 Figure A.34 MS/MS spectrum of peptide SIDDLEDELYNOAQK , m/z = 784.36+2...... 211 252 264 Figure A.35 MS/MS spectrum of peptide SIDDLEDELYNO2AQK , m/z = 792.36+2...... 212 Figure A.36 MS/MS spectrum of peptide 269AISEELDHALNDMTSI284, m/z = 879.91+2...... 213 269 284 Figure A.37 MS/MS spectrum of peptide AISEELDHALNDMOXTSI , m/z = 887.91+2...... 214

xii

Abbreviation List

ABC: ammonia bicarbonate

ACN: acetonitrile

AIM: accurate inclusion mass

CID: collision induced dissociation

CLL: chronic lymphocytic leukemia

CML: chronic myelogenous leukemia

DDNL: data dependent neutral loss scan

DDTRM: data dependent total reaction monitoring

ESI-LC-MS: electrospray-liquid chromatography-mass spectrometry

FPs: false positives

FTICR: fourier transform ion cyclotron resonance

IDA: iodoacetamide

IP: immunoprecipitation

MRM: multiple reaction monitoring

Protein ID: protein identification

PTK: phosphorylation tyrosine kinase

PTM: post-translational modifications pTyr: phosphorylated tyrosine

xiii

RP-LC/MS: reversed phase-liquid chromatography/mass spectrometry

SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis

SIM: selected ion morning

SRM: selected reaction monitoring

TFA: trifluoroacetic acid

TRM: total reaction monitoring

WB: western blot

xiv

1 Introduction

1.1 Proteomics and basic proteomic technologies

Proteins are the building blocks of cells. Genetic alterations that change a protein’s structure can effect protein-protein interactions, enzyme catalysis and signaling networks [1]. Changes in protein structure or function can have serious consequences for the health of a patient as a wide variety of diseases have been demonstrated to be driven by protein alterations. Diseases including many types of cancer, cystic fibrosis, Alzheimer’s disease and Wilson’s disease are all caused by changes in a cellular protein [2]. The pivotal role proteins play in disease initiation and progression means they also have great potential to serve as biomarkers for disease risk and development [3].

Proteomics is the study of proteins, including identification and characterization of proteins and their posttranslational modifications (PTMs), determination of protein structure and function, protein localization, and detection of protein- protein interactions [1, 4]. Proteomic technologies are constantly being developed to study proteins and their PTMs. Immunoassay and mass spectrometry are two commonly used techniques for proteomic analysis.

Immunoassays, such as western blot (WB), immunoprecipitation (IP) and

immunofluorescence, use the binding of an antibody to its homologous antigen to identify proteins. Mass spectrometry (MS) characterizes proteins by measuring the mass of the protein, its enzymatically produced peptides, individual amino acids, and even the posttranslational modifications [5-16]. Immunoassay is sensitive but requires a priori knowledge of the proteins and their PTMs for raising antibodies. Conversely, MS analysis can be used to obtain protein sequence information, discover proteins and their PTMs, and simultaneously evaluate multiple analytes.

Immunoassay and MS techniques are routinely combined with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) or liquid chromatography

(LC) to separate complex proteins and/or peptide mixtures to improve proteomic analysis performance. Due to the limited dynamic range of detection for immunoblotting and MS, it is often necessary to separate highly abundant species from the analytes of interest. LC and MS instruments are often connected together to form LC-MS or LC-MS/MS techniques to separate and analyze proteins or peptides qualitatively and/or quantitatively. SDS-PAGE is regularly used after immunoprecipitation analysis and prior to LC-MS/MS analysis. An immunopurified protein complex from a cell lysate is separated by

SDS-PAGE. The gel-bands containing proteins are digested with an enzyme to produce peptides and analyzed by LC-MS/MS.

Proteins

LC-MS In-solution SDS-PAGE Immunoprecipitation tryptic digestion

In-gel tryptic Western blot digestion

Peptides

LC-MS/MS

MassMatrix database search

Figure 1.1 Proteomic workflow used in this dissertation.

In this dissertation, my efforts were focused on the development of targeted proteomic assays to elucidate differences in protein profiles present in diseases and their correlation with other molecular markers (proteins or microRNA).

Immunoprecipitation analysis was used to enrich targeted proteins; SDS-PAGE and LC were used to separate proteins or peptides, MS analysis was used for protein discovery, identification and quantification; and western blot analysis was used for protein verification. Chapter 1 introduces these five techniques in details.

Chapter 2, 3, 4 and 5 demonstrate four individual projects on method development and optimization of LC techniques, MS techniques and the combination of LC-MS/MS with immunoassay techniques. Figure 1.1 shows the basic workflow used in this dissertation. 3

1.2 Separation of proteomic analytes by liquid chromatography

Liquid chromatography is an analytical technique that separates analytes dissolved in a solvent. A LC instrument consists of a solvent delivery system, a sample injector, a sample injection valve, and a column packed with small particles. The separation of analytes depends on the partitioning of analytes between a stationary phase (column) and a mobile phase (solvent). Better separation of analytes results in higher possibility for each analyte to be mass analyzed individually. With efficient separation the low abundant species could be detected and differentiated from highly abundant analytes.

Because proteins and peptides are highly hydrophobic, columns with nonpolar packing materials (C4, C8, and C18) are used as the stationary phase because their hydrophobic nature interacts with proteins and peptides and provides efficient separation. Table 1.1 lists the columns used in this dissertation. To elute analytes out of the column, water and acetonitrile (ACN) were used as the mobile phase. The percentage of ACN was increased gradually in the separation process to increase solvent strength and elute from hydrophilic analyte to hydrophobic analyte.

Table 1.1 Columns used in this dissertation.

Column Column size Particle size Pore size Vendor type C8 0.3×150 mm 5 µm 300 Å Michrom Bioresources C8 0.1×150 mm 3 µm 300 Å Michrom Bioresources C18 0.2×50 mm 3 µm 200 Å Michrom Bioresources C18 0.2×150 mm 3 µm 200 Å Michrom Bioresources C18 0.1×150 mm 3 µm 200 Å Michrom Bioresources C18 1.0×150 mm 5 µm SUPELCO(Sigma Aldrich) C18 10×250 mm 5 µm SUPELCO(Sigma Aldrich) C18 0.3×5 mm 5 µm 100 Å LC Packings (Dionex)

LC performance is critical for MS analysis. To achieve highly sensitive and highly separation efficiency for MS analysis, the experimental parameters for the LC system must be optimized. In Chapter 2, a systematic study of the following LC parameters was performed in order to improve LC sensitivitvy for detection of proteins by Mass Spectrometry: 1) flow rate, 2) column internal diameter (id), 3) particle size of column packing material, 4) LC gradient elution program and 5) mobile phase composition: ion-pairing agent(s) and their concentration(s) in the mobile phase.

High mobile phase flow rate reduces retention time and leads to inefficient separation. Low flow rate allows better transfer of analyte between stationary phase and mobile phase but can lead to broader peaks due to longitudinal diffusion. Column id and particle size dictate the volume of stationary phase and the distance through which analytes transfer from stationary phase to mobile

phase. The gradient elution program controls mobile phase composition and solvent strength during the separation process. Ion-pairing agents are acids or bases added to the mobile phase to bind charged analytes in order to improve peak resolution. For example, in chapter 2 the different ion-pairing agents were examined along with small particle capillary and nano ID columns to improve MS detection sensitivity without sacrificing peak resolution.

1.3 Separation of proteins by SDS-PAGE

SDS-PAGE is a gel based method to separate protein mixtures in an electric field by their molecular weights. In this technique, proteins are heated with the anionic detergent SDS. In this condition, proteins are denatured but retain their primary structure. The negatively charged SDS-polypeptide complexes migrate to the positive pole through a sifter-like polyacrylamide gel onto which an electric field is applied. Because low molecular-weight proteins have access to more paths in the gel compared with high mass proteins, small proteins pass through the gel faster than larger proteins. As a result smaller proteins accumulate lower in the gel than larger proteins producing a separation by size.

Proteins in each gel band are visualized, physically excised, digested with an enzyme to produce peptides and then analyzed by LC-MS/MS. To visualize the protein bands separated by SDS-PAGE, Coomassie blue staining is used due to its compatibility with mass spectrometric analysis. It is an organic dye that

combines with basic amino acids, such as arginine, lysine, histidine, and tyrosine.

Examples of SDS-PAGE analysis of whole proteins or enriched protein complexes extracted from different cell lines are presented in chapters 4 and 5.

1.4 Western blot

Western blotting is an antibody based method to detect proteins extracted from tissue or cells. Western blotting begins with SDS-PAGE to separate proteins.

Following the SDS-PAGE proteins are transferred from the acrylamide gel to a membrane made of PVDF or nitrocellulose. In the transfer process, an electric current is passed through a sandwich pressing the gel and the membrane together. The positive electrode pulls the negatively charged proteins from the gel and implants them onto the positively charged membrane. With the proteins now electroeluted, the membrane is incubated with a primary antibody designed to recognize a specific protein or type of protein. A secondary antibody recognizing the primary antibody is then incubated with the membrane. The secondary antibody is conjugated to an enzyme, usually horseradish peroxidase

(HRP), which produces light when incubated with a substrate. The production of light indicates the presence of the protein. This light production is captured on an x-ray film, which is pressed against the membrane in the dark.

1.5 Immunoprecipitation

To separate or enrich a specific protein or protein complex from a batch of cell lysate an immunoprecipitation is performed. To do this, an antibody that recognizes and binds to the protein of interest is added to the solubilized cell lysate. Agarose microbeads coated with a bacterially derived protein A or protein

G are added also to bind to the antibody. The antibody binds to the protein of interest while the Fc (fragment crystallizable; the “tail” of the antibody) region of the antibody binds to the protein A or G on the bead. After an overnight incubation a protein/antibody/bead complex is formed and can be separated from the cell lysate through centrifugation.

1.6 Mass spectrometry

Mass spectrometry is an analytical technique that measures the mass to charge ratio (m/z) of gas-phase ions. A mass spectrometer is an instrument used to measure the m/z ratios. The mass spectrometer consists of four basic parts: 1) the ion source used to form ions from the analytes, 2) the mass analyzer used to separate ions based on their m/z ratio, 3) the detector used to convert ion abundance to an electrical signal and 4) the data acquisition system used to control the MS instrument and record the m/z ratios [17]. There are many different techniques for creating gas-phase ions and separating them based on their m/z ratios. The techniques relevant to the work described in this dissertation are discussed in the next sections.

1.6.1 Ion sources used for proteomic analysis

Analytes are ionized in the ion source before they are introduced to the mass analyzer. There are a variety of ionization methods used in MS analysis. They can be simply classified as “soft” ionization and “hard” ionization. The “soft” ionization methods produce the ion of an intact analyte molecule. In contrast,

“hard” ionization techniques impart much more energy to the analyte and can produce fragment ions (also called product ions) of the analyte molecule.

Proteins and peptides are polar, nonvolatile and heat-unstable. To produce gas- phase ions of intact proteins or peptides, “soft” ionization techniques are required to avoid degradation and fragmentation before their masses are measured. The most common “soft” ionization methods used for proteomics are matrix-assisted laser desorption ionization (MALDI) [18-21] and electrospray ionization (ESI) [22].

In MALDI, energy from an ultraviolet laser is used to ionize analyte(s) suspended in a matrix. The analyte(s) is first dissolved in an organic matrix that absorbs energy at the laser’s wavelength. This mixture is dried into a “solid solution”, in which the matrix surrounds and isolates individual analyte molecules [23]. This solid solution is then irradiated by a short UV laser pulse. The absorption of energy by the matrix results in desorption of the matrix and analyte into the gas- phase [24]. Protons are then transferred from the photoionized matrix molecules to the analyte to form [M+H]+ ions for positive ion mode experiments or [M-H]- for

negative ion mode experiments [25, 26]. MALDI typically produces singly- charged ions but can also produce ions with multiple charges.

In contrast to MALDI, ESI uses a strong electric field to nebulize and ionize analytes directly from solution. In ESI, analytes in solution are flowed through an electrospray tip to which a strong electric field (2-6 kV) is applied. The electric field accumulates charges in the solution at the end of the tip. A nascent spherical drop is pulled into a Taylor cone by the field that then emits highly charged droplets once the surface tension is broken [27]. The initial drops pass through a heated capillary (Figure 1.2) or a curtain of heated nitrogen gas [28-30] resulting in solvent evaporation. As the droplets desolvate, the charge density per drop increases and smaller droplets are generated by Coulomb repulsion.

The analytes within the drop are eventually desolvated to form ions that can carry multiple charges. Because the ions are generated at atmospheric pressure, a series of lenses and skimmers are used to introduce the ions into the high vacuum of the mass analyzer. Because ESI is a continuous ionization method compatible with solutions, it is routinely coupled with continuous chromatographic separation techniques [31-34]. In this dissertation, ESI was used for all the research work due to its compatibility with LC separations.

Figure 1.2 Diagram of electrospray source and schematic of ESI.

1.6.2 Mass analyzer

In current proteomic research, 5 types of mass analyzers are commonly used.

They are Fourier transform ion cyclotron resonance (FT-ICR), time-of-flight (TOF), quadrupole (Q), ion trap (IT), and orbitrap. Different mass analyzers use different

electrical and physical principles to separate gas-phase ions. Also each mass analyzer has its advantages and limitations. Table 1.2 lists their main characteristics including resolution, mass accuracy and vacuum requirements to avoid collision between ions in the mass analyzer.

Table 1.2 Comparison of mass analyzers [17].

TOF Q IT Orbitrap FTICR

Resolution 5,000 2,000 4,000 100,000 500,000 FWHM (m/z 1000) Mass accuracy 200 ppm 100 ppm 100 ppm < 5 ppm < 5 ppm

Pressure 10-6 Torr 10-5 Torr 10-3 Torr 10-10 Torr 10-10 Torr

Resolution or resolving power is the ability of a mass analyzer to resolve signals for two ions with a small m/z difference. The resolution in Table 1.2 is defined as the peak width ∆m at 50% of the peak height, also known as full width at half maximum (FWHM). Mass accuracy indicates the accuracy of the m/z provided by the mass analyzer. It is often expressed in parts per million (ppm). In proteomic analysis, it is critical to distinguish the masses of different protein isoforms or variants. The FT-ICR mass analyzer and the orbitrap mass analyzer both have high resolution and high mass accuracy. They ensure high confidence in the identification of proteins and their PTMs. For example, the mass difference

between protein tri-methylation and acetylation is 0.0364 Da. Only high- resolution and high-mass accuracy mass analyzers could detect this difference.

In this dissertation, a linear ion trap (LIT) mass analyzer and a hybrid LIT-

Orbitrap mass analyzer were used. The IT mass analyzer stores ions with a broad range of m/z values and then sequentially ejects ions of different m/z values where they are detected [35]. The IT is classified into two types, quadrupole ion trap (QIT) and linear ion trap (LIT). QIT consists of a ring electrode in the middle and two ellipsoid end caps [36, 37]. In this confined 3 dimensional space, ions are trapped by an oscillating electric potential applied between the ring and end cap electrodes [38-40]. The LIT is a quadrupole mass analyzer with additional trapping electrodes on each end [41]. A DC voltage is applied to the lenses to confine the ions within the quadrupole [42, 43].

The LIT used in this dissertation (Figure 1.3) is comprised of a quadrupole cut into three separate parts by two lenses that also reflect ions back and forth in the center quadrupole. The three separate parts are electrically isolated from one another. The LIT is used for ion storage, ion filter, ion collision, and radial / axial ion ejection. By using LIT (2D IT), trapping efficiency is improved to 50%, 10-fold higher than trapping efficiency of QIT (3D IT); and ion capacity is increased by

10× compared with that of QIT [17]. Therefore, LIT has higher sensitivity and selectivity than QIT. Compared to other mass analyzers, the IT mass analyzer

has low resolution and poor mass accuracy. But it requires low vacuum and has low cost.

Figure 1.3 Diagram of an LIT mass analyzer.

The orbitrap mass analyzer traps ions between an outer barrel-like electrode and an inner spindle-like electrode using an electrostatic field (Figure 1.4). The outer electrode is separated into two equal halves with a ceramic insulator. Ions are injected perpendicularly through the small gap between the two halves of the outer electrode. Ions move in complex spirals around the inner electrode due to the balance between centrifugal force and electrical force. The centrifugal force is generated by the injected ion carrying kinetic energy (several keV). The electrical force is produced by an electrostatic voltage (several kV) added on the central electrode with the outer electrode at ground potential [44, 45]. As shown is Table 14

1.2, the orbitrap is a high-resolution and high-mass accuracy mass analyzer. Its resolution is less than the resolution of the FT-ICR. But the orbitrap is less expensive than the FT-ICR.

Figure 1.4 A face view of the orbitrap mass analyzer.

1.6.3 Tandem mass spectrometry

In tandem mass spectrometry two or more MS analysis steps are combined.

Tandem mass spectrometers are instrument that house multiple mass analyzers or consists of a single mass analyzer than can perform multiple MS events on the trapped ions. Tandem MS instruments have multiple mass analyzers of the same type (triple quadrupoles) or different analyzer types (hybrid tandem MS, LIT-

Orbitrap). The most common tandem mass spectrometry experiment used in proteomics is the product ion scan (MS/MS or MS2). In the product ion scan, a 15

full MS scan of the analyte precursor ions m/z is performed (MS1 scan or full scan). A selected precursor ion is then isolated and fragmented. The fragment ions (product ions) are scanned in the second event (MS2 scan). Further fragmentation on the product ions can also be performed based on the specific experiment requirement. For example, in chapter 4 a neutral-loss MS3 analysis was used to characterize phosphotyrosine proteins. In this experiment, a third

MS event is performed if a product ion is detected resulting from the neutral loss of phosphoric acid (80 Da for phosphotyrosine). The neutral loss product is selected and fragmented, and its products mass analyzed in the MS3 event.

In this dissertation, an LIT mass analyzer and a hybrid LIT-Orbitrap mass analyzer were used for tandem mass spectrometry. For LIT instrument, all MS events occur within the single linear ion trap mass analyzer. The hybrid LIT-

Orbitrap instrument has several advantages over the LIT. For LIT-Orbitrap, MS1 analysis is performed with the orbitrap mass analyzer and MS/MS analysis with the LIT mass analyzer. Under this setup high-mass accuracy MS1 scans are obtained for the precursors and high-throughput MS2 scans are acquired for the precursors (acquisition time in the orbitrap is ~1 sec whereas it is ~0.3 sec for the

LIT). On the specific model instrument used in this dissertation (LTQ-Orbitrap XL

ThermoFisher Scientific) preview mode for MS1 scans was enabled, in which the

LTQ and the Orbitrap operate in parallel. In this mode, MS2 scans on the LTQ are obtained during the Orbitrap’s data acquisition time.

1.6.4 Peptide fragmentation by collision-induced dissociation

Tandem MS analysis requires the fragmentation of precursor ions selected by the first mass analyzer in order to allow the second analyzer to analyze the product ions. Collision-induced dissociation (CID), also known as collision- activated decomposition (CAD) is commonly used for peptide fragmentation. In

CID (Figure 1.5), an accelerated precursor ion collides with a neutral gas such as nitrogen, argon or helium. During the inelastic collisions, kinetic energy is converted to vibrational energy causing bond cleavage. In CID internal energy throughout the ion is equilibrated prior to fragmentation. Fragmentation is performed via the lowest-energy pathway (the amide bond).

Figure 1.5 CID fragmentation.

Because CID results in cleavage of labile bonds, it is well suited for peptide analysis. The most labile bond in peptides is typically the amide bond. CID fragmentation of peptides leads to predictable cleavages that can be used to determine the amino acid composition and sequence. Figure 1.6 shows the possible ions are produced from a peptide.

n+ x3 y3 z3 x2 y2 z2 x1 y1 z1

n+ x3 y3 z3 x2 y2 z2 x1 y1 z1 R1 O R2 O R3 O R4 R1 O R2 O R3 O R4

H2N C C N C C N C C N C COOH + nH H2N C C N C C N C C N C COOH + nH H HH H H H H H HH H HH H

a1 b1 c1 a2 b2 c2 a3 b3 c3 a b c a b c a b c 1 1 1 2 2 2 3 3 3

R1 O R2 R1 O R2 R1 O R2 O

+ + + H2N C C N C H2N C C N C C O H2N C C N C C NH3

H H H H H H H H H

a + b + + 2 2 c2 R3 O R4 R3 O R4 R3 O R4

+ + + O C N C C N C COOH H3N C C N C COOH C C N C COOH H H H H H H H H H H x + y + z + 2 2 2

Figure 1.6 Peptide fragmentation nomenclature [46-48].

Peptide fragment ions are called a, b or c if the charge is retained on the N- terminus and x, y or z if the charge is retained on the C-terminus. CID favors formation of b and y ions because amide bonds (carbonyl carbon-nitrogen) are usually the most labile bonds. The mass difference between adjacent b- or y- series ions is used to identify the amino acid at that site. Database search algorithms are used to automate analysis of mass spectral data. The peptide mass spectra are matched to predicted sequences from protein database.

1.7 Research goals

LC-MS, TFA-free methods for protein separation were optimized. Protein

standards and histones were used to evaluate TFA-free separations using capillary (0.3 mm id) and nanoscale (0.1 mm id) C8 columns with the ion-pairing agents, formic acid or acetic acid. The optimized method was then used to examine the applicability of the approach for histone characterization in human cancer cell lines and primary tumor cells from chronic lymphocytic leukemia patients.

LTQ-Orbitrap mass spectrometer to take advantage of its high mass resolution and high mass accuracy. A recursive process was used to discover, verify and quantify all the possible nitrated and nitrosylated peptides. Measurement of nitrotyrosine and nitrosyltyrosine on Tm highlights the utility of this approach for discovering and characterizing the challenging low abundant post-translational modifications.

In Chapter 4, phosphotyrosine (pTyr) protein enrichment was used to assist the identification of new potentially druggable targets in FLT3 internal tandem duplication (FLT3 ITD) driven acute myeloid leukemia (AML). The MV4-11 cell line was used in this study because it carries the FLT3 ITD activating mutation. pTyr protein enrichment was used to characterize protein extracts from MV4-11 cells before and after treated with the tyrosine kinases inhibitor PKC412. The characterization of pTyr proteins is challenging due to their low abundance relative to total proteins (~0.05%). The use of 4G10 anti-pTyr conjugated beads yielded high quality pTyr enrichment with low background. New FLT3 downstream signaling effectors were expected to be identified from pTyr immunopurified protein complex by LC-MS3 analysis, and serve as novel therapeutic targets in AML. Notably, one of the proteins detected was Myosin

Heavy Chain 9 (MYH9, 226 KDa). Mutations in the MYH9 gene have been shown to result in hyperproliferation in a lung cancer cell line and MYH9 have been shown to be important in other hematological diseases e.g. bleeding disorders with decreased platelet, it is speculated that MYH9 may play a role in

FLT3-ITD associated AML. Additional studies were made to characterize MYH9 and its role in AML as well as to investigate its association with the receptor tyrosine kinase FLT3.

In Chapter 5, DICER-associated or DGCR8-associated proteins were studied by

LC-MS/MS following immunoprecipitation with Flag-DICER or Flag-DGCR8.

Among the identified proteins, nucleolin (NCL), a major nucleolar protein often up-regulated in cancer, was detected and confirmed as a component of the

DROSHA-DGCR8 complex by coimmunoprecipitation experiments, as previously reported. Further research was focused on this RNA-binding protein NCL to characterize its role in miRNA biogenesis. Experimental data showed NCL regulates the biogenesis of a specific cohort of miRNAs. Notably, NCL-targeted miRNAs, such as miR-21, miR-221, miR-222, miR-103 and miR-10a, have been extensively implicated in cancer initiation, progression and drug resistance. Since miRNA level modulation as a therapeutic approach has been considered challenging so far, these findings could have a strong clinical impact on the development of future miRNA-based anti-cancer therapies.

2 High-sensitivity TFA-free LC-MS for profiling histones

2.1 Introduction

The fundamental unit of chromatin is the nucleosome which consists of histones wrapped with DNA. Histones contribute to the regulation of chromatin structure and function [49]. Chromatin structure influences DNA replication, repair and recombination, as well as gene transcription [50]. Traditionally, to identify histones and their PTMs, immunoassay techniques such as immunoprecipitation, western-blotting and immunofluorescence have been commonly utilized [51-53].

However, the shortcomings of these methods limit their applications.

Immunoassays are dependent on the availability of high specificity antibodies for known modification sites. Furthermore, the specificity of the antibody to a given posttranslational modification can be affected by modifications on neighboring amino acids in the epitope [54]. Moreover, the identification and characterization of histones are complicated because of sequence variants and their multiple

PTMs. These variants usually differ from each other by only a few amino acids, which may or may not be within the antigenic epitope. Therefore, detection of specific variants by antibodies is especially challenging [55].

Liquid Chromatography Mass Spectrometry (LC-MS) has become increasingly popular to analyze histones and their PTMs [56, 57]. Ion-pairing agents are added to the LC mobile phases to bind analytes and neutralize charge in order to improve chromatographic resolution. The most commonly used ion-pairing reagent in histone analysis is trifluoroacetic acid (TFA). TFA provides excellent chromatographic protein separation, but causes signal suppression in ESI–MS systems due to stable ion pair formation and increased mobile phase surface tension [58, 59]. In addition, TFA binds the histones producing adducts which lower the signal intensity, increase the limit of detection and complicate the data analysis. An alternative ion-pairing agent heptafluorobutyric acid (HFBA) has also been shown to exhibit the same effects [56]. Weaker ion-pairing reagents, such as formic acid and acetic acid, form adducts that are less stable but result in poorer chromatographic performance. Consequently, the choice of ion-pairing reagents is a balance between sensitivity and separation efficiency.

Mixed modifiers of TFA with other ion-pairing agents are widely used to separate and identify proteins by LC-MS. Duchateau et al. used a mixture of TFA and formic acid to obtain high separation efficiency and better sensitivity [60]. Years later Clarke et al. [61] tested a mixture of acetic acid (0.5%) and TFA (0.02%) for the analysis of amyloid-β polypeptides. Chong et al. [62] used the combination of

TFA (0.1%) and formic acid (0.2 to 0.3%) to characterize proteins from human breast cancer cells [63]. Despite these efforts, even modest amounts of TFA still

result in adduct formation complicating data analysis, especially when species coelute and are isobaric in mass with the TFA adducts.

The focus of the work described in this chapter was to develop TFA-free histone separations. Capillary and nanoscale columns were used to offset decreased chromatographic performance when using weaker ion-pairing agents. Formic acid, acetic acid, and a mixture of formic acid and TFA were evaluated at varied mobile phase concentrations on C8 columns of different column diameters and particle sizes. Core histones extracted from bovine calf thymus and protein standards were used for method optimization. The optimized methods were then evaluated for their ability to profile histones by LC-MS for human cancer cell lines and primary tumor cells from chronic lymphocytic leukemia (CLL) patients.

2.2 Experimental

2.2.1 Preparation of cell lines

Peripheral blood was obtained from patients following written consent. Patients were diagnosed with CLL by NCI 1996 criteria [64] and had elevated peripheral leukocyte counts (> 20,000/μL), but were otherwise unselected based on disease stage or prognostic subgroup. CLL B-cells were negatively selected using

RosetteSep (Stem Cell Technologies, Vancouver, BC) and isolated by ficoll density gradient centrifugation. Cells were incubated at 37 °C and 5% CO2 in

RPMI 1640 with 10% fetal bovine serum (FBS), 100 U/mL penicillin, 100 µg/mL streptomycin, and 2 mM L-glutamine (Sigma-Aldrich Co., St. Louis, MO).

The non-malignant immortalized breast cell line, MCF-10A (CRL-10317) and the breast cancer cell lines, MCF-7 (HTB-22) and MDA-MB-231 (HTB-26), were obtained from ATCC (Manassas, VA). MCF-10A cells were cultured in DMEM/F-

12 (#11320-033, Life Technologies, Carlsbad, CA) with 5% Horse serum (Life

Technologies), 100 µM MEM Non-Essential Amino Acid (NEAA, #111-400-50,

Life Technologies), 10 mg/mL EGF (#E1257, Sigma-Aldrich Co., St. Louis, MO),

0.5 µg/mL Hydrocortisone (EMD Chemicals Inc., Gibbstown, NJ), 100 ng/mL

Cholera Toxin (#C8052, Sigma-Aldrich Co.), and 10 µg/mL bovine insulin (#I5500,

Sigma-Aldrich Co.) as described previously [65]. MCF-7 and MDA-MB-231 cells were cultured in RPMI Medium 1640 (#11875-119, Life Technologies) and

DMEM (#11965-126, Life Technologies), respectively, in the presence of 10%

FBS and MEM NEAA. All three cell lines were maintained in humidified incubator with 5% CO2. At the time of splitting or harvesting, cells were treated with 0.05% or 0.25% trypsin for 10 min with subsequent termination by addition of growth medium then washed with ice-cold PBS and stored at -80 °C.

2.2.2 Preparation of protein standards

Ubiquitin from bovine erythrocytes and insulin from bovine pancreas were purchased from Sigma-Aldrich Corp (St. Louis, MO). Carbonic anhydrase from

bovine erythrocytes, cytochrome C from equine heart, lysozyme from chicken egg white, and myoglobin from equine heart were purchased from Protea

Biosciences Inc. (Morgantown, WV). A six-component equimolar (50 µM) mixture of them was made by dissolving and mixing all the compounds by HPLC grade water.

2.2.3 Extraction of histones from bovine calf thymus

Core histones were extracted from bovine calf thymus (Worthington Biochemical

Corp., Lakewood, NJ) using an acidic extraction procedure previously described

[54, 66]. Briefly, frozen tissue was thawed in buffer C (0.01 M MgCl2, 0.025 M

KCl, 0.05 M Tris-HCl, pH 7.5, 0.05 M NaHSO3, and 0.25 M sucrose) with 1:10

(v/v) ratio. The tissue was then homogenized using a Polytron Homogenizer

(Brinkmann Instruments Inc., Westbury, NY) and the homogenized mixture was centrifuged for 5 min at 3,000 rpm. The pellet was resuspended in buffer C and centrifuged for 2-3 cycles, followed by 5 washings with solution I (0.14 M NaCl,

0.05 M NaHSO3). The pellet was resuspended in 10 volumes of solution II (0.25

M HCl) and gently vortexed for 2 hours at 4 °C. The mixture was centrifuged at

14,000 rpm for 10 min. The supernatant was collected and dialyzed against 300 volumes of solution III (0.025 M HCl) for more than 12 hours at 4 °C. Core histones were precipitated by adding 10 volumes of acetone at -20 °C for 24 h.

The precipitate was collected, dried and dissolved in water before HPLC separation.

2.2.4 Extraction of histones from human cells

Histones in human cancer cells (1.0×108 cells) were extracted as previously described [67]. The cell pellet was resuspended with 5 mL ice cold nuclei isolation buffer (NIB) (10 mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM MgCl2, 0.5%

Nonidet P-40, 0.15 mM Spermine, and 0.5 mM Spermidine) and incubated on ice for 5 min. Nuclei were pelleted by 1,500 rpm centrifugation at 4 °C for 15 min, and then the nuclei pellet was washed with 5 mL solution (10 mM Tris-HCl, pH

7.5, 150 mM NaCl) and resuspended in 400 µL 0.4 M H2SO4 (ice cold), followed by 30 min incubation on ice. After 15 min centrifugation (14,000 rpm, 4 °C), acetone was added to the supernatant with a final concentration of 80% to precipitate histones at -20 °C overnight. The precipitate was washed with ice cold acetone, and dried, and dissolved in water before HPLC separation.

2.2.5 Liquid chromatography mass spectrometry (LC-MS)

Histone extracts and protein standards were separated by reversed-phase (RP)

HPLC (Dionex Ultimate 3000 capillary/nano HPLC system, Dionex, Sunnyvale,

CA) and mass analyzed with either a Thermo Fisher LTQ Orbitrap XL, or an LCQ

Deca XP (Thermo Finnigan, San Jose, CA), equipped with micro/nanospray ionization sources (Michrom Bioresources Inc., Auburn, CA). HPLC separations were carried out at a flow rate of 5 µL/min or 7 µL/min on a 0.3 mm × 150 mm C8 column (5 µm, 300 Å, Michrom Bioresources Inc., Auburn, CA), and at a flow rate

of 1 µL/min on a 0.1 mm × 150 mm C8 column (3 µm, 300 Å, Michrom

Bioresources Inc., Auburn, CA). The mobile phases consisted of HPLC grade water, and acetonitrile (ACN), with TFA, formic acid, or acetic acid added as ion- pairing reagents. The optimized gradient methods were developed to provide the optimal separation of core histones and protein standards. The optimized gradient to separate histones was a linear-convex segment gradient (Table 2.1).

Protein standards were eluted with a linear segment gradient (Table 2.2). The heated capillary temperature and electrospray voltage were set at 175 °C and 2.0 kV, respectively. Molecular weight and distribution of protein isoforms were determined using Xtract deconvolution (Thermo FisherScientific, San Jose, CA) and IsoPro 3.1 (http://sites.google.com/site/isoproms/).

Table 2.1 Linear-convex gradient for histone separation

Time range % B Curve 0-5 min 20% - 20% linear 5-25 min 20% - 30% convex 2 25-65 min 30% - 35% convex 4 65-78 min 35% - 48% linear

Table 2.2 Linear gradient for protein standard separation

Time range % B 0-5 min 15% - 15% 5-15 min 15% - 35% 15-20 min 35% - 40% 20-25 min 40% - 40% 25-27 min 40% - 60%

2.3 Results and discussion

2.3.1 Effect of TFA ion-pairing agent on the ESI-MS spectra of histones

Effective separations of proteins by RP-HPLC require the addition of ion-pairing agents. These components form ion-pairs with protein analytes’ charged side- chains exposing the hydrophobic core of the protein. Consequently, the interaction of proteins with the hydrophobic stationary phase allows for their retention and separation [63, 68]. Organic acids are common ion-pairing agents and their low pKa promotes protein unfolding and denaturation. The combination of ion-pairing and unfolding results in proteins adopting similar conformations in solution manifested by sharp and symmetrical peaks [58, 69, 70].

The most frequently used ion-pairing agent TFA, even in modest amounts, results in the formation of adducts with basic species complicating data analysis.

For histone profiling, this is especially a problem due to their highly basic nature and protein modifications that can be obscured by the TFA adducts. To illustrate this effect, Figure 2.1 shows a capillary (0.3 mm id, 5 μm particle size) LC-MS separation of bovine histones using either 0.5% formic acid or a mixture of 0.5% formic acid and 0.005% TFA as the mobile phase modifiers. Comparison of the two histone profiles reveals that TFA gave a better separation of histones, and improved retention times, which can be attributed to its well-known ion pairing.

This effect may also be partially attributed to the adsorption of TFA on the RP surface and consequent ion interaction effects [71]. Formic acid yielded higher

signal response (as measured by the total ion current from separations with the same quantity injected onto the column) and thus higher sensitivity. More important, TFA in the mobile phase gives rise to adducts that suppress ionization and complicate data analysis (Figure 2.2). Attempts to disrupt the TFA adducts using nozzle skimmer dissociation ultimately result in fragmentation of histone H4

(data not shown) before the adducts are disrupted. Moreover, TFA affects stability of the electrospray resulting in decreased sensitivity [58]. A comparison of two histone profiles in Figure 2.1 and Figure 2.2 shows that it is possible to balance efficient LC separation and sensitive mass detection. For the characterization of histones with complex co-eluting PTMs, the elimination of adducts is necessary to not only simplify data analysis but also improve the detection of low abundant species.

Figure 2.1 Capillary LC-MS separation of bovine histones, 5 μL/min, C8 column, 0.3 mm × 150 mm, 5 μm, 300 Å. (A): The separation performed without TFA, (B): The separation with TFA. The absence of TFA adducts on (A) is noticeable. Data were collected on an LTQ Orbitrap XL.

Figure 2.2 Reconstructed mass spectra of histone H4 from Figure 2.1 using the Xtract deconvolution software (Thermo FisherScientific, San Jose, CA). (A): The H4 profile obtained without TFA, (B): The H4 profile with TFA present. Data were collected on an LTQ Orbitrap XL. TFA adduct formulas, observed and expected masses are listed in Table 2.3.

Table 2.3 Formulas of TFA adducts formed with histone H4, and their masses (observed and expected)

Formulas Formulas Observed Expected Observed Expected of the of the mass (Da) mass (Da) mass (Da) mass (Da) adducts adducts M1* 11305.41 11305.40 M2* 11347.43 11347.41 M1 + 1TFA 11420.35 11419.39 M2 + 1TFA 11462.37 11461.40 M1 + 2TFA 11534.38 11533.38 M2 + 2TFA 11576.40 11575.39 M1 + 3TFA 11648.34 11647.38 M2 + 3TFA 11690.37 11689.39 M1 + 4TFA 11762.33 11761.37 M2 + 4TFA 11803.35 11803.38 M1 + 5TFA 11876.34 11875.36 M2 + 5TFA 11917.35 11917.37

* M1: H4, loss of Met, N-Ac, 2Me * M2: H4, loss of Met, N-Ac, 2Me1Ac

2.3.2 Optimization of TFA-free histone LC-MS

Our laboratory has taken great efforts to develop histone separation methods for

LC-MS. Our lab has previously reported on the application of microbore separations based on the 1.0 mm × 150 mm C18 columns (Discovery Bio wide pore C18 column, 5 µm, 300 Å, Supleco Inc., Bellefonte, PA) using TFA as a mobile phase additive [9, 54, 55]. Histone separations yield an average peak capacity of 65 for this method. When evaluating the capillary scale (0.3 mm id) separations, it was found that C18 columns provided poorer performance than

C8 columns. The use of a 0.3 mm id C8 column w/TFA (Figure 2.1) provided greatly improved peak capacity (124) over the microbore separations.

In this study, in order to develop TFA-free histone separation methods, several variants and factors important for LC and MS performance were optimized; gradient elution program, flow rate, ion-pairing agent(s) and their concentration(s) in the mobile phase, column id (capillary scale 0.3 mm id, and nanoscale 0.1 mm id), and the particle size of stationary phase.

Figure 2.3 shows the capillary scale LC-MS separation of bovine histones at different flow rates using 1% formic acid as the modifier. 5 µL/min and 7 µL/min flow rates yielded similar peak capacities (120 and 126). However, 5 µL/min produced slightly better resolution compared with that of 7 µL/min. Therefore, all other parameters were optimized under the 5 µL/min flow rate.

Figure 2.3 Capillary LC-MS chromatograms of bovine histones, 1% formic acid, C8 column, 0.3 mm × 150 mm, 5 μm, 300 Å. Data were collected on an LTQ Orbitrap XL. (A): 5 μL/min, (B): 7 μL/min.

Next evaluation was made for the use of formic acid and acetic acid as ion- pairing agents at varying concentrations in mobile phase. Figure 2.4 shows the

LC-MS separations of bovine histones with the optimized gradient over 5 different concentrations of formic acid in mobile phase, 0.1%, 0.2%, 0.4%, 0.5%, and 1%. Separation resolution was enhanced with increased mobile phase concentrations of formic acid until it is above 0.5%. Peak shape improved and peak widths at half height decreased when increasing concentration of formic acid in mobile phase. No significant difference was observed between 0.5% and

1.0% formic acid. The increased retention time of the histones at higher formic acid concentrations in the mobile phase is due to increased adsorption of formic acid on the RP surface and consequently more ion interaction effects [63]. Peak capacity also decreased as the concentration of formic acid in mobile phase decreased. The peak capacity was 120 for 1% formic acid, 116 for 0.5% formic acid, 112 for 0.4% formic acid, 71 for 0.2% formic acid, 52 for 0.1% formic acid.

Also higher background with 1% formic acid (2.5 times higher noise level) was noted compared with 0.5% formic acid, emphasizing the importance of high purity reagents. Therefore, 0.5% formic acid was selected as the preferred mobile phase modifier concentration.

Figure 2.4 Capillary LC-MS chromatograms of bovine histones. From (A) to (E): 1%, 0.5%, 0.4%, 0.2%, and 0.1% formic acid. 5 μL/min, C8 column, 0.3 mm × 150 mm, 5 μm, 300 Å. Data were collected on an LTQ Orbitrap XL.

Figure 2.5 Capillary LC-MS chromatograms of bovine histones. (A): 0.5% formic acid, (B): 0.5% acetic acid. 5 μL/min, C8 column, 0.3 mm × 150 mm, 5 μm, 300 Å. Data were collected on an LTQ Orbitrap XL.

In addition to formic acid, acetic acid (0.5%, 1%) was also evaluated as a mobile phase modifier. Figure 2.5 shows the LC-MS separations of bovine histones with the optimized gradient over 2 different conditions, 0.5% formic acid and 0.5% acetic acid. Acetic acid provided much poorer separation as compared to formic acid. The chromatogram with 1% acetic acid wasn’t shown as no signal was obtained because of the high noise level presumably due to the increased amount of acetic acid. These results are consistent with those reported by Garcia

[68]. The better performance of the formic acid can be partially explained by the strength of the ion-pair complex. Formic acid has a pKa = 3.75 compared to acetic acid’s pKa = 4.75. The ion-pair complex forms a stronger bond with formic acid than with acetic acid because its lower pKa, thus decreasing dissociation of the ion-pair bond. Overall the effect is a reduction in the band broadening for separations using formic acid.

Next evaluation moved to the use of smaller id column with smaller particle sizes.

By moving to the smaller C8 column (0.1 mm × 150 mm, 3 μm, 300Å), sensitivity, detection limit and peak capacity were all improved. At 1% formic acid concentration, the peak capacity improved to 154 and at 0.5% concentration improved to 146 (Figure 2.6). In addition the amount of sample loaded on the column was reduced from 0.5-1.0 μg on the capillary column (0.3 mm id) to 100-

200 ng on the nanoscale column (0.1 mm id). Thus the nanoscale sensitivity was > 5 times better than that for capillary separations.

Figure 2.6 Nano LC-MS chromatograms of bovine histones, 1 μL/min, C8 column, 0.1 mm × 150 mm, 3 μm, 300 Å. Data were collected on an LTQ Orbitrap XL. (A): 1% formic acid, (B): 0.5% formic acid.

Xtract deconvolution of the average FTMS spectra for each resolved LC peak was performed for all the separation conditions. The resulting histone isoform masses were then compared against bovine histone sequences with commonly observed PTMs applied and prior analyses performed with Human histones extracted from Hela Cells [55]. The masses of histones and histone PTMs were calculated by IsoPro based on known amino acid sequences and PTMs. The histone variants observed under each separation condition are listed in Table 2.4.

The majority of histone variants/isoforms were observable under all the conditions examined. The histone isoform corresponding in mass to H2AV was only detected with 0.1 mm column and the H2B variant PT15 was not observed with the acetic acid modifier. This analysis suggests that regardless of the peak capacity the TFA-free separations are robust at detecting a wide range of histone isoforms.

Table 2.4 Histone variants and their masses (monoisotopic and average) detected under all the experimental conditions

Retention time (min) 0.3 mm id 0.1 mm id Mass Mass Histone variants 7 µL/min 5 µL/min 1 µL/min (Mono, Da) (Ave, Da) 0.5%FA 0.1% 1% 0.5% 0.4% 0.2% 0.1% 1% 0.5% 1% 0.5% 0.005% FA FA FA FA FA FA AA AA FA FA TFA H2B Loss of Met, N-H 13766.5156 13774.9912

HSBO22 H2B N-H 13766.5156 13774.9912

701196A H2B N-H 13765.5313 13774.0068 39.66 46.90 47.80 42.99 40.64 34.62 31.92 44.39 30.71 54.36 52.44 H2BFT

44 Loss of Met, N-H 13750.5205 13758.9922

H2B type 1-N Loss of Met, N-H 13783.4697 13791.9346

H2B type 1-K 13735.5098 13743.9775 Loss of Met, N-H H4 Loss of Met, 11299.3809 11306.2783 N-Ac, 2Me 39.66 46.90 51.91 44.46 40.64 34.62 31.92 44.39 30.71 54.36 50.98 H4 Loss of Met, 11341.3916 11348.3154 N-Ac, 2Me1Ac H2A type 2-C Loss of Met, 13997.8574 14006.3750 45.09 54.14 56.06 48.46 46.10 40.83 37.78 44.39 35.46 63.78 59.50 N-Ac H2AV - Loss of Met, 13411.4951 13419.5674 ------63.78 59.50 N-Ac Continued

Table 2.4 continued Retention time (min) 0.3 mm id 0.1 mm id Mass Mass Histone variants 7 µL/min 5 µL/min 1 µL/min (Mono, Da) (Ave, Da) 0.5%FA 0.1% 1% 0.5% 0.4% 0.2% 0.1% 1% 0.5% 1% 0.5% 0.005% FA FA FA FA FA FA AA AA FA FA TFA H2B variant PT15 14083.4717 14092.4707 45.09 54.14 56.06 48.46 46.10 40.83 37.78 - - - 59.50 Loss of Met, N-H HSBO2A H2A N-Ac 13993.9170 14002.3643

H2A.1 Loss of Met, 13993.9170 14002.3643 N-Ac

H2A.1 Loss of Met, 14007.9326 14016.3916 50.43 60.74 61.14 54.16 51.01 43.68 40.24 50.40 36.56 71.42 65.38 N-Ac, 1Me

45 H2A.1

Loss of Met, 14035.9268 14044.4023 N-Ac, 1Ac

H2AFJ Loss of Met, 13921.8945 13930.2930 N-Ac H3.2 N-Ac 15289.4736 15298.9258 71.17 73.60 73.51 72.20 71.70 69.38 63.03 - 50.98 84.87 86.52 H3.3 15229.4707 15238.8066 Loss of Met, N-H HSBO3 H3 N-Ac 15305.4521 15314.9902

73.03 75.64 75.24 74.06 73.56 71.67 70.71 72.44 58.89 86.29 88.23 H3.1 Loss of Met, 15305.4521 15314.9902 N-Ac

2.3.3 TFA-free LC-MS analysis of protein standards

To test the general applicability of the TFA-free capillary scale separation method, an equimolar mixture of 6 protein standards was separated on the capillary C8 column (0.3 mm × 150 mm, 5 μm, 300 Å) at 5 μL/min, using a solvent system consisting of 0.5% formic acid in water (solvent A) and 0.5% formic acid in ACN

(solvent B), and a linear segment gradient described in the experimental section.

The chromatogram is shown in Figure 2.7. By use of the Xtract deconvolution algorithm (Thermo FisherScientific, San Jose, CA), the protein standards’ molecular weights and elution order were determined. Six protein standards eluted in the following order: lysozyme (14,305 Da), cytochrome C (12,360 Da), ubiquitin (8,560 Da), insulin (5,733 Da), myoglobin (16,951 Da), and carbonic anhydrase (29,024 Da). The elution order correlates with the predicted increasing hydrophobicity of protein standards [72].

Figure 2.7 Capillary LC-MS chromatogram of protein standards, 0.5% formic acid, 5 μL/min, C8 column, 0.3 mm × 150 mm, 5 μm, 300 Å. Protein standards eluted within the peaks labeled 1~6. Data were collected on an LTQ Orbitrap XL.

2.3.4 Application of TFA-free LC-MS analysis

The previous data demonstrate that the TFA-free LC-MS method is valuable for identification of histones and characterization of histone PTMs, and could be applied to analyze protein standards in general (mass range from 5,733 Da to

29,024 Da). It is important to determine whether this method can be extended to intended application of profiling histones in human cancer samples. For this purpose this chapter studied histones extracted from B cells (one normal volunteer and seven CLL patients) and three human breast cancer cell lines.

Extracted histones were separated under the optimized conditions, consisting of a capillary scale column (C8, 0.3 mm × 150 mm, 5 μm, 300 Å), 5 μL/min flow rate, mobile phase A (0.5% formic acid in water) and mobile phase B (0.5% formic acid in ACN), and a linear-convex segment gradient described in the experimental section. Intact histone mass profiles were generated from acquired mass spectra using the Xtract deconvolution (Thermo FisherScientific, San Jose,

CA) in Xcalibur QualBrowser software.

Figure 2.8 and 2.9A show the chromatograms of histones extracted from normal

B cells, primary CLL patients’ B cells and human breast cancer cell lines. The elution order of histones for every sample is the same as that of bovine histones,

H1 for peaks 1 and 2, H2B for peak 3, H4 for peak 4, H2A for peak 5 and 6, H3 for peaks 7 and 8. Comparing the chromatograms, for the same species of

histone from different patients or different breast cancer cell lines, the retention time is similar to each other, as is the resolution of adjacent peaks.

To demonstrate the potential of the approach to determine changes in histone isoform distributions, the representative mass spectra of histone H4 in the bovine calf thymus and breast cancer cells are shown in Figure 2.9B. Note that in these deconvoluted spectra there are no adducts from TFA. Thus the assignment of isoform mass is straightforward with a higher potential for automation. H4 is unique compared to H2A, H2B and H3. Several variants of these histones are known whereas no sequence variants for H4 have been reported (Table 2.4).

Therefore, the analysis of H4 mass spectra is not complicated by the existence of its variants and is only related to its PTMs [55]. Following this logic the highly abundant peak observed at 11,305 Da is due predominantly to the dimethylation

(Me2) and N-terminal acetylation (NAc) of H4 (Figure 2.9B). The second most abundant peak, 11,347 Da is 42 Da higher in mass and characteristic of additional acetylation upon the H4 N-terminal tail. Other minor peaks at 11,276

Da and 11,290 Da corresponded to the H4 isoforms with NAc and NAc + Me

(monomethylation) respectively. This interpretation of the data is consistent with previous reports that assigned 11,305 Da to NAc + K20Me2, 11,347 Da to NAc +

K16Ac + K20Me2 [73, 74]. It is important to note that with additional fractionation, middle-down and 2D LC-MS methods can detect greater numbers of isoforms

[10, 75-79]. However, the current approach is designed to maximize the amount

of sample information whilst minimizing the upfront sample preparation. As such it is an excellent tool for profiling samples obtained from limited human tissues.

The data in Figure 2.9B demonstrate the feasibility of LC-MS profiling to reveal histone isoform differences using the optimized approach. There are distinct differences in the distribution of H4 isoforms between the MCF-10A/MCF-7 and

MDA-MB-231 cells. These results are consistent with other observations that suggest loss of H4 (K16Ac) is associated with more aggressive tumors [80]. It has been long known that global changes in histone PTMs have prognostic significance in many different cancers [81]. For example, the reduction in H4

(K16Ac) and H4 (K20Me2) appears to be an early event that progresses throughout tumor development. Both H4 (K20Me2) and H4 (K16Ac) appear to be involved in DNA damage control and the loss of these PTMs has been considered as a near universal epigenetic marker for cancer [80]. In addition, cells with reduced H4 (K16Ac) demonstrate an increase in genomic instability that appears similar and/or linked to the gH2AX damage response, suggesting a role in facilitating mutations and chromosomal rearrangements that are a fundamental cause of cancer [82]. Taken as a whole, this work displays the potential of TFA-free separation to reveal histone patterns in human cancers.

Figure 2.8 Capillary LC-MS chromatograms of bovine histone standard, and histones extracted from B cells (one normal volunteer and seven CLL patients), 0.5% formic acid, 5 μL/min, C8 column, 0.3 mm × 150 mm, 5 μm, 300 Å. Data were collected on an LTQ Orbitrap XL.

Figure 2.9 (A) Capillary LC-MS chromatograms of bovine histone standard, and histones extracted from three human breast cancer cell lines. (B) Reconstructed mass spectra of H4 from Figure 2.9A using the Xtract deconvolution software (Thermo FisherScientific, San Jose, CA). 0.5% formic acid, 5 μL/min, C8 column, 0.3 mm × 150 mm, 5 μm, 300 Å. Data were collected on an LTQ Orbitrap XL.

2.4 Conclusion

A TFA-free histone separation method was developed, optimized using bovine histone standard and further applied to human cancer samples. Gradient program and flow rate were optimized on a capillary column and a nanoscale column respectively. Formic acid (0.1%, 0.2%, 0.4%, 0.5%, and 1%) and acetic acid (0.5% and 1%) were evaluated by comparing sensitivity, resolution and peak capacity. Formic acid (0.5%) gave the best separation performance and quality of

MS data. Capillary separations of protein standards, histones extracted from primary CLL cells and histones from breast cancer cells were demonstrated.

TFA-free capillary and nanoscale separations bring two advantages to LC-MS analysis of proteins. First, less sample is consumed and second, elimination of

TFA adducts simplifies data analysis.

3 Targeted mass spectrometry methods for detection and

quantitation of tyrosine nitration

3.1 Introduction

- In the stressed myocardium, the generation of superoxide anion (O2 ) is prevalent during the period that follows reperfusion of an ischemic event [83], and it has

- been shown that O2 readily reacts with the vasodilating compound nitric oxide

(NO), also prevalent during reperfusion, to form ONOO- [84]. This strong nitrating compound reacts extensively with aromatic and sulfur containing amino acid residues such as tryptophan, phenylalanine, tyrosine, methionine and cysteine

[85, 86]. The ONOO- compound demonstrates a high propensity to react with tyrosine (Tyr) to form 3-nitrotyrosine (3-NT). At physiological pH, this negatively

3-NT modification can alter protein function [87, 88]. In the case of heart disease, reduction of cardiac force as a result of protein nitration has been implicated as a source of dysfunction [89]. Nitration of cardiac proteins has been previously reported in aging and heart failure [90-92]; however, misidentification of nitrated proteins [93] has brought doubts to the validity of such discoveries. Furthermore, the quantification of nitration in diseased cardiac tissue remains a challenging task as the nitration modification characteristically occurs in low abundance.

It is predicted that nitration of tropomyosin (Tm) is heart disease related. Tm is a

32 kDa, alpha-helical protein that forms a head-to-tail dimer and lies on the actin filament over a region of seven actin molecules. In the heart, it is this interaction that contributes directly to the regulation of cardiac contraction through intracellular Ca2+ binding with troponin C (TnC) of the Tn complex (TnC, TnI, and

TnT) [94]. As shown in Figure 3.1, Tm’s amino acid sequence is comprised of heptad repeats commonly denoted as a-b-c-d-e-f-g. Residues located in positions a and d are typically comprised of hydrophobic residues clustering at the dimer interface, while charged residues commonly occupy the e and g positions providing dimer stability through opposite charge interactions between

Tm monomers [95]. Furthermore, when examining the content of residues comprising the amino acid sequence of Tm, it was found that clusters of stabilizing hydrophobic residues interspersed with clusters of destabilizing polar residues [96] suggesting a role for residue composition on the structure and function of Tm. It is the distribution of stabilizing and destabilizing regions of Tm that determine its flexibility, and therefore, how the molecule functions on actin.

Tm contains six Tyr residues, five of which are located in either the a or d position implicating their involvement in stabilization of the hydrophobic dimer interface. Additionally, two Tyr residues (amino acid 261 and 267 on Tm sequence) are located in the region of Tm involved in binding with troponin T

(TnT), the subunit of the Tn that links Tm to the Tn complex [97], and four Tyr residues (amino acid 60, 214, 221 and 261 on Tm sequence) are located in Tm-

actin binding regions highlighting the importance of Tyr modification to alter structure and function of Tm.

The nitration of these Tyr residues could alter the structure of the Tm dimer and its interactions with actin and TnT, resulting in the effect on cardiac contraction.

To date, the specific Tyr residues of Tm that become nitrated following in vivo exposure to ONOO-, as well as the effect of Tm nitration on the structure-function relationship remain unclear.

In this chapter, a targeted mass spectrometry approach was used to examine reactive nitrogen species modification of Tyr residues on tropomyosin, including nitration and nitrosylation. A highly versatile target-driven MS/MS strategy was developed to facilitate identification and quantification of especially low abundance protein post-translational modifications. A series of MS/MS experiments were performed to optimize targeted proteomics. Comparison between different target-driven MS/MS techniques was also presented. The LC-

MS/MS analysis was carried out on an LTQ-Orbitrap mass spectrometer to take advantage of its high mass resolution and high mass accuracy. A recursive process was used to discover, verify and quantify all the possible nitrated and nitrosylated peptides. Measurement of nitrotyrosine and nitrosyltyrosine on Tm highlights the utility of this approach for discovering and characterizing the challenging low abundant post-translational modifications.

(A) (B) Tm amino acid sequence Tm dimer interactions

ABCDEFG RESIDUE MDAIKKK 7 MQMLKLD 14 KENALDR 21 AEQAEAD 28 KKAAEDR 35 SKQLEDE 42 LVSLQKK 49 LKGTEDE 56 LDKYSEA 63 LKDAQEK 70 LELAEKK 77 ATDAEAD 84 VASLNRR 91 IQLVEEE 98 LDRAQER 105 LATALQK 112 LEEAEKA 119 ADESERG 126 MKVIESR 133 AQKDEEK 140 MEIQEIQ 147 LKEAKHI 154 AEDADRK 161 YEEVARK 168 LVIIESD 175 LERAEER 182 AELSEGK 189 CAELEEE 196 LKTVTNN 203 LKSLEAQ 210 AEKYSQK 217 EDKYEEE 224 IKVLSDK 231 Hydrophobic LKEAETR 238 AEFAERS 245 Electrostatic VTKLEKS 252 IDDLEDE 259 LYAQKLK 266 Actin Binding YKAISEE 273 LDHALND 280 cTnT Binding MTSI 284

Figure 3.1 (A) Heptad repeat (a-b-c-d-e-f-g) amino acid sequence of mouse alpha Tm. (B) Tm dimer interactions typically involved in the stabilization of the Tm molecule. Tyrosines located in the a or d position are highlighted in green and while tyrosines located in the b position are highlighted in yellow with actin and TnT binding domans denoted.

3.2 Experimental

3.2.1 Expression of Tm

Authentic N-terminal acetylated mouse alpha Tm was expressed in Sf9 insect cells employing the Bac-to-Bac Baculovirus Expression System with slight adaptation of the manufactures direction (Invitrogen).

3.2.2 Nitration of Tm tyrosine

Nitration of Tm was carried out using the nitrating agent peroxynitrite (ONOO-)

(Millipore). Purified Sf-9 expressed recombinant mouse alpha Tm was incubated with varying molar ratios of ONOO- to Tm ranging from 0:1 to 200:1 for five min to determine optimal concentration for Tyr nitration. The lowest dose to achieve maximal nitration was determined to be 150:1 molar ratio ONOO-:Tm. The inactive degraded ONOO- (Millipore) was used as a negative control.

3.2.3 Protein electrophoresis and western blot

Identification of nitrated Tm was carried out by western blot as previously described [98]. Briefly, nitrated purified Sf-9 expressed recombinant mouse cardiac Tm were solubulized in denaturing sample buffer (50 mM Tris-HCl, pH

6.8, 2% SDS, 0.1% bromophenol blue and 10% glycerol), heated for 5 min at

80 °C and centrifuged for 5 min. Protein was separated by SDS-PAGE on cooled

8 x 10 cm (Hoefer) 12% (29:1) acrylamide gels as previously described. Wet transfer of gels to 0.2 μm Hybond LFP PVDF membrane (GE Healthcare) for

western blot was carried out at 10 °C for 90 min. Western blot detection of 3-NT was achieved using a primary polyclonal rabbit antibody specific for 3-NT and a

Dylight-conjugated secondary antibody (Jackson ImmunoResearch Laboratories,

Inc.). Images were collected on a Typhoon 9410 imager (GE Healthcare) with an excitation of 488 nm and 520BP30 emission filter. Similarly, total Tm was achieved using a primary monoclonal antibody specific for cardiac Tm followed by a Dylight-conjugated secondary antibody (Jackson ImmunoResearch

Laboratories, Inc.) with an excitation of 649nm and 670BP30 emission filter.

3.2.4 LC-MS

Nitrated or non-nitrated purified Sf-9 expressed recombinant Tm were separated by reversed-phase HPLC (Dionex) and detected by ESI-Q-TOF mass spectrometer (Waters). HPLC separation was carried out using a flow rate of 50

µL/min on a C18 column (1.0 mm × 150 mm). The elution gradient consisted of mobile phase A (0.1% TFA in water) and mobile phase B (0.1% TFA in ACN), where mobile phase B linearly increased from 30% to 45% in 2 min, 45% to 60% in 20 min, and stayed at 60% for 4 min. Between each run, the column was washed to reduce sample carryover. A Micromass LCT mass spectrometer with an orthogonal electrospray source (Z-spray) was coupled to the outlet of the

HPLC. Tm samples were infused into the electrospray source at the flow rate 50

L/min without splitting. ESI was performed at optimal condition (capillary voltage

= 3 kV, source temperature = 100 °C, cone voltage = 50 V). Data were acquired

in continuum mode at the rate of 1 spectrum/sec. All spectra were obtained in the positive ion mode. NaI was used for external mass calibration over the m/z range

500-2500. Mass tolerance of TOF is ± 3Da.

3.2.5 Protein digestion

Nitrated or non-nitrated Tm was dialyzed three times against 50 mM Ammonium

Bicarbonate (NH4HCO3) compatible with mass spectrometry analysis. After dialysis, in-solution tryptic digestion was carried out in 50 mM NH4HCO3 in combination with 0.25% (w/v) RapiGest (Waters Corp.) overnight at 37°C. The ratio of trypsin (Promega) to purified Sf-9 expressed recombinant mouse cardiac

Tm was 1:50 (w/w). Following overnight incubation, formic acid (EMD Chemicals) was added at a final percentage of 30% (v/v) to degrade RapiGest. To make the degradation completed, samples were heated at 37 °C for 1 hr and then placed at 4 °C for another hr. Subsequently, samples were centrifuged by 14,000 rpm at

4°C for 10 min. Supernatant containing the digested peptides was collected, dried completely by using a SpeedVac concentrator and redissolved in HPLC grade water at a final concentration of 500 ng/uL. Samples were stored at -80 °C until use.

3.2.6 Data dependent LC-MS/MS

The tryptic digests were characterized by capillary LC-MS/MS analysis performed on a Dionex Ultamate 3000 HPLC instrument (Dionex, Sunnyvale, CA)

and a Thermo Fisher LTQ Orbitrap XL (Thermo Finnigan, San Jose, CA) equipped with a microspray ionization source (Michrom Bioresources Inc.,

Auburn, CA). Peptides were desalted and preconcentrated on a trap column

(C18, 300 μm × 5 mm, 5 µm, 100 Å, Dionex, Sunnyvale, CA) for 10 min with loading buffer (0.03% TFA in the solvent of 2% ACN and 98% water) at a flow rate of 20 μL/min and then eluted on an analytical column (magic C18, 0.2 mm ×

150 mm, 3 µm, 200 Å, Michrom Bioresources Inc., Auburn, CA) using mobile phase A (0.1% formic acid in water) and mobile phase B (0.1% formic acid in

ACN) at a flow rate of 2 µL/min with a linear gradient (mobile phase B increased from 2% to 25% in 130 min, then to 90% in 20 min). The separation system was washed 2X between each sample in order to reduce sample carryover. 500 ng of the digests was injected onto the column for each experiment. The electrospray voltage was maintained at 2.2 kV and the capillary temperature was set at

175 °C. Profile MS1 scans were collected at high mass accuracy using the

Orbitrap mass analyzer (preview mode enabled, mass range = 300-2000 m/z, resolution = 60,000). Data-dependent MS2 scans were collected in centroid mode using the LTQ mass analyzer. Five data-dependent MS2 scans were acquired during each MS1 scan (collision energy = 35%; dynamic exclusion settings: repeat count = 2, repeat duration = 20 sec, exclusion duration = 60 sec).

All data were acquired in positive ion mode.

3.2.7 Data dependent total reaction monitoring (DDTRM)

Similar experimental conditions were used for DDTRM as described above. In this experiment, MS2 spectra were acquired only for m/z values provided on the precursor mass list. Dynamic exclusion was disabled and the precursor mass tolerance set at ±10 ppm relative to the target precursors. The peptide precursor mass lists were generated using the Protein Prospector MS-Digest application

(http://prospector.ucsf.edu). The final precursor mass list is shown in Table 3.1.

Three runs were carried out for each sample.

3.2.8 Total reaction monitoring (TRM)

Timed precursor mass list was used for precursor ion isolation and CID fragmentation on the LTQ mass analyzer. Each precursor was triggered to dedicate MS2 events within the time segments defined on the list. No MS1 scan was taken and the MS2 spectra of fragment ions were acquired on the LTQ mass analyzer (data type = centroid, isolation width = 2.5 m/z, last m/z of scan range =

1500). Three runs were carried out for each sample.

3.2.9 Data analysis

All the mass spectral data were searched against the MassMatrix database search program. The search parameters included the following variable modifications: nitration of Tyr, nitrosylation of Tyr, oxidation of methionine, ±10.00 ppm mass tolerance for precursor ions, ±0.80 Da mass tolerance for product ions,

pp value of output ≥ 5.0, pptag of output ≥ 1.3. False discovery rates were estimated using the target-decoy strategy and subjected to manual validation [99].

Each of the tandem MS spectra matched by the database search was manually validated.

Quantitative analysis was performed with Thermo Xcalibur Quan Browser.

Algorithm: genesis, retention time window: ± 100 sec, nearest retention time model, minimum peak height(S/N) 3.0. The selected m/z window was set to 0.8 m/z for transition ions.

3.2.10 Selected ion monitoring (SIM)

Selected ion monitoring was administrated on the raw data files collected with

DDTRM method by the LTQ Orbitrap XL. Extracted ion chromatograms were constructed against MS1 spectra collected on the Orbitap mass analyzer.

Thermo Xcalibur Quan Browser was used to reconstruct ion chromatograms. The theoretical m/z value of each precursor ion was set as the center of mass tolerance window, mass precision: 4 decimals, mass tolerance: ± 10 ppm. The expected retention time window was centered with the observed retention time at peak apex obtained from TRM experiment result, retention time window: ± 100 sec.

3.3 Results and discussion

3.3.1 Overview

To study the nitration of Tyr residues on Tm, recombinant expressed alpha Tm was exposed in vitro to ONOO- to produce nitrated Tm. Figure 3.2 shows the chemical reaction between ONOO- and Tyr amino acid. Both 3-nitrotyrosine and

3-nitrosyltyrosine on Tm were observed in the MS/MS experiment result obtained in this research work.

Figure 3.2 Reaction of peroxynitrite (ONOO-) with Tyr results in the addition of a nitro- or nitrosyl- adduct at the three position to form 3-nitrotyrosine or 3- nitrosyltyrosine.

3.3.2 Western blot analysis

Western blot analysis is highly sensitive, but prior knowledge about protein post- translational modifications is required to raise antibodies. For example, a 3-NT antibody is commercially available, but no Tm specific 3-NT antibody is currently 64

available. To detect the effect of ONOO- on Tm Tyr residues, Tm was incubated with ONOO- at different molar ratios of ONOO- to Tm (0:1, 40:1, and 150:1).

Western blot analysis against 3-NT and Tm was performed individually.

Figure 3.3 shows Tm Tyr residues were nitrated by ONOO-. The nitration of Tyr was enhanced as the molar ratio of ONOO- to Tm was increased. When the molar ratio of ONOO- to Tm was increased to 150:1, two bands of Tm nitration appeared at and above 37 kDa indicating the development of multiple species of nitrated protein. Both observations suggested that nitration of Tyr likely impacts the remaining structure of Tm protein and caused a slower migration of Tm on the gel.

(A)

(B)

Figure 3.3 Sf-9 expressed alpha mouse Tm was treated with inactive degraded ONOO- to act as a negative control and 40 or 150 molar excess ONOO- to Tm. Previously nitrated Tm acted as a positive identification for nitration. Western blot detection of (A) 3-NT was achieved using an antibody specific for 3-NT (α3-NT) followed by a 488nm fluorophore-conjugated secondary antibody and (B) total Tm was achieved using an antibody for Tm (αTm) followed by a 649 fluorophore- conjugated secondary antibody.

3.3.3 LC-MS analysis

LC-MS is a useful technique to determine the overall modification distribution for a protein. By analyzing a protein’s MS data, the mass spectral peaks of different modified species provide clues to the modification type and number [5]. To confirm the result of western blot, protein LC-MS was performed on Tm before and after nitration. In Figure 3.4, a mass spec peak at 32728 Da (N-terminal acetylated mouse alpha Tm) corresponding to Tm was detected in the untreated sample. Mass shifts of 29 Da (nitrosylation) and 45 Da (nitration) were observed for both treated samples. Multiple modifications were detected for Tm nitration,

Tm nitrosylation, and their combination. The protein nitration and nitrosylation levels were increased at the higher molar ratio of ONOO-:Tm.

Figure 3.4 LC-MS analysis on Tm treated with ONOO- at molar ratios of ONOO- to Tm as 0:1, 40:1 and 150:1.

3.3.4 Identification nitrotyrosine and nitrosyltyrosine sites

To evaluate the distribution of nitration and nitrosylation of 6 Tyr residues on Tm, data-dependent LC-MS/MS was used to analyze digested Tm after treatments of

ONOO- at different molar ratios of ONOO- to Tm (0:1, 40:1, 60:1, 80:1, 100:1, and

150:1). Mass spectral data were searched by MassMatrix database search program as described in section 3.2.9. To improve trypsin digestion efficiency and reduce missed cleavages, RapiGest was used to denature the protein structure. The digestion and LC-MS/MS separation were optimized for the recovery of Tyr containing peptides (see section 3.2.4).

Four peptides containing Tyr 60, one peptide including Tyr 214, two peptides covering Tyr 221, and one peptide containing Tyr 261 were detected. Peptide sequences that cover Tyr 162 and 267 were not detected, which probably eluted form the trap column during the desalting process. Compared to tryptic digestion without RapiGest, the number of missed cleavage sites was reduced but completed digestion was still not achieved. Amino acids of aspartate and glutamate are abundant in Tm. These negatively charged acidic residues have been reported to cause missed cleavages in tryptic digestion [100]. The proposed reason for missed cleavages is salt bridge formation between basic amino acids (arginine and lysine) and the adjacent acidic amino acids (aspartate and glutamate). The salt bridges inhibit the trypsin interaction with the basic side chains [100]. Nitration was detected on Tyr 60, 214 and 261 at the highest

ONOO- treatment (molar ratio of ONOO- to Tm, 150:1) but not for every Tyr containing peptide (Table 3.1).

Data dependent acquisition (DDA) is a method that is optimized for high- throughput peptide identification and used for global proteomic profiling. As described in section 3.2.6, during each full mass scan, 5 MS/MS scans were collected for the top five most abundant precursor ions. Dynamic exclusion was enabled to reduce oversampling the most abundant precursors. However, low abundant analytes can be missed if they coelute with other highly abundant peptides [101, 102].

Table 3.1 Summary of detected peptides containing nitrotyrosine or nitrosyltyrosine in DDA, DDTRM and TRM experiments.

40:1 molar ratio 150:1 molar ratio - - Peptide sequence ONOO :Tm ONOO :Tm DDA DDTRM TRM DDA DDTRM TRM

50 65 LKGTEDELDKYNO2SEALK ○ ○ ○ ● ● ● 50 70 LKGTEDELDKYNOSEALKDAQEK ○ ○ ○ ○ ● ● 50 70 LKGTEDELDKYNO2SEALKDAQEK ○ ● ● ● ● ● 52 65 GTEDELDKYNOSEALK ○ ○ ○ ● ● ● 52 65 GTEDELDKYNO2SEALK ● ● ● ● ● ●

70 52 70 GTEDELDKYNOSEALKDAQEK ○ ○ ○ ○ ● ●

52 70 GTEDELDKYNO2SEALKDAQEK ● ● ● ● ● ● 214 226 YNOSQKEDKYEEEIK ○ ○ ○ ○ ● ● 214 226 YNO2SQKEDKYEEEIK ○ ● ● ● ● ● 214 226 YSQKEDKYNO2EEEIK ○ ○ ○ ○ ● ● 214 226 YNO2SQKEDKYNO2EEEIK ○ ○ ○ ○ ● ● 218 226 EDKYNO2EEEIK ○ ○ ● ○ ● ● 252 264 SIDDLEDELYNOAQK ○ ○ ● ● ● ● 252 264 SIDDLEDELYNO2AQK ● ● ● ● ● ●

● detected, ○ not detected

To identify low abundant peptides, an inclusion list of the theoretical m/z values for predicted precursor ions can be used to override isolation and fragmentation of the abundant ions. If a precursor ion on the inclusion list is detected, the mass spectrometer will prioritize its MS/MS. Otherwise, MS/MS spectra are controlled by DDA. This method, referred to as accurate inclusion mass screening (AIMS), was described by Jacob D. Jaffe in 2008 [103]. AIMS is an effective approach to balance high-thought proteomics and low abundance analyte detection. However data collection on analytes is limited by knowing the targets in advance and the throughput of the mass spectrometer.

AIMS is a powerful method that could be used to detect low abundant modified peptide of Tm. A disadvantage of AIMS for the characterization of low abundant ions is that few MS/MS scans are obtained on the ions of interest. To improve upon this approach for the characterization of low abundant nitrotyrosine and nitrosyltyrosine, I developed a method that is referred to as data dependent total reaction monitoring (DDTRM). In DDTRM, MS2 spectra are acquired exclusively for preselected peptide precursor ions using a target inclusion list. Dynamic exclusion is disabled to insure that MS2 scan events are obtained for target precursor ions only in their elution time envelops individually. The target list is then populated with peptide candidates detected by DDA and peptides predicted by theoretical digestion (Protein Prospector MS-Digest).

To facilitate DDTRM and reduce false discoveries, high-mass accuracy full mass measurements for precursor ions were obtained by use of an Orbitrap mass analyzer. Multiple successive MS2 scans were then acquired for each target precursor ion. In this manner, highly confident peptide identification was achieved.

To optimize the final inclusion list, recursive DDTRM experiments were performed. In the process, retention time envelops for each target was first estimated and then refined. By fixing the retention window for target detection, accurate and selective MS/MS spectra can be collected and more candidates can be examined without sacrificing MS/MS throughput. New predicted candidates can be added into the target list at any time. This scheme is shown in

Figure 3.5.

With the optimized inclusion list (Table 3.2), triplicate DDTRM experiments were carried out for each sample treatment using an LTQ-Orbitrap XL mass spectrometer. Mass spectral data were searched by MassMatrix database search program. Table 3.1 lists the identified nitrotyrosine and nitrosyltyrosine containing peptides. With the maximum treatment of ONOO- (molar ratio of

ONOO- to Tm, 150:1), nitration was detected on every Tyr containing peptide as was nitrosylation with the exception of Tyr 221.

List 1 List 2 List 3 Highest RT Candidate Target m/z Detected Candidate Target m/z Candidate Target m/z + ● Signal Window Peptide A [mA+z1H ]/z1 Peptide A [m +z H+]/z ○ Peptide A [m +z H+]/z ● + ○ A 1 1 A 3 3 [mA+z2H ]/z2 [m +z H+]/z ● Peptide B [m +z H+]/z ● + ● A 3 3 B 1 1 [mA+z3H ]/z3 Peptide B [m +z H+]/z ● Peptide D … + ● B 1 1 Peptide B [mB+z1H ]/z1 73 [m +z H+]/z ○ + ● B 2 2 [mB+z2H ]/z2 ● detected Peptide D … ○ + ○ not detected Peptide C [mC+z1H ]/z1 + ○ [mC+z2H ]/z2 Peptide D …

Figure 3.5 The illustration for optimizing the inclusion list.

Table 3.2 Parameters used for target precursor ions and their target transitions in DDTRM and TRM experiments.

Retention Precursor Peptide sequence Transition 1* m/z range Transition 2* m/z range time (min) m/z

50 65 +3 2+ 3+ LKGTEDELDKYSEALK 82.0-86.0 613.65 y14 799.25-800.05 y15 575.75-576.55

50 65 +3 2+ 3+ LKGTEDELDKYNO2SEALK 96.0-99.0 628.65 y14 821.60-822.40 y15 590.75-591.55

50 70 +4 3+ 3+ LKGTEDELDKYSEALKDAQEK 91.5-95.0 603.31 y19 723.45-724.25 y15 589.50-590.30

50 70 +4 3+ 3+ LKGTEDELDKYNOSEALKDAQEK 95.0-97.5 610.55 y19 733.25-734.05 y15 599.25-600.05

50 70 +4 3+ 3+ LKGTEDELDKYNO2SEALKDAQEK 104.2 -108.2 614.55 y19 738.57-739.37 y15 604.48-605.28

52 65 +2 2+ + GTEDELDKYSEALK 86.5-90.9 799.38 [M-H2O] 790.05-790.85 y7 838.05-838.85

52 65 +2 2+ + GTEDELDKYNOSEALK 90.7-93.4 813.88 [M-H2O] 804.32-805.12 y7 867.00-867.80

52 65 +2 2+ + GTEDELDKYNO2SEALK 101.4-105.0 821.88 [M-H2O] 812.50-813.30 y7 883.00-883.80

52 70 +3 2+ + GTEDELDKYSEALKDAQEK 95.5-99.5 723.68 y12 705.00-705.80 y5 589.80-590.60

52 70 +3 2+ 2+ GTEDELDKYNOSEALKDAQEK 99.4-102.4 733.34 y12 719.50-720.30 b15 862.10-862.90

52 70 +3 2+ 2+ GTEDELDKYNO2SEALKDAQEK 109.5-113.0 738.67 y12 727.45-728.25 b15 870.05-870.85

214 226 +3 2+ 2+ YSQKEDKYEEEIK 48.2-53.0 563.61 b11 714.95-715.75 y8 527.00-527.80

214 226 +3 2+ 2+ YNOSQKEDKYEEEIK 52.0-54.8 573.27 y12 763.20-764.00 b11 729.30-730.10

214 226 +3 2+ 2+ YNO2SQKEDKYEEEIK 55.7-61.3 578.60 b11 737.50-738.30 y8 527.05-527.85

214 226 +3 2+ 2+ YSQKEDKYNO2EEEIK 55.7-61.3 578.60 b11 737.50-738.30 y12 785.50-786.30 214 226 +3 2+ 2+ 549.35-550.15 YNO2SQKEDKYNO2EEEIK 66.5-68.9 593.60 b11 760.00-760.80 y8 Continued

Table 3.1 continued Retention Precursor Peptide sequence Transition 1* m/z range Transition 2* m/z range time (min) m/z

218 226 +2 2+ + EDKYEEEIK 44.5-49.5 591.78 [M-H2O] 582.40-583.20 [b7-H2O] 904.90-905.70

218 226 +2 2+ + EDKYNO2EEEIK 57.0-60.0 614.27 [M-H2O] 604.95-605.75 [b7-H2O] 949.85-950.65

252 264 +2 + + SIDDLEDELYAQK 103.5-107.3 769.86 y4 508.80-509.60 y8 994.90-995.70

252 264 +2 + + SIDDLEDELYNOAQK 110.0-112.5 784.36 y8 1023.85-1024.65 y11 1366.90-1367.70

252 264 +2 + + SIDDLEDELYNO2AQK 124.4-128.0 792.36 y8 1039.90-1040.70 y11 1382.90-1383.70

13 21 +2 2+ 2+ LDKENALDR 34.4-40.0 537.28 y7 423.01-423.81 [M-NH3] 528.10-528.90

38 48 +2 2+ + QLEDELVSLQK 90.5-94.5 651.35 [M-NH3] 642.06-642.86 y4 475.00-475.80

77 90 +2 2+ + KATDAEADVASLNR 58.2-62.6 730.87 [M-NH3] 721.62-722.42 y10 1045.04-1045.84

75 78 90 +2 + +

ATDAEADVASLNR 63.6-68.0 666.82 y4 489.00-489.80 b9 843.85-844.65

91 101 +2 2+ + RIQLVEEELDR 79.7-84.3 700.38 [M-NH3] 691.52-692.32 b10 1225.20-1226.00

92 101 +2 + + IQLVEEELDR 85.3-89.3 622.33 y8 1002.00-1002.80 y6 790.00-790.80

168 178 +2 + + KLVIIESDLER 79.8-84.0 657.89 y7 861.00-861.80 y8 974.00-974.80

169 178 +2 + + LVIIESDLER 88.0-92.5 593.84 y8 974.00-974.80 y6 747.90-748.70

269 284 +2 2+ + AISEELDHALNDMTSI 134.0-137.5 879.91 b14 770.45-771.25 b10 1078.90-1079.70

269 284 +2 + 2+ AISEELDHALNDMOXTSI 105.5-109.4 887.91 b10 1078.85-1079.65 [b15-NH3] 813.10-813.90

* The 1st and 2nd most intense product ions.

Figure 3.6 The LC elution profile for target peptides in Table 3.2. Hydrophobicity values were calculated by an online sequence specific retention calculator.

A LC elution profile (Figure 3.6) was generated in the DDTRM experiments for all peptides in Table 3.2. Nitration and nitrosylation increased the hydrophobicity of the peptide and its retention time. The hydrophobicity for each unmodified peptide was estimated by inputing the peptide sequence to the online sequence specific retention calculator (http://hs2.proteome.ca/SSRCalc/SSRCalcX).

Retention time is linearly correlated with hydrophobicity according to the following equation (RT = a + b × H, where RT=retention time; a=the gradient delay time, b=a constant related to the slope of the acetonitrile gradient, and H=analyte hydrophobicity)[104]. Therefore, a robust linear regression can be used to then fit the hydrophobicity to retention time for the unmodified peptides. The hydrophobicities of modified peptides were predicted by this linear function using their observed retention time. The results from this prediction are provided in

Figure A.1 and Table A.1 in appendix A. The addition of nitro group to Tyr increased the protein hydrophobicity by ~4.8 (arbitrary units). Likewise, hydrophobicity was increased by 1.3 (arbitrary units) when the nitrosyl group was added to Tyr. By using the predicted hydrophobicities, the retention time for modified peptides can be predicted in the elution gradient programs.

3.3.5 Quantification of nitrotyrosine and nitrosyltyrosine

To quantify the expression of proteins and their post-translational modifications a modified version of the multiple reaction monitoring (MRM also termed SRM for selected reaction monitoring) quantitative analysis was performed. A triple

quadrupole mass spectrometer is most commonly used to execute MRM quantitative analysis. In MRM a precursor ion of a specific m/z value is isolated and transmitted through the first quadrupole, fragmented in the second and a single product ion (referred to as a transition) is selected and transmitted through the third quadrupole to the detector. Several precursor ions to product ion transitions are monitored for one or more target peptides. The extracted ion chromatogram for each transition across its retention time envelope is used to confirm the presence of the relating peptide [105, 106]. MRM methods are very powerful because they have high selectivity and sensitivity. MRM experiments performed on triple quadrupoles benefit from high throughput when compared to trap based MRM. However, the method requires the precursors to product ion transitions are unique for the target analyte. Thus a large amount of time, labor and expense may be required to develop the assay for each given analyte and matrix [107].

Target peptide mass spectrometry can also be performed in trap-type mass spectrometers. The primary difference between triple quadrupole and trap based experiments is the time required to select, fragment and detect product ions.

Triple quadrupoles can rapidly change the voltages that control what mass is allowed to pass through the quadrupoles. Thus they can be rapidly switched from one target transition to another. Targeted experiment performed in traps require more time due to the overhead from precursor selection, ion excitation

(fragmentation) and product ion detection (which requires scanning all the ions in the trap).

One example for targeted mass spectrometry using ion traps is targeted peptide monitoring (TPM) [108]. In TPM, a full MS scan is performed followed by ~4-8

MS/MS scan events on selected peptides. Throughout one TPM experiment, a limited number of precursor ions are triggered to generate MS2 spectra sequentially and repeatedly [108, 109]. Unlike MRM where a single product ion is monitored, in TPM all the product ions for each selected precursor are detected.

Because the time to scan a single m/z value is nearly as long as the time to scan all product ion m/z values, all possible target transitions are obtained with no lose in duty cycle.

Another trap based target peptide mass spectrometry is the peptide ion monitoring (PIM) [110]. PIM experiments eliminate the precursor ion scan and set the linear ion trap mass spectrometer to continuously acquire MS2 data for a limited number of target peptides. In the research work described by Vathany

Kulasingam [110], only one peptide was targeted.

The disadvantage of TPM and PIM is low throughput. To overcome the limitations of TPM and PIM, an inclusion list with well defined retention time windows could be used to allow for the acquisition of MS2 spectra for a greater

number of targets in a given experiment. To obtain the well defined inclusion list, the DDTRM method described in section 3.3.4 was developed. However, the disadvantage of DDTRM was its requirement for detecting the precursor ions in the full MS scan (similar to TPM). To improve upon the DDTRM approach, the full MS step was eliminated so that the mass analyzer is exclusively used to collect MS/MS data for precursors (similar to PIM). This target-driven quantitative

LC-MS/MS method was developed and implemented using an LTQ linear ion trap mass spectrometer. The method is referred to as simply, total reaction monitoring (TRM). Two advantages over DDTRM were achieved by using the

TRM approach. First, the threshold detection requirement for the full mass scan was eliminated, as a result, sensitivity and detection limit were improved. Second, elution profiles were improved and thus more accurate peak areas and/or peak heights were obtained. Table 3.3 compared scan numbers obtained for 2 coeluted peptides in a 1 min time window using DDA, DDTRM and TRM. The highest number of MS2 scans was achieved by TRM.

Table 3.3 Comparison of scan numbers collected by DDA, DDTRM and TRM methods. Data were obtained for 2 coeluted peptides in 1 min time window.

Scan numbers of peptide 1 Scan numbers of peptide 2

Method Full scans MS2 scans Full scans MS2 scans Total scans DDA 14 0 14 0 88 DDTRM 61 61 61 60 182 TRM 0 100 0 100 200

To quantify nitrotyrosine and nitrosyltyrosine changes on each modification site across all the treatments (the molar ratios of ONOO- to Tm, 0:1, 40:1, 60:1, 80:1,

100:1, and 150:1), triplicate TRM experiments were performed for each sample using an LTQ instrument. The mass spectral data were searched by MassMatrix database search program to identify peptide sequences. The peak area across the elution profile for the total reaction transitions of each precursor was extracted and calculated using the Thermo Xcalibur Quan Browser. A time window of 200 sec was used to ensure consistent selection of elution peaks and calculation of peak areas. The percentage of each modification for each site and each treatment was then calculated. Summary data are presented in bar chart format (Figure A.2 to Figure A.5 in appendix A). The percentage of nitration modification for each peptide is defined as the percentage of the peak area of nitrated peptide over the sum of the peak areas of the unmodified, nitrated and nitrosylated species. The calculation methods for each peptide and each Tyr site are shown in Figure A.3 and Figure A.4.

As an example, a comparison of experiment data obtained for nitrotyrosine and nitrosyltyrosine on peptide (214YSQKEDKYEEEIK226) is shown in Figure 3.7. The percentage of each modification for each treatment is presented as bar chart format in Figure 3.8. The error bar represented the standard error of the mean.

The addition of nitro/nitrosyl group increased hydrophobicity and delayed the retention of the nitrated/nitrosylated peptides.

The TRM experiment uses the sum of all product ion abundances to determine peak area. This method is susceptible to noise from coeluted peptides that have precursor m/z values that overlap with those of the targets. An example is demonstrated in Figures 3.7 and 3.8. In Figure 3.8, the percentage of nitration/nitrosylation obtained for untreated sample is due to overlapping peptides.

To improve selectivity, a pseudo-SRM data analysis was next performed. In this method only the first and second most abundant product ions (also referred to as transitions) are used for the quantitative analysis. The m/z range for each selected transition is reported in Table 3.2. The mass tolerance (0.8 m/z) was fixed for all the selected transitions. The calculation of peak areas over selected ions was carried out by Thermo Xcalibur Quan Browser. As a result, selectivity and accuracy were significantly improved for each peptide as compared to TRM.

However, as shown in the MS/MS spectra in Figure 3.7, nitration/nitrsylation caused changes on fragmentation efficiency, which altered the abundance of transitions. This bias limits absolute quantitative analysis, especially for examining modification changes across different ONOO- treatments.

TRM SRM SIM, 10 ppm

214 226 2+ YSQKEDKYEEEIK 563.61 715.31, b11 RT: 49.81 *2+ 2+ y11 b11 RT: 49.81 RT: 49.56 Area: 2503713 2+ y8 Area: 178142 Area: 41380499 ’2+ b11 2+ * loss of NH + y12 + 3 y y6 ’ 5 loss of H2O 2+ 2+ + y10 b6 b7

214 226 2+ YNOSQKEDKYEEEIK 573.27 763.37, y12 RT: 52.74 2+ RT: 52.72 RT: 52.67 Area: 5120 y12 Area: 569 Area: 37025 ’2+ b11 2+ 2+ b11 y8 + y5 y *2+ + 11 y6 + b7

214 226 2+ YNO2SQKEDKYEEEIK 578.60 737.80, b11 RT: 57.22 2+ RT: 57.20 RT: 57.07 b11 Area: 331227 ’2+ Area: 21376 Area: 2941375 2+ b11 y8 2+ y + + 10 y *2+ 2+ 6

83 y 5 y11 b + 2+ 6 b7 y12

214 226 2+ YSQKEDKYNO2EEEIK 578.60 737.80, b11 2+ RT: 59.49 b11 RT: 59.46 RT: 59.34 *2+ 2+ Area: 32833 y11 y12 Area: 2589 Area: 304187 2+ y8 ’2+ b11 2+ 2+ + + y10 b6 y y5 6 + b7

214 226 2+ YNO2SQKEDKYNO2EEEIK 593.60 760.29, b11 RT: 67.08 2+ RT: 67.10 RT: 66.81 2+ ’2+ b11 Area: 6637 y8 b11 Area: 645 Area: 80815

2+ y10 y *2+ + + 11 2+ y6 y5 b6 + b7

48 58 68 600 700 800 900 48 58 68 48 58 68 Time (min) m/z Time (min) Time (min)

Figure 3.7 The comparison of TRM, SRM and SIM experiment data on peptide (214YSQKEDKYEEEIK226). Peak area and retention time for each type of peptide were generated by Quan Brower.

Figure 3.8 The comparison of TRM, SRM and SIM experiment data on peptide (214YSQKEDKYEEEIK226). The percentage of each type of peptide for each treatment is presented as bar chart format.

To do absolute quantitative analysis, the full MS spectra obtained from DDTRM data was used to calculate the peak area using selected ion morning (SIM). SIM is a quantitation method in which the abundance of a selected precursor ion is used to represent the amount of an analyte in a matrix. Thermo Xcalibur Quan

Browser was used to calculate the elution peak area from the MS1 full scan for each precursor. The retention time used for each SIM calculation was obtained from TRM data. The results of the SIM data analysis are shown in Figures 3.8 and 3.9. The Tm nitrotyrosine and nitrosyltyrosine levels obtained by SIM were consistent with the TRM results. The key difference is that SIM was not affected by changes in fragmentation that affect product ion abundances.

Table 3.4 reports the percentage of nitration and nitrosylation for each Tyr site at the maximum treatment of ONOO- (molar ratio of ONOO- to Tm, 150:1).

Comparison of TRM and SIM experiment data was performed by t-test. The significance test showed these two methods give the same results for the percentage of nitration and nitrosylation with the sole exception of Tyr 214.

It has been reported that ONOO- has a half-life (~1 sec). And also nitrated/nitrosylated proteins can be degraded. Therefore, all the ONOO- treatments in this research work were performed at the same time and with the same manner. 10 peptides were selected as control peptides to evaluate data consistence across all the treatments and assess the effect of

nitration/nitrosylation on tryptic digestion. The relative abundance for each peptide across all the treatments is presented in bar chart format in Figure 3.10.

Figure 3.9 The SIM experiment data of nitration and nitrosylation on each Tyr site.

Table 3.4 The statistical comparison of TRM and SIM. The data represent the percentage of nitration and nitrosylation on each Tyr site at the maximum treatment of ONOO- (molar ratio of ONOO- to Tm, 150:1). Triplicate experiments were performed for each method. Data were reported as mean ± standard error.

Modification percentage 100% - P value of t-Test Modification at 150:1 molar ratio ONOO :Tm on TRM and SIM TRM SIM 60 YNO 0.00293 ± 0.00003 0.00267 ± 0.00020 0.32599 60 YNO2 0.24872 ± 0.01287 0.22930 ± 0.01050 0.30734 214 YNO 0.00212 ± 0.00018 0.00088 ± 0.00002 0.02072 214 YNO2 0.11379 ± 0.00177 0.05167 ± 0.00972 0.02437 221 YNO2 0.01097 ± 0.00025 0.00710 ± 0.00118 0.08483 261 YNO 0.00028 ± 0.00011 0.00044 ± 0.00001 0.29137 261 YNO2 0.03211 ± 0.00287 0.03008 ± 0.00321 0.66261

P<0.05, significantly different

Figure 3.10 The comparison of TRM, SRM and SIM experiment data on control peptides, in which Tyr is not contained. The percentage of each peptide for each treatment is presented as bar chart format.

The mechanism underlying Tyr nitration does not occur in a random manner as protein Tyr abundance does not dictate the extent of nitration suggesting that other factors play a role in directing the nitration of Tyr [111]. One would predict that solvent accessibility would be a good indicator of nitrating potential as Tyr residues that are more exposed have been shown to have an increased reactivity with nitrating agents [112]. Of the four Tyr residues identified with LC-MS/MS, Tyr

60, the most nitrated residue, is 41% exposed followed closely by the second most nitrated Tyr 214 with 37% solvent accessibility. As expected, the least exposed Tyr residue Tyr 221 is only 3% solvent accessible. Interestingly, the third most nitrated Tyr residue, Tyr 261, has a solvent accessibility of 88% suggesting that exposure of the Tyr residue is not the sole determining factor of

ONOO- nitration susceptibility as increased solvent exposure does result in an increase in nitration.

Souza and colleagues have found that nitration of protein Tyr share similar characteristics: 1) presence of acidic residues in close proximity to Tyr, 2) limited number of sulfur-containing residues to compete for reaction with ONOO- , and 3) the presence of turn-inducing residues such as proline or glycine [113]. Both the primary sequence and secondary structure of Tm exhibit an acidic environment surrounding all Tyr; however, no clear pattern is present with regards to extent of acidic environment in relation to extent of nitration. Furthermore, no sulfur- containing residues are in close proximity to any Tyr to compete for reactivity with

ONOO-. While we cannot delineate a specific reasoning for preferential nitration of Tm Tyr it is clear nitration of Tm does not occur in a random fashion as multiple experiments of dose-dependent Tm exposure to ONOO- produces the same preferential nitration pattern (Tyr 60 > Tyr 214 > Tyr 261 > Tyr 221). One possible explanation for Tyr 60 being the most nitrated Tyr residue is its close proximity and polar contact with a glutamic acid (Glu) residue since as previously mentioned an acidic environment promotes nitration of Tyr. Furthermore, it was shown that the close proximity of a polar residue, in the case of Tyr 60 a serine residue, favors nitration of Tyr [114]. While the specific rationale for preferential nitration of Tm Tyr 60 remains unclear, it evident that there is a non-random, favorable targeting of specific Tyr residues for nitration of the Tm molecule in vitro. It is possible, however, in an in vivo setting Tm nitration could differ than that of in vitro nitration as interactions with neighboring proteins such as actin and troponin could alter exposure and local environment of Tyr residues of Tm.

Tm plays an integral role in beat-to-beat function of the heart by allowing the interaction of actin and myosin, and thus cardiac contraction/relaxation, to occur.

Post-translational modification [115] [116] or mutation [117] [118] [119] of the Tm molecule has been shown to alter function of Tm [120] [121] and have potential to impact whole heart function. Critical to Tm is its residue sequence which imparts varying structural characteristics to allow for proper function. It was previously determined that in position a or d Tyr residues contributed to the

stability of the Tm dimer while other residues such as Asp or Glu resulted in decreased stability, or increased flexibility, of Tm [122] [123] which is necessary for normal function. Incorporation of a negatively charged nitro group onto Tyr has similar electrostatic properties as that of phosphorylation [124]. Such an addition could elicit similar electrostatic effects to that of acidic residues which have been shown to alter function. Additionally, it has been shown that incorporation of a negative charge in a hydrophobic region, such as that of an aspartic acid, can decrease the stability of the Tm dimer through electrostatic repulsion of monomers [125]. We hypothesize that the introductions of a negatively charged nitro adduct to Tyr residues results in increased destabilization, or increase flexibility, translating to altered function.

When considering the potential in vivo implications of Tm Tyr nitration, it is important to point out that Tyr residues are located in both actin and troponin T binding domains [97]. Oguchi and colleagues showed that increasing the destabilization within specific actin binding domains of Tm can alter the binding of actin as well as sliding velocity and force [126]. Furthermore, a decrease in Ca2+ sensitivity was observed in dilated cardiomyopathy mutations of Tm in similar regions [127]. Interestingly, Tyr 60 is located within one of the domains that were altered resulting in decreased sliding velocity and force compared to wild-type

Tm stressing the importance of modifications made to this region of Tm. Nitration of Tyr 60 would likely induce similar destabilizing effects contributing to altered

myofilament regulation. Such complications at the whole heart level could result in altered systolic and diastolic function, for example decreased force production and increased relaxation time [128]. It is possible that nitration of other Tyr residues in Tm, albeit nitrated to a lesser extent than Tyr 60, could also affect the normal function of Tm as Tyr 162, Tyr 214, Tyr 221 and Tyr 267 are also found in actin binding regions of Tm. Additionally, Tyr 261 is located in b position which is said to interact with actin [126] suggesting that nitration could alter the interaction of Tm and actin and therefore lead to altered function. As shown in Figure 3.9, nitration of Tm Tyr occurs in a dose-dependent manner, in such a way that at lower concentrations of ONOO- Tyr 60 would initially be significantly nitrated and impart structural and functional alterations. Following an increase in ONOO- other

Tyr would be nitrated further contributing to structural and functional alterations.

Further investigation into the site-specific effects of nitrated Tyr in Tm will be carried out to fully elucidate the biochemical and functional effects of Tm nitration.

3.4 Conclusion

The research goals for this project are 1) to evaluate the distribution of nitration and nitrosylation of 6 Tyr residues on Tm, 2) to quantitatively measure the modification on each Tyr residue. To reach the research goal, two targeted mass spectrometry methods were developed. First, DDTRM was designed to supply a bridge from target driven discovery to target drive quantitation. DDTRM analysis was performed using an LTQ-Orbitrap mass spectrometer to take advantage of

its high mass resolution and high mass accuracy. A recursive process was used to optimize the target inclusion list. Second, TRM was developed on an LTQ mass spectrometer with the optimized target list. By eliminating the full MS scan and the threshold requirements, sensitivity, LOD and LOQ were improved.

Overall, one target precursor ion was selected for each candidate peptide and triggered to fragmentation dependently of the inclusion list but not the abundance of precursor ion. Total reaction transitions were recorded to provide informative product ions and positive identification of peptides and their modifications. SRM can be used with to provide even greater selectivity. SIM on full MS spectra of

DDTRM data was also carried out to enhance the accuracy of quantitative analysis.

The methods described within provide means for detecting low abundance protein modifications, such as nitration, induced during ischemic heart disease.

Utilizing this approach will allow for greater understanding of the mechanisms underlying Tm nitration in cardiac disease. While this method has been applied to the detection of low abundance nitration of Tm, the true strength lies within the ability to detect other low abundance protein post-translational modifications not only in cardiac disease, but other pathophysiological systems as well.

4 Identification and validation of new drug targets in Acute

Myeloid Leukemia

4.1 Introduction

Acute myeloid leukemia (AML) is one of the most common adult leukemias and presents with poor long-term survival [129], based on a recent SEER

(Surveillance, Epidemiology and End Results) study where the relative 5-year survival rate for AML was 23.4% [129]. AML can be driven by a number of different genetic mutations. The most prevalent are involved in signal transduction and cellular differentiation [130]. Mutated signal transduction genes include FMS-like tyrosine kinase 3 (FLT3), stem cell factor receptor (c-kit) and

Janus kinase 2 (Jak2). Differentiation regulators consist of runt-related transcription factor 1 (RUNX1), spleen proviral integration oncogene 1 (SPI1),

CCAAT/enhancer-binding protein alpha (CEBPA) among others (reviewed in

[131]).

The most clinically relevant mutations are found in the signal transduction protein

FLT3. FLT3 is a tyrosine kinase cytokine receptor primarily found on CD34+ bone marrow cells and drives survival and proliferation of these cells, as well as the differentiation of these cells in response to FLT ligand (FL) stimulation [132].

Upon binding of the ligand to the receptor, FLT3 becomes autophosphorylated and thus activated. Phosphorylated FLT3 initiates downstream signaling through

STAT5 (signal transducer and activator of transcription 5), ERK1/2 (extracellular signal-regulated kinase 1 and 2) and PLC (phospholipase C)-mediated pathways, in addition to other pathways [133, 134]. Following activation the receptor is internalized and degraded resulting in the termination of signaling [135]. FLT3 is normally regulated by the presence of its ligand FL. FL levels are typically very low in human serum but can be increased in paracrine fashion to initiate signaling in a specific localized niche [136]. Mutations in the FLT3 protein can result in the loss of this regulation and effectively remove endogenous control over the proliferation of hematopoietic progenitors.

The most common mutation in FLT3 is the internal tandem duplication (FLT3

ITD). FLT3 ITD, first found in AML patients by Nakao in 1996 [137], differs from wild-type FLT3 in that it can produce autophosphorylation in the absence of FL, thus removing any endogenous restriction on the tyrosine kinase activity. FLT3

ITD occurs in one-third to one-half of AML patients [138, 139] and is correlated with a poor prognosis [140] and greater likelihood of relapse relative to FLT3 ITD negative AML [141, 142].

The success of tyrosine kinase inhibitors (TKIs), such as imatinib (Gleevec ®) used in chronic myeloid leukemia (CML) and gastrointestinal stromal tumors

(GIST) has prompted research into TKIs for the treatment of AML. Several TKIs have been developed to target FLT3 and a subset of these have been evaluated clinically. FLT3 inhibitors have been shown to be highly efficacious against cell lines expressing FLT3 ITD (primarily due to “oncogene addiction”) while having little effect on similar cell lines expressing wild-type FLT3. However, these inhibitors have been less effective in patients or have been dose-limited due to side effects [143-145]. The understanding of existing FLT3 inhibitors, the discovery of new targets for the current inhibitors and the development of novel inhibitors are paramount for advancing AML therapy.

In this chapter, an effective program (Figure 4.1) was built and utilized to identify and validate new potentially “druggable” targets in FLT3 ITD driven AML. The

MV4-11 cell line was used in this study as it expresses the FLT3 activating mutation (FLT3 ITD). Phosphotyrosine (pTyr) protein enrichment was applied to characterize protein extracts from MV4-11 cells before and after treatment with the tyrosine kinase inhibitor PKC412. The characterization of pTyr proteins is challenging due to their low abundance relative to total proteins (~0.05%). The use of 4G10 anti-pTyr conjugated beads yielded high quality pTyr enrichment with low background. New FLT3 downstream signaling effectors were expected to be identified from pTyr immunopurified protein complex by LC-MS3 analysis and serve as novel therapeutic targets for AML.

Figure 4.1 Schematic of phosphoproteomic-enrichment analysis. HPLC: separation of samples, Ion source: vaporization/ionization of the molecules, Mass analyzers: separation of ions by the mass-to-charge (m/z) ratio, Detector: detection of mass separated ions.

Data-dependent neutral loss MS3 acquisition was used for phosphopeptide analysis. In neutral loss MS3 characterization of phosphopeptides, MS3 measurements are automatically performed if the specified neutral loss is observed in the MS2 spectrum. In this work, the product ion resulting from loss of phosphoric acid (80 Da for phosphotyrosine) during CID is selected to undergo an additional stage of MS/MS (Figure 4.2).

Notably, one of the proteins detected was Myosin Heavy Chain 9 (MYH9, 226

KDa). Mutations in the MYH9 gene have been shown to result in hyperproliferation in a lung cancer cell line. Additionally MYH9 has been shown to be important in other hematological diseases such as bleeding disorders with decreased platelet [146, 147]. It is speculated that MYH9 may play a role in

FLT3-ITD associated AML. Additional studies were made to characterize MYH9 and its role in AML as well as to investigate its association with the receptor tyrosine kinase FLT3.

Figure 4.2 Schematic of neutral loss MS3 characterization of phosphopeptides. MS3 measurements are automatically performed if the specified neutral loss is observed in the MS2 spectrum. In this work, the product ion resulting from loss of phosphoric acid (80 Da for phosphotyrosine) during CID is selected to undergo an additional stage of MS/MS.

4.2 Methods

4.2.1 Cell culture

The human acute myeloid leukemia (AML) cell line MV4-11 was cultured in

Iscove's Modified Dulbecco's Medium (IMDM) with 10% FBS, 1% penicillin/streptomycin, 1% L-glutamine (Gibco). Transfected derivative cell lines were selected via antibiotic-mediated selection.

4.2.2 Drug treatment

MV4-11 cells were suspended in cell media as described previously and treated with 1 μM PKC412 (LC Laboratories). Treated and untreated MV411 cells were harvested and pelleted by centrifugation (1,200 rpm, 5 min, 4 °C) at different time points as needed.

4.2.3 Western blot and immunoprecipitation

For western blot (WB) analysis, cells were lysed in RIPA buffer (150 mM NaCl, 2%

NP-40, 0.1% SDS, 50 mM Tris [pH 8.0]) supplemented with Complete protease inhibitor and PhosStop phosphatase inhibitor (Roche). After incubation on ice for

20 min, lysates were clarified (14,000 rpm, 20 min, 4 °C), suspended in SDS- buffer and boiled for 10 min before loading on 4-20% SDS-PAGE gradient gels.

Proteins on the gel were transferred onto nitrocellulose membranes and probed with antibodies as indicated, following the standard western blot procedures [148].

100

For immunoprecipitation (IP) cell lysates (1 mg) were prepared in RIPA buffer and incubated overnight at 4 °C with antibody (10 µL) and protein G+ beads (25

µL). Specifically, 4G10 anti-pTyr conjugated agarose beads (Millipore) were used for enrichment of phosphotyrosine proteins. The beads and supernatant were separated by pulse microcentrifugation. Immunoprecipitates were washed with

RIPA buffer, suspended in SDS-PAGE loading buffer and boiled to dissociate the immunocomplexes from the beads. After centrifugation, the supernatant was loaded onto a SDS-PAGE gel for separation.

The antibodies used were anti-pTyr clone 4G10 (Millipore), anti-MYH9 (Abcam), anti-pFLT3 (Tyr589/591) (Cell Signaling), anti-FLT3 (Santa Cruz), anti-GAPDH

(Santa Cruz), and anti-GRB2 (BD TransLab Inc.).

4.2.4 In-gel tryptic digestion

Gel bands were visualized by Coomassie blue staining. Each of the gel bands separated by SDS-PAGE was excised and cut into approximately 1 mm × 1 mm pieces. The gel pieces were washed twice (1 hr each) in a freshly made wash solution (methanol: acetic acid: water = 50:5:45). After the gel pieces were dehydrated with ACN for 5 min, 5 mM dithiothreitol was added and incubated for

30 min at room temperature to reduce the disulfide bonds. The proteins were alkylated by the addition of 15 mM iodoacetamide for 30 min at room temperature in the dark, followed by two cycles of rehydration with 100 mM

101

ammonium bicarbonate and dehydration with ACN (5 min each). The gel pieces were dried in a SpeedVac concentrator for 2-3 min prior to the addition of 600 ng trypsin (20 ng/µL in 50 mM NH4HCO3) to each gel band. The mixture was then hydrated on ice for 10 min and another 20 µL of 50 mM NH4HCO3 was added.

The digestion was performed at 37 °C for 2 hours. Finally, the digested peptides were extracted with 30-40 µL extraction solution (ACN: formic acid: water =

50:5:45) three times. The extract was dried completely in a SpeedVac concentrator and redissolved in 10 µL of HPLC water.

4.2.5 Data-dependent neutral loss LC-MS3 analysis

The in-gel tryptic digests of each gel band were characterized by capillary LC-

MS3 analysis performed on a Dionex Ultamate 3000 HPLC instrument (Dionex) and a Thermo Fisher LTQ Orbitrap XL (Thermo Finnigan) equipped with a microspray ionization source (Michrom Bioresources). Peptides were desalted and preconcentrated on a trap column (C18, 300 μm × 5 mm, 5 µm, 100 Å,

Dionex) for 10 min with loading buffer (0.03% TFA in the solvent of 2% ACN and

98% water) at a flow rate of 20 μL/min and then eluted on an analytical column

(magic C18, 0.2 mm × 150 mm, 3 µm, 200 Å, Michrom Bioresources) using mobile phase A (0.1% formic acid in water) and mobile phase B (0.1% formic acid in ACN) at a flow rate of 2 µL/min with a linear gradient (mobile phase B increased from 2% to 40% in 45 min, 40% to 90% in 2 min). The separation system was washed 2X between each sample in order to reduce sample

102

carryover. 10 μL of the digests were injected onto the column for each band. The electrospray voltage was maintained at 2.0 kV and the capillary temperature was set at 175 °C. Profile MS1 scans were collected at high mass accuracy using the

Orbitrap mass analyzer (preview mode enabled, mass range = 300-2000 m/z, resolution = 60,000). Data-dependent MS2 or MS3 scans were collected for the five most abundant precursor ions in centroid mode using the LTQ mass analyzer. (collision energy = 35%; dynamic exclusion settings: repeat count = 2, repeat duration = 5 s, exclusion duration = 15 s). When a neutral loss of 98, 49 or

32.7 (H3PO4 for +1, +2 and +3 charge states) or 80, 40 or 26.7 (HPO3 for +1, +2

2 3 and +3 charge states) occurs in the MS scan, the MS scan is trigged to isolate and fragment the corresponding neutral loss product ions from the preceding

MS2 scan. All data were acquired in positive ion mode. All the mass spectral data were searched against the MassMatrix database search program [12]. False discovery rates were estimated using the target-decoy strategy and subjected to manual validation [99].

4.2.6 Transfections with siRNAs

In order to transiently silence the expression of FLT3 or MYH9, siRNA oligonucleotides were purchased from Dharmacon and transfected in solution L.

All the transfections were performed by an AMAXA Nucleofector II as suggested by the manufacturer.

103

4.2.7 Transfections with shRNA

MYH9 shRNA was purchased from Openbiosystems. MV4-11 cells were serially transfected with lentivirus produced from each of five shRNA constructs each in the pLKO.1 vector.

4.2.8 Lentivirus production

MYH9 shRNA was purchased from Openbiosystems. 106 MV4-11 cells were serially transfected with lentivirus produced from each of five shRNA constructs each in the pLKO.1 vector. The hairpin sequences used were shown in Table 4.1.

Five hairpin sequences were used because previous experiments showed that a single sequence was inadequate to produce a measurable decrease in protein level.

Table 4.1 Hairpin sequences used for lentivirus production.

Hairpin Sequence 1 CCGGGCCGTACAACAAATACCGCTTCTCGAGAAGCGGTATTTGTTGTACGGCTTTTT 2 CCGGCGCATCAACTTTGATGTCAATCTCGAGATTGACATCAAAGTTGATGCGTTTTT 3 CCGGGACAGCAATCTGTACCGCATTCTCGAGAATGCGGTACAGATTGCTGTCTTTTT 4 CCGGCCGCGAAGTCAGCTCCCTAAACTCGAGTTTAGGGAGCTGACTTCGCGGTTTTT 5 CCGGGCCAAGCTCAAGAACAAGCATCTCGAGATGCTTGTTCTTGAGCTTGGCTTTTT

104

Lentivirus used to produce MYH9 knock-down cells was produced by transiently transfecting HEK 293T cells with using calcium phosphate (Promega Profection) with the plasmid of interest in conjunction with vesicular stomatitis virus G protein

(VSVG) as a nuclear envelope protein as well as psPAX2 packing vector. HEK

293T cells were incubated at 37 ºC overnight in the presence of transfection mixture in DMEM. Following incubation medium was changed to IMDM supplemented with 10% FBS and cells were incubated at 32 ºC for 48 hours after which time the virus-containing supernatant was collected and filtered through a

0.45 µm cellulose filter.

4.2.9 Lentiviral infection

5 x 105 MV4-11 cells were incubated in 15 mL of virus-containing medium for 12 hours in the presence of 8 ng/mL polybrene at 37 ºC. Following incubation medium was replaced with standard IMDM medium and cells were incubated in for 12 hours again at 37 ºC. This process was repeated to encompass five separate shRNA constructs over five days.

4.2.10 Methylcellulose-based clonogenic assay

Methylcellulose colony formation assays were carried out by plating 103 MV4-11 cells following transient transfection with either scrambled or MYH9 siRNA in 0.9%

MethoCult M3234 (Stem Cell Technologies Inc.). Colonies (>125 µm) were scored after two weeks.

105

4.3 Results and discussion

This study is centered on the MV4-11 FLT3 ITD positive human AML cell line.

PKC412 is a tyrosine kinase inhibitor. It is a known inhibitor of FLT3 and is under investigation as a therapeutic in AML. To confirm its affect on FLT3 activity, MV4-

11 cells were treated with PKC412. A dose of 1 µM was selected as this was expected to nearly eradicate FLT3 activity while producing minimal off-target effects. A single 1 hr, 1 µM dose of PKC412 was found to abolish FLT3 signaling in MV4-11 cells as evidenced by a total loss of pTyr detected on immunoprecipitated FLT3 protein (Figure 4.3).

Figure 4.3 4G10 pTyr western blot analysis following anti-FLT3 immunoprecipitation of protein extracts from untreated MV4-11 cells or cells treated with 1 µM PKC412 for 1 hr. Sample loading control was shown by FLT3 western blot analysis following anti-FLT3 immunoprecipitation.

106

To study the effects of PKC412 on other pTyr proteins extracted from MV4-11 cells, a highly specific anti-pTyr antibody (4G10) was used to enrich pTyr proteins by immunoprecipitation (IP). Identification of enriched pTyr proteins was performed by data-dependent neutral loss LC-MS3 as described in the method section. 4G10 anti-pTyr IP and 4G10 anti-pTyr WB showed several proteins with lower pTyr levels in the PKC412 treated samples (1 µM, 1 hr) compared to untreated controls (Figure 4.4).

Figure 4.4 4G10 pTyr western blot analysis following 4G10 anti-pTyr immunoprecipitation of MV4-11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr.

107

This finding was supported by 4G10 anti-pTyr IP followed by SDS-PAGE analysis and Coomassie blue staining on the same batch of samples (Figure

4.5). In total, 32 gel bands, labeled on Figure 4.5, were excised and in-gel digested with trypsin. The tryptic digests of each band were separated and characterized by capillary LC-MS3 proteomic identification. Mass spectra were collected on an LTQ Orbitrap XL. Proteins were identified using the MassMatrix database search program.

108

Figure 4.5 Coomassie blue staining following 4G10 anti-pTyr immunoprecipitation of MV4-11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr.

109

MYH9 was identified (Figure 4.5 gel band 1 and 17) and selected for further validation and evaluation of its role in AML due to its critical role in oncogenic cellular proliferation and thrombocytopenia [146, 147]. 4G10 anti-pTyr immunoprecipitation pulled down MYH9, the amount of which was lower in the treated sample (1 μM PKC412, 1 hr) relative to the untreated control. This indicates treatment with PKC412 decreased phosphorylation of the tyrosine residues on MYH9 (Figure 4.6). This result was validated by a reciprocal immunoprecipitation where MYH9 was immunoprecipated and pTyr was measured by 4G10 western blot (Figure 4.7).

Figure 4.6 MYH9 western blot following 4G10 anti-pTyr immunoprecipitation of MV4-11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr demonstrating a reduction in tyrosine phosphorylation of MYH9 following PKC412 treatment.

Figure 4.7 pTyr western blot following anti-MYH9 immunoprecipitation of MV4-11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr. Sample loading control was shown by MYH9 western blot following anti-MYH9 immunoprecipitation. The relative amount of tyrosine phosphorylation of MYH9 is reduced following PKC412 treatment. 110

The next set of experiments sought to determine the relationship between MYH9 and FLT3. To this end, FLT3 was immunoprecipitated from MV4-11 cell lysates treated (Figure 4.8 right bottom) and untreated (Figure 4.8 left bottom) with

PKC412. Western blotting for MYH9 showed a decrease in MYH9 from the

PKC412 treated FLT3 pull-down when compared to the untreated sample

(Figure 4.8 Top).

Figure 4.8 MYH9 western blot following anti-FLT3 immunoprecipitation of MV4- 11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr. Sample loading control was shown by FLT3 western blot following anti-FLT3 immunoprecipitation.

Figure 4.9 FLT3 western blot following anti-MYH9 immunoprecipitation of MV4- 11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr. Sample loading control was shown by MYH9 western blot following anti-MYH9 immunoprecipitation.

111

Similarly, immunoprecipitating MYH9 from these same samples showed a decrease in FLT3 association with MYH9 (Figure 4.9). These results suggested that FLT3 and MYH9 exist in a complex, which is contingent upon FLT3 activity.

However the kinase responsible for MYH9 phosphorylation remains to be identified. Interestingly, the loss of FLT3 activity, and presumably, loss of MYH9 phosphorylation results in a reduction of total MYH9 protein levels.

As seen in (Figure 4.10), a time-dependent loss of MYH9 was found in MV4-11 cells treated with PKC412. It was observed that FLT3 levels diminished in untreated cells due to overcrowding. However in PKC412 treated cells, the total

FLT3 level remained stable. This apparent disconnection between total FLT3 and total MYH9 expression indicate that it is FLT3 activity, not expression, which controls MYH9 expression or stability.

Figure 4.10 MYH9 and FLT3 western blot of MV4-11 cell lysate untreated/treated with 1 µM PKC412 for 1 hr, 3 hr, 6 hr, 12 hr, 24 hr, and 48 hr. Sample loading control was shown by GAPDH western blot analysis.

112

Based on these data, a 48 hr time point was selected to measure MYH9 expression following transfection with siRNA targeting FLT3 as the half-life of

MYH9 is long as supported by the gradual decrease in protein levels following

FLT3 inhibition by PKC412. At this 48 hr time point a robust decrease in MYH9 was detected while FLT3 levels remained low (Figure 4.11).

Figure 4.11 MYH9 western blot demonstrating FLT3 knock-down in MV4-11 following siRNA administration and corresponding loss of MYH9. Sample loading control was shown by GAPDH western blot analysis.

113

Real-time PCR analysis showed the expected decrease in FLT3 mRNA levels following FLT3 siRNA knockdown administration and a stark decrease in MYH9 mRNA (Figure 4.12). This loss of MYH9 transcript suggests the loss of MYH9 protein is caused by a reduction in mRNA creation or a decrease in mRNA stability rather than a destabilization of the MYH9 protein itself. To further examine the relationship between MYH9 and FLT3, FLT3 was monitored when

MYH9 was targeted for knockdown.

mRNA expression in MV4-11 cells FLT3

2.4 MYH9

1.8

1.2 Fold change Fold

0.6

0.0 Scramble MYH9 siRNA (48 hr) FLT3 siRNA (48 hr)

Figure 4.12 Taqman real-time PCR shows a decrease of MYH9 mRNA after FLT3 siRNA transfection in MV4-11 cells. FLT3 mRNA is increased slightly following MYH9 siRNA transfection. MV4-11 cells transfected with scrambled sequence are controls.

114

To evaluate if MYH9 expression influences FLT3 levels, siRNA directed at MYH9 was administered and FLT3 levels were measured at 24 hr and 48 hr. Total FLT3 and pFLT3 (Tyr589/591) were also measured at 48 hr, 72 hr and 96 hr. While there was no detectable change in total FLT3 levels at any time point, a decrease in phosphorylated FLT3 was found at the 48 hr and 72 hr time points but not in

96 hr collection (Figures 4.13 and Figure 4.14 Top). Interestingly, an increase in total FLT3 is noted in both the scramble and MYH9 knock-down samples through all the time points. As shown in Figure 4.14 Bottom, the ratio of pFLT3 to total

FLT3 remains approximately 70% as determined by densitometry throughout the experiment despite the increase in total FLT3. The increase in total FLT3 is likely a result of autocrine stimulation caused by a gradual increase in cell density. A greater increase in total FLT3 levels in the MYH9 knock-down sample relative to the scramble sample is noted; which is presumed as a result of a feedback loop.

Figure 4.13 siRNA mediated MYH9 knock-down produces a modest decrease in MYH9 levels and no change in FLT3 experssion in MV4-11 cells. 115

Densitometry analysis Scramble MYH9 siRNA

100%

75%

50% pFLT3/FLT3 25%

0% 48 hr 72 hr 96 hr

Figure 4.14 Time course western blot demonstrating a reduction in phosphorylated FLT3 following transfection with MYH9 siRNA. Total FLT3 levels increase with time as cell density increase (Top). Densitometric analysis demonstrates pFLT3 expression in MYH9 knock-down cells is about 30% less than that of scramble cells at each time point (Bottom).

116

As was found at the protein level using a western blot, a knock down of MYH9 produced a modest increase in FLT3 mRNA (Figure 4.12). The hypothesis is that FLT3 is moderately inactivated in the MYH9 knock down cells and therefore is subject to slower recycling, relative to the scramble cells with active FLT3.

Therefore, to offset the loss of FLT3 activity, FLT3 is expressed more in MYH9 knock down cells compared with the scramble cells.

To verify this hypothesis, a lentiviral shRNA construct was administered to MV4-

11 cells. First, this method produced a greater reduction in MYH9 levels than siRNA transfection. Second, a much greater number of cells required for coimmunoprecipitation experiment could be collected due to the stable transfection produced by the shRNA. A near-total loss of FLT3 phosphorylation was detected while modest decrease in total FLT3 levels was observed following

MYH9 knock down (Figure 4.15). MV4-11 cells are dependent upon active FLT3 for proliferation therefore the final experiments were designed to determine if the reduction in MYH9 altered the propagation of these cells.

117

Figure 4.15 (Top): shRNA mediated MYH9 knock down produces a modest decrease of FLT3 levels as measured by western blot. (Bottom): CO-IP demonstrates a robust loss of FLT3 phosphotyrosine with loss of MYH9 expression.

118

To compare the expansion of parental MV4-11 cells with those expressing a durable MYH9 knock down, trypan blue exclusion criteria was used with liquid culture medium and a colony-forming assay was used with semisolid methocellulose-based medium. Parental MV4-11 and MV4-11 expressing MYH9 shRNA were each diluted to a cell density of 5 x 104/mL and grown for five days at 37 ºC. As shown in Figure 4.16, MV4-11 cells expressing MYH9 shRNA grew at consistently reduced rates when compared to untransfected normal controls.

The growth inhibition was robust and lasting. A colony forming assay was used to confirm this result as it is a better representation of the in vivo microenvironment.

MV4-11 (untransformed parental and MYH9 knock down) cells were each plated in quadruplicate 1 mL dishes at a cell density of 5 × 104/mL and incubated for two weeks at 37 ºC. Again, a significant decrease in clonogenic potential was found in MV4-11 cells following MYH9 knock down. As shown in Figure 4.17, loss of

MYH9 reduced the colony-forming of MV4-11 cells by over 70%. The reduction in colony forming may be due to the loss of MYH9 or due to the reduction in FLT3 activity that accompanies MYH9 knock-down. The long-term nature of the colony forming assay (2 weeks) suggests MYH9 may be the more likely candidate for inhibiting long-term proliferation.

119

Time course of MV4-11 cells Control MYH9 shRNA

100%

75%

50%

25% Cell number (% of control) of (% number Cell

0% Day 2 Day 3 Day 4 Day 5

Figure 4.16 Time course comparing growth rate of untransfected control MV4-11 cells with cells expressing MYH9 shRNA. Trypan blue exclusion was used to differentiate living and dead cells. MV4-11 cells expressing MYH9 shRNA had a consistently reduced proliferation rate.

Figure 4.17 Semisolid colony forming assay of MV4-11 MYH9 knock down cells. The data illustrates reduction in proliferation of MV4-11 MYH9 knock down cells when compared to untransfected controls. 120

4.4 Conclusions

This study is a proof of principle, showing that the technique of optimized phosphotyrosine protein enrichment is capable of identifying possible new targets of active phosphorylation and possible new drug targets in AML. Furthermore this chapter revealed a previously unrecognized network that involves the tyrosine kinase receptor FLT3 and protein MHY9. This interaction may favorably contribute to the development of AML treatments.

This study also demonstrates, for the first time, the potential of MYH9, a nonmuscle myosin protein, as a therapeutic target in FLT3 ITD-driven AML. MYH9 is typically described as structural protein that is suspected to play a primary role in the motility of hematopoietic cells of the myeloid lineage [149]. Likewise, MYH9 possesses an ATP-dependant function of actin filament arrangement in fish epidermal keratinocytes, a process that is likely closely related to the role of

MYH9 in myeloid cell motility [150]. Importantly, this ATP-dependent motility function is sensitive to the MYH9 inhibitor blebbistatin. In this system, however, blebbistatin produces no changes in FLT3 expression or activity (data not shown).

It can be inferred from these data that the results shown here are representative of a novel function of MYH9 that is not related to the previously described ATP- mediated motility. Blebbistatin is reported to function as a myosin inhibitor through binding to the ADP+Pi pocket of the myosin molecule [151]. This prevents the binding of actin that partners with myosin to produce a contraction.

121

The lack of effect of blebbistatin in the phosphorylation or expression of FLT3 suggests that the relationship between FLT3 and MYH9 is not analogous to actin and myosins.

122

5 Nucleolin is a key component of miRNA-processing

complex and regulates the biogenesis of a cohort of miRNAs

5.1 Introduction

MicroRNAs (miRNAs) are noncoding single-stranded (ss) RNA molecules of ~22 nucleotides (nt) in length [152]. They have a critical role in regulating gene expression by targeting messenger RNAs (mRNAs) in a sequence-specific manner [153]. Mature miRNAs are produced from primary miRNA transcripts (pri- miRNAs) through sequential cleavages by the microprocessor complex or pri- miRNA processing protein complex DROSHA-DGCR8 in the nucleus and the enzyme DICER in the cytoplasm, to release precursor miRNAs (pre-miRNAs) and mature miRNAs, respectively [152].

A large body of evidence indicates that the multigene regulatory capacity of miRNAs is altered in human cancer [154, 155]. In fact, miRNA loci are subject to genetic and epigenetic changes, and miRNA “signatures” have been found informative for tumor classification and clinical outcome [156-158]. Several miRNAs are specifically upregulated in various types of tumors [159] and a wide range of studies has demonstrated how their down-regulation could potentially affect tumorigenesis, metastasis formation and drug-resistance [154, 160].

123

However the mechanisms of DROSHA- and DICER-dependent process from pri- miRNAs first to pre-miRNAs and then to mature miRNAs have not been completely elucidated [161-164]. In this chapter, DICER-associated or DGCR8- associated proteins were studied by LC-MS/MS following immunoprecipitation with Flag-DICER or Flag-DGCR8. Among the identified proteins, nucleolin (NCL), a major nucleolar protein often up-regulated in cancer, was detected and confirmed as a component of the DROSHA-DGCR8 complex by coimmunoprecipitation experiments, as previously reported [148]. Further research was focused on this RNA-binding protein NCL to characterize its role in miRNA biogenesis. Experimental data showed NCL regulates the biogenesis of a specific cohort of miRNAs. Notably, NCL-targeted miRNAs, such as miR-21, miR-221, miR-222, miR-103 and miR-10a, have been extensively implicated in cancer initiation, progression and drug resistance. Since miRNA level modulation as a therapeutic approach has been considered challenging so far, these findings could have a strong clinical impact on the development of future miRNA-based anti-cancer therapies.

5.2 Experimental

5.2.1 Cell lines

HEK-293 and HeLa cells were cultured in Dulbecco’s Modified Eagle Medium

(DMEM) with 10% FBS, L-glutamine, and antibiotics (Life Technologies;

124

Invitrogen). MCF-7 cells were grown in Eagle’s Minimum Essential Medium

(MEM) supplemented with 10% FBS, L-glutamine, antibiotics, 0.01 mg/mL bovine insulin and 100 nM Fulvestrant [165]. Cell lines were purchased from ATCC and cultured in a humidified atmosphere containing 5% CO2.

5.2.2 Immunoprecipitation and western blot

1-2 mg of total protein extracts (either HeLa or HEK-293 cells) were collected at

72 hours after transfection with protein expression plasmids or siRNAs as indicated, and immunoprecipitated with anti-Flag (SIGMA #A2220-5 mL) or anti- cMyc (SIGMA #E6654-1 mL) specific resins overnight at 4 °C in rotation.In the biotinylated oligo pull-down assay, 10 mg of HEK-293 whole cell lysate was incubated with 100 nM biotinylated pre-miR-21, mature miR-21 or poly-A overnight at 4 °C in rotation. At the end of the incubation, Streptavidin-Agarose resins were added to the reactions for 1 hr in rotation. Oligonucleotides used for the pull-down assay are listed in Table 5.1.

Table 5.1 Oligonucleotides used for the pull-down assay.

Name Sequence

Biotinylated Poly-A Biotin 5’-AAAAAAAAAAAAAAA-3’ Biotin 5’-UGUCGGGUAGCUUAUCAGACUGAUGUUG Biotinylated pre-miR-21 ACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGG CUGUCUGACA-3’ Biotinylated miR-21 Biotin 5’-UAGCUUAUCAGACUGAUGUUGA-3’

125

Immunoprecipitates were washed three times with lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% Glycerol and 0.5% NP-40). After the last wash the resin of each sample for both experiments was suspended in SDS-buffer and boiled for 10 min before loading on 4-20% SDS-PAGE gradient gel. Proteins on the gel were electroblotted onto Nitrocellulose membranes, and probed with antibodies as indicated, following standard western blot procedures [148].

Flag-DGCR8 and cMyc-Drosha were provided by Addgene (Addgene # 10921 and #10828). Anti-NCL (sc-56640), anti-hnRNP-U (sc-32315), anti-DICER (sc-

136981) and anti-cMYC (sc-40-HRP) were purchased from Santa Cruz

Biotechnology. Anti-DROSHA (ab12286-200) was purchased from Abcam. Anti-

Flag (F1804) and anti-ACTIN (A2228) were from SIGMA.

5.2.3 In-gel tryptic digestion

The gel bands were visualized by Coomassie blue staining. Each of the gel bands separated by SDS-PAGE was excised and cut into approximately 1 mm ×

1 mm pieces. The gel pieces were washed twice (1 hr each) in a freshly made solution (methanol: acetic acid: water = 50:5:45). After the gel pieces were dehydrated with ACN for 5 min, 5 mM dithiothreitol was added and incubated for

30 min at room temperature to reduce the disulfide bonds. The proteins were then alkylated by the addition of 15 mM iodoacetamide for 30 min at room temperature in the dark, followed by two cycles of rehydration with 100 mM

126

The digestion was performed at 37 °C for 2 hours. Finally, the digested peptides were extracted with 30-40 µL extraction solution (ACN: formic acid: water =

50:5:45) three times. The extract was dried completely in a SpeedVac concentrator and redissolved in 10 µL of HPLC water.

5.2.4 LC-MS/MS analysis

The in-gel tryptic digests of each band were characterized by capillary LC-

MS/MS analysis performed on a Dionex Ultamate 3000 HPLC instrument

(Dionex) and a Thermo Fisher LTQ Orbitrap XL (Thermo Finnigan) equipped with a microspray ionization source (Michrom Bioresources). Peptides were desalted and preconcentrated on a trap column (C18, 300 μm × 5 mm, 5 µm, 100 Å,

Dionex) for 10 min with loading buffer (0.03% TFA in the solvent of 2% ACN and

98% water) at a flow rate of 20 μL/min and then eluted on an analytical column

(magic C18, 0.2 mm × 150 mm, 3 µm, 200 Å, Michrom Bioresources) using mobile phase A (0.1% formic acid in water) and mobile phase B (0.1% formic acid in ACN) at a flow rate of 2 µL/min with a linear gradient (mobile phase B increased from 2% to 5% in 10 min, 5% to 15% in 20 min, 15% to 30% in 45 min,

30% to 50% in 15 min, 50% to 90% in 5 min). The separation system was

127

washed 2X between each sample in order to reduce sample carryover. 10 μL of the digests was injected onto the column for each band. The electrospray voltage was maintained at 2.2 kV and the capillary temperature was set at 175 °C. Profile

MS1 scans were collected at high mass accuracy using the Orbitrap mass analyzer (preview mode enabled, mass range = 300-2000 m/z, resolution =

60,000). Data-dependent MS2 scans were collected in centroid mode using the

LTQ mass analyzer. Five data-dependent MS/MS scans were acquired during each MS1 scan (collision energy = 35%; dynamic exclusion settings: repeat count = 2, repeat duration = 20 s, exclusion duration = 60 s). All data were acquired in positive ion mode. All the mass spectral data were searched against the MassMatrix database search program [12]. False discovery rates were estimated using the target-decoy strategy and subjected to manual validation [99].

5.2.5 Transfections with siRNAs

In order to transiently silence the expression of human NCL, Dicer and Drosha, siRNAs, consisting of a pool of three to five target-specific 19-25 nt siRNAs, were purchased from Santa Cruz Biotechnology and transfected at a final concentration of 100 nM. Used siRNAs were: NCL siRNA (sc-29230), Dicer siRNA (sc-40489) and RNase III Drosha siRNA (sc-44080). Control siRNA-A (sc-

37007) was used as negative control. All the transfections were performed by using Lipofectamine 2000 (Invitrogen), as suggested by the manufacturer.

128

5.2.6 miRNA profiling

HeLa cells were transiently transfected with either siRNA against NCL or siRNA control. Total RNA was extracted using Trizol solution (Invitrogen). The RNA was analyzed by NanoString assay, a novel digital technology, performed as described [166].

5.2.7 Northern blot

Total RNA was extracted with Trizol solution (Invitrogen) and the integrity of RNA was assessed with an Agilent BioAnalizer 2100 (Agilent). Northern blot was performed as described [155]. The oligonucleotides used as probes were the complementary sequences of the mature miRNA (miRNA Registry). All images were acquired using Typhoon 9200 Scanner.

5.2.8 Bioinformatic analysis

The samples analyzed by NanoString assay were normalized using the Variance

Stabilization Normalization. The Average Linkage hierarchical clustering algorithm was conducted to identify subgroups of significant miRNAs [167].

These results have been obtained using both the Rank Product package

(v.2.16.0) of the BioConductor Library under the R system and the Rank Product library in connection to the cluster analysis module of the Tmev system [168].

129

5.3 Results

5.3.1 NCL is a component of the miRNA-processing complex

To identify new molecular players potentially involved in miRNA biogenesis, LC-

MS/MS was used to analyze DGCR8 immunopurified protein complex and

DICER immunopurified protein complex in HEK-293 cell lysates. By targeting

DGCR8 with anti-Flag-DGCR8, the entire protein complex was pulled out of the whole cell lysate. Other unknown members of the protein complex were identified by LC-MS/MS following SDS-PAGE protein analysis and in-gel tryptic digestion.

The same process was performed for the DICER containing protein complex in

HEK-293 cell lysate.

Figure 5.1 shows the Coomassie blue stained gel of the Flag-DGCR8 pull-down and the Flag-DICER pull-down. Gel bands 1-13 were selected for the DGCR8 containing protein complex. Gel bands 14-24 were cut for the Flag-DICER immunopurified protein complex. The in-gel tryptic digests of each band were characterized by capillary LC-MS/MS analysis. Mass spectra were collected on an LTQ Orbitrap XL or an LCQ Deca XP. All the mass spectral data were searched by the MassMatrix database search program. The LCQ Deca XP is routinely used to run in-gel digests and obtain protein identification. For the gel bands of particular interest (gel band 3, 4, 14, 17 and their corresponding control bands), however, the high resolution and high mass accuracy mass spectrometer

LTQ-Orbitrap was used. High mass accuracy allows for high confidence in

130

protein identification. High resolution resolves peaks with small m/z differences, provides better detection of low abundant analytes and improves sensitivity.

131

Figure 5.1 SDS-PAGE analysis of DICER-associated and DGCR8-associated proteins in HEK-293 cell extracts. 28 gel bands (24 gel bands labeled above and the corresponding control gel bands for gel band 3, 4, 14, and 17) were cut and in-gel digested with trypsin followed by bottom-up LC-MS/MS proteomic identification.

132

Notably, NCL was identified in both protein complexes (Figure 5.1, gel band 4 and 17). NCL was consistently identified in triplicate bottom-up LC-MS/MS proteomic analysis of DGCR8 or DICER coimmunoprecipitation experiments. In the validation experiments only the gel bands associated with NCL, DGCR8 and

DICER were excised and in-gel digested. The protein identification data for NCL,

DGCR8 and DICER are summarized in Table 5.2. Figure 5.2 summarizes sequence coverage for NCL obtained from the DGCR8 and DICER IPs. Greater than 30% sequence coverage as well as multiple peptide identifications were obtained for NCL in both experiments. The MS results were then validated by western blot analysis as shown in Figure 5.3. These data confirmed that NCL is an integral component of the DGCR8-DROSHA complex in HEK-293 cells as previously reported [148].

Table 5.2 Protein identification and assignment for gel band 3, 4, 14, and 17 on Figure 5.1 by LC-MS/MS. Mass spectra were collected on an LTQ Orbitrap XL. The mass spectral data were searched by the MassMatrix database search program. Protein scores indicate overall match quality of protein matches. Sequence coverage is the percentage of amino acid residues covered by peptide matches of the protein. Three independent experiments were performed and the best set was shown as below.

Gel IP Protein Length Protein Sequence M.W. (Da) band experiment name (a.a.) score coverage 3 DGCR8 86045 773 2008 52% DGCR8 IP 4 Nucleolin 76343 707 646 31% 14 DICER 217627 1912 1832 42% DICER IP 17 Nucleolin 76343 707 1174 36%

* For the corresponding control bands only background keratin was detected.

133

(A)

(B)

Figure 5.2 (A) MassMatrix result for band 4 in Figure 5.1. Several peptides (indicated in color) covering 31% of the entire sequence of NCL (707 residues) were identified by LC-MS/MS. (B) MassMatrix result for band 17 in Figure 5.1. Several peptides (indicated in color) covering 36% of the entire sequence of NCL (707 residues) were identified by LC-MS/MS. The color tag means an amino acid residue is covered by one or more peptide matches. A green/blue tag represents the mass difference of a pair of consecutive y/b ions equals the mass of the amino acid residue. (Red tag = green tag + blue tag).

134

Figure 5.3 Identification of NCL as a component of the microprocessor complex or pri-miRNA processing protein complex composed of DGCR8 and DROSHA in HEK-293 cells. (A): Western blot analysis (using the indicated antibodies) after anti-Flag-DGCR8 immunoprecipitation of HEK-293 cell.extracts. Specificity was shown by same immunoblot analysis after IgG pull-down of HEK-293 cell.extracts. Sample quality was shown by western blot analysis using anti-Flag- DGCR8 and anti-NCL of total extracts from HEK-293 cells. (B): Western blot analysis (using the indicated antibodies) after anti-Myc-DROSHA immunoprecipitation of HEK-293 cell.extracts. Specificity was shown by same immunoblot analysis after IgG pull-down of HEK-293 cell.extracts. Sample quality was shown by western blot analysis using anti-Myc-DROSHA and anti-NCL of total extracts from HEK-293 cells.

135

5.3.2 NCL affects the expression of a specific set of miRNAs

NCL is a highly conserved nucleo-cytoplasmic multifunctional protein, abundantly expressed in the nucleolus [169]. This protein is composed of three main domains: a N-terminal domain rich in acidic residues, a central domain containing four consensus RNA-binding motifs (cs-RBD), and a C-terminal domain rich in arginine and glycine residues [170]. In the nucleolus, NCL is associated with chromatin structure, recombinant DNA (rDNA) transcription, ribosomal RNA

(rRNA) maturation, mRNA translation, ribosome assembly and nucleo- cytoplasmic transport [170-176].

NCL has also been found on the cell surface, where it serves as an anchor protein for specific ligands [177-180]. Several studies have demonstrated its localization on the surface of different types of cancer cells, but not on their normal counterparts [166, 181-183]. These findings support the idea that NCL might be considered a cancer cell-specific receptor, able to mediate tumor- selective uptake of specific molecules. The importance of NCL in cancer biology was recently highlighted by studies showing that NCL plays a critical role in tumorigenesis and angiogenesis [182, 184-188].

Although interaction between NCL and the microprocessor complex has been noted previously [148], no further studies have been performed regarding the possible involvement of NCL in miRNA regulation. To examine whether NCL

136

affects miRNA expression, a biotinylated oligo pull-down assay and MS analysis were used to demonstrate the interaction between NCL and pre-miR-21 in HEK-

293 cells (Figure 5.4A and Figure 5.5). These experiments showed no association between NCL and mature miR-21 or poly-A RNA, NCL was only pulled down in the pre-miR complex. Immunoblot experiments confirmed this result (Figure 5.4B). The interaction between NCL with pre-miRNAs suggests its potential involvement in miRNA maturation.

137

Figure 5.4 NCL interacts with pre-miR-21 in HEK-293 cells. (A): Coomassie blue stained gel of 5’-biotinylated-oligos pull-down after incubation with HEK-293 whole cell lysate. Two bands, corresponding to proteins having a molecular weight of about 100 kDa or 75 kDa, present only in the pre-miR-21 pull-down (P.D.), were cut and in-gel digested with trypsin followed by bottom-up LC- MS/MS proteomic identification. (B): Anti-NCL western blot following 5’- biotinylated-oligos pull-down after incubation with HEK-293 whole cell lysate shows specific interaction of NCL with pre-miR-21 but not with either mature miR-21 or poly-A.

138

(A)

(B)

Figure 5.5 (A) MassMatrix result for band1 in Figure 5.4A. Several peptides (indicated in color) covering 34% of the entire sequence of NCL (707 residues) were identified in two independent experiments by LC-MS/MS. (B) MassMatrix result for band2 in Figure 5.4A. Several peptides (indicated in color) covering 21% of the entire sequence of NCL (707 residues) were identified in two independent experiments by LC-MS/MS. The color tag means an amino acid residue is covered by one or more peptide matches. A green/blue tag represents the mass difference of a pair of consecutive y/b ions equals the mass of the amino acid residue. (Red tag = green tag + blue tag).

139

To investigate the effect of NCL on miRNA expression, analysis of miRNA levels was carried out using NanoString profiling by our collaborator (Dr. Flavia Pichiorri)

[189] (Figure 5.6). Transient NCL knockdown (Figure 5.7) in HeLa cells significantly reduced (>1.5-fold, p<0.05) the expression of 31 miRNAs (Figure

5.6B, 5.6C).

In accord with the miR profile data, northern blot analysis in HeLa cells confirmed that mature miR-21, -10a, -221, -222 and -103 levels were reduced upon NCL knockdown, whereas miR-155 and miR-30a were unaffected (Figure 5.7).

Furthermore, northern blot analysis in HEK-293 cells showed that the down regulation of mature miR-221, -222 and -103, but not of miR-155, upon NCL knockdown. This result was comparable to the effects of the silencing of each component (DROSHA or DICER) in the miRNA-processing complex (Figure 5.8).

A decrease of miR-21 and -103, but not miR-30a was also observed in MCF-7 cells following NCL knockdown (Figure 5.9). Thus, the data indicated that NCL could be involved in the regulation of this group of miRNAs in various cell types.

140

Figure 5.6 NCL specifically regulates the expression of specific miRNAs in HeLa cells. (A): Representation of NanoString's miRNA technology based on the ligation of miRNAs to a specific miRtag avoiding amplification step for the detection. (B): Overview of two-way (miRNAs against samples) hierarchical cluster (Pearson Correlation Distance) of HeLa cells transfected with NCL siRNA (si-NCL) (biological triplicate) and control (si-Scr) (biological triplicate) using the miRNAs that vary the most between samples. As shown, the clustering is mainly determined by the NCL down-regulation (si-NCL) or its normal expression (si- Scr). (C): Human miRNAs whose expression was reduced by more than 1.5 fold (p-value< 0.05) following NCL knockdown. 141

Figure 5.7 Effect of NCL knockdown on mature miRNA levels in HeLa cells. Western blot analysis using anti-DICER, anti-DROSHA, anti-NCL, and anti-β- ACTIN of total extracts from HeLa cells transiently transfected with either scrambled sequence (si-Scr) or NCL siRNA (si-NCL). Northern blot analysis of endogenous miR-21, miR-10a, miR-221, miR-222, miR-103, miR-155 and miR- 30a from HeLa cells transfected as indicated. RNU6 expression was used for normalization. All experiments reported are representative of at least three independent experiments.

142

Figure 5.8 Effect of NCL knockdown on mature miRNA levels in HEK-293 cells. Western blot analysis using anti-DICER, anti-DROSHA, anti-NCL, and anti-β- ACTIN of total extracts from HEK-293 cells transiently transfected with scrambled sequence (si-Scr), NCL siRNA (si-NCL), DROSHA siRNA (si-DROSHA) or DICER siRNA (si-DICER). Northern blot analysis of endogenous miR-222, miR- 221, miR-103 and miR-155 from HEK-293 cells transfected as indicated. RNU6 expression was used for normalization. All experiments are representative of at least three independent experiments.

143

Figure 5.9 Effect of NCL knockdown on mature miRNA levels in MCF-7 cells. Western blot analysis using anti-DICER, anti-DROSHA, anti-NCL, and anti-β- ACTIN of total extracts from MCF-7 cells transiently transfected with either scrambled sequence (si-Scr) or NCL siRNA (si-NCL). Northern blot analysis of endogenous miR-21, miR-103 and miR-30a from MCF-7 cells transfected as indicated. RNU6 expression was used for normalization. All experiments reported are representative of at least three independent experiments.

144

5.4 Conclusion

The RNA binding protein NCL is a major component of the nuclear processing complex involved in the first step of the ribosomal RNA processing (pre-rRNA)

[171]. Here the evidence was provided that NCL is an important component of the miRNA-processing complex involved in the biogenesis of a subset of miRNAs.

The analysis of LC-MS/MS and western blot following immunoprecipitation experiment clearly indicated that NCL interacts with the DROHSA-DGCR8 complex. Moreover, the biotinylated oligo pull-down assay showed that NCL interacts with the precursor (pre-) forms of miRNAs, supporting its potential involvement in miRNA maturation. Additionally, the role of NCL in miRNA processing was investigated. By using a full-spectrum analysis of miRNA levels, it was demonstrated that abrogation of NCL expression affects a specific cohort of miRNAs, including miR-10a, miR-21, miR-103, miR-221 and miR-222. NCL is a key component for the biogenesis of a specific group of miRNAs.

145

6 Summary

A TFA-free histone separation method was developed, optimized using bovine histone standard and further applied to human cancer samples. In chapter 2, gradient program and flow rate were optimized on a capillary column and a nanoscale column respectively. Formic acid (0.1%, 0.2%, 0.4%, 0.5%, and 1%) and acetic acid (0.5% and 1%) were evaluated by comparing sensitivity, resolution and peak capacity. Formic acid (0.5%) gave the best separation performance and quality of MS data. Capillary separations of protein standards, histones extracted from primary CLL cells and histones from breast cancer cells were demonstrated. TFA-free capillary and nanoscale separations bring two advantages to LC-MS analysis of proteins. First, less sample is consumed and second, elimination of TFA adducts simplifies data analysis.

The research goals for chapter 3 are 1) to evaluate the distribution of nitration and nitrosylation of 6 Tyr residues on Tm, 2) to quantitatively measure the

146

modification on each Tyr residue. To reach the research goal, two targeted mass spectrometry methods were developed. First, DDTRM was designed to supply a bridge from target driven discovery to target drive quantitation. DDTRM analysis was performed using an LTQ-Orbitrap mass spectrometer to take advantage of its high mass resolution and high mass accuracy. A recursive process was used to optimize the target inclusion list. Second, TRM was developed on an LTQ mass spectrometer with the optimized target list. By eliminating the full MS scan and the threshold requirements, sensitivity, LOD and LOQ were improved.

DDTRM data was also carried out to enhance the accuracy of quantitative analysis. The methods described within provide means for detecting low abundance protein modifications, such as nitration, induced during ischemic heart disease. Utilizing this approach will allow for greater understanding of the mechanisms underlying Tm nitration in cardiac disease. While this method has been applied to the detection of low abundance nitration of Tm, the true strength lies within the ability to detect other low abundance protein post-translational modifications not only in cardiac disease, but other pathophysiological systems as well.

147

Phosphotyrosine (pTyr) protein enrichment was used in chapter 4 to assist the identification of new potentially druggable targets in FLT3 internal tandem duplication (FLT3 ITD) driven acute myeloid leukemia (AML). This study is a proof of principle, showing that the technique of optimized phosphotyrosine protein enrichment is capable of identifying possible new targets of active phosphorylation and possible new drug targets in AML. Furthermore this chapter revealed a previously unrecognized network that involves the tyrosine kinase receptor FLT3 and protein MHY9. This interaction may favorably contribute to the development of AML treatments.

DICER-associated or DGCR8-associated proteins were studied in chapter 5 by

LC-MS/MS following immunoprecipitation with Flag-DICER or Flag-DGCR8.

Among the identified proteins, nucleolin (NCL), a major nucleolar protein often up-regulated in cancer, was detected and confirmed as a component of the

DROSHA-DGCR8 complex by coimmunoprecipitation experiments, as previously reported. The evidence was provided that NCL is an important component of the miRNA-processing complex involved in the biogenesis of a subset of miRNAs.

148

involvement in miRNA maturation. Additionally, the role of NCL in miRNA processing was investigated. By using a full-spectrum analysis of miRNA levels, it was demonstrated that abrogation of NCL expression affects a specific cohort of miRNAs, including miR-10a, miR-21, miR-103, miR-221 and miR-222. NCL is a key component for the biogenesis of a specific group of miRNAs.

149

References

[1] Yates, J. R., Ruse, C. I., Nakorchevsky, A., Proteomics by mass spectrometry: approaches, advances, and applications. Annu Rev Biomed Eng 2009, 11, 49-79. [2] Alessandro, R., Fontana, S., Kohn, E., De Leo, G., Proteomic strategies and their application in cancer research. Tumori 2005, 91, 447-455. [3] Christofori, G., New signals from the invasive front. Nature 2006, 441, 444-450. [4] Yarmush, M. L., Jayaraman, A., Advances in proteomic technologies. Annu Rev Biomed Eng 2002, 4, 349-373. [5] You, J., Wang, L., Saji, M., Olesik, S. V., et al., High-sensitivity TFA-free LC-MS for profiling histones. Proteomics 2011, 11, 3326-3334. [6] Yu, J. M., Wu, X., Gimble, J. M., Guan, X., et al., Age-related changes in mesenchymal stem cells derived from rhesus macaque bone marrow. Aging Cell 2011, 10, 66-79. [7] Yang, L., Tu, S., Ren, C., Bulloch, E. M., et al., Unambiguous determination of isobaric histone modifications by reversed-phase retention time and high-mass accuracy. Anal Biochem 2010, 396, 13-22. [8] Wang, L., Harshman, S. W., Liu, S., Ren, C., et al., Assaying pharmacodynamic endpoints with targeted therapy: flavopiridol and 17AAG induced dephosphorylation of histone H1.5 in acute myeloid leukemia. Proteomics 2010, 10, 4281-4292. [9] Su, X., Lucas, D. M., Zhang, L., Xu, H., et al., Validation of an LC-MS based approach for profiling histones in chronic lymphocytic leukemia. Proteomics 2009, 9, 1197-1206. [10] Su, X., Jacob, N. K., Amunugama, R., Hsu, P. H., et al., Enrichment and characterization of histones by two-dimensional hydroxyapatite/reversed- phase liquid chromatography-mass spectrometry. Anal Biochem 2009, 388, 47-55. [11] Xu, H., Wang, L., Sallans, L., Freitas, M. A., A hierarchical MS2/MS3 database search algorithm for automated analysis of phosphopeptide tandem mass spectra. Proteomics 2009, 9, 1763-1770.

150

[12] Xu, H., Freitas, M. A., MassMatrix: a database search program for rapid characterization of proteins and peptides from tandem mass spectrometry data. Proteomics 2009, 9, 1548-1555. [13] Xu, H., Freitas, M. A., Automated diagnosis of LC-MS/MS performance. Bioinformatics 2009, 25, 1341-1343. [14] Freitas, M. A., Sklenar, A. R., Parthun, M. R., Application of mass spectrometry to the identification and quantification of histone post- translational modifications. J Cell Biochem 2004, 92, 691-700. [15] Lapalombella, R., Yeh, Y. Y., Wang, L., Ramanunni, A., et al., Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. Cancer Cell 2012, 21, 694-708. [16] Palamarchuk, A., Yan, P. S., Zanesi, N., Wang, L., et al., Tcl1 protein functions as an inhibitor of de novo DNA methylation in B-cell chronic lymphocytic leukemia (CLL). Proc Natl Acad Sci U S A 2012, 109, 2555- 2560. [17] de Hoffmann, E., Stroobant, V., Mass spectrometry : principles and applications, John Wiley & Sons Ltd., West Sussex 2007. [18] Hillenkamp, F., Karas, M., Mass spectrometry of peptides and proteins by matrix-assisted ultraviolet laser desorption/ionization. Methods Enzymol 1990, 193, 280-295. [19] Hillenkamp, F., Karas, M., Beavis, R. C., Chait, B. T., Matrix-assisted laser desorption/ionization mass spectrometry of biopolymers. Anal Chem 1991, 63, 1193A-1203A. [20] Karas, M., Hillenkamp, F., Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem 1988, 60, 2299- 2301. [21] Tanaka, K., The origin of macromolecule ionization by laser irradiation (Nobel lecture). Angew Chem Int Ed Engl 2003, 42, 3860-3870. [22] Fenn, J. B., Mann, M., Meng, C. K., Wong, S. F., Whitehouse, C. M., Electrospray ionization for mass spectrometry of large biomolecules. Science 1989, 246, 64-71. [23] Kruger, R., Pfenninger, A., Fournier, I., Gluckmann, M., Karas, M., Analyte incorporation and ionization in matrix-assisted laser desorption/ionization visualized by pH indicator molecular probes. Anal Chem 2001, 73, 5812- 5821. [24] Dreisewerd, K., The desorption process in MALDI. Chem Rev 2003, 103, 395-426. [25] Knochenmuss, R., A quantitative model of ultraviolet matrix-assisted laser desorption/ionization. J Mass Spectrom 2002, 37, 867-877. 151

[26] Karas, M., Kruger, R., Ion formation in MALDI: the cluster ionization mechanism. Chem Rev 2003, 103, 427-440. [27] Latham, J., Roxburgh, I. W., Disintegration of Pairs of Water Drops in an Electric Field. Proc R Soc Lon Ser-A 1966, 295, 84-&. [28] Felitsyn, N., Peschke, M., Kebarle, P., Origin and number of charges observed on multiply-protonated native proteins produced by ESI. Int J Mass Spectrom 2002, 219, 39-62. [29] Loscertales, I. G., Delamora, J. F., Experiments on the Kinetics of Field Evaporation of Small Ions from Droplets. J Chem Phys 1995, 103, 5041- 5060. [30] Thomson, B. A., Iribarne, J. V., Field-Induced Ion Evaporation from Liquid Surfaces at Atmospheric-Pressure. J Chem Phys 1979, 71, 4451-4463. [31] Griffin, P. R., Coffman, J. A., Hood, L. E., Yates, J. R., Structural-Analysis of Proteins by Capillary Hplc Electrospray Tandem Mass-Spectrometry. International Journal of Mass Spectrometry and Ion Processes 1991, 111, 131-149. [32] Emmett, M. R., Caprioli, R. M., Micro-Electrospray Mass-Spectrometry - Ultra-High-Sensitivity Analysis of Peptides and Proteins. J Am Soc Mass Spectr 1994, 5, 605-613. [33] Shen, Y. F., Moore, R. J., Zhao, R., Blonder, J., et al., High-efficiency online solid-phase extraction coupling to 15-150-mu m-id column liquid chromatography for proteomic analysis. Analytical Chemistry 2003, 75, 3596-3605. [34] Shen, Y. F., Zhao, R., Berger, S. J., Anderson, G. A., et al., High- efficiency nanoscale liquid chromatography coupled on-line with mass spectrometry using nanoelectrospray ionization for proteomics. Analytical Chemistry 2002, 74, 4235-4249. [35] Stafford, G. C., Kelley, P. E., Syka, J. E. P., Reynolds, W. E., Todd, J. F. J., Recent Improvements in and Analytical Applications of Advanced Ion Trap Technology. International Journal of Mass Spectrometry and Ion Processes 1984, 60, 85-98. [36] March, R. E., Quadrupole ion trap mass spectrometry: Theory, simulation, recent developments and applications. Rapid Commun Mass Sp 1998, 12, 1543-1554. [37] Londry, F. A., Wells, G. J., March, R. E., Enhanced Mass Resolution in a Quadrupole Ion Trap. Rapid Commun Mass Sp 1993, 7, 43-45. [38] March, R. E., Quadrupole Ion Traps. Mass Spectrom Rev 2009, 28, 961- 989.

152

[39] March, R. E., Todd, J. F. J., Quadrupole Ion Trap Mass Spectrometry Second Edition Preface. Chem Anal Series Mon 2005, 165, Xiii-Xviii. [40] March, R. E., Quadrupole ion trap mass spectrometry: a view at the turn of the century. Int J Mass Spectrom 2000, 200, 285-312. [41] March, R. E., Todd, J. F. J., Linear Quadrupole Ion Trap Mass Spectrometer. Chem Anal Series Mon 2005, 165, 161-187. [42] Michaud, A. L., Frank, A. J., Ding, C., Zhao, X., Douglas, D. J., Ion excitation in a linear quadrupole ion trap with an added octopole field. J Am Soc Mass Spectrom 2005, 16, 835-849. [43] Douglas, D. J., Frank, A. J., Mao, D. M., Linear ion traps in mass spectrometry. Mass Spectrom Rev 2005, 24, 1-29. [44] Makarov, A., Electrostatic axially harmonic orbital trapping: a high- performance technique of mass analysis. Anal Chem 2000, 72, 1156-1162. [45] Hu, Q., Noll, R. J., Li, H., Makarov, A., et al., The Orbitrap: a new mass spectrometer. J Mass Spectrom 2005, 40, 430-443. [46] Roepstorff, P., Fohlman, J., Proposal for a common nomenclature for sequence ions in mass spectra of peptides. Biomed Mass Spectrom 1984, 11, 601. [47] Johnson, R. S., Martin, S. A., Biemann, K., Stults, J. T., Watson, J. T., Novel fragmentation process of peptides by collision-induced decomposition in a tandem mass spectrometer: differentiation of leucine and isoleucine. Anal Chem 1987, 59, 2621-2625. [48] Biemann, K., Appendix 5. Nomenclature for peptide fragment ions (positive ions). Methods Enzymol 1990, 193, 886-887. [49] Henry, K. W., Berger, S. L., Trans-tail histone modifications: wedge or bridge? Nat Struct Biol 2002, 9, 565-566. [50] Inagaki, S., Nakamura, K., Morikami, A., A link among DNA replication, recombination, and gene expression revealed by genetic and genomic analysis of TEBICHI gene of Arabidopsis thaliana. PLoS Genet 2009, 5, e1000613. [51] Edmondson, D. G., Davie, J. K., Zhou, J., Mirnikjoo, B., et al., Site-specific loss of acetylation upon phosphorylation of histone H3. J Biol Chem 2002, 277, 29496-29502. [52] Lo, W. S., Trievel, R. C., Rojas, J. R., Duggan, L., et al., Phosphorylation of serine 10 in histone H3 is functionally linked in vitro and in vivo to Gcn5- mediated acetylation at lysine 14. Mol Cell 2000, 5, 917-926.

153

[53] Davie, J. K., Edmondson, D. G., Coco, C. B., Dent, S. Y., Tup1-Ssn6 interacts with multiple class I histone deacetylases in vivo. J Biol Chem 2003, 278, 50158-50162. [54] Zhang, L., Freitas, M. A., Wickham, J., Parthun, M. R., et al., Differential expression of histone post-translational modifications in acute myeloid and chronic lymphocytic leukemia determined by high-pressure liquid chromatography and mass spectrometry. J Am Soc Mass Spectrom 2004, 15, 77-86. [55] Su, X., Jacob, N. K., Amunugama, R., Lucas, D. M., et al., Liquid chromatography mass spectrometry profiling of histones. J Chromatogr B Analyt Technol Biomed Life Sci 2007, 850, 440-454. [56] Zhang, K., Tang, H., Analysis of core histones by liquid chromatography- mass spectrometry and peptide mapping. J Chromatogr B Analyt Technol Biomed Life Sci 2003, 783, 173-179. [57] Bonenfant, D., Coulot, M., Towbin, H., Schindler, P., van Oostrum, J., Characterization of histone H2A and H2B variants and their post- translational modifications by mass spectrometry. Mol Cell Proteomics 2006, 5, 541-552. [58] Apffel, A., Fischer, S., Goldberg, G., Goodley, P. C., Kuhlmann, F. E., Enhanced sensitivity for peptide mapping with electrospray liquid chromatography-mass spectrometry in the presence of signal suppression due to trifluoroacetic acid-containing mobile phases. J Chromatogr A 1995, 712, 177-190. [59] Eshraghi, J., Chowdhury, S. K., Factors affecting electrospray ionization of effluents containing trifluoroacetic acid for high-performance liquid chromatography/mass spectrometry. Analytical Chemistry 1993, 65, 3528- 3533. [60] Duchateau, A. L. L., Munsters, B. H. M., Kwakkenbos, G. T. C., Van Leuken, R. G. J., Selection of buffers and of an ion-pairing agent for thermospray liquid chromatographic--mass spectrometric analysis of ionic compounds. Journal of Chromatography A 1991, 552, 605-612. [61] Clarke, N. J., Crow, F. W., Younkin, S., Naylor, S., Analysis of in vivo- derived amyloid-beta polypeptides by on-line two-dimensional chromatography-mass spectrometry. Anal Biochem 2001, 298, 32-39. [62] Chong, B. E., Yan, F., Lubman, D. M., Miller, F. R., Chromatofocusing nonporous reversed-phase high-performance liquid chromatography/electrospray ionization time-of-flight mass spectrometry of proteins from human breast cancer whole cell lysates: a novel two- dimensional liquid chromatography/mass spectrometry method. Rapid Commun Mass Spectrom 2001, 15, 291-296.

154

[63] Garcia, M. C., The effect of the mobile phase additives on sensitivity in the analysis of peptides and proteins by high-performance liquid chromatography-electrospray mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 2005, 825, 111-123. [64] Cheson, B. D., Bennett, J. M., Grever, M., Kay, N., et al., National Cancer Institute-sponsored Working Group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment. Blood 1996, 87, 4990-4997. [65] Debnath, J., Muthuswamy, S. K., Brugge, J. S., Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three- dimensional basement membrane cultures. Methods 2003, 30, 256-268. [66] Sures, I., Gallwitz, D., Histone-specific acetyltransferases from calf thymus. Isolation, properties, and substrate specificity of three different enzymes. Biochemistry 1980, 19, 943-951. [67] Chadee, D. N., Hendzel, M. J., Tylipski, C. P., Allis, C. D., et al., Increased Ser-10 phosphorylation of histone H3 in mitogen-stimulated and oncogene-transformed mouse fibroblasts. J Biol Chem 1999, 274, 24914- 24920. [68] Garcia, M. C., Hogenboom, A. C., Zappey, H., Irth, H., Effect of the mobile phase composition on the separation and detection of intact proteins by reversed-phase liquid chromatography-electrospray mass spectrometry. J Chromatogr A 2002, 957, 187-199. [69] Nugent, K. D., Burton, W. G., Slattery, T. K., Johnson, B. F., Snyder, L. R., Separation of proteins by reversed-phase high-performance liquid chromatography. II. Optimizing sample pretreatment and mobile phase conditions. J Chromatogr 1988, 443, 381-397. [70] Kastner, M., Protein liquid chromatography, Elsevier, Amsterdam ; New York 2000. [71] McCalley, D. V., Effect of buffer on peak shape of peptides in reversed- phase high performance liquid chromatography. J Chromatogr A 2004, 1038, 77-84. [72] Krokhin, O. V., Sequence-specific retention calculator. Algorithm for peptide retention prediction in ion-pair RP-HPLC: application to 300- and 100-A pore size C18 sorbents. Anal Chem 2006, 78, 7785-7795. [73] Ren, C., Zhang, L., Freitas, M. A., Ghoshal, K., et al., Peptide mass mapping of acetylated isoforms of histone H4 from mouse lymphosarcoma cells treated with histone deacetylase (HDACs) inhibitors. J Am Soc Mass Spectrom 2005, 16, 1641-1653. [74] Zhang, K., Williams, K. E., Huang, L., Yau, P., et al., Histone acetylation and deacetylation: identification of acetylation and methylation sites of 155

HeLa histone H4 by mass spectrometry. Mol Cell Proteomics 2002, 1, 500-508. [75] Garcia, B. A., Mass spectrometric analysis of histone variants and post- translational modifications. Front Biosci (Schol Ed) 2009, 1, 142-153. [76] Zee, B. M., Levin, R. S., Dimaggio, P. A., Garcia, B. A., Global turnover of histone post-translational modifications and variants in human cells. Epigenetics Chromatin, 3, 22. [77] Phanstiel, D., Brumbaugh, J., Berggren, W. T., Conard, K., et al., Mass spectrometry identifies and quantifies 74 unique histone H4 isoforms in differentiating human embryonic stem cells. Proc Natl Acad Sci U S A 2008, 105, 4093-4098. [78] Shechter, D., Nicklay, J. J., Chitta, R. K., Shabanowitz, J., et al., Analysis of histones in Xenopus laevis. I. A distinct index of enriched variants and modifications exists in each cell type and is remodeled during developmental transitions. J Biol Chem 2009, 284, 1064-1074. [79] Nicklay, J. J., Shechter, D., Chitta, R. K., Garcia, B. A., et al., Analysis of histones in Xenopus laevis. II. mass spectrometry reveals an index of cell type-specific modifications on H3 and H4. J Biol Chem 2009, 284, 1075- 1085. [80] Fraga, M. F., Ballestar, E., Villar-Garea, A., Boix-Chornet, M., et al., Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat Genet 2005, 37, 391-400. [81] Lennartsson, A., Ekwall, K., Histone modification patterns and epigenetic codes. Biochim Biophys Acta 2009, 1790, 863-868. [82] Gupta, A., Guerin-Peyrou, T. G., Sharma, G. G., Park, C., et al., The mammalian ortholog of Drosophila MOF that acetylates histone H4 lysine 16 is essential for embryogenesis and oncogenesis. Mol Cell Biol 2008, 28, 397-409. [83] Yasmin, W., Strynadka, K. D., Schulz, R., Generation of peroxynitrite contributes to ischemia-reperfusion injury in isolated rat hearts. Cardiovascular research 1997, 33, 422-432. [84] Beckman, J. S., Oxidative damage and tyrosine nitration from peroxynitrite. Chemical research in toxicology 1996, 9, 836-844. [85] Ferdinandy, P., Schulz, R., Inhibition of peroxynitrite-induced dityrosine formation with oxidized and reduced thiols, nitric oxide donors, and purine derivatives. Antioxidants & redox signaling 2001, 3, 165-171. [86] Wang, P., Zweier, J. L., Measurement of nitric oxide and peroxynitrite generation in the postischemic heart. Evidence for peroxynitrite-mediated reperfusion injury. J Biol Chem 1996, 271, 29223-29230.

156

[87] Zou, M. H., Shi, C., Cohen, R. A., High glucose via peroxynitrite causes tyrosine nitration and inactivation of prostacyclin synthase that is associated with thromboxane/prostaglandin H(2) receptor-mediated apoptosis and adhesion molecule expression in cultured human aortic endothelial cells. Diabetes 2002, 51, 198-203. [88] MacMillan-Crow, L. A., Crow, J. P., Kerby, J. D., Beckman, J. S., Thompson, J. A., Nitration and inactivation of manganese superoxide dismutase in chronic rejection of human renal allografts. Proc Natl Acad Sci U S A 1996, 93, 11853-11858. [89] Mihm, M. J., Coyle, C. M., Schanbacher, B. L., Weinstein, D. M., Bauer, J. A., Peroxynitrite induced nitration and inactivation of myofibrillar creatine kinase in experimental heart failure. Cardiovascular research 2001, 49, 798-807. [90] Kanski, J., Behring, A., Pelling, J., Schoneich, C., Proteomic identification of 3-nitrotyrosine-containing rat cardiac proteins: effects of biological aging. American journal of physiology. Heart and circulatory physiology 2005, 288, H371-381. [91] Kanski, J., Hong, S. J., Schoneich, C., Proteomic analysis of protein nitration in aging skeletal muscle and identification of nitrotyrosine- containing sequences in vivo by nanoelectrospray ionization tandem mass spectrometry. J Biol Chem 2005, 280, 24261-24266. [92] Mihm, M. J., Bauer, J. A., Peroxynitrite-induced inhibition and nitration of cardiac myofibrillar creatine kinase. Biochimie 2002, 84, 1013-1019. [93] Hong, S. J., Gokulrangan, G., Schoneich, C., Proteomic analysis of age dependent nitration of rat cardiac proteins by solution isoelectric focusing coupled to nanoHPLC tandem mass spectrometry. Experimental gerontology 2007, 42, 639-651. [94] Kobayashi, T., Solaro, R. J., Calcium, thin filaments, and the integrative biology of cardiac contractility. Annual review of physiology 2005, 67, 39- 67. [95] Singh, A., Hitchcock-DeGregori, S. E., Local destabilization of the tropomyosin coiled coil gives the molecular flexibility required for actin binding. Biochemistry 2003, 42, 14114-14121. [96] Kwok, S. C., Hodges, R. S., Stabilizing and destabilizing clusters in the hydrophobic core of long two-stranded alpha-helical coiled-coils. The Journal of biological chemistry 2004, 279, 21576-21588. [97] Wolska, B. M., Wieczorek, D. M., The role of tropomyosin in the regulation of myocardial contraction and relaxation. Pflugers Archiv : European journal of physiology 2003, 446, 1-8.

157

[98] Nixon, B. R., Thawornkaiwong, A., Jin, J., Brundage, E. A., et al., AMP- activated Protein Kinase Phosphorylates Cardiac Troponin I at Ser-150 to Increase Myofilament Calcium Sensitivity and Blunt PKA-dependent Function. J Biol Chem 2012, 287, 19136-19147. [99] Elias, J. E., Gygi, S. P., Target-decoy search strategy for mass spectrometry-based proteomics. Methods Mol Biol 2010, 604, 55-71. [100] Siepen, J. A., Keevil, E. J., Knight, D., Hubbard, S. J., Prediction of missed cleavage sites in tryptic peptides aids protein identification in proteomics. J Proteome Res 2007, 6, 399-408. [101] Aebersold, R., Mann, M., Mass spectrometry-based proteomics. Nature 2003, 422, 198-207. [102] Delahunty, C., Yates, J. R., Protein identification using 2D-LC-MS/MS. Methods 2005, 35, 248-255. [103] Jaffe, J. D., Keshishian, H., Chang, B., Addona, T. A., et al., Accurate inclusion mass screening: a bridge from unbiased discovery to targeted assay development for biomarker verification. Mol Cell Proteomics 2008, 7, 1952-1962. [104] Spicer, V., Yamchuk, A., Cortens, J., Sousa, S., et al., Sequence-specific retention calculator. A family of peptide retention time prediction algorithms in reversed-phase HPLC: applicability to various chromatographic conditions and columns. Anal Chem 2007, 79, 8762- 8768. [105] Lin, S., Shaler, T. A., Becker, C. H., Quantification of intermediate- abundance proteins in serum by multiple reaction monitoring mass spectrometry in a single-quadrupole ion trap. Anal Chem 2006, 78, 5762- 5767. [106] Madalinski, G., Godat, E., Alves, S., Lesage, D., et al., Direct introduction of biological samples into a LTQ-Orbitrap hybrid mass spectrometer as a tool for fast metabolome analysis. Anal Chem 2008, 80, 3291-3303. [107] Yan, W., Luo, J., Robinson, M., Eng, J., et al., Index-ion triggered MS2 ion quantification: a novel proteomics approach for reproducible detection and quantification of targeted proteins in complex mixtures. Mol Cell Proteomics 2011, 10, M110 005611. [108] Hewel, J. A., Liu, J., Onishi, K., Fong, V., et al., Synthetic peptide arrays for pathway-level protein monitoring by liquid chromatography-tandem mass spectrometry. Mol Cell Proteomics 2010, 9, 2460-2473. [109] Sandhu, C., Hewel, J. A., Badis, G., Talukder, S., et al., Evaluation of data-dependent versus targeted shotgun proteomic approaches for monitoring transcription factor expression in breast cancer. J Proteome Res 2008, 7, 1529-1541. 158

[110] Kulasingam, V., Smith, C. R., Batruch, I., Buckler, A., et al., "Product ion monitoring" assay for prostate-specific antigen in serum using a linear ion- trap. J Proteome Res 2008, 7, 640-647. [111] Souza, J. M., Daikhin, E., Yudkoff, M., Raman, C. S., Ischiropoulos, H., Factors determining the selectivity of protein tyrosine nitration. Archives of biochemistry and biophysics 1999, 371, 169-178. [112] Sokolovsky, M., Riordan, J. F., Vallee, B. L., Tetranitromethane. A reagent for the nitration of tyrosyl residues in proteins. Biochemistry 1966, 5, 3582- 3589. [113] Souza, J. M., Peluffo, G., Radi, R., Protein tyrosine nitration--functional alteration or just a biomarker? Free radical biology & medicine 2008, 45, 357-366. [114] Bayden, A. S., Yakovlev, V. A., Graves, P. R., Mikkelsen, R. B., Kellogg, G. E., Factors influencing protein tyrosine nitration--structure-based predictive models. Free radical biology & medicine 2011, 50, 749-762. [115] Mak, A., Smillie, L. B., Barany, M., Specific phosphorylation at serine-283 of alpha tropomyosin from frog skeletal and rabbit skeletal and cardiac muscle. Proceedings of the National Academy of Sciences of the United States of America 1978, 75, 3588-3592. [116] deBelle, I., Mak, A. S., Isolation and characterization of tropomyosin kinase from chicken embryo. Biochimica et biophysica acta 1987, 925, 17- 26. [117] Coviello, D. A., Maron, B. J., Spirito, P., Watkins, H., et al., Clinical features of hypertrophic cardiomyopathy caused by mutation of a "hot spot" in the alpha-tropomyosin gene. Journal of the American College of Cardiology 1997, 29, 635-640. [118] Thierfelder, L., Watkins, H., MacRae, C., Lamas, R., et al., Alpha- tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell 1994, 77, 701-712. [119] Yamauchi-Takihara, K., Nakajima-Taniguchi, C., Matsui, H., Fujio, Y., et al., Clinical implications of hypertrophic cardiomyopathy associated with mutations in the alpha-tropomyosin gene. Heart 1996, 76, 63-65. [120] Golitsina, N., An, Y., Greenfield, N. J., Thierfelder, L., et al., Effects of two familial hypertrophic cardiomyopathy-causing mutations on alpha- tropomyosin structure and function. Biochemistry 1999, 38, 3850. [121] Heeley, D. H., Watson, M. H., Mak, A. S., Dubord, P., Smillie, L. B., Effect of phosphorylation on the interaction and functional properties of rabbit striated muscle alpha alpha-tropomyosin. The Journal of biological chemistry 1989, 264, 2424-2430.

159

[122] Tripet, B., Wagschal, K., Lavigne, P., Mant, C. T., Hodges, R. S., Effects of side-chain characteristics on stability and oligomerization state of a de novo-designed model coiled-coil: 20 amino acid substitutions in position "d". Journal of molecular biology 2000, 300, 377-402. [123] Wagschal, K., Tripet, B., Lavigne, P., Mant, C., Hodges, R. S., The role of position a in determining the stability and oligomerization state of alpha- helical coiled coils: 20 amino acid stability coefficients in the hydrophobic core of proteins. Protein science : a publication of the Protein Society 1999, 8, 2312-2329. [124] Monteiro, H. P., Signal transduction by protein tyrosine nitration: competition or cooperation with tyrosine phosphorylation-dependent signaling events? Free radical biology & medicine 2002, 33, 765-773. [125] Sumida, J. P., Wu, E., Lehrer, S. S., Conserved Asp-137 imparts flexibility to tropomyosin and affects function. The Journal of biological chemistry 2008, 283, 6728-6734. [126] Oguchi, Y., Ishizuka, J., Hitchcock-DeGregori, S. E., Ishiwata, S., Kawai, M., The role of tropomyosin domains in cooperative activation of the actin- myosin interaction. Journal of molecular biology 2011, 414, 667-680. [127] Mirza, M., Marston, S., Willott, R., Ashley, C., et al., Dilated cardiomyopathy mutations in three thin filament regulatory proteins result in a common functional phenotype. The Journal of biological chemistry 2005, 280, 28498-28506. [128] Wieczorek, D. F., Jagatheesan, G., Rajan, S., The role of tropomyosin in heart disease. Advances in experimental medicine and biology 2008, 644, 132-142. [129] Howlader N, N. A., Krapcho M, Neyman N, Aminou R, Altekruse SF, Kosary CL, Ruhl J, Tatalovich Z, Cho H, Mariotto A, Eisner MP, Lewis DR, Chen HS, Feuer EJ, Cronin KA (eds). (Ed.), SEER Cancer Statistics Review, 1975-2009 (Vintage 2009 Populations),, National Cancer Institute, Bethesda 2012. [130] Shen, Y., Zhu, Y. M., Fan, X., Shi, J. Y., et al., Gene mutation patterns and their prognostic impact in a cohort of 1185 patients with acute myeloid leukemia. Blood, 118, 5593-5603. [131] Takahashi, S., Current findings for recurring mutations in acute myeloid leukemia. J Hematol Oncol, 4, 36. [132] Dosil, M., Wang, S., Lemischka, I. R., Mitogenic signalling and substrate specificity of the Flk2/Flt3 receptor tyrosine kinase in fibroblasts and interleukin 3-dependent hematopoietic cells. Mol Cell Biol 1993, 13, 6572- 6585.

160

[133] Rosnet, O., Buhring, H. J., deLapeyriere, O., Beslu, N., et al., Expression and signal transduction of the FLT3 tyrosine kinase receptor. Acta Haematol 1996, 95, 218-223. [134] Zhang, S., Fukuda, S., Lee, Y., Hangoc, G., et al., Essential role of signal transducer and activator of transcription (Stat)5a but not Stat5b for Flt3- dependent signaling. J Exp Med 2000, 192, 719-728. [135] Buchwald, M., Pietschmann, K., Muller, J. P., Bohmer, F. D., et al., Ubiquitin conjugase UBCH8 targets active FMS-like tyrosine kinase 3 for proteasomal degradation. Leukemia, 24, 1412-1421. [136] Lyman, S. D., Seaberg, M., Hanna, R., Zappone, J., et al., Plasma/serum levels of flt3 ligand are low in normal individuals and highly elevated in patients with Fanconi anemia and acquired aplastic anemia. Blood 1995, 86, 4091-4096. [137] Nakao, M., Yokota, S., Iwai, T., Kaneko, H., et al., Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia 1996, 10, 1911-1918. [138] Govedarovic, N., Marjanovic, G., Frequency and prognostic impact of FLT3/ITD mutation in patients with acute myeloid leukaemia. J Buon, 16, 108-111. [139] Haferlach, T., Bacher, U., Alpermann, T., Haferlach, C., et al., Amount of bone marrow blasts is strongly correlated to NPM1 and FLT3-ITD mutation rate in AML with normal karyotype. Leuk Res, 36, 51-58. [140] Yanada, M., Matsuo, K., Suzuki, T., Kiyoi, H., Naoe, T., Prognostic significance of FLT3 internal tandem duplication and tyrosine kinase domain mutations for acute myeloid leukemia: a meta-analysis. Leukemia 2005, 19, 1345-1349. [141] Ravandi, F., Kantarjian, H., Faderl, S., Garcia-Manero, G., et al., Outcome of patients with FLT3-mutated acute myeloid leukemia in first relapse. Leuk Res, 34, 752-756. [142] Levis, M., Ravandi, F., Wang, E. S., Baer, M. R., et al., Results from a randomized trial of salvage chemotherapy followed by lestaurtinib for patients with FLT3 mutant AML in first relapse. Blood, 117, 3294-3301. [143] Knapper, S., Burnett, A. K., Littlewood, T., Kell, W. J., et al., A phase 2 trial of the FLT3 inhibitor lestaurtinib (CEP701) as first-line treatment for older patients with acute myeloid leukemia not considered fit for intensive chemotherapy. Blood 2006, 108, 3262-3270. [144] Fischer, T., Stone, R. M., Deangelo, D. J., Galinsky, I., et al., Phase IIB trial of oral Midostaurin (PKC412), the FMS-like tyrosine kinase 3 receptor (FLT3) and multi-targeted kinase inhibitor, in patients with acute myeloid

161

leukemia and high-risk myelodysplastic syndrome with either wild-type or mutated FLT3. J Clin Oncol, 28, 4339-4345. [145] DeAngelo, D. J., Stone, R. M., Heaney, M. L., Nimer, S. D., et al., Phase 1 clinical results with tandutinib (MLN518), a novel FLT3 antagonist, in patients with acute myelogenous leukemia or high-risk myelodysplastic syndrome: safety, pharmacokinetics, and pharmacodynamics. Blood 2006, 108, 3674-3681. [146] Xia, Z. K., Yuan, Y. C., Yin, N., Yin, B. L., et al., Nonmuscle myosin IIA is associated with poor prognosis of esophageal squamous cancer. Dis Esophagus 2012, 25, 427-436. [147] Leon, C., Eckly, A., Hechler, B., Aleil, B., et al., Megakaryocyte-restricted MYH9 inactivation dramatically affects hemostasis while preserving platelet aggregation and secretion. Blood 2007, 110, 3183-3191. [148] Shiohama, A., Sasaki, T., Noda, S., Minoshima, S., Shimizu, N., Nucleolar localization of DGCR8 and identification of eleven DGCR8-associated proteins. Exp Cell Res 2007, 313, 4196-4207. [149] Toothaker, L. E., Gonzalez, D. A., Tung, N., Lemons, R. S., et al., Cellular myosin heavy chain in human leukocytes: isolation of 5' cDNA clones, characterization of the protein, chromosomal localization, and upregulation during myeloid differentiation. Blood 1991, 78, 1826-1833. [150] Wilson, C. A., Tsuchida, M. A., Allen, G. M., Barnhart, E. L., et al., Myosin II contributes to cell-scale actin network treadmilling through network disassembly. Nature, 465, 373-377. [151] Kovacs, M., Toth, J., Hetenyi, C., Malnasi-Csizmadia, A., Sellers, J. R., Mechanism of blebbistatin inhibition of myosin II. J Biol Chem 2004, 279, 35557-35563. [152] Bartel, D. P., MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281-297. [153] Pillai, R. S., Bhattacharyya, S. N., Filipowicz, W., Repression of protein synthesis by miRNAs: how many mechanisms? Trends Cell Biol 2007, 17, 118-126. [154] Croce, C. M., Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 2009, 10, 704-714. [155] Pichiorri, F., Suh, S. S., Rocci, A., De Luca, L., et al., Downregulation of p53-inducible microRNAs 192, 194, and 215 impairs the p53/MDM2 autoregulatory loop in multiple myeloma development. Cancer Cell 2010, 18, 367-381.

162

[156] Calin, G. A., Ferracin, M., Cimmino, A., Di Leva, G., et al., A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N Engl J Med 2005, 353, 1793-1801. [157] Visone, R., Veronese, A., Rassenti, L. Z., Balatti, V., et al., miR-181b is a biomarker of disease progression in chronic lymphocytic leukemia. Blood 2011, 118, 3072-3079. [158] Volinia, S., Galasso, M., Costinean, S., Tagliavini, L., et al., Reprogramming of miRNA networks in cancer and leukemia. Genome Res 2010, 20, 589-599. [159] Volinia, S., Calin, G. A., Liu, C. G., Ambs, S., et al., A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006, 103, 2257-2261. [160] Garofalo, M., Croce, C. M., microRNAs: Master regulators as potential therapeutics in cancer. Annu Rev Pharmacol Toxicol 2011, 51, 25-43. [161] Obernosterer, G., Leuschner, P. J., Alenius, M., Martinez, J., Post- transcriptional regulation of microRNA expression. RNA 2006, 12, 1161- 1167. [162] Guil, S., Caceres, J. F., The multifunctional RNA-binding protein hnRNP A1 is required for processing of miR-18a. Nat Struct Mol Biol 2007, 14, 591-596. [163] Trabucchi, M., Briata, P., Garcia-Mayoral, M., Haase, A. D., et al., The RNA-binding protein KSRP promotes the biogenesis of a subset of microRNAs. Nature 2009, 459, 1010-1014. [164] Viswanathan, S. R., Daley, G. Q., Gregory, R. I., Selective blockade of microRNA processing by Lin28. Science 2008, 320, 97-100. [165] Rao, X., Di Leva, G., Li, M., Fang, F., et al., MicroRNA-221/222 confers breast cancer fulvestrant resistance by regulating multiple signaling pathways. Oncogene 2011, 30, 1082-1097. [166] Soundararajan, S., Chen, W., Spicer, E. K., Courtenay-Luck, N., Fernandes, D. J., The nucleolin targeting aptamer AS1411 destabilizes Bcl-2 messenger RNA in human breast cancer cells. Cancer Res 2008, 68, 2358-2365. [167] Huber, W., von Heydebreck, A., Sultmann, H., Poustka, A., Vingron, M., Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics 2002, 18 Suppl 1, S96-104. [168] Yeung, K. Y., Medvedovic, M., Bumgarner, R. E., Clustering gene- expression data with repeated measurements. Genome Biol 2003, 4, R34.

163

[169] Srivastava, M., Pollard, H. B., Molecular dissection of nucleolin's role in growth and cell proliferation: new insights. FASEB J 1999, 13, 1911-1922. [170] Ginisty, H., Sicard, H., Roger, B., Bouvet, P., Structure and functions of nucleolin. J Cell Sci 1999, 112 ( Pt 6), 761-772. [171] Ginisty, H., Amalric, F., Bouvet, P., Nucleolin functions in the first step of ribosomal RNA processing. EMBO J 1998, 17, 1476-1486. [172] Mongelard, F., Bouvet, P., Nucleolin: a multiFACeTed protein. Trends Cell Biol 2007, 17, 80-86. [173] Storck, S., Shukla, M., Dimitrov, S., Bouvet, P., Functions of the histone chaperone nucleolin in diseases. Subcell Biochem 2007, 41, 125-144. [174] Belisova, A., Semrad, K., Mayer, O., Kocian, G., et al., RNA chaperone activity of protein components of human Ro RNPs. RNA 2005, 11, 1084- 1094. [175] Ishimaru, D., Zuraw, L., Ramalingam, S., Sengupta, T. K., et al., Mechanism of regulation of bcl-2 mRNA by nucleolin and A+U-rich element-binding factor 1 (AUF1). J Biol Chem 2010, 285, 27182-27191. [176] Zheng, X., Zhang, Y., Chen, Y. Q., Castranova, V., et al., Inhibition of NF- kappaB stabilizes gadd45alpha mRNA. Biochem Biophys Res Commun 2005, 329, 95-99. [177] Farin, K., Di Segni, A., Mor, A., Pinkas-Kramarski, R., Structure-function analysis of nucleolin and ErbB receptors interactions. PLoS One 2009, 4, e6128. [178] Greco, A., Arata, L., Soler, E., Gaume, X., et al., Nucleolin interacts with US11 protein of herpes simplex virus 1 and is involved in its trafficking. J Virol 2012, 86, 1449-1457. [179] Tayyari, F., Marchant, D., Moraes, T. J., Duan, W., et al., Identification of nucleolin as a cellular receptor for human respiratory syncytial virus. Nat Med 2011, 17, 1132-1135. [180] Watanabe, T., Tsuge, H., Imagawa, T., Kise, D., et al., Nucleolin as cell surface receptor for tumor necrosis factor-alpha inducing protein: a carcinogenic factor of Helicobacter pylori. J Cancer Res Clin Oncol 2010, 136, 911-921. [181] Bates, P. J., Choi, E. W., Nayak, L. V., G-rich oligonucleotides for cancer treatment. Methods Mol Biol 2009, 542, 379-392. [182] Destouches, D., Page, N., Hamma-Kourbali, Y., Machi, V., et al., A simple approach to cancer therapy afforded by multivalent pseudopeptides that target cell-surface nucleoproteins. Cancer Res 2011, 71, 3296-3305.

164

[183] Hovanessian, A. G., Soundaramourty, C., El Khoury, D., Nondier, I., et al., Surface expressed nucleolin is constantly induced in tumor cells to mediate calcium-dependent ligand internalization. PLoS One 2010, 5, e15787. [184] El Khoury, D., Destouches, D., Lengagne, R., Krust, B., et al., Targeting surface nucleolin with a multivalent pseudopeptide delays development of spontaneous melanoma in RET transgenic mice. BMC Cancer 2010, 10, 325. [185] Farin, K., Schokoroy, S., Haklai, R., Cohen-Or, I., et al., Oncogenic synergism between ErbB1, nucleolin, and mutant Ras. Cancer Res 2011, 71, 2140-2151. [186] Reyes-Reyes, E. M., Akiyama, S. K., Cell-surface nucleolin is a signal transducing P-selectin binding protein for human colon carcinoma cells. Exp Cell Res 2008, 314, 2212-2223. [187] Shi, H., Huang, Y., Zhou, H., Song, X., et al., Nucleolin is a receptor that mediates antiangiogenic and antitumor activity of endostatin. Blood 2007, 110, 2899-2906. [188] Wu, C. D., Chou, H. W., Kuo, Y. S., Lu, R. M., et al., Nucleolin antisense oligodeoxynucleotides induce apoptosis and may be used as a potential drug for nasopharyngeal carcinoma therapy. Oncol Rep 2012, 27, 94-100. [189] Fortina, P., Surrey, S., Digital mRNA profiling. Nat Biotechnol 2008, 26, 293-294.

165

Appendix A: Supporting information for chapter 3

140 RT = a + b H

100

SSRC Retention time time (min) Retention Robust linear regression

20 10 20 30 40 50 Hydrophobicity

Figure A.1 Linear function of retention time and hydrophobicity (a: the gradient delay time, b: a value related to the slope of acetonitrile gradient). The SSRC trendline slope is 2.95. The robust linear regression slope is 2.69.

166

Table A.1 Hydrophobicities of unmodified peptides.

Hydrophobicity Retention Peptide sequence Robust linear time (min) SSRC regression 13LDKENALDR21 37.00 13.34 13.75 218EDKYEEEIK226 47.00 18.08 17.47 214YSQKEDKYEEEIK226 50.00 13.97 18.59 77KATDAEADVASLNR90 59.55 20.84 22.14 78ATDAEADVASLNR90 64.80 24.16 24.09 168KLVIIESDLER178 81.40 30.02 30.26 91RIQLVEEELDR101 81.50 28.95 30.30 50LKGTEDELDKYSEALK65 83.80 26.68 31.15 92IQLVEEELDR101 86.80 32.21 32.27 52GTEDELDKYSEALK65 87.90 28.13 32.68 169LVIIESDLER178 89.41 33.60 33.24 38QLEDELVSLQK48 91.90 34.14 34.16 50LKGTEDELDKYSEALKDAQEK70 92.80 26.04 34.50 52GTEDELDKYSEALKDAQEK70 97.00 27.28 36.06 252SIDDLEDELYAQK264 104.70 37.49 38.92 269AISEELDHALNDMTSI284 135.52 36.46 50.38

167

Nitrosylation & Nitration on Tyrosine 60

50 65 LKGTEDELDKYNO SEALK 0.2 2

0.1 TRM Transition 1

0.0 Transition 2 SIM 0 20 40 60 80 100 150 0.6 50 70 50 70 LKGTEDELDKYNO SEALKDAQEK LKGTEDELDKYNOSEALKDAQEK 2 0.04

0.3 0.02

0.0 0.00 0 20 40 60 80 100 150 0 20 40 60 80 100 150

52 65 GTEDELDKYNOSEALK 0.2 52 65 GTEDELDKYNO2SEALK 0.003

0.002 0.1 0.001

0.0 0.000 0 20 40 60 80 100 150 0 20 40 60 80 100 150

52 70 52 70 GTEDELDKYNOSEALKDAQEK 0.4 GTEDELDKYNO2SEALKDAQEK 0.006

0.2 0.003

0.0 0.000 0 20 40 60 80 100 150 0 20 40 60 80 100 150

0.3 60 0.003 60 YNO2 YNO 0.2 0.002

0.1 0.001

0.0 0.000 0 20 40 60 80 100 150 0 20 40 60 80 100 150

X-axis: Molar Ratio of Peroxynitrite to Tropomysion Y-axis: Percentage (100%)

Figure A.2 The TRM, SRM and SIM experiment data of nitration and nitrosylation on tyrosine 60. 168

Peptide Sequence Peak Area Nitrosylation & Nitration on Tyrosine 60 50LKGTEDELDKYSEALK65 A

50 65 LKGTEDELDKYNO2SEALK ANO2 50LKGTEDELDKYSEALKDAQEK70 B

50 70 LKGTEDELDKYNOSEALKDAQEK BNO Nitrosylation (BNO + CNO + DNO) = 50 70 LKGTEDELDKYNO SEALKDAQEK BNO Percentage 2 2 (A + ANO2 + ··· + DNO2) 52GTEDELDKYSEALK65 C

52 65 GTEDELDKYNOSEALK CNO

52 65 GTEDELDKYNO2SEALK CNO2 52 70 Nitration (ANO2 + BNO2 + CNO2 + DNO2) GTEDELDKYSEALKDAQEK D = 52 70 Percentage GTEDELDKYNOSEALKDAQEK DNO (A + ANO2 + ··· + DNO2)

52 70 GTEDELDKYNO2SEALKDAQEK DNO2

Figure A.3 Calculation methods for nitrosylation level and nitration level on tyrosine 60.

169

Nitrosylation & Nitration on Tyrosine 214 Nitration on Tyrosine 221

0.02 214 226 YNOSQKEDKYEEEIK 0.014 218 226 0.003 EDKYNO2EEEIK

0.01 0.007 0.000 20 40 60 80 100 150 0.00 0.000 0 20 40 60 80 100 150 0 20 40 60 80 100 150

0.12 221 214 226 0.018 YNO2 YNO2SQKEDKYEEEIK

0.06 0.009

0.00 0.000 0 20 40 60 80 100 150 0 20 40 60 80 100 150

Peptide Sequence Peak Area 0.04 214 226 YSQKEDKYNO2EEEIK 214YSQKEDKYEEEIK226 A

214 226 0.02 YNOSQKEDKYEEEIK ANO

214 226 YNO2SQKEDKYEEEIK ANO2 0.00 214 226 YSQKEDKYNO2EEEIK ANO2_2 0 20 40 60 80 100 150 214 226 YNO2SQKEDKYNO2EEEIK A2NO2 0.008 218 226 214 226 EDKYEEEIK B YNO2SQKEDKYNO2EEEIK 218 226 EDKYNO2EEEIK BNO2 0.004 Nitration on Tyrosine 214

Nitration (ANO2 + A2NO2) 0.000 = Percentage (A + ANO + ··· + A2NO ) 0 20 40 60 80 100 150 2

0.12 214 YNO2 Nitration on Tyrosine 221

Nitration (ANO2_2 + BNO2) = 0.06 Percentage (A + ANO + ··· + BNO2)

TRM Transition 1 0.00 0 20 40 60 80 100 150 Transition 2 SIM

X-axis: Molar Ratio of Peroxynitrite to Tropomysion Y-axis: Percentage (100%)

Figure A.4 The TRM, SRM and SIM experiment data of nitration and nitrosylation on tyrosine 214; nitration on tyrosine 221. Calculation methods for nitration levels on tyrosine 214 and 221. 170

Nitrosylation & Nitration on Tyrosine 261 TRM Transition 1

Transition 2 SIM

261 261 YNO YNO 0.0004 3.0E-5 0.04 2 0.0002

0.0002 0.02 0.0E+0 0.0000 0 20 40 0 20 40

0.0000 0.00 0 20 40 60 80 100 150 0 20 40 60 80 100 150

X-axis: Molar Ratio of Peroxynitrite to Tropomysion Y-axis: Percentage (100%)

Figure A.5 The TRM, SRM and SIM experiment data of nitration and nitrosylation on tyrosine 261.

171

Figure A.6 MS/MS spectrum of peptide 13LDKENALDR21, m/z = 537.28+2. Red color: the observed data match the theoretical data.

Table A.2 Product ions of 13LDKENALDR21, m/z = 537.28+2. Red color: the observed data match the theoretical data.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 57.55 -- -- 114.09 L 528.28 528.77 537.28 1055.55 1056.53 1073.56 M 2 106.06 -- 115.06 211.11 -- 229.12 D 471.74 472.23 480.74 942.46 943.45 960.47 8 3 170.10 170.60 179.11 339.20 340.19 357.21 K 414.22 414.71 423.23 827.44 828.42 845.45 7 4 234.63 235.12 243.63 468.25 469.23 486.26 E 350.17 350.67 359.18 699.34 700.33 717.35 6 5 291.65 292.14 300.65 582.29 583.27 600.30 N 285.65 286.15 294.66 570.30 571.28 588.31 5 6 327.17 327.66 336.17 653.33 654.31 671.34 A 228.63 229.12 237.64 456.26 457.24 474.27 4 7 383.71 384.20 392.71 766.41 767.39 784.42 L 193.11 193.61 202.12 385.22 386.20 403.23 3 8 441.22 441.71 450.23 881.44 882.42 899.45 D 136.57 137.06 145.58 272.14 273.12 290.15 2 ------R 79.06 79.55 88.06 157.11 158.09 175.12 1

172

Figure A.7 MS/MS spectrum of peptide 38QLEDELVSLQK48, m/z = 651.35+2.

Table A.3 Product ions of 38QLEDELVSLQK48, m/z = 651.35+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- 56.52 65.04 -- 112.04 129.07 Q 642.35 642.84 651.35 1283.68 1284.67 1301.69 M 2 -- 113.07 121.58 -- 225.12 242.15 L 578.32 578.81 587.32 1155.63 1156.61 1173.64 10 3 177.09 177.59 186.10 353.18 354.17 371.19 E 521.77 522.27 530.78 1042.54 1043.53 1060.55 9 4 234.61 235.10 243.61 468.21 469.19 486.22 D 457.25 457.75 466.26 913.50 914.48 931.51 8 5 299.13 299.62 308.13 597.25 598.24 615.26 E 399.74 400.23 408.74 798.47 799.46 816.48 7 6 355.67 356.16 364.68 710.34 711.32 728.35 L 335.22 335.71 344.22 669.43 670.41 687.44 6 7 405.21 405.70 414.21 809.40 810.39 827.41 V 278.68 279.17 287.68 556.35 557.33 574.36 5 8 448.72 449.21 457.73 896.44 897.42 914.45 S 229.14 229.63 238.15 457.28 458.26 475.29 4 9 505.26 505.76 514.27 1009.52 1010.50 1027.53 L 185.63 186.12 194.63 370.24 371.23 388.26 3 10 569.29 569.78 578.30 1137.58 1138.56 1155.59 Q 129.08 129.58 138.09 257.16 258.14 275.17 2 K 1 ------65.05 65.55 74.06 129.10 130.09 147.11

173

Figure A.8 MS/MS spectrum of peptide 50LKGTEDELDKYSEALK65, m/z = 613.65+3.

Table A.4 Product ions of 50LKGTEDELDKYSEALK65, m/z = 613.65+3.

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 38.70 -- -- 57.55 -- -- 114.09 L 607.65 607.98 613.65 910.97 911.46 919.97 1820.93 1821.91 1838.94 M 2 -- 75.72 81.40 -- 113.08 121.60 -- 225.16 242.19 K 569.95 570.28 575.96 854.43 854.92 863.43 1707.84 1708.83 1725.85 15 3 -- 94.73 100.41 -- 141.59 150.11 -- 282.18 299.21 G 527.25 527.58 533.26 790.38 790.87 799.38 1579.75 1580.73 1597.76 14 4 128.09 128.41 134.09 191.63 192.12 200.63 382.24 383.23 400.26 T 508.25 508.58 514.25 761.87 762.36 770.87 1522.73 1523.71 1540.74 13 5 171.10 171.43 177.10 256.15 256.64 265.15 511.29 512.27 529.30 E 474.56 474.89 480.57 711.34 711.84 720.35 1421.68 1422.66 1439.69 12 6 209.44 209.77 215.45 313.66 314.15 322.67 626.31 627.30 644.32 D 431.55 431.88 437.55 646.82 647.31 655.83 1292.64 1293.62 1310.65 11 7 252.46 252.79 258.46 378.18 378.67 387.19 755.36 756.34 773.37 E 393.21 393.54 399.21 589.31 589.80 598.31 1177.61 1178.59 1195.62 10 8 290.15 290.48 296.16 434.72 435.22 443.73 868.44 869.43 886.45 L 350.19 350.52 356.20 524.79 525.28 533.79 1048.57 1049.55 1066.58 9 9 328.49 328.82 334.50 492.24 492.73 501.24 983.47 984.45 1001.48 D 312.50 312.83 318.50 468.25 468.74 477.25 935.48 936.47 953.49 8 10 371.19 371.52 377.20 556.29 556.78 565.29 1111.56 1112.55 1129.57 K 274.16 274.48 280.16 410.73 411.22 419.74 820.46 821.44 838.47 7 11 425.55 425.87 431.55 637.82 638.31 646.82 1274.63 1275.61 1292.64 Y 231.46 231.79 237.46 346.68 347.18 355.69 692.36 693.35 710.37 6 12 454.56 454.89 460.56 681.33 681.82 690.34 1361.66 1362.64 1379.67 S 177.10 177.43 183.11 265.15 265.64 274.16 529.30 530.28 547.31 5 13 497.57 497.90 503.58 745.85 746.35 754.86 1490.70 1491.68 1508.71 E 148.09 148.42 154.10 221.64 222.13 230.64 442.27 443.25 460.28 4 14 521.25 521.58 527.25 781.37 781.86 790.38 1561.74 1562.72 1579.75 A 105.08 105.41 111.08 157.12 157.61 166.12 313.22 314.21 331.23 3 15 558.95 559.27 564.95 837.91 838.41 846.92 1674.82 1675.81 1692.83 L 81.40 81.73 87.40 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

174

50 65 Figure A.9 MS/MS spectrum of peptide LKGTEDELDKYNO2SEALK , m/z = 628.65+3.

50 65 +3 Table A.5 Product ions of LKGTEDELDKYNO2SEALK , m/z = 628.65 .

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 38.70 -- -- 57.55 -- -- 114.09 L 622.64 622.97 628.65 933.46 933.95 942.47 1865.91 1866.90 1883.92 M

2 -- 75.72 81.40 -- 113.08 121.60 -- 225.16 242.19 K 584.95 585.28 590.95 876.92 877.41 885.92 1752.83 1753.81 1770.84 15

3 -- 94.73 100.41 -- 141.59 150.11 -- 282.18 299.21 G 542.25 542.58 548.25 812.87 813.36 821.88 1624.73 1625.72 1642.74 14

4 128.09 128.41 134.09 191.63 192.12 200.63 382.24 383.23 400.26 T 523.24 523.57 529.25 784.36 784.85 793.37 1567.71 1568.70 1585.72 13

5 171.10 171.43 177.10 256.15 256.64 265.15 511.29 512.27 529.30 E 489.56 489.89 495.56 733.84 734.33 742.84 1466.66 1467.65 1484.68 12

6 209.44 209.77 215.45 313.66 314.15 322.67 626.31 627.30 644.32 D 446.55 446.87 452.55 669.31 669.81 678.32 1337.62 1338.61 1355.63 11

7 252.46 252.79 258.46 378.18 378.67 387.19 755.36 756.34 773.37 E 408.20 408.53 414.21 611.80 612.29 620.81 1222.60 1223.58 1240.61 10

8 290.15 290.48 296.16 434.72 435.22 443.73 868.44 869.43 886.45 L 365.19 365.52 371.19 547.28 547.77 556.29 1093.55 1094.54 1111.56 9

9 328.49 328.82 334.50 492.24 492.73 501.24 983.47 984.45 1001.48 D 327.49 327.82 333.50 490.74 491.23 499.74 980.47 981.45 998.48 8

10 371.19 371.52 377.20 556.29 556.78 565.29 1111.56 1112.55 1129.57 K 289.15 289.48 295.16 433.22 433.72 442.23 865.44 866.43 883.45 7

11 440.54 440.87 446.55 660.31 660.80 669.31 1319.61 1320.60 1337.62 Y 246.45 246.78 252.46 369.18 369.67 378.18 737.35 738.33 755.36 6

12 469.55 469.88 475.56 703.83 704.32 712.83 1406.64 1407.63 1424.65 S 177.10 177.43 183.11 265.15 265.64 274.16 529.30 530.28 547.31 5

13 512.57 512.89 518.57 768.35 768.84 777.35 1535.69 1536.67 1553.70 E 148.09 148.42 154.10 221.64 222.13 230.64 442.27 443.25 460.28 4

14 536.25 536.57 542.25 803.87 804.36 812.87 1606.72 1607.71 1624.73 A 105.08 105.41 111.08 157.12 157.61 166.12 313.22 314.21 331.23 3

15 573.94 574.27 579.94 860.41 860.90 869.41 1719.81 1720.79 1737.82 L 81.40 81.73 87.40 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1 175

Figure A.10 MS/MS spectrum of peptide 50LKGTEDELDKYSEALKDAQEK70, m/z = 603.31+4.

176

Table A.6 Product ions of 50LKGTEDELDKYSEALKDAQEK70, m/z = 603.31+4.

# b'+4 b*+4 b+4 b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+4 y*+4 y+4 y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 29.28 -- -- 38.70 -- -- 57.55 -- -- 114.09 L 598.80 599.05 603.31 798.07 798.40 804.07 1196.60 1197.09 1205.60 2392.19 2393.17 2410.20 M

2 -- 57.05 61.30 -- 75.72 81.40 -- 113.08 121.60 -- 225.16 242.19 K 570.53 570.78 575.03 760.37 760.70 766.38 1140.06 1140.55 1149.06 2279.10 2280.09 2297.11 20

3 -- 71.30 75.56 -- 94.73 100.41 -- 141.59 150.11 -- 282.18 299.21 G 538.51 538.75 543.01 717.67 718.00 723.68 1076.01 1076.50 1085.01 2151.01 2151.99 2169.02 19

4 96.32 96.56 100.82 128.09 128.41 134.09 191.63 192.12 200.63 382.24 383.23 400.26 T 524.25 524.50 528.75 698.67 699.00 704.67 1047.50 1047.99 1056.50 2093.99 2094.97 2112.00 18

5 128.58 128.82 133.08 171.10 171.43 177.10 256.15 256.64 265.15 511.29 512.27 529.30 E 498.99 499.24 503.49 664.98 665.31 670.99 996.97 997.47 1005.98 1992.94 1993.92 2010.95 17

6 157.33 157.58 161.84 209.44 209.77 215.45 313.66 314.15 322.67 626.31 627.30 644.32 D 466.73 466.98 471.23 621.97 622.30 627.97 932.45 932.94 941.46 1863.90 1864.88 1881.91 16

7 189.59 189.84 194.10 252.46 252.79 258.46 378.18 378.67 387.19 755.36 756.34 773.37 E 437.97 438.22 442.48 583.63 583.96 589.63 874.94 875.43 883.94 1748.87 1749.85 1766.88 15

177 8 217.87 218.11 222.37 290.15 290.48 296.16 434.72 435.22 443.73 868.44 869.43 886.45 L 405.71 405.96 410.21 540.61 540.94 546.62 810.42 810.91 819.42 1619.83 1620.81 1637.84 14

9 246.62 246.87 251.13 328.49 328.82 334.50 492.24 492.73 501.24 983.47 984.45 1001.48 D 377.44 377.69 381.94 502.92 503.25 508.92 753.88 754.37 762.88 1506.74 1507.73 1524.75 13

10 278.65 278.89 283.15 371.19 371.52 377.20 556.29 556.78 565.29 1111.56 1112.55 1129.57 K 348.68 348.93 353.19 464.58 464.91 470.58 696.36 696.85 705.37 1391.72 1392.70 1409.73 12

11 319.41 319.66 323.91 425.55 425.87 431.55 637.82 638.31 646.82 1274.63 1275.61 1292.64 Y 316.66 316.91 321.16 421.88 422.21 427.88 632.31 632.81 641.32 1263.62 1264.61 1281.63 11

12 341.17 341.42 345.67 454.56 454.89 460.56 681.33 681.82 690.34 1361.66 1362.64 1379.67 S 275.90 276.14 280.40 367.52 367.85 373.53 550.78 551.27 559.79 1100.56 1101.54 1118.57 10

13 373.43 373.68 377.93 497.57 497.90 503.58 745.85 746.35 754.86 1490.70 1491.68 1508.71 E 254.14 254.38 258.64 338.51 338.84 344.52 507.27 507.76 516.27 1013.53 1014.51 1031.54 9

14 391.19 391.44 395.69 521.25 521.58 527.25 781.37 781.86 790.38 1561.74 1562.72 1579.75 A 221.88 222.12 226.38 295.50 295.83 301.50 442.75 443.24 451.75 884.48 885.47 902.49 8

15 419.46 419.71 423.96 558.95 559.27 564.95 837.91 838.41 846.92 1674.82 1675.81 1692.83 L 204.12 204.36 208.62 271.82 272.15 277.82 407.23 407.72 416.23 813.45 814.43 831.46 7

16 451.48 451.73 455.99 601.64 601.97 607.65 901.96 902.45 910.97 1802.92 1803.90 1820.93 K 175.85 176.09 180.35 234.13 234.45 240.13 350.68 351.18 359.69 700.36 701.35 718.37 6

17 480.24 480.49 484.74 639.99 640.31 645.99 959.48 959.97 968.48 1917.94 1918.93 1935.95 D 143.82 144.07 148.32 191.43 191.76 197.43 286.64 287.13 295.64 572.27 573.25 590.28 5

18 498.00 498.25 502.50 663.67 663.99 669.67 994.99 995.49 1004.00 1988.98 1989.97 2006.99 A 115.07 115.31 119.57 153.09 153.41 159.09 229.12 229.62 238.13 457.24 458.22 475.25 4

19 530.02 530.26 534.52 706.35 706.68 712.35 1059.02 1059.52 1068.03 2117.04 2118.02 2135.05 Q 97.31 97.55 101.81 129.41 129.73 135.41 193.61 194.10 202.61 386.20 387.19 404.21 3

20 562.28 562.52 566.78 749.37 749.69 755.37 1123.54 1124.04 1132.55 2246.08 2247.07 2264.09 E 65.29 65.54 69.79 86.72 87.05 92.72 129.58 130.07 138.58 258.14 259.13 276.16 2

------K 33.03 33.28 37.53 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

50 70 Figure A.11 MS/MS spectrum of peptide LKGTEDELDKYNOSEALKDAQEK , m/z = 610.55+4.

178

50 70 +4 Table A.7 Product ions of LKGTEDELDKYNOSEALKDAQEK , m/z = 610.55 .

# b'+4 b*+4 b+4 b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+4 y*+4 y+4 y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 29.28 -- -- 38.70 -- -- 57.55 -- -- 114.09 L 606.05 606.30 610.55 807.73 808.06 813.73 1211.09 1211.58 1220.10 2421.18 2422.16 2439.19 M

2 -- 57.05 61.30 -- 75.72 81.40 -- 113.08 121.60 -- 225.16 242.19 K 577.78 578.02 582.28 770.04 770.36 776.04 1154.55 1155.04 1163.56 2308.09 2309.08 2326.10 20

3 -- 71.30 75.56 -- 94.73 100.41 -- 141.59 150.11 -- 282.18 299.21 G 545.76 546.00 550.26 727.34 727.67 733.34 1090.50 1091.00 1099.51 2180.00 2180.98 2198.01 19

4 96.32 96.56 100.82 128.09 128.41 134.09 191.63 192.12 200.63 382.24 383.23 400.26 T 531.50 531.75 536.00 708.33 708.66 714.33 1061.99 1062.48 1071.00 2122.98 2123.96 2140.99 18

5 128.58 128.82 133.08 171.10 171.43 177.10 256.15 256.64 265.15 511.29 512.27 529.30 E 506.24 506.48 510.74 674.65 674.98 680.65 1011.47 1011.96 1020.47 2021.93 2022.91 2039.94 17

6 157.33 157.58 161.84 209.44 209.77 215.45 313.66 314.15 322.67 626.31 627.30 644.32 D 473.98 474.22 478.48 631.63 631.96 637.64 946.95 947.44 955.95 1892.89 1893.87 1910.90 16

7 189.59 189.84 194.10 252.46 252.79 258.46 378.18 378.67 387.19 755.36 756.34 773.37 E 445.22 445.47 449.72 593.29 593.62 599.30 889.43 889.93 898.44 1777.86 1778.84 1795.87 15

8 217.87 218.11 222.37 290.15 290.48 296.16 434.72 435.22 443.73 868.44 869.43 886.45 L 412.96 413.21 417.46 550.28 550.61 556.28 824.91 825.40 833.92 1648.82 1649.80 1666.83 14

179 9 246.62 246.87 251.13 328.49 328.82 334.50 492.24 492.73 501.24 983.47 984.45 1001.48 D 384.69 384.93 389.19 512.58 512.91 518.59 768.37 768.86 777.38 1535.73 1536.72 1553.74 13

10 278.65 278.89 283.15 371.19 371.52 377.20 556.29 556.78 565.29 1111.56 1112.55 1129.57 K 355.93 356.18 360.43 474.24 474.57 480.24 710.86 711.35 719.86 1420.71 1421.69 1438.72 12

11 326.66 326.91 331.16 435.21 435.54 441.21 652.31 652.80 661.32 1303.62 1304.60 1321.63 Y 323.91 324.15 328.41 431.54 431.87 437.55 646.81 647.30 655.81 1292.61 1293.60 1310.62 11

12 348.42 348.66 352.92 464.22 464.55 470.22 695.83 696.32 704.83 1390.65 1391.63 1408.66 S 275.90 276.14 280.40 367.52 367.85 373.53 550.78 551.27 559.79 1100.56 1101.54 1118.57 10

13 380.68 380.92 385.18 507.24 507.56 513.24 760.35 760.84 769.35 1519.69 1520.68 1537.70 E 254.14 254.38 258.64 338.51 338.84 344.52 507.27 507.76 516.27 1013.53 1014.51 1031.54 9

14 398.44 398.68 402.94 530.91 531.24 536.92 795.87 796.36 804.87 1590.73 1591.71 1608.74 A 221.88 222.12 226.38 295.50 295.83 301.50 442.75 443.24 451.75 884.48 885.47 902.49 8

15 426.71 426.95 431.21 568.61 568.94 574.61 852.41 852.90 861.42 1703.81 1704.80 1721.82 L 204.12 204.36 208.62 271.82 272.15 277.82 407.23 407.72 416.23 813.45 814.43 831.46 7

16 458.73 458.98 463.23 611.31 611.64 617.31 916.46 916.95 925.46 1831.91 1832.89 1849.92 K 175.85 176.09 180.35 234.13 234.45 240.13 350.68 351.18 359.69 700.36 701.35 718.37 6

17 487.49 487.74 491.99 649.65 649.98 655.65 973.97 974.46 982.98 1946.93 1947.92 1964.94 D 143.82 144.07 148.32 191.43 191.76 197.43 286.64 287.13 295.64 572.27 573.25 590.28 5

18 505.25 505.49 509.75 673.33 673.66 679.33 1009.49 1009.98 1018.49 2017.97 2018.96 2035.98 A 115.07 115.31 119.57 153.09 153.41 159.09 229.12 229.62 238.13 457.24 458.22 475.25 4

19 537.26 537.51 541.77 716.01 716.34 722.02 1073.52 1074.01 1082.52 2146.03 2147.01 2164.04 Q 97.31 97.55 101.81 129.41 129.73 135.41 193.61 194.10 202.61 386.20 387.19 404.21 3

20 569.52 569.77 574.03 759.03 759.36 765.03 1138.04 1138.53 1147.05 2275.07 2276.06 2293.08 E 65.29 65.54 69.79 86.72 87.05 92.72 129.58 130.07 138.58 258.14 259.13 276.16 2 ------K 33.03 33.28 37.53 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

50 70 Figure A.12 MS/MS spectrum of peptide LKGTEDELDKYNO2SEALKDAQEK , m/z = 614.55+4.

180

50 70 +4 Table A.8 Product ions of peptide LKGTEDELDKYNO2SEALKDAQEK , m/z = 614.55 .

# b'+4 b*+4 b+4 b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+4 y*+4 y+4 y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 29.28 -- -- 38.70 -- -- 57.55 -- -- 114.09 L 610.05 610.29 614.55 813.06 813.39 819.07 1219.09 1219.58 1228.10 2437.17 2438.16 2455.18 M

2 -- 57.05 61.30 -- 75.72 81.40 -- 113.08 121.60 -- 225.16 242.19 K 581.78 582.02 586.28 775.37 775.70 781.37 1162.55 1163.04 1171.55 2324.09 2325.07 2342.10 20

3 -- 71.30 75.56 -- 94.73 100.41 -- 141.59 150.11 -- 282.18 299.21 G 549.75 550.00 554.26 732.67 733.00 738.67 1098.50 1098.99 1107.51 2195.99 2196.98 2214.00 19

4 96.32 96.56 100.82 128.09 128.41 134.09 191.63 192.12 200.63 382.24 383.23 400.26 T 535.50 535.74 540.00 713.66 713.99 719.67 1069.99 1070.48 1079.00 2138.97 2139.96 2156.98 18

5 128.58 128.82 133.08 171.10 171.43 177.10 256.15 256.64 265.15 511.29 512.27 529.30 E 510.24 510.48 514.74 679.98 680.31 685.98 1019.47 1019.96 1028.47 2037.92 2038.91 2055.94 17

6 157.33 157.58 161.84 209.44 209.77 215.45 313.66 314.15 322.67 626.31 627.30 644.32 D 477.98 478.22 482.48 636.97 637.29 642.97 954.94 955.44 963.95 1908.88 1909.87 1926.89 16

7 189.59 189.84 194.10 252.46 252.79 258.46 378.18 378.67 387.19 755.36 756.34 773.37 E 449.22 449.47 453.72 598.62 598.95 604.63 897.43 897.92 906.44 1793.86 1794.84 1811.87 15

8 217.87 218.11 222.37 290.15 290.48 296.16 434.72 435.22 443.73 868.44 869.43 886.45 L 416.96 417.20 421.46 555.61 555.94 561.61 832.91 833.40 841.92 1664.81 1665.80 1682.82 14

181 9 246.62 246.87 251.13 328.49 328.82 334.50 492.24 492.73 501.24 983.47 984.45 1001.48 D 388.69 388.93 393.19 517.91 518.24 523.92 776.37 776.86 785.37 1551.73 1552.71 1569.74 13

10 278.65 278.89 283.15 371.19 371.52 377.20 556.29 556.78 565.29 1111.56 1112.55 1129.57 K 359.93 360.18 364.43 479.57 479.90 485.58 718.85 719.35 727.86 1436.70 1437.69 1454.71 12

11 330.66 330.90 335.16 440.54 440.87 446.55 660.31 660.80 669.31 1319.61 1320.60 1337.62 Y 327.91 328.15 332.41 436.87 437.20 442.88 654.81 655.30 663.81 1308.61 1309.59 1326.62 11

12 352.42 352.66 356.92 469.55 469.88 475.56 703.83 704.32 712.83 1406.64 1407.63 1424.65 S 275.90 276.14 280.40 367.52 367.85 373.53 550.78 551.27 559.79 1100.56 1101.54 1118.57 10

13 384.68 384.92 389.18 512.57 512.89 518.57 768.35 768.84 777.35 1535.69 1536.67 1553.70 E 254.14 254.38 258.64 338.51 338.84 344.52 507.27 507.76 516.27 1013.53 1014.51 1031.54 9

14 402.44 402.68 406.94 536.25 536.57 542.25 803.87 804.36 812.87 1606.72 1607.71 1624.73 A 221.88 222.12 226.38 295.50 295.83 301.50 442.75 443.24 451.75 884.48 885.47 902.49 8

15 430.71 430.95 435.21 573.94 574.27 579.94 860.41 860.90 869.41 1719.81 1720.79 1737.82 L 204.12 204.36 208.62 271.82 272.15 277.82 407.23 407.72 416.23 813.45 814.43 831.46 7

16 462.73 462.98 467.23 616.64 616.97 622.64 924.45 924.95 933.46 1847.90 1848.89 1865.91 K 175.85 176.09 180.35 234.13 234.45 240.13 350.68 351.18 359.69 700.36 701.35 718.37 6

17 491.49 491.73 495.99 654.98 655.31 660.98 981.97 982.46 990.97 1962.93 1963.91 1980.94 D 143.82 144.07 148.32 191.43 191.76 197.43 286.64 287.13 295.64 572.27 573.25 590.28 5

18 509.25 509.49 513.75 678.66 678.99 684.66 1017.49 1017.98 1026.49 2033.97 2034.95 2051.98 A 115.07 115.31 119.57 153.09 153.41 159.09 229.12 229.62 238.13 457.24 458.22 475.25 4

19 541.26 541.51 545.76 721.35 721.67 727.35 1081.52 1082.01 1090.52 2162.02 2163.01 2180.04 Q 97.31 97.55 101.81 129.41 129.73 135.41 193.61 194.10 202.61 386.20 387.19 404.21 3

20 573.52 573.77 578.02 764.36 764.69 770.36 1146.04 1146.53 1155.04 2291.07 2292.05 2309.08 E 65.29 65.54 69.79 86.72 87.05 92.72 129.58 130.07 138.58 258.14 259.13 276.16 2 ------K 33.03 33.28 37.53 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

Figure A.13 MS/MS spectrum of peptide 52GTEDELDKYSEALK65, m/z = 799.38+2.

Table A.9 Product ions of 52GTEDELDKYSEALK65, m/z = 799.38+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 29.52 -- -- 58.03 G 790.38 790.87 799.38 1579.75 1580.73 1597.76 M 2 71.04 -- 80.04 141.07 -- 159.08 T 761.87 762.36 770.87 1522.73 1523.71 1540.74 13 3 135.56 -- 144.56 270.11 -- 288.12 E 711.34 711.84 720.35 1421.68 1422.66 1439.69 12 4 193.07 -- 202.08 385.14 -- 403.15 D 646.82 647.31 655.83 1292.64 1293.62 1310.65 11 5 257.59 -- 266.60 514.18 -- 532.19 E 589.31 589.80 598.31 1177.61 1178.59 1195.62 10 6 314.13 -- 323.14 627.26 -- 645.27 L 524.79 525.28 533.79 1048.57 1049.55 1066.58 9 7 371.65 -- 380.65 742.29 -- 760.30 D 468.25 468.74 477.25 935.48 936.47 953.49 8 8 435.70 436.19 444.70 870.38 871.37 888.39 K 410.73 411.22 419.74 820.46 821.44 838.47 7 9 517.23 517.72 526.23 1033.45 1034.43 1051.46 Y 346.68 347.18 355.69 692.36 693.35 710.37 6 10 560.74 561.24 569.75 1120.48 1121.46 1138.49 S 265.15 265.64 274.16 529.30 530.28 547.31 5 11 625.26 625.76 634.27 1249.52 1250.51 1267.53 E 221.64 222.13 230.64 442.27 443.25 460.28 4 12 660.78 661.28 669.79 1320.56 1321.54 1338.57 A 157.12 157.61 166.12 313.22 314.21 331.23 3 13 717.33 717.82 726.33 1433.64 1434.63 1451.65 L 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1 182

52 65 Figure A.14 MS/MS spectrum of peptide GTEDELDKYNOSEALK , m/z = 813.88+2.

52 65 +2 Table A.10 Product ions of GTEDELDKYNOSEALK , m/z = 813.88 .

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 29.52 -- -- 58.03 G 804.87 805.37 813.88 1608.74 1609.72 1626.75 M 2 71.04 -- 80.04 141.07 -- 159.08 T 776.36 776.85 785.37 1551.72 1552.70 1569.73 13 3 135.56 -- 144.56 270.11 -- 288.12 E 725.84 726.33 734.84 1450.67 1451.65 1468.68 12 4 193.07 -- 202.08 385.14 -- 403.15 D 661.32 661.81 670.32 1321.63 1322.61 1339.64 11 5 257.59 -- 266.60 514.18 -- 532.19 E 603.80 604.30 612.81 1206.60 1207.58 1224.61 10 6 314.13 -- 323.14 627.26 -- 645.27 L 539.28 539.77 548.29 1077.56 1078.54 1095.57 9 7 371.65 -- 380.65 742.29 -- 760.30 D 482.74 483.23 491.75 964.47 965.46 982.48 8 8 435.70 436.19 444.70 870.38 871.37 888.39 K 425.23 425.72 434.23 849.45 850.43 867.46 7 9 531.72 532.21 540.73 1062.44 1063.42 1080.45 Y 361.18 361.67 370.18 721.35 722.34 739.36 6 10 575.24 575.73 584.24 1149.47 1150.45 1167.48 S 265.15 265.64 274.16 529.30 530.28 547.31 5 11 639.76 640.25 648.76 1278.51 1279.50 1296.52 E 221.64 222.13 230.64 442.27 443.25 460.28 4 12 675.28 675.77 684.28 1349.55 1350.53 1367.56 A 157.12 157.61 166.12 313.22 314.21 331.23 3 13 731.82 732.31 740.83 1462.63 1463.62 1480.64 L 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1 183

52 65 Figure A.15 MS/MS spectrum of peptide GTEDELDKYNO2SEALK , m/z = 821.88+2.

52 65 +2 Table A.11 Product ions of GTEDELDKYNO2SEALK , m/z = 821.88 .

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 29.52 -- -- 58.03 G 812.87 813.36 821.88 1624.73 1625.72 1642.74 M 2 71.04 -- 80.04 141.07 -- 159.08 T 784.36 784.85 793.37 1567.71 1568.70 1585.72 13 3 135.56 -- 144.56 270.11 -- 288.12 E 733.84 734.33 742.84 1466.66 1467.65 1484.68 12 4 193.07 -- 202.08 385.14 -- 403.15 D 669.31 669.81 678.32 1337.62 1338.61 1355.63 11 5 257.59 -- 266.60 514.18 -- 532.19 E 611.80 612.29 620.81 1222.60 1223.58 1240.61 10 6 314.13 -- 323.14 627.26 -- 645.27 L 547.28 547.77 556.29 1093.55 1094.54 1111.56 9 7 371.65 -- 380.65 742.29 -- 760.30 D 490.74 491.23 499.74 980.47 981.45 998.48 8 8 435.70 436.19 444.70 870.38 871.37 888.39 K 433.22 433.72 442.23 865.44 866.43 883.45 7 9 539.72 540.21 548.73 1078.43 1079.42 1096.44 Y 369.18 369.67 378.18 737.35 738.33 755.36 6 10 583.24 583.73 592.24 1165.46 1166.45 1183.47 S 265.15 265.64 274.16 529.30 530.28 547.31 5 11 647.76 648.25 656.76 1294.51 1295.49 1312.52 E 221.64 222.13 230.64 442.27 443.25 460.28 4 12 683.28 683.77 692.28 1365.54 1366.53 1383.55 A 157.12 157.61 166.12 313.22 314.21 331.23 3 13 739.82 740.31 748.82 1478.63 1479.61 1496.64 L 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1 184

Figure A.16 MS/MS spectrum of peptide 52GTEDELDKYSEALKDAQEK70, m/z = 723.68+3.

185

Table A.12 Product ions of 52GTEDELDKYSEALKDAQEK70, m/z = 723.68+3.

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 20.01 -- -- 29.52 -- -- 58.03 G 717.67 718.00 723.68 1076.01 1076.50 1085.01 2151.01 2151.99 2169.02 M

2 47.69 -- 53.70 71.04 -- 80.04 141.07 -- 159.08 T 698.67 699.00 704.67 1047.50 1047.99 1056.50 2093.99 2094.97 2112.00 18

3 90.71 -- 96.71 135.56 -- 144.56 270.11 -- 288.12 E 664.98 665.31 670.99 996.97 997.47 1005.98 1992.94 1993.92 2010.95 17

4 129.05 -- 135.05 193.07 -- 202.08 385.14 -- 403.15 D 621.97 622.30 627.97 932.45 932.94 941.46 1863.90 1864.88 1881.91 16

5 172.06 -- 178.07 257.59 -- 266.60 514.18 -- 532.19 E 583.63 583.96 589.63 874.94 875.43 883.94 1748.87 1749.85 1766.88 15

6 209.76 -- 215.76 314.13 -- 323.14 627.26 -- 645.27 L 540.61 540.94 546.62 810.42 810.91 819.42 1619.83 1620.81 1637.84 14

7 248.10 -- 254.10 371.65 -- 380.65 742.29 -- 760.30 D 502.92 503.25 508.92 753.88 754.37 762.88 1506.74 1507.73 1524.75 13

186 8 290.80 291.13 296.80 435.70 436.19 444.70 870.38 871.37 888.39 K 464.58 464.91 470.58 696.36 696.85 705.37 1391.72 1392.70 1409.73 12

9 345.15 345.48 351.16 517.23 517.72 526.23 1033.45 1034.43 1051.46 Y 421.88 422.21 427.88 632.31 632.81 641.32 1263.62 1264.61 1281.63 11

10 374.16 374.49 380.17 560.74 561.24 569.75 1120.48 1121.46 1138.49 S 367.52 367.85 373.53 550.78 551.27 559.79 1100.56 1101.54 1118.57 10

11 417.18 417.51 423.18 625.26 625.76 634.27 1249.52 1250.51 1267.53 E 338.51 338.84 344.52 507.27 507.76 516.27 1013.53 1014.51 1031.54 9

12 440.86 441.19 446.86 660.78 661.28 669.79 1320.56 1321.54 1338.57 A 295.50 295.83 301.50 442.75 443.24 451.75 884.48 885.47 902.49 8

13 478.55 478.88 484.56 717.33 717.82 726.33 1433.64 1434.63 1451.65 L 271.82 272.15 277.82 407.23 407.72 416.23 813.45 814.43 831.46 7

14 521.25 521.58 527.25 781.37 781.86 790.38 1561.74 1562.72 1579.75 K 234.13 234.45 240.13 350.68 351.18 359.69 700.36 701.35 718.37 6

15 559.59 559.92 565.60 838.89 839.38 847.89 1676.76 1677.75 1694.78 D 191.43 191.76 197.43 286.64 287.13 295.64 572.27 573.25 590.28 5

16 583.27 583.60 589.28 874.40 874.90 883.41 1747.80 1748.79 1765.81 A 153.09 153.41 159.09 229.12 229.62 238.13 457.24 458.22 475.25 4

17 625.96 626.29 631.96 938.43 938.93 947.44 1875.86 1876.84 1893.87 Q 129.41 129.73 135.41 193.61 194.10 202.61 386.20 387.19 404.21 3

18 668.97 669.30 674.98 1002.96 1003.45 1011.96 2004.90 2005.89 2022.91 E 86.72 87.05 92.72 129.58 130.07 138.58 258.14 259.13 276.16 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

52 70 Figure A.17 MS/MS spectrum of peptide GTEDELDKYNOSEALKDAQEK , m/z = 733.34+3.

187

52 70 +3 Table A.13 Product ions of GTEDELDKYNOSEALKDAQEK , m/z = 733.34 .

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 20.01 -- -- 29.52 -- -- 58.03 G 727.34 727.67 733.34 1090.50 1091.00 1099.51 2180.00 2180.98 2198.01 M

2 47.69 -- 53.70 71.04 -- 80.04 141.07 -- 159.08 T 708.33 708.66 714.33 1061.99 1062.48 1071.00 2122.98 2123.96 2140.99 18

3 90.71 -- 96.71 135.56 -- 144.56 270.11 -- 288.12 E 674.65 674.98 680.65 1011.47 1011.96 1020.47 2021.93 2022.91 2039.94 17

4 129.05 -- 135.05 193.07 -- 202.08 385.14 -- 403.15 D 631.63 631.96 637.64 946.95 947.44 955.95 1892.89 1893.87 1910.90 16

5 172.06 -- 178.07 257.59 -- 266.60 514.18 -- 532.19 E 593.29 593.62 599.30 889.43 889.93 898.44 1777.86 1778.84 1795.87 15

6 209.76 -- 215.76 314.13 -- 323.14 627.26 -- 645.27 L 550.28 550.61 556.28 824.91 825.40 833.92 1648.82 1649.80 1666.83 14

7 248.10 -- 254.10 371.65 -- 380.65 742.29 -- 760.30 D 512.58 512.91 518.59 768.37 768.86 777.38 1535.73 1536.72 1553.74 13

188 8 290.80 291.13 296.80 435.70 436.19 444.70 870.38 871.37 888.39 K 474.24 474.57 480.24 710.86 711.35 719.86 1420.71 1421.69 1438.72 12

9 354.82 355.15 360.82 531.72 532.21 540.73 1062.44 1063.42 1080.45 Y 431.54 431.87 437.55 646.81 647.30 655.81 1292.61 1293.60 1310.62 11

10 383.83 384.16 389.83 575.24 575.73 584.24 1149.47 1150.45 1167.48 S 367.52 367.85 373.53 550.78 551.27 559.79 1100.56 1101.54 1118.57 10

11 426.84 427.17 432.85 639.76 640.25 648.76 1278.51 1279.50 1296.52 E 338.51 338.84 344.52 507.27 507.76 516.27 1013.53 1014.51 1031.54 9

12 450.52 450.85 456.52 675.28 675.77 684.28 1349.55 1350.53 1367.56 A 295.50 295.83 301.50 442.75 443.24 451.75 884.48 885.47 902.49 8

13 488.22 488.54 494.22 731.82 732.31 740.83 1462.63 1463.62 1480.64 L 271.82 272.15 277.82 407.23 407.72 416.23 813.45 814.43 831.46 7

14 530.91 531.24 536.92 795.87 796.36 804.87 1590.73 1591.71 1608.74 K 234.13 234.45 240.13 350.68 351.18 359.69 700.36 701.35 718.37 6

15 569.26 569.58 575.26 853.38 853.87 862.39 1705.76 1706.74 1723.77 D 191.43 191.76 197.43 286.64 287.13 295.64 572.27 573.25 590.28 5

16 592.94 593.26 598.94 888.90 889.39 897.91 1776.79 1777.78 1794.80 A 153.09 153.41 159.09 229.12 229.62 238.13 457.24 458.22 475.25 4

17 635.62 635.95 641.63 952.93 953.42 961.93 1904.85 1905.83 1922.86 Q 129.41 129.73 135.41 193.61 194.10 202.61 386.20 387.19 404.21 3

18 678.64 678.96 684.64 1017.45 1017.94 1026.46 2033.89 2034.88 2051.90 E 86.72 87.05 92.72 129.58 130.07 138.58 258.14 259.13 276.16 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

52 70 Figure A.18 MS/MS spectrum of peptide GTEDELDKYNO2SEALKDAQEK , m/z = 738.67+3.

189

52 70 +3 Table A.14 Product ions of GTEDELDKYNO2SEALKDAQEK , m/z = 738.67 .

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 20.01 -- -- 29.52 -- -- 58.03 G 732.67 733.00 738.67 1098.50 1098.99 1107.51 2195.99 2196.98 2214.00 M

2 47.69 -- 53.70 71.04 -- 80.04 141.07 -- 159.08 T 713.66 713.99 719.67 1069.99 1070.48 1079.00 2138.97 2139.96 2156.98 18

3 90.71 -- 96.71 135.56 -- 144.56 270.11 -- 288.12 E 679.98 680.31 685.98 1019.47 1019.96 1028.47 2037.92 2038.91 2055.94 17

4 129.05 -- 135.05 193.07 -- 202.08 385.14 -- 403.15 D 636.97 637.29 642.97 954.94 955.44 963.95 1908.88 1909.87 1926.89 16

5 172.06 -- 178.07 257.59 -- 266.60 514.18 -- 532.19 E 598.62 598.95 604.63 897.43 897.92 906.44 1793.86 1794.84 1811.87 15

6 209.76 -- 215.76 314.13 -- 323.14 627.26 -- 645.27 L 555.61 555.94 561.61 832.91 833.40 841.92 1664.81 1665.80 1682.82 14

7 248.10 -- 254.10 371.65 -- 380.65 742.29 -- 760.30 D 517.91 518.24 523.92 776.37 776.86 785.37 1551.73 1552.71 1569.74 13

190 8 290.80 291.13 296.80 435.70 436.19 444.70 870.38 871.37 888.39 K 479.57 479.90 485.58 718.85 719.35 727.86 1436.70 1437.69 1454.71 12

9 360.15 360.48 366.15 539.72 540.21 548.73 1078.43 1079.42 1096.44 Y 436.87 437.20 442.88 654.81 655.30 663.81 1308.61 1309.59 1326.62 11

10 389.16 389.49 395.16 583.24 583.73 592.24 1165.46 1166.45 1183.47 S 367.52 367.85 373.53 550.78 551.27 559.79 1100.56 1101.54 1118.57 10

11 432.17 432.50 438.18 647.76 648.25 656.76 1294.51 1295.49 1312.52 E 338.51 338.84 344.52 507.27 507.76 516.27 1013.53 1014.51 1031.54 9

12 455.85 456.18 461.86 683.28 683.77 692.28 1365.54 1366.53 1383.55 A 295.50 295.83 301.50 442.75 443.24 451.75 884.48 885.47 902.49 8

13 493.55 493.88 499.55 739.82 740.31 748.82 1478.63 1479.61 1496.64 L 271.82 272.15 277.82 407.23 407.72 416.23 813.45 814.43 831.46 7

14 536.25 536.57 542.25 803.87 804.36 812.87 1606.72 1607.71 1624.73 K 234.13 234.45 240.13 350.68 351.18 359.69 700.36 701.35 718.37 6

15 574.59 574.92 580.59 861.38 861.87 870.38 1721.75 1722.73 1739.76 D 191.43 191.76 197.43 286.64 287.13 295.64 572.27 573.25 590.28 5

16 598.27 598.60 604.27 896.90 897.39 905.90 1792.79 1793.77 1810.80 A 153.09 153.41 159.09 229.12 229.62 238.13 457.24 458.22 475.25 4

17 640.95 641.28 646.96 960.93 961.42 969.93 1920.85 1921.83 1938.86 Q 129.41 129.73 135.41 193.61 194.10 202.61 386.20 387.19 404.21 3

18 683.97 684.30 689.97 1025.45 1025.94 1034.45 2049.89 2050.87 2067.90 E 86.72 87.05 92.72 129.58 130.07 138.58 258.14 259.13 276.16 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

Figure A.19 MS/MS spectrum of peptide 77KATDAEADVASLNR90, m/z = 730.87+2.

Table A.15 Product ions of 77KATDAEADVASLNR90, m/z = 730.87+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- 56.54 65.05 -- 112.08 129.10 K 721.87 722.36 730.87 1442.72 1443.71 1460.73 M 2 -- 92.06 100.57 -- 183.11 200.14 A 657.82 658.31 666.82 1314.63 1315.61 1332.64 13 3 142.09 142.58 151.10 283.18 284.16 301.19 T 622.30 622.79 631.30 1243.59 1244.58 1261.60 12 4 199.61 200.10 208.61 398.20 399.19 416.21 D 571.78 572.27 580.78 1142.54 1143.53 1160.55 11 5 235.12 235.62 244.13 469.24 470.22 487.25 A 514.26 514.75 523.27 1027.52 1028.50 1045.53 10 6 299.65 300.14 308.65 598.28 599.27 616.29 E 478.74 479.24 487.75 956.48 957.46 974.49 9 7 335.16 335.66 344.17 669.32 670.30 687.33 A 414.22 414.71 423.23 827.44 828.42 845.45 8 8 392.68 393.17 401.68 784.35 785.33 802.36 D 378.70 379.20 387.71 756.40 757.38 774.41 7 9 442.21 442.70 451.22 883.42 884.40 901.43 V 321.19 321.68 330.20 641.37 642.36 659.38 6 10 477.73 478.22 486.74 954.45 955.44 972.46 A 271.66 272.15 280.66 542.30 543.29 560.32 5 11 521.25 521.74 530.25 1041.48 1042.47 1059.50 S 236.14 236.63 245.14 471.27 472.25 489.28 4 12 577.79 578.28 586.79 1154.57 1155.55 1172.58 L 192.62 193.11 201.63 384.24 385.22 402.25 3 13 634.81 635.30 643.81 1268.61 1269.60 1286.62 N 136.08 136.57 145.08 271.15 272.14 289.16 2 ------R 79.06 79.55 88.06 157.11 158.09 175.12 1 191

Figure A.20 MS/MS spectrum of peptide 78ATDAEADVASLNR90, m/z = 666.82+2.

Table A.16 Product ions of 78ATDAEADVASLNR90, m/z = 666.82+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 36.53 -- -- 72.04 A 657.82 658.31 666.82 1314.63 1315.61 1332.64 M 2 78.04 -- 87.05 155.08 -- 173.09 T 622.30 622.79 631.30 1243.59 1244.58 1261.60 12 3 135.56 -- 144.56 270.11 -- 288.12 D 571.78 572.27 580.78 1142.54 1143.53 1160.55 11 4 171.08 -- 180.08 341.15 -- 359.16 A 514.26 514.75 523.27 1027.52 1028.50 1045.53 10 5 235.60 -- 244.60 470.19 -- 488.20 E 478.74 479.24 487.75 956.48 957.46 974.49 9 6 271.12 -- 280.12 541.23 -- 559.24 A 414.22 414.71 423.23 827.44 828.42 845.45 8 7 328.63 -- 337.64 656.25 -- 674.26 D 378.70 379.20 387.71 756.40 757.38 774.41 7 8 378.16 -- 387.17 755.32 -- 773.33 V 321.19 321.68 330.20 641.37 642.36 659.38 6 9 413.68 -- 422.69 826.36 -- 844.37 A 271.66 272.15 280.66 542.30 543.29 560.32 5 10 457.20 -- 466.20 913.39 -- 931.40 S 236.14 236.63 245.14 471.27 472.25 489.28 4 11 513.74 -- 522.75 1026.47 -- 1044.48 L 192.62 193.11 201.63 384.24 385.22 402.25 3 12 570.76 571.25 579.77 1140.52 1141.50 1158.53 N 136.08 136.57 145.08 271.15 272.14 289.16 2 ------R 79.06 79.55 88.06 157.11 158.09 175.12 1 192

Figure A.21 MS/MS spectrum of peptide 91RIQLVEEELDR101, m/z = 700.38+2.

Table A.17 Product ions of 91RIQLVEEELDR101, m/z = 700.38+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- 70.54 79.06 -- 140.08 157.11 R 691.38 691.87 700.38 1381.74 1382.73 1399.75 M 2 -- 127.09 135.60 -- 253.17 270.19 I 613.32 613.82 622.33 1225.64 1226.63 1243.65 10 3 -- 191.12 199.63 -- 381.22 398.25 Q 556.78 557.27 565.79 1112.56 1113.54 1130.57 9 4 -- 247.66 256.17 -- 494.31 511.34 L 492.75 493.25 501.76 984.50 985.48 1002.51 8 5 -- 297.19 305.71 -- 593.38 610.40 V 436.21 436.70 445.22 871.42 872.40 889.43 7 6 361.22 361.71 370.23 721.44 722.42 739.45 E 386.68 387.17 395.68 772.35 773.33 790.36 6 7 425.74 426.23 434.75 850.48 851.46 868.49 E 322.16 322.65 331.16 643.30 644.29 661.32 5 8 490.26 490.76 499.27 979.52 980.50 997.53 E 257.63 258.13 266.64 514.26 515.25 532.27 4 9 546.81 547.30 555.81 1092.60 1093.59 1110.62 L 193.11 193.61 202.12 385.22 386.20 403.23 3 10 604.32 604.81 613.32 1207.63 1208.62 1225.64 D 136.57 137.06 145.58 272.14 273.12 290.15 2 ------R 79.06 79.55 88.06 157.11 158.09 175.12 1

193

Figure A.22 MS/MS spectrum of peptide 92IQLVEEELDR101, m/z = 622.33+2.

Table A.18 Product ions of 92IQLVEEELDR101, m/z = 622.33+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 57.55 -- -- 114.09 I 613.32 613.82 622.33 1225.64 1226.63 1243.65 M 2 -- 113.07 121.58 -- 225.12 242.15 Q 556.78 557.27 565.79 1112.56 1113.54 1130.57 9 3 -- 169.61 178.12 -- 338.21 355.23 L 492.75 493.25 501.76 984.50 985.48 1002.51 8 4 -- 219.14 227.65 -- 437.28 454.30 V 436.21 436.70 445.22 871.42 872.40 889.43 7 5 283.17 283.66 292.18 565.33 566.32 583.34 E 386.68 387.17 395.68 772.35 773.33 790.36 6 6 347.69 348.18 356.70 694.38 695.36 712.39 E 322.16 322.65 331.16 643.30 644.29 661.32 5 7 412.21 412.71 421.22 823.42 824.40 841.43 E 257.63 258.13 266.64 514.26 515.25 532.27 4 8 468.76 469.25 477.76 936.50 937.49 954.51 L 193.11 193.61 202.12 385.22 386.20 403.23 3 9 526.27 526.76 535.27 1051.53 1052.51 1069.54 D 136.57 137.06 145.58 272.14 273.12 290.15 2 ------R 79.06 79.55 88.06 157.11 158.09 175.12 1

194

Figure A.23 MS/MS spectrum of peptide 168KLVIIESDLER178, m/z = 657.89+2.

Table A.19 Product ions of 168KLVIIESDLER178, m/z = 657.89+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- 56.54 65.05 -- 112.08 129.10 K 648.88 649.37 657.89 1296.75 1297.74 1314.76 M 2 -- 113.08 121.60 -- 225.16 242.19 L 584.83 585.32 593.84 1168.66 1169.64 1186.67 10 3 -- 162.62 171.13 -- 324.23 341.25 V 528.29 528.78 537.30 1055.57 1056.56 1073.58 9 4 -- 219.16 227.67 -- 437.31 454.34 I 478.76 479.25 487.76 956.50 957.49 974.52 8 5 -- 275.70 284.22 -- 550.40 567.42 I 422.21 422.71 431.22 843.42 844.40 861.43 7 6 339.73 340.22 348.74 678.45 679.44 696.47 E 365.67 366.16 374.68 730.34 731.32 748.35 6 7 383.25 383.74 392.25 765.49 766.47 783.50 S 301.15 301.64 310.16 601.29 602.28 619.30 5 8 440.76 441.25 449.77 880.51 881.50 898.52 D 257.63 258.13 266.64 514.26 515.25 532.27 4 9 497.30 497.79 506.31 993.60 994.58 1011.61 L 200.12 200.61 209.13 399.24 400.22 417.25 3 10 561.82 562.32 570.83 1122.64 1123.62 1140.65 E 143.58 144.07 152.58 286.15 287.13 304.16 2 ------R 79.06 79.55 88.06 157.11 158.09 175.12 1

195

Figure A.24 MS/MS spectrum of peptide 169LVIIESDLER178, m/z = 593.84+2.

Table A.20 Product ions of 169LVIIESDLER178, m/z = 593.84+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 57.55 -- -- 114.09 L 584.83 585.32 593.84 1168.66 1169.64 1186.67 M 2 -- -- 107.08 -- -- 213.16 V 528.29 528.78 537.30 1055.57 1056.56 1073.58 9 3 -- -- 163.63 -- -- 326.24 I 478.76 479.25 487.76 956.50 957.49 974.52 8 4 -- -- 220.17 -- -- 439.33 I 422.21 422.71 431.22 843.42 844.40 861.43 7 5 275.68 -- 284.69 550.36 -- 568.37 E 365.67 366.16 374.68 730.34 731.32 748.35 6 6 319.20 -- 328.20 637.39 -- 655.40 S 301.15 301.64 310.16 601.29 602.28 619.30 5 7 376.71 -- 385.72 752.42 -- 770.43 D 257.63 258.13 266.64 514.26 515.25 532.27 4 8 433.26 -- 442.26 865.50 -- 883.51 L 200.12 200.61 209.13 399.24 400.22 417.25 3 9 497.78 -- 506.78 994.55 -- 1012.56 E 143.58 144.07 152.58 286.15 287.13 304.16 2 R 175.12 1 ------79.06 79.55 88.06 157.11 158.09

196

Figure A.25 MS/MS spectrum of peptide 214YSQKEDKYEEEIK226, m/z = 563.61+3.

197

Table A.21 Product ions of 214YSQKEDKYEEEIK226, m/z = 563.61+3.

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 55.36 -- -- 82.54 -- -- 164.07 Y 557.60 557.93 563.61 835.90 836.39 844.90 1670.79 1671.77 1688.80 M

2 78.37 -- 84.37 117.05 -- 126.05 233.09 -- 251.10 S 503.25 503.58 509.25 754.37 754.86 763.37 1507.73 1508.71 1525.74 12

3 121.06 121.38 127.06 181.08 181.57 190.08 361.15 362.13 379.16 Q 474.24 474.56 480.24 710.85 711.34 719.86 1420.70 1421.68 1438.71 11

4 163.75 164.08 169.76 245.13 245.62 254.13 489.25 490.23 507.26 K 431.55 431.88 437.55 646.82 647.31 655.83 1292.64 1293.62 1310.65 10

5 206.77 207.10 212.77 309.65 310.14 318.65 618.29 619.27 636.30 E 388.85 389.18 394.86 582.77 583.27 591.78 1164.54 1165.53 1182.55 9

198 6 245.11 245.44 251.11 367.16 367.65 376.17 733.32 734.30 751.33 D 345.84 346.17 351.84 518.25 518.75 527.26 1035.50 1036.48 1053.51 8

7 287.81 288.14 293.81 431.21 431.70 440.21 861.41 862.39 879.42 K 307.50 307.82 313.50 460.74 461.23 469.75 920.47 921.46 938.48 7

8 342.16 342.49 348.17 512.74 513.23 521.75 1024.47 1025.46 1042.48 Y 264.80 265.13 270.80 396.69 397.18 405.70 792.38 793.36 810.39 6

9 385.18 385.50 391.18 577.26 577.75 586.27 1153.52 1154.50 1171.53 E 210.44 210.77 216.45 315.16 315.65 324.17 629.31 630.30 647.32 5

10 428.19 428.52 434.19 641.78 642.27 650.79 1282.56 1283.54 1300.57 E 167.43 167.76 173.43 250.64 251.13 259.64 500.27 501.26 518.28 4

11 471.21 471.53 477.21 706.30 706.80 715.31 1411.60 1412.59 1429.61 E 124.41 124.74 130.42 186.12 186.61 195.12 371.23 372.21 389.24 3

12 508.90 509.23 514.90 762.85 763.34 771.85 1524.69 1525.67 1542.70 I 81.40 81.73 87.40 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

214 226 Figure A.26 MS/MS spectrum of peptide YNOSQKEDKYEEEIK , m/z = 573.27+3.

199

214 226 +3 Table A.22 Product ions of YNOSQKEDKYEEEIK , m/z = 573.27 .

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 65.03 -- -- 97.03 -- -- 193.06 Y 567.27 567.59 573.27 850.39 850.89 859.40 1699.78 1700.76 1717.79 M

2 88.03 -- 94.04 131.54 -- 140.55 262.08 -- 280.09 S 503.25 503.58 509.25 754.37 754.86 763.37 1507.73 1508.71 1525.74 12

3 130.72 131.05 136.72 195.57 196.07 204.58 390.14 391.12 408.15 Q 474.24 474.56 480.24 710.85 711.34 719.86 1420.70 1421.68 1438.71 11

4 173.42 173.74 179.42 259.62 260.11 268.63 518.24 519.22 536.25 K 431.55 431.88 437.55 646.82 647.31 655.83 1292.64 1293.62 1310.65 10

5 216.43 216.76 222.43 324.14 324.63 333.15 647.28 648.26 665.29 E 388.85 389.18 394.86 582.77 583.27 591.78 1164.54 1165.53 1182.55 9

200 6 254.77 255.10 260.78 381.66 382.15 390.66 762.31 763.29 780.32 D 345.84 346.17 351.84 518.25 518.75 527.26 1035.50 1036.48 1053.51 8

7 297.47 297.80 303.48 445.70 446.20 454.71 890.40 891.38 908.41 K 307.50 307.82 313.50 460.74 461.23 469.75 920.47 921.46 938.48 7

8 351.83 352.15 357.83 527.24 527.73 536.24 1053.46 1054.45 1071.47 Y 264.80 265.13 270.80 396.69 397.18 405.70 792.38 793.36 810.39 6

9 394.84 395.17 400.84 591.76 592.25 600.76 1182.51 1183.49 1200.52 E 210.44 210.77 216.45 315.16 315.65 324.17 629.31 630.30 647.32 5

10 437.85 438.18 443.86 656.28 656.77 665.28 1311.55 1312.53 1329.56 E 167.43 167.76 173.43 250.64 251.13 259.64 500.27 501.26 518.28 4

11 480.87 481.20 486.87 720.80 721.29 729.80 1440.59 1441.58 1458.60 E 124.41 124.74 130.42 186.12 186.61 195.12 371.23 372.21 389.24 3

12 518.56 518.89 524.57 777.34 777.83 786.35 1553.68 1554.66 1571.69 I 81.40 81.73 87.40 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

214 226 Figure A.27 MS/MS spectrum of peptide YNO2SQKEDKYEEEIK , m/z = 578.60+3.

201

214 226 +3 Table A.23 Product ions of YNO2SQKEDKYEEEIK , m/z = 578.60 .

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 70.36 -- -- 105.03 -- -- 209.06 Y 572.60 572.92 578.60 858.39 858.88 867.40 1715.78 1716.76 1733.79 M

2 93.36 -- 99.37 139.54 -- 148.55 278.08 -- 296.09 S 503.25 503.58 509.25 754.37 754.86 763.37 1507.73 1508.71 1525.74 12

3 136.05 136.38 142.05 203.57 204.06 212.58 406.14 407.12 424.15 Q 474.24 474.56 480.24 710.85 711.34 719.86 1420.70 1421.68 1438.71 11

4 178.75 179.08 184.75 267.62 268.11 276.62 534.23 535.21 552.24 K 431.55 431.88 437.55 646.82 647.31 655.83 1292.64 1293.62 1310.65 10

5 221.76 222.09 227.77 332.14 332.63 341.15 663.27 664.26 681.28 E 388.85 389.18 394.86 582.77 583.27 591.78 1164.54 1165.53 1182.55 9

202 6 260.10 260.43 266.11 389.65 390.15 398.66 778.30 779.28 796.31 D 345.84 346.17 351.84 518.25 518.75 527.26 1035.50 1036.48 1053.51 8

7 302.80 303.13 308.81 453.70 454.19 462.71 906.40 907.38 924.41 K 307.50 307.82 313.50 460.74 461.23 469.75 920.47 921.46 938.48 7

8 357.16 357.49 363.16 535.23 535.72 544.24 1069.46 1070.44 1087.47 Y 264.80 265.13 270.80 396.69 397.18 405.70 792.38 793.36 810.39 6

9 400.17 400.50 406.18 599.75 600.25 608.76 1198.50 1199.49 1216.51 E 210.44 210.77 216.45 315.16 315.65 324.17 629.31 630.30 647.32 5

10 443.19 443.51 449.19 664.28 664.77 673.28 1327.54 1328.53 1345.55 E 167.43 167.76 173.43 250.64 251.13 259.64 500.27 501.26 518.28 4

11 486.20 486.53 492.20 728.80 729.29 737.80 1456.59 1457.57 1474.60 E 124.41 124.74 130.42 186.12 186.61 195.12 371.23 372.21 389.24 3

12 523.89 524.22 529.90 785.34 785.83 794.34 1569.67 1570.65 1587.68 I 81.40 81.73 87.40 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

214 226 Figure A.28 MS/MS spectrum of peptide YSQKEDKYNO2EEEIK , m/z = 578.60+3.

203

214 226 +3 Table A.24 Product ions of YSQKEDKYNO2EEEIK , m/z = 578.60 .

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 55.36 -- -- 82.54 -- -- 164.07 Y 572.60 572.92 578.60 858.39 858.88 867.40 1715.78 1716.76 1733.79 M

2 78.37 -- 84.37 117.05 -- 126.05 233.09 -- 251.10 S 518.24 518.57 524.25 776.86 777.35 785.87 1552.71 1553.70 1570.72 12

3 121.06 121.38 127.06 181.08 181.57 190.08 361.15 362.13 379.16 Q 489.23 489.56 495.24 733.34 733.84 742.35 1465.68 1466.66 1483.69 11

4 163.75 164.08 169.76 245.13 245.62 254.13 489.25 490.23 507.26 K 446.55 446.87 452.55 669.31 669.81 678.32 1337.62 1338.61 1355.63 10

5 206.77 207.10 212.77 309.65 310.14 318.65 618.29 619.27 636.30 E 403.85 404.18 409.85 605.27 605.76 614.27 1209.53 1210.51 1227.54 9

204 6 245.11 245.44 251.11 367.16 367.65 376.17 733.32 734.30 751.33 D 360.83 361.16 366.84 540.75 541.24 549.75 1080.48 1081.47 1098.49 8

7 287.81 288.14 293.81 431.21 431.70 440.21 861.41 862.39 879.42 K 322.49 322.82 328.49 483.23 483.72 492.24 965.46 966.44 983.47 7

8 357.16 357.49 363.16 535.23 535.72 544.24 1069.46 1070.44 1087.47 Y 279.79 280.12 285.80 419.18 419.68 428.19 837.36 838.35 855.37 6

9 400.17 400.50 406.18 599.75 600.25 608.76 1198.50 1199.49 1216.51 E 210.44 210.77 216.45 315.16 315.65 324.17 629.31 630.30 647.32 5

10 443.19 443.51 449.19 664.28 664.77 673.28 1327.54 1328.53 1345.55 E 167.43 167.76 173.43 250.64 251.13 259.64 500.27 501.26 518.28 4

11 486.20 486.53 492.20 728.80 729.29 737.80 1456.59 1457.57 1474.60 E 124.41 124.74 130.42 186.12 186.61 195.12 371.23 372.21 389.24 3

12 523.89 524.22 529.90 785.34 785.83 794.34 1569.67 1570.65 1587.68 I 81.40 81.73 87.40 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

214 226 Figure A.29 MS/MS spectrum of peptide YNO2SQKEDKYNO2EEEIK , m/z = 593.60+3.

205

214 226 +3 Table A.25 Product ions of YNO2SQKEDKYNO2EEEIK , m/z = 593.60 .

# b'+3 b*+3 b+3 b'++ b*++ b++ b'+ b*+ b+ seq y'+3 y*+3 y+3 y'++ y*++ y++ y'+ y*+ y+ #

1 -- -- 70.36 -- -- 105.03 -- -- 209.06 Y 587.59 587.92 593.60 880.88 881.38 889.89 1760.76 1761.74 1778.77 M

2 93.36 -- 99.37 139.54 -- 148.55 278.08 -- 296.09 S 518.24 518.57 524.25 776.86 777.35 785.87 1552.71 1553.70 1570.72 12

3 136.05 136.38 142.05 203.57 204.06 212.58 406.14 407.12 424.15 Q 489.23 489.56 495.24 733.34 733.84 742.35 1465.68 1466.66 1483.69 11

4 178.75 179.08 184.75 267.62 268.11 276.62 534.23 535.21 552.24 K 446.55 446.87 452.55 669.31 669.81 678.32 1337.62 1338.61 1355.63 10

5 221.76 222.09 227.77 332.14 332.63 341.15 663.27 664.26 681.28 E 403.85 404.18 409.85 605.27 605.76 614.27 1209.53 1210.51 1227.54 9

206 6 260.10 260.43 266.11 389.65 390.15 398.66 778.30 779.28 796.31 D 360.83 361.16 366.84 540.75 541.24 549.75 1080.48 1081.47 1098.49 8

7 302.80 303.13 308.81 453.70 454.19 462.71 906.40 907.38 924.41 K 322.49 322.82 328.49 483.23 483.72 492.24 965.46 966.44 983.47 7

8 372.15 372.48 378.16 557.73 558.22 566.73 1114.44 1115.43 1132.45 Y 279.79 280.12 285.80 419.18 419.68 428.19 837.36 838.35 855.37 6

9 415.17 415.49 421.17 622.25 622.74 631.25 1243.49 1244.47 1261.50 E 210.44 210.77 216.45 315.16 315.65 324.17 629.31 630.30 647.32 5

10 458.18 458.51 464.18 686.77 687.26 695.77 1372.53 1373.51 1390.54 E 167.43 167.76 173.43 250.64 251.13 259.64 500.27 501.26 518.28 4

11 501.20 501.52 507.20 751.29 751.78 760.29 1501.57 1502.56 1519.58 E 124.41 124.74 130.42 186.12 186.61 195.12 371.23 372.21 389.24 3

12 538.89 539.22 544.89 807.83 808.32 816.84 1614.66 1615.64 1632.67 I 81.40 81.73 87.40 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 43.71 44.03 49.71 65.05 65.55 74.06 129.10 130.09 147.11 1

Figure A.30 MS/MS spectrum of peptide 218EDKYEEEIK226, m/z = 591.78+2.

Table A.26 Product ions of 218EDKYEEEIK226, m/z = 591.78+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 56.52 -- 65.53 112.04 -- 130.05 E 582.77 583.27 591.78 1164.54 1165.53 1182.55 M 2 114.04 -- 123.04 227.07 -- 245.08 D 518.25 518.75 527.26 1035.50 1036.48 1053.51 8 3 178.08 178.58 187.09 355.16 356.15 373.17 K 460.74 461.23 469.75 920.47 921.46 938.48 7 4 259.62 260.11 268.62 518.22 519.21 536.24 Y 396.69 397.18 405.70 792.38 793.36 810.39 6 5 324.14 324.63 333.14 647.27 648.25 665.28 E 315.16 315.65 324.17 629.31 630.30 647.32 5 6 388.66 389.15 397.66 776.31 777.29 794.32 E 250.64 251.13 259.64 500.27 501.26 518.28 4 7 453.18 453.67 462.19 905.35 906.34 923.36 E 186.12 186.61 195.12 371.23 372.21 389.24 3 8 509.72 510.21 518.73 1018.44 1019.42 1036.45 I 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1

207

218 226 +2 Figure A.31 MS/MS spectrum of peptide EDKYNOEEEIK , m/z = 606.27 .

218 226 +2 Table A.27 Product ions of EDKYNOEEEIK , m/z = 606.27 .

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 56.52 -- 65.53 112.04 -- 130.05 E 597.27 597.76 606.27 1193.53 1194.52 1211.54 M 2 114.04 -- 123.04 227.07 -- 245.08 D 532.75 533.24 541.75 1064.49 1065.47 1082.50 8 3 178.08 178.58 187.09 355.16 356.15 373.17 K 475.23 475.73 484.24 949.46 950.45 967.47 7 4 274.11 274.60 283.12 547.21 548.20 565.23 Y 411.19 411.68 420.19 821.37 822.35 839.38 6 5 338.63 339.12 347.64 676.26 677.24 694.27 E 315.16 315.65 324.17 629.31 630.30 647.32 5 6 403.15 403.65 412.16 805.30 806.28 823.31 E 250.64 251.13 259.64 500.27 501.26 518.28 4 7 467.67 468.17 476.68 934.34 935.33 952.35 E 186.12 186.61 195.12 371.23 372.21 389.24 3 8 524.22 524.71 533.22 1047.43 1048.41 1065.44 I 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1

208

218 226 +2 Figure A.32 MS/MS spectrum of peptide EDKYNO2EEEIK , m/z = 614.27 .

218 226 +2 Table A.28 Product ions of EDKYNO2EEEIK , m/z = 614.27 .

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 56.52 -- 65.53 112.04 -- 130.05 E 605.27 605.76 614.27 1209.53 1210.51 1227.54 M 2 114.04 -- 123.04 227.07 -- 245.08 D 540.75 541.24 549.75 1080.48 1081.47 1098.49 8 3 178.08 178.58 187.09 355.16 356.15 373.17 K 483.23 483.72 492.24 965.46 966.44 983.47 7 4 282.11 282.60 291.11 563.21 564.19 581.22 Y 419.18 419.68 428.19 837.36 838.35 855.37 6 5 346.63 347.12 355.64 692.25 693.24 710.26 E 315.16 315.65 324.17 629.31 630.30 647.32 5 6 411.15 411.64 420.16 821.29 822.28 839.31 E 250.64 251.13 259.64 500.27 501.26 518.28 4 7 475.67 476.16 484.68 950.34 951.32 968.35 E 186.12 186.61 195.12 371.23 372.21 389.24 3 8 532.21 532.71 541.22 1063.42 1064.41 1081.43 I 121.60 122.09 130.60 242.19 243.17 260.20 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1

209

Figure A.33 MS/MS spectrum of peptide 252SIDDLEDELYAQK264, m/z = 769.86+2.

Table A.29 Product ions of 252SIDDLEDELYAQK264, m/z = 769.86+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 35.52 -- 44.52 70.03 -- 88.04 S 760.86 761.35 769.86 1520.71 1521.70 1538.72 M 2 92.06 -- 101.07 183.11 -- 201.12 I 717.34 717.84 726.35 1433.68 1434.66 1451.69 12 3 149.57 -- 158.58 298.14 -- 316.15 D 660.80 661.29 669.81 1320.60 1321.58 1338.61 11 4 207.09 -- 216.09 413.17 -- 431.18 D 603.29 603.78 612.29 1205.57 1206.55 1223.58 10 5 263.63 -- 272.63 526.25 -- 544.26 L 545.77 546.27 554.78 1090.54 1091.53 1108.55 9 6 328.15 -- 337.16 655.29 -- 673.30 E 489.23 489.72 498.24 977.46 978.44 995.47 8 7 385.66 -- 394.67 770.32 -- 788.33 D 424.71 425.20 433.72 848.41 849.40 866.43 7 8 450.19 -- 459.19 899.36 -- 917.37 E 367.20 367.69 376.20 733.39 734.37 751.40 6 9 506.73 -- 515.73 1012.45 -- 1030.46 L 302.68 303.17 311.68 604.35 605.33 622.36 5 10 588.26 -- 597.26 1175.51 -- 1193.52 Y 246.13 246.63 255.14 491.26 492.25 509.27 4 11 623.78 -- 632.78 1246.55 -- 1264.56 A 164.60 165.09 173.61 328.20 329.18 346.21 3 12 687.81 688.30 696.81 1374.61 1375.59 1392.62 Q 129.08 129.58 138.09 257.16 258.14 275.17 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1 210

252 264 Figure A.34 MS/MS spectrum of peptide SIDDLEDELYNOAQK , m/z = 784.36+2.

252 264 +2 Table A.30 Product ions of SIDDLEDELYNOAQK , m/z = 784.36 .

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 35.52 -- 44.52 70.03 -- 88.04 S 775.35 775.85 784.36 1549.70 1550.69 1567.71 M 2 92.06 -- 101.07 183.11 -- 201.12 I 731.84 732.33 740.84 1462.67 1463.65 1480.68 12 3 149.57 -- 158.58 298.14 -- 316.15 D 675.30 675.79 684.30 1349.59 1350.57 1367.60 11 4 207.09 -- 216.09 413.17 -- 431.18 D 617.78 618.27 626.79 1234.56 1235.54 1252.57 10 5 263.63 -- 272.63 526.25 -- 544.26 L 560.27 560.76 569.27 1119.53 1120.52 1137.54 9 6 328.15 -- 337.16 655.29 -- 673.30 E 503.73 504.22 512.73 1006.45 1007.43 1024.46 8 7 385.66 -- 394.67 770.32 -- 788.33 D 439.21 439.70 448.21 877.41 878.39 895.42 7 8 450.19 -- 459.19 899.36 -- 917.37 E 381.69 382.18 390.70 762.38 763.36 780.39 6 9 506.73 -- 515.73 1012.45 -- 1030.46 L 317.17 317.66 326.18 633.34 634.32 651.35 5 10 602.75 -- 611.76 1204.50 -- 1222.51 Y 260.63 261.12 269.63 520.25 521.24 538.26 4 11 638.27 -- 647.28 1275.54 -- 1293.55 A 164.60 165.09 173.61 328.20 329.18 346.21 3 12 702.30 702.79 711.31 1403.60 1404.58 1421.61 Q 129.08 129.58 138.09 257.16 258.14 275.17 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1 211

252 264 Figure A.35 MS/MS spectrum of peptide SIDDLEDELYNO2AQK , m/z = 792.36+2.

252 264 +2 Table A.31 Product ions of SIDDLEDELYNO2AQK , m/z = 792.36 .

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 35.52 -- 44.52 70.03 -- 88.04 S 783.35 783.84 792.36 1565.70 1566.68 1583.71 M 2 92.06 -- 101.07 183.11 -- 201.12 I 739.84 740.33 748.84 1478.66 1479.65 1496.68 12 3 149.57 -- 158.58 298.14 -- 316.15 D 683.29 683.79 692.30 1365.58 1366.56 1383.59 11 4 207.09 -- 216.09 413.17 -- 431.18 D 625.78 626.27 634.79 1250.55 1251.54 1268.56 10 5 263.63 -- 272.63 526.25 -- 544.26 L 568.27 568.76 577.27 1135.53 1136.51 1153.54 9 6 328.15 -- 337.16 655.29 -- 673.30 E 511.72 512.22 520.73 1022.44 1023.43 1040.45 8 7 385.66 -- 394.67 770.32 -- 788.33 D 447.20 447.70 456.21 893.40 894.38 911.41 7 8 450.19 -- 459.19 899.36 -- 917.37 E 389.69 390.18 398.70 778.37 779.36 796.38 6 9 506.73 -- 515.73 1012.45 -- 1030.46 L 325.17 325.66 334.17 649.33 650.31 667.34 5 10 610.75 -- 619.76 1220.50 -- 1238.51 Y 268.63 269.12 277.63 536.25 537.23 554.26 4 11 646.27 -- 655.28 1291.53 -- 1309.54 A 164.60 165.09 173.61 328.20 329.18 346.21 3 12 710.30 710.79 719.30 1419.59 1420.58 1437.60 Q 129.08 129.58 138.09 257.16 258.14 275.17 2 ------K 65.05 65.55 74.06 129.10 130.09 147.11 1 212

Figure A.36 MS/MS spectrum of peptide 269AISEELDHALNDMTSI284, m/z = 879.91+2.

Table A.32 Product ions of 269AISEELDHALNDMTSI284, m/z = 879.91+2.

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 36.53 -- -- 72.04 A 870.91 871.40 879.91 1740.81 1741.79 1758.82 M 2 -- -- 93.07 -- -- 185.13 I 835.39 835.88 844.40 1669.77 1670.76 1687.78 15 3 127.58 -- 136.58 254.15 -- 272.16 S 778.85 779.34 787.85 1556.69 1557.67 1574.70 14 4 192.10 -- 201.11 383.19 -- 401.20 E 735.33 735.82 744.34 1469.66 1470.64 1487.67 13 5 256.62 -- 265.63 512.24 -- 530.25 E 670.81 671.30 679.82 1340.62 1341.60 1358.63 12 6 313.16 -- 322.17 625.32 -- 643.33 L 606.29 606.78 615.30 1211.57 1212.56 1229.58 11 7 370.68 -- 379.68 740.35 -- 758.36 D 549.75 550.24 558.75 1098.49 1099.47 1116.50 10 8 439.21 -- 448.21 877.41 -- 895.42 H 492.23 492.73 501.24 983.46 984.45 1001.47 9 9 474.72 -- 483.73 948.44 -- 966.45 A 423.70 424.20 432.71 846.40 847.39 864.41 8 10 531.27 -- 540.27 1061.53 -- 1079.54 L 388.19 388.68 397.19 775.37 776.35 793.38 7 11 588.29 588.78 597.29 1175.57 1176.55 1193.58 N 331.64 332.14 340.65 662.28 663.27 680.29 6 12 645.80 646.29 654.81 1290.60 1291.58 1308.61 D 274.62 -- 283.63 548.24 -- 566.25 5 13 711.32 711.81 720.33 1421.64 1422.62 1439.65 M 217.11 -- 226.11 433.21 -- 451.22 4 14 761.85 762.34 770.85 1522.68 1523.67 1540.69 T 151.59 -- 160.59 302.17 -- 320.18 3 15 805.36 805.85 814.37 1609.72 1610.70 1627.73 S 101.07 -- 110.07 201.12 -- 219.13 2 ------I 57.55 -- 66.55 114.09 -- 132.10 1 213

269 284 Figure A.37 MS/MS spectrum of peptide AISEELDHALNDMOXTSI , m/z = 887.91+2.

269 284 +2 Table A.33 Product ions of AISEELDHALNDMOXTSI , m/z = 887.91 .

# b'++ b*++ b++ b'+ b*+ b+ seq y'++ y*++ y++ y'+ y*+ y+ # 1 -- -- 36.53 -- -- 72.04 A 878.91 879.40 887.91 1756.81 1757.79 1774.82 M 2 -- -- 93.07 -- -- 185.13 I 843.39 843.88 852.39 1685.77 1686.75 1703.78 15 3 127.58 -- 136.58 254.15 -- 272.16 S 786.85 787.34 795.85 1572.68 1573.67 1590.70 14 4 192.10 -- 201.11 383.19 -- 401.20 E 743.33 743.82 752.34 1485.65 1486.64 1503.66 13 5 256.62 -- 265.63 512.24 -- 530.25 E 678.81 679.30 687.81 1356.61 1357.59 1374.62 12 6 313.16 -- 322.17 625.32 -- 643.33 L 614.29 614.78 623.29 1227.57 1228.55 1245.58 11 7 370.68 -- 379.68 740.35 -- 758.36 D 557.75 558.24 566.75 1114.48 1115.47 1132.49 10 8 439.21 -- 448.21 877.41 -- 895.42 H 500.23 500.72 509.24 999.46 1000.44 1017.47 9 9 474.72 -- 483.73 948.44 -- 966.45 A 431.70 432.19 440.71 862.40 863.38 880.41 8 10 531.27 -- 540.27 1061.53 -- 1079.54 L 396.18 396.68 405.19 791.36 792.34 809.37 7 11 588.29 588.78 597.29 1175.57 1176.55 1193.58 N 339.64 340.13 348.65 678.28 679.26 696.29 6 12 645.80 646.29 654.81 1290.60 1291.58 1308.61 D 282.62 -- 291.63 564.23 -- 582.24 5 13 719.32 719.81 728.32 1437.63 1438.62 1455.64 M 225.11 -- 234.11 449.21 -- 467.22 4 14 769.84 770.34 778.85 1538.68 1539.66 1556.69 T 151.59 -- 160.59 302.17 -- 320.18 3 15 813.36 813.85 822.36 1625.71 1626.70 1643.72 S 101.07 -- 110.07 201.12 -- 219.13 2 ------I 57.55 -- 66.55 114.09 -- 132.10 1 214