DOCSLIB.ORG

ESCMID Online Lecture Library © by Author

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ESCMID Online Lecture Library © by Author Echinococcosis and other zoonotic helminths Echinococcus, Toxocara en Trichinella Titia Kortbeek Titia Kortbeek thanks to [email protected] Joke van der Giessen Center for Disease Controle The Netherlands National institute Public Health 1 2 © by author ESCMID Online Lecture Library Bilthoven Centre for Infectious disease control Netherlands National Institute for Public Health and the environment 1 National Coordination Centre for Communicable Disease Control National Coordination Centre for Communicable Disease Control the Netherlands ● Joke van der Giessen, veterinarian-microbiologist/parasitologist and head of NRL- ● Titia Kortbeek; medical microbiologist, special focus on parasitology and public foodborne and zoonotic parasites health ● Reports of trends Echinococcus granulosus trends in NL :since 1992 – Research risk Echinococcus multilocularis in foxes since 1996 – Echinococcus multilocularis humans: seroprevalence study Pienter2 (2006-7) – International projects since 1998: EURreg and Echinorisk – ESCMID study group for clinical parasitology, subgroup Echinococcus ESCMID: Basic course parasitology Ankara 2011 5 6 19 april One Health © by author ESCMID Online Lecture Library For more information about the studygroup www.escmid.org/esgcp 7 2 This is only the beginning Reportable diseases humans: • Advanced courses (hopefully 2016) Different per country • ECCMID sessions: Educational workshops ; symposia etc. All Europese memberstates have to report yearly to ECDC (European Center of Desease Control) for a list of parasites. • Conferences and congresses : specific (tropical medicine; Toxoplasma, Giardia and Cryptosporidium etc) or general ● http://www.ecdc.europa.eu/ ● Surveillance reports (ICOPA : 2018 and EMOP : Finland 2016) ● FWBP initiative • National meetings: e.g. Echinococcus Romania October 2015 © by author Notification veterinary: Which parasites are notifiable in the NL? Per country different Human Veterinary Reportable zoonosis have to be notified to European Food Safety ● Trichinella ● Trichinella ESCMIDAuthority (EFSA) Parma Italy Online Lecture Library ● Malaria ● Echinococcus EU Reference laboratory parasitic diseases: Instituto Superiore Sanita in Rome: Eduardo Pozio ● Cysticercosis ( Taenia saginata) National Reference laboratories in all memberstates Regulation by OIA: including methods that have to be used. ● Toxoplasma 3 Case 1 Echinococcosis granulosus and multilocularis Dutch female, born 1961 ● Both zoonotic No travel history ● Both cestodes ● Public health concern (spreading by dogs and foxes ) Medical history: ● operated in 1975 for lung disease, due to contact with sheep Endemic in Europe and Northern hemisfere (diagnosis unknown at moment of presentation) – Echinococcus granulosus in mediterranean area – Echinococcus multilocularis in Central and Eastern Europe; endemic in ● Pain in the back and right upper quadrant ; increasing in few China days ● Echinococcus multilocularis is emerging in Europe and Asia What do you want to know? © by author Case 1 ● CRP 180; ● Eosinophiles:1.28 (N: 0.4); ESCMID● Liver function normal Online Lecture Library ● Gallbladder : N 4 Case 1 Case 1 Therapy: Old medical information: – Operation 1975: Echinococcus granulosus of the lungs ● PAIR (puncture, aspiration, injection, reaspiration) Serology: ● Albendazol 3 courses of three weeks. ● Echinococcus ELISA positive 1:80 – The procedure was complicated due to an infection – Immunoblot IgG1 and IgG4: IgG1 positive with S. aureus. She was treated with clindamycin oraly Cystfluid: Protoscolices positive PCR and sequencing: typing CO1 and NADH: G5 strain (Dutch ● 3 months later: The CRP had dropped to 12. cattle strain) Where did this echinococcus come from? © by author Patient was given a dog for her 11th birthday. The dog died when she was 17. There were no other contact with dogs or travels to endemic ESCMIDareas. Online Lecture Library 5 Dog Dog Sheep Echinococcus granulosus Cervid G1,G2, G3, E.granulosus s.s. ● Hydatic echinococcosis G8/10, ● Sheep strain G1, G2, G3 common in South Europe Dog Dog – Most pathogen to humans Cattle Pig – Not only in sheep: also in cattle › Romenian cattle imported in the Netherlands G6, E.ortoleppi G7, ● Pig strain : emerging in Eastern part of Europe (e.g. Dog Baltics) due to home slaughter ; close contact dogs – Horse, Donkey Dog humans G4, E.equinus Camel G6, Thompson, McManus Trends 22 Parasitology 2002 © by author E.granulosus Echinococcus granulosus Clinical symptoms : ● Depending on location and destruction ● Cysto-biliar fistula ● Obstruction of biliary duct Photo courtesy of Greg ESCMID● anafylactic reaction due to leakage Online cyst LectureNelsen Library ● Metastases due to ruptures ● secundary bacterial infections ● Invasion of other organs: – pulmonary obstructions, destruction of bones etc. http://med.ege.edu.tr/~norolbil/1999/Cysthydatid.jpg 6 Pictures courtesy Dr. Stoot, Maastricht liver spleen 25 © by author Lumbal vertebra Destruction of the bone ESCMID Online Lecture Library Femur Pictures courtesy Dr. Stoot, Maastricht 28 Eg,Em & Tsol2010 7 Classification of ultrasound Echinococcus cysts: http://www.who.int/emc-documents/zoonoses/docs/ whocdscsraph20016.pdf 29 Eg,Em & Tsol2010 © by author diagnostics Cyst and daughter Always combination: cysts ESCMID● Imaging Online Lecture Library ● Serology – If possible: PCR ● Clinical history 8 Diagnostics: serology Commercial kits protoscolices ● Haemagglutionation ● Immunoblotting We use: Home made ELISA Home made immunoblot IgG1 en IgG4 Why? – Long during experience: > 30 year same test, same antigens etc – Trends in time – Independent from producers: › Change of kit without informing client › Delivery problems (for Europa: EC mark/ transport problems) › Costs © by author Sensitivy Sera echinococcosis patients 24kD Therapy 16kD ● Uncomplicated single cyst: surgery 8k ESCMIDIgG1 OnlineD Lecture Library ● Multiple cysts or complicated cysts/patients – Albendazol – PAIR (puncture, aspiration, injection, reaspiration) 24kD 16kD IgG4 8k D 9 PAIR teaching 30-2742372 © by author Echinococcus granulosus in NL ● Tineke Herremans, Jaco J. Verweij, Hans G. Schipper, Mariël Casparie, Lisette van Lieshout, Elena Pinelli en Titia Kortbeek Afname van echinokokkose in Nederland; 1997-2008. Ned Tijdschr Geneeskd. 2010;154:A2297 ESCMID Online Lecture Library 39 10 See ECCMID website https://www.escmid.org/escmid_library/online_lecture_library S272: Symposium ● New trends in the management and treatment of Echinococcus granulosus ● Carmen Cretu, Bukarest, Romania S271 Symposium ● New trends in the management and treatment of Echinococcus multilocularis ● Beate Grüner, Ulm, Germany 41 © by author Echinococcose ESCMID Online Lecture Library Hippocrates 470-375 v Chr Rudolf Virchow 1821-1902 Since ancient times hydatide cysten known in humans and animals. Hippocrates descibed it as a liver full of water ( hydatis = drop of water). 43 44 11 Foto: dank aan Annette Stemerdink Echinococcus multilocularis= zoonosis ● Fox tapeworm ● Intestinal parasite ● Definite and intermediate host Small tapeworm (1,5-4,5 mm) Torgerson et al. 2010 45 46 © by author Echinococcus ESCMID Online Lecturemultilocularis Library 0.5 mm Echinococcus multilocularis isolated from a fox in Hungary. 12 case Hydatide E.multilocularis ● Female, 55 years old ● Medical history: – liposarcoma : first episode in 1993 – Several relapses ● Beginning of 2008 cervical pain – metastasis liposarcoma? ● Imaging April 2008: – PET-CT: PET negative but…. © by author Regular CT Case : continuation ● Start Chemotherapy june/july 2008 ● Imaging July 2008: no change ESCMID Online Lecture● Partial hepatectomy augustus Library 2008 – 3 lesions resected ● Pathology: Echinococcosis ? Cystic structures in necrotic leasions with a thick pink ( eosinophilic) wall Picture: courtesy Laura van Dommelen Maastricht 13 Case : continuation Serology E.granulosus positive Case : continuation ● Serology november 2008 (RIVM) ● Start Chemotherapy june/july 2008 – ELISA E.granulosus 1:80 ● Imaging July 2008: no change – Immunoblot IgG1 positive – Immunoblot IgG4 negative ● Partial hepatectomy augustus 2008 – 3 lesions resected plus – ELISA E.multilocularis Em2 negative ● Pathology: Echinococcosis ? © by author Molecular detection: Alignment with DQ979365 PCR CO1 PCR NADH PCR Echinococcus multilocularis isolate S6 cytochrome c oxidase subunit 1. Cestode PCR two targets: CO1 en NADH ( developed by CIb Dr. +P- - +P- - TGGATTTGGTATAATTAGTCATATTTGTTTAAGTATAAGTGGTAATTTTGATGCGTTTGG Joke van der Giessen, LZO 1999) |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGATTTGGTATAATTAGTCATATTTGTTTAAGTATAAGTGGTAATTTTGATGCGTTTGG 2. Other targets possible: PCR 12S, NAD5 and CO1 (Jeroen GTTTTATGGTTTGTTATTTGCTATGTTTTCTATAGTGTGTTTAGGGAGTAGTGTTTGGGG Roelfsema, 2011) |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ESCMID Online LectureGTTTTATGGTTTGTTATTTGCTATGTTTTCTATAGTGTGTTTAGGGAGTAGTGTTTGGGG Library TCATCATATGTTTACTGTTGGGTTGGATGTGAAGACGGCGGttttttttAGTTCTGTTAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 3. Sequencing TCATCATATGTTTACTGTTGGGTTGGATGTGAAGACGGCGGTTTTTTTTAGTTCTGTTAC GATGATTATAGGTGTTCCGACTGGTATAAAGGTGTTTACTTGGTTGTATATGTTGCTTAA – E. granulosus ( G1- G8) and E. multilocularis typing |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| – Taenia solium and T. saginata GATGATTATAGGTGTTCCGACTGGTATAAAGGTGTTTACTTGGTTGTATATGTTGCTTAA TTCTAGTGTAAATAAGAGTGATCCTATTTTGTGGTGGGTTATTTCTTTTATAGTGTTGTT – Other Cestodes like Diphyllobotrium ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Load more

Recommended publications
  • The Functional Parasitic Worm Secretome: Mapping the Place of Onchocerca Volvulus Excretory Secretory Products
    pathogens Review The Functional Parasitic Worm Secretome: Mapping the Place of Onchocerca volvulus Excretory Secretory Products Luc Vanhamme 1,*, Jacob Souopgui 1 , Stephen Ghogomu 2 and Ferdinand Ngale Njume 1,2 1 Department of Molecular Biology, Institute of Biology and Molecular Medicine, IBMM, Université Libre de Bruxelles, Rue des Professeurs Jeener et Brachet 12, 6041 Gosselies, Belgium; [email protected] (J.S.); [email protected] (F.N.N.) 2 Molecular and Cell Biology Laboratory, Biotechnology Unit, University of Buea, Buea P.O Box 63, Cameroon; [email protected] * Correspondence: [email protected] Received: 28 October 2020; Accepted: 18 November 2020; Published: 23 November 2020 Abstract: Nematodes constitute a very successful phylum, especially in terms of parasitism. Inside their mammalian hosts, parasitic nematodes mainly dwell in the digestive tract (geohelminths) or in the vascular system (filariae). One of their main characteristics is their long sojourn inside the body where they are accessible to the immune system. Several strategies are used by parasites in order to counteract the immune attacks. One of them is the expression of molecules interfering with the function of the immune system. Excretory-secretory products (ESPs) pertain to this category. This is, however, not their only biological function, as they seem also involved in other mechanisms such as pathogenicity or parasitic cycle (molting, for example). Wewill mainly focus on filariae ESPs with an emphasis on data available regarding Onchocerca volvulus, but we will also refer to a few relevant/illustrative examples related to other worm categories when necessary (geohelminth nematodes, trematodes or cestodes).
    [Show full text]
  • Specific Status of Echinococcus Canadensis (Cestoda: Taeniidae) Inferred from Nuclear and Mitochondrial Gene Sequences
    Accepted Manuscript Specific status of Echinococcus canadensis (Cestoda: Taeniidae) inferred from nuclear and mitochondrial gene sequences Tetsuya Yanagida, Antti Lavikainen, Eric P. Hoberg, Sergey Konyaev, Akira Ito, Marcello Otake Sato, Vladimir A. Zaikov, Kimberlee Beckmen, Minoru Nakao PII: S0020-7519(17)30212-6 DOI: http://dx.doi.org/10.1016/j.ijpara.2017.07.001 Reference: PARA 3980 To appear in: International Journal for Parasitology Received Date: 20 January 2017 Revised Date: 27 June 2017 Accepted Date: 3 July 2017 Please cite this article as: Yanagida, T., Lavikainen, A., Hoberg, E.P., Konyaev, S., Ito, A., Otake Sato, M., Zaikov, V.A., Beckmen, K., Nakao, M., Specific status of Echinococcus canadensis (Cestoda: Taeniidae) inferred from nuclear and mitochondrial gene sequences, International Journal for Parasitology (2017), doi: http://dx.doi.org/ 10.1016/j.ijpara.2017.07.001 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Specific status of Echinococcus canadensis (Cestoda: Taeniidae) inferred from nuclear and mitochondrial gene sequences Tetsuya Yanagidaa,*, Antti Lavikainenb, Eric P. Hobergc, Sergey Konyaevd, Akira
    [Show full text]
  • WHO/OIE Manual on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern
    World Health Organization World Organisation for Animal Health WHO/OIE Manual on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern Edited by J. Eckert, M.A. Gemmell, F.-X. Meslin and Z.S. Pawłowski • Aetiology • Geographic distribution • Echinococcosis in humans • Surveillance • Echinococcosis in animals • Epidemiology • Diagnosis • Control • Treatment • Prevention • Ethical aspects • Methods Cover image: Echinococcus granulosus Courtesy of the Institute of Parasitology, University of Zurich © World Organisation for Animal Health (Office International des Epizooties) and World Health Organization, 2001 Reprinted: January 2002 World Organisation for Animal Health 12, rue de Prony, 75017 Paris, France http://www.oie.int ISBN 92-9044-522-X All rights are reserved by the World Organisation for Animal Health (OIE) and World Health Organization (WHO). This document is not a formal publication of the WHO. The document may, however, be freely reviewed, abstracted, reproduced and translated, in part or in whole, provided reference is made to the source and a cutting of reprinted material is sent to the OIE, but cannot be sold or used for commercial purposes. The designations employed and the presentation of the material in this work, including tables, maps and figures, do not imply the expression of any opinion whatsoever on the part of the OIE and WHO concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers and boundaries. The views expressed in documents by named authors are solely the responsibility of those authors. The mention of specific companies or specific products of manufacturers does not imply that they are endorsed or recommended by the OIE or WHO in preference to others of a similar nature that are not mentioned.
    [Show full text]
  • Protozoan Parasites
    Welcome to “PARA-SITE: an interactive multimedia electronic resource dedicated to parasitology”, developed as an educational initiative of the ASP (Australian Society of Parasitology Inc.) and the ARC/NHMRC (Australian Research Council/National Health and Medical Research Council) Research Network for Parasitology. PARA-SITE was designed to provide basic information about parasites causing disease in animals and people. It covers information on: parasite morphology (fundamental to taxonomy); host range (species specificity); site of infection (tissue/organ tropism); parasite pathogenicity (disease potential); modes of transmission (spread of infections); differential diagnosis (detection of infections); and treatment and control (cure and prevention). This website uses the following devices to access information in an interactive multimedia format: PARA-SIGHT life-cycle diagrams and photographs illustrating: > developmental stages > host range > sites of infection > modes of transmission > clinical consequences PARA-CITE textual description presenting: > general overviews for each parasite assemblage > detailed summaries for specific parasite taxa > host-parasite checklists Developed by Professor Peter O’Donoghue, Artwork & design by Lynn Pryor School of Chemistry & Molecular Biosciences The School of Biological Sciences Published by: Faculty of Science, The University of Queensland, Brisbane 4072 Australia [July, 2010] ISBN 978-1-8649999-1-4 http://parasite.org.au/ 1 Foreword In developing this resource, we considered it essential that
    [Show full text]
  • Echinococcus Granulosus (Dog Tapeworm) ---> Hydatid Disease Taenia Saginata the Beef Tapeworm “Field O’ Beeves”
    Helminths • Phylum Nematoda (Roundworms) - “Nematodes” • Phylum Platyhelminthes (Flatworms) – Class Cestoidea (segmented flatworms) - “Cestodes” – Class Trematoda (non-segmented flatworms) - “Trematodes” The tapeworms (Cestodes): Taenia saginata (beef tapeworm) Taenia solium (pork tapeworm) ---> Cysticercosis Echinococcus granulosus (dog tapeworm) ---> Hydatid Disease Taenia saginata The beef tapeworm “Field o’ beeves” D. Despommier, master photographer and fly-fisherman “Plate o’ Beef” a la “Wellington D. Despommier, expert chef Cysticerci - heart of cow Veterinary Pathology Laboratory, Univ. Penn Cestode hosts T. saginata Definitive Host: Human Intermediate Host: Cow Adult Taenia saginata Mature proglottids Scolex Immature proglottids Gravid proglottids cm scale Taenia saginata scolex Suckers Taenia saginata adult “Bowl o’ Worms” www.Healthinplainenglish.com/health/infectious_diseases/tapeworm Gravid Proglottid of Taenia saginata Uterine branches Uterus The central uterus of T. saginata has more than 12 branches on a side Embryonated, infectious taeniid eggs Hexacanth larva Hooklets Egg “Envelope” Cannot distinguish species of Taenia tapeworms based on morphology of eggs Pathogenesis: None Clinical Disease: None in humans Diagnosis: 1. Find eggs or proglottids in stool 2. Identify species based on proglottid morphology, after formalin and India Ink 3. Identify scolex Drug of Choice Praziquantel O C N N O Mode of Action: Increases permeability of flatworm tegument to Ca 2+ ions, Causing muscle tetany and worm detachment. Prevention and Control: 1. Sanitary disposal of human feces Prevention and Control (cont’d): 2. Prevent cows from coming into contact with human feces, ie good sanitation and physical restraints. 3. Freeze and/or cook all beef until well-done Good luck, NYC restaurants!! (No more rare filet mignon or steak tartar) 4.
    [Show full text]
  • And Seropositivity Among Patients Suspected of Visceral and Ocular Larva Migrans in the Netherlands: Trends from 1998 to 2009 E
    and seropositivity among patients suspected of visceral and ocular larva migrans in the Netherlands: trends from 1998 to 2009 E. Pinelli, T. Herremans, M. G. Harms, D. Hoek, L. M. Kortbeek To cite this version: E. Pinelli, T. Herremans, M. G. Harms, D. Hoek, L. M. Kortbeek. and seropositivity among patients suspected of visceral and ocular larva migrans in the Netherlands: trends from 1998 to 2009. European Journal of Clinical Microbiology and Infectious Diseases, Springer Verlag, 2011, 30 (7), pp.873-879. 10.1007/s10096-011-1170-9. hal-00675791 HAL Id: hal-00675791 https://hal.archives-ouvertes.fr/hal-00675791 Submitted on 2 Mar 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Toxocara and Ascaris seropositivity among patients suspected of visceral and 2 ocular larva migrans in the Netherlands: trends from 1998 to 2009 3 4 5 E. Pinelli, T. Herremans, M.G. Harms, D. Hoek and L.M. Kortbeek 6 7 8 Centre for Infectious Disease Control Netherlands (Cib). National Institute for 9 Public Health and the Environment (RIVM), Bilthoven, The Netherlands. 10 11 Running title: Trends of Toxocara and Ascaris seropositivity in the Netherlands 12 13 Keywords: Toxocara canis, Toxocara cati, Ascaris suum, antibodies, ELISA, 14 Excretory- Secretory (ES) antigen 15 16 Correspondence to: Dr.
    [Show full text]
  • Severe Coenurosis Caused by Larvae of Taenia Serialis in an Olive Baboon (Papio Anubis) in Benin T
    IJP: Parasites and Wildlife 9 (2019) 134–138 Contents lists available at ScienceDirect IJP: Parasites and Wildlife journal homepage: www.elsevier.com/locate/ijppaw Severe coenurosis caused by larvae of Taenia serialis in an olive baboon (Papio anubis) in Benin T ∗ E. Chanoveb, , A.M. Ionicăa, D. Hochmanc, F. Berchtolda, C.M. Ghermana, A.D. Mihalcaa a Department of Parasitology and Parasitic Diseases, University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Calea Mănăștur 3-5, Cluj-Napoca, 400372, Romania b Department of Infectious Diseases, University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Calea Mănăștur 3-5, Cluj-Napoca, 400372, Romania c Veterinary Clinic “du clos”, 67 rue de la chapelle, Saint-Cergues, 74140, France ARTICLE INFO ABSTRACT Keywords: In March 2017, a captive male juvenile (ca. 6 months old) olive baboon (Papio anubis) was brought to a primate Olive baboon rescue center in Benin with multiple subcutaneous swellings of unknown aetiology. At the general inspection of Intermediate host the body, around 15 partially mobile masses of variable sizes were found in different locations across the body. Taenia serialis Following two surgical procedures, several cyst-like structures were removed and placed either in 10% formalin Coenurus or in absolute ethanol. The cysts had a typical coenurus-like morphology. Genomic DNA was extracted from one cyst using a commercially available kit. The molecular characterization was performed by PCR amplification and sequencing of a region of the nuclear ITS-2 rDNA and a fragment of the mitochondrial 12S rDNA gene, revealing its identity as T. serialis, with 88%–98% similarity to T.
    [Show full text]
  • Incidence and the History of Echinococcus Granulosus Infection in Dogs Within the Past Few Decades in Libya: a Review
    Vol. 9(1), pp. 1-10, January 2017 DOI: 10.5897/JVMAH2016.0525 Article Number: D1913D462294 Journal of Veterinary Medicine and ISSN 2141-2529 Copyright © 2017 Animal Health Author(s) retain the copyright of this article http://www.academicjournals.org/JVMAH Review Incidence and the history of Echinococcus granulosus infection in dogs within the past few decades in Libya: A review 1*, 2 3 4 Mohamed, M. Ibrahem Wafa, M. Ibrahem , Kawther, M. Ibrahem , Badereddin, B. Annajar 1Department of Zoology, Faculty of Sciences, University of Zawia, P. O. Box 16418, Zawia, Libya. 2Department of Parasitology, Faculty of Medicine, University of Zawia, P. O. Box 16418, Zawia, Libya. 3Department of Medicinal Chemistry, Faculty of Pharmacy, University of Zawia, P. O. Box 16418, Zawia, Libya. 4National Centre for Disease Control, Ain Zara, P. O. Box 71171, Tripoli, Libya. Received 19 September, 2016: Accepted 16 December, 2016 Echinococcus granulosus is a tiny tapeworm that parasitizes the small intestine of canids, mainly dogs, which act as definitive hosts for the parasite. Infected dogs are the main source of infection to humans and livestock which act as intermediate hosts resulting in hydatid disease condition. E. granulosus is widely distributed in many parts of the world, and is very common in North African countries. In Libya, the rate of infection with echinococcosis in dogs was reported to be lower than 7 to 80% in stray dogs, 34.8 to 60% in sheep/guard dogs and 7.7 to 21.6% in farm/house dogs. This data fulfills the world health organization (WHO) criteria and suggests that the incidence of infection with echinococcosis/ hydatidosis in some parts of the country can be reaching the level of hyper endemic.
    [Show full text]
  • What Is Echinococcus?
    For Pet Owners What is Echinococcus? • Echinococcus is a group (genus) of tapeworms. Tapeworms are parasites that live in the small intestines of many different species of animals, including humans. • Echinococcus spp. are quite small compared to other tapeworms. For example, Echinococcus multilocularis is less than 1 cm long, whereas an adult Taenia saginata may be up to 10 metres long! • Except for the head, a tapeworm’s body is made up entirely of small segments, called proglottids, which regularly break off from the end of the worm’s tail as it grows and contain the parasite’s eggs. Both intact proglottids and eggs may be passed in the feces. • Of all the tapeworms in pets, Echinococcus spp. pose the greatest disease risk to people. More information about other kinds of tapeworms can be found on the general Tapeworms information sheet on the Worms & Germs Resources – Pets page. Different Tapeworms, Different Risks There are three main groups of tapeworms, each containing one or more species, that are a concern for most domestic animals and humans. Each group poses a different level of risk to people, and may be spread between animals and people in a different way: Dipylidium caninum This is the most common type of tapeworm found in dogs and cats in North America, and can be found in pets worldwide. It is transmitted via fleas, and although infection is common, it rarely makes pets sick. Infection in people (usually children) is rare. Taenia spp. Human infections with certain tapeworms in this group are a significant problem in some areas, but most of these come from livestock.
    [Show full text]
  • Proteomic Insights Into the Biology of the Most Important Foodborne Parasites in Europe
    foods Review Proteomic Insights into the Biology of the Most Important Foodborne Parasites in Europe Robert Stryi ´nski 1,* , El˙zbietaŁopie ´nska-Biernat 1 and Mónica Carrera 2,* 1 Department of Biochemistry, Faculty of Biology and Biotechnology, University of Warmia and Mazury in Olsztyn, 10-719 Olsztyn, Poland; [email protected] 2 Department of Food Technology, Marine Research Institute (IIM), Spanish National Research Council (CSIC), 36-208 Vigo, Spain * Correspondence: [email protected] (R.S.); [email protected] (M.C.) Received: 18 August 2020; Accepted: 27 September 2020; Published: 3 October 2020 Abstract: Foodborne parasitoses compared with bacterial and viral-caused diseases seem to be neglected, and their unrecognition is a serious issue. Parasitic diseases transmitted by food are currently becoming more common. Constantly changing eating habits, new culinary trends, and easier access to food make foodborne parasites’ transmission effortless, and the increase in the diagnosis of foodborne parasitic diseases in noted worldwide. This work presents the applications of numerous proteomic methods into the studies on foodborne parasites and their possible use in targeted diagnostics. Potential directions for the future are also provided. Keywords: foodborne parasite; food; proteomics; biomarker; liquid chromatography-tandem mass spectrometry (LC-MS/MS) 1. Introduction Foodborne parasites (FBPs) are becoming recognized as serious pathogens that are considered neglect in relation to bacteria and viruses that can be transmitted by food [1]. The mode of infection is usually by eating the host of the parasite as human food. Many of these organisms are spread through food products like uncooked fish and mollusks; raw meat; raw vegetables or fresh water plants contaminated with human or animal excrement.
    [Show full text]
  • Demodex, Echinococcus and Northern Parasites
    New treatments for manges in dogs? Andrew S. Peregrine, BVMS, PhD, DVM, DipEVPC, DipACVM E-mail: [email protected]; Tel: 519-824-4120 ext 54714 Canine demodicosis (Cerundolo 2017) . Most common = D. canis . No difference in treatment recommendations for the three types of mite Canine demodicosis Current approved drug in Canada: imidacloprid + moxidectin (Advantage Multi®) . “aid in treatment and control” . administer monthly for 4 applications . administer weekly if severe disease (European claim) . stop treatment after 1 month of negative scrapings 1 New treatments for demodicosis in dogs ? Isoxazolines: • fluralaner (Bravecto®) • afoxolaner (NexGard™) • sarolaner (Simparica®) fluralaner (Bravecto®) . Two groups of 8 dogs with generalized demodicosis Group 1 – fluralaner (25 mg/kg) – once Group 2 – imidacloprid (10 mg/kg) /moxidectin (2.5 mg/kg) – 3 times at 28-day intervals Reduction in mite numbers in scrapings compared to day 0: Day 28 Day 56 Day 84 fluralaner 99.8% 100%* 100%+ imidacloprid/moxidectin 98.0% 96.5%* 94.7%+ *,+ same symbol = significantly different At 12 weeks after initial treatment: equally effective impact on () skin lesions and () hair regrowth (Fourie et al 2015) fluralaner (Bravecto®) . On label in Argentina, Columbia, Mexico, New Zealand, Philippines, South Korea, Taiwan, Thailand and Vietnam - for treatment and control of dogs with demodicosis . Most cases resolve after single treatment (label dosage) . If second treatment, give 3 months later (N. Colapinto, Nov 14, 2017) 2 afoxolaner (NexGard™) . Two groups of 8 dogs with generalized demodicosis Group 1 –afoxolaner (≥2.5 mg/kg) – days 0, 14, 28, 56 Group 2 – imidacloprid (10 mg/kg) /moxidectin (2.5 mg/kg) – days 0, 14, 28, 56 Reduction in mite numbers in scrapings compared to day 0: Day 28 Day 56 Day 84 afoxolaner 99.2%* 99.9%+ 100%# imidacloprid/moxidectin 89.8%* 85.2%+ 86.6%# *,+,# same symbol = significantly different Days 28-84: significantly improved skin condition in group treated with afoxolaner (Beugnet et al 2016) afoxolaner (NexGard™) .
    [Show full text]
  • Zoonotic Helminths Affecting the Human Eye Domenico Otranto1* and Mark L Eberhard2
    Otranto and Eberhard Parasites & Vectors 2011, 4:41 http://www.parasitesandvectors.com/content/4/1/41 REVIEW Open Access Zoonotic helminths affecting the human eye Domenico Otranto1* and Mark L Eberhard2 Abstract Nowaday, zoonoses are an important cause of human parasitic diseases worldwide and a major threat to the socio-economic development, mainly in developing countries. Importantly, zoonotic helminths that affect human eyes (HIE) may cause blindness with severe socio-economic consequences to human communities. These infections include nematodes, cestodes and trematodes, which may be transmitted by vectors (dirofilariasis, onchocerciasis, thelaziasis), food consumption (sparganosis, trichinellosis) and those acquired indirectly from the environment (ascariasis, echinococcosis, fascioliasis). Adult and/or larval stages of HIE may localize into human ocular tissues externally (i.e., lachrymal glands, eyelids, conjunctival sacs) or into the ocular globe (i.e., intravitreous retina, anterior and or posterior chamber) causing symptoms due to the parasitic localization in the eyes or to the immune reaction they elicit in the host. Unfortunately, data on HIE are scant and mostly limited to case reports from different countries. The biology and epidemiology of the most frequently reported HIE are discussed as well as clinical description of the diseases, diagnostic considerations and video clips on their presentation and surgical treatment. Homines amplius oculis, quam auribus credunt Seneca Ep 6,5 Men believe their eyes more than their ears Background and developing countries. For example, eye disease Blindness and ocular diseases represent one of the most caused by river blindness (Onchocerca volvulus), affects traumatic events for human patients as they have the more than 17.7 million people inducing visual impair- potential to severely impair both their quality of life and ment and blindness elicited by microfilariae that migrate their psychological equilibrium.
    [Show full text]