ESCMID Online Lecture Library © by Author

Echinococcosis and other zoonotic helminths Echinococcus, Toxocara en Trichinella

Titia Kortbeek

Titia Kortbeek thanks to [email protected] Joke van der Giessen

Center for Disease Controle The Netherlands National institute Public Health

1 2

Centre for Infectious disease control Netherlands National Institute for Public Health and the environment

1 National Coordination Centre for Communicable Disease Control National Coordination Centre for Communicable Disease Control the Netherlands

● Joke van der Giessen, veterinarian-microbiologist/parasitologist and head of NRL- ● Titia Kortbeek; medical microbiologist, special focus on parasitology and public foodborne and zoonotic parasites health ● Reports of trends Echinococcus granulosus trends in NL :since 1992 – Research risk Echinococcus multilocularis in foxes since 1996 – Echinococcus multilocularis humans: seroprevalence study Pienter2 (2006-7) – International projects since 1998: EURreg and Echinorisk – ESCMID study group for clinical parasitology, subgroup Echinococcus

ESCMID: Basic course parasitology Ankara 2011

5 6 19 april One Health

2 This is only the beginning Reportable diseases humans:

• Advanced courses (hopefully 2016) Different per country

• ECCMID sessions: Educational workshops ; symposia etc. All Europese memberstates have to report yearly to ECDC (European Center of Desease Control) for a list of parasites. • Conferences and congresses : specific (tropical medicine; Toxoplasma, Giardia and Cryptosporidium etc) or general ● http://www.ecdc.europa.eu/ ● Surveillance reports (ICOPA : 2018 and EMOP : Finland 2016) ● FWBP initiative

• National meetings: e.g. Echinococcus Romania October 2015

Notification veterinary: Which parasites are notifiable in the NL? Per country different Human Veterinary Reportable zoonosis have to be notified to European Food Safety ● Trichinella ● Trichinella ESCMIDAuthority (EFSA) Parma Italy Online Lecture Library ● Malaria ● Echinococcus EU Reference laboratory parasitic diseases: Instituto Superiore Sanita in Rome: Eduardo Pozio ● Cysticercosis ( Taenia saginata) National Reference laboratories in all memberstates

Regulation by OIA: including methods that have to be used. ● Toxoplasma

3 Case 1

Echinococcosis granulosus and multilocularis Dutch female, born 1961 ● Both zoonotic No travel history ● Both cestodes ● Public health concern (spreading by dogs and foxes ) Medical history: ● operated in 1975 for lung disease, due to contact with sheep Endemic in Europe and Northern hemisfere (diagnosis unknown at moment of presentation) – Echinococcus granulosus in mediterranean area – Echinococcus multilocularis in Central and Eastern Europe; endemic in ● Pain in the back and right upper quadrant ; increasing in few China days

● Echinococcus multilocularis is emerging in Europe and Asia What do you want to know?

● CRP 180; ● Eosinophiles:1.28 (N: 0.4); ESCMID● Liver function normal Online Lecture Library ● Gallbladder : N

4 Case 1 Case 1

Therapy: Old medical information: – Operation 1975: Echinococcus granulosus of the lungs ● PAIR (puncture, aspiration, injection, reaspiration) Serology: ● Albendazol 3 courses of three weeks. ● Echinococcus ELISA positive 1:80 – The procedure was complicated due to an infection – Immunoblot IgG1 and IgG4: IgG1 positive with S. aureus. She was treated with clindamycin oraly Cystfluid: Protoscolices positive PCR and sequencing: typing CO1 and NADH: G5 strain (Dutch ● 3 months later: The CRP had dropped to 12. cattle strain)

Where did this echinococcus come from?

Patient was given a dog for her 11th birthday. The dog died when she was 17.

There were no other contact with dogs or travels to endemic ESCMIDareas. Online Lecture Library

5 Dog Dog Sheep Echinococcus granulosus Cervid G1,G2, G3, E.granulosus s.s. ● Hydatic echinococcosis G8/10,

● Sheep strain G1, G2, G3 common in South Europe Dog Dog – Most pathogen to humans Cattle Pig – Not only in sheep: also in cattle › Romenian cattle imported in the Netherlands G6, E.ortoleppi G7,

● Pig strain : emerging in Eastern part of Europe (e.g. Dog Baltics) due to home slaughter ; close contact dogs – Horse, Donkey Dog humans G4, E.equinus Camel G6,

Thompson, McManus Trends 22 Parasitology 2002

Echinococcus granulosus Clinical symptoms : ● Depending on location and destruction ● Cysto-biliar fistula ● Obstruction of biliary duct Photo courtesy of Greg ESCMID● anafylactic reaction due to leakage Online cyst LectureNelsen Library ● Metastases due to ruptures ● secundary bacterial infections

● Invasion of other organs: – pulmonary obstructions, destruction of bones etc.

http://med.ege.edu.tr/~norolbil/1999/Cysthydatid.jpg

6 Pictures courtesy Dr. Stoot, Maastricht

liver spleen

Lumbal vertebra Destruction of the bone ESCMID Online Lecture Library Femur

Pictures courtesy Dr. Stoot, Maastricht

28 Eg,Em & Tsol2010

7 Classification of ultrasound Echinococcus cysts: http://www.who.int/emc-documents/zoonoses/docs/ whocdscsraph20016.pdf

29 Eg,Em & Tsol2010

diagnostics

Cyst and daughter Always combination: cysts ESCMID● Imaging Online Lecture Library ● Serology – If possible: PCR

● Clinical history

8 Diagnostics: serology

Commercial kits protoscolices ● Haemagglutionation ● Immunoblotting

We use: Home made ELISA Home made immunoblot IgG1 en IgG4

Why? – Long during experience: > 30 year same test, same antigens etc – Trends in time – Independent from producers: › Change of kit without informing client › Delivery problems (for Europa: EC mark/ transport problems) › Costs

Sensitivy Sera echinococcosis patients 24kD Therapy 16kD ● Uncomplicated single cyst: surgery 8k ESCMIDIgG1 OnlineD Lecture Library ● Multiple cysts or complicated cysts/patients – Albendazol – PAIR (puncture, aspiration, injection, reaspiration) 24kD 16kD

IgG4 8k D

9 PAIR teaching

30-2742372

● Tineke Herremans, Jaco J. Verweij, Hans G. Schipper, Mariël Casparie, Lisette van Lieshout, Elena Pinelli en Titia Kortbeek Afname van echinokokkose in Nederland; 1997-2008. Ned Tijdschr Geneeskd. 2010;154:A2297 ESCMID Online Lecture Library

10 See ECCMID website https://www.escmid.org/escmid_library/online_lecture_library S272: Symposium ● New trends in the management and treatment of Echinococcus granulosus ● Carmen Cretu, Bukarest, Romania

S271 Symposium ● New trends in the management and treatment of Echinococcus multilocularis ● Beate Grüner, Ulm, Germany

Echinococcose ESCMID Online Lecture Library

Hippocrates 470-375 v Chr Rudolf Virchow 1821-1902

Since ancient times hydatide cysten known in humans and animals. Hippocrates descibed it as a liver full of water ( hydatis = drop of water).

43 44

11 Foto: dank aan Annette Stemerdink Echinococcus multilocularis= zoonosis ● Fox tapeworm ● Intestinal parasite ● Definite and intermediate host Small tapeworm (1,5-4,5 mm)

Torgerson et al. 2010 45 46

Echinococcus ESCMID Online Lecturemultilocularis Library

0.5 mm Echinococcus multilocularis isolated from a fox in Hungary.

12 case

Hydatide E.multilocularis ● Female, 55 years old ● Medical history: – liposarcoma : first episode in 1993 – Several relapses ● Beginning of 2008 cervical pain – metastasis liposarcoma? ● Imaging April 2008: – PET-CT: PET negative but….

● Start Chemotherapy june/july 2008 ● Imaging July 2008: no change ESCMID Online Lecture● Partial hepatectomy augustus Library 2008 – 3 lesions resected

● Pathology: Echinococcosis ?

Cystic structures in necrotic leasions with a thick pink ( eosinophilic) wall

Picture: courtesy Laura van Dommelen Maastricht

13 Case : continuation

Serology E.granulosus positive Case : continuation

● Serology november 2008 (RIVM) ● Start Chemotherapy june/july 2008 – ELISA E.granulosus 1:80 ● Imaging July 2008: no change

– Immunoblot IgG1 positive – Immunoblot IgG4 negative ● Partial hepatectomy augustus 2008 – 3 lesions resected plus – ELISA E.multilocularis Em2 negative ● Pathology: Echinococcosis ?

© by author Molecular detection: Alignment with DQ979365 PCR CO1 PCR NADH PCR Echinococcus multilocularis isolate S6 cytochrome c oxidase subunit 1. Cestode PCR two targets: CO1 en NADH ( developed by CIb Dr. +P- - +P- - TGGATTTGGTATAATTAGTCATATTTGTTTAAGTATAAGTGGTAATTTTGATGCGTTTGG Joke van der Giessen, LZO 1999) |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGATTTGGTATAATTAGTCATATTTGTTTAAGTATAAGTGGTAATTTTGATGCGTTTGG 2. Other targets possible: PCR 12S, NAD5 and CO1 (Jeroen GTTTTATGGTTTGTTATTTGCTATGTTTTCTATAGTGTGTTTAGGGAGTAGTGTTTGGGG Roelfsema, 2011) |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ESCMID Online LectureGTTTTATGGTTTGTTATTTGCTATGTTTTCTATAGTGTGTTTAGGGAGTAGTGTTTGGGG Library TCATCATATGTTTACTGTTGGGTTGGATGTGAAGACGGCGGttttttttAGTTCTGTTAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 3. Sequencing TCATCATATGTTTACTGTTGGGTTGGATGTGAAGACGGCGGTTTTTTTTAGTTCTGTTAC

GATGATTATAGGTGTTCCGACTGGTATAAAGGTGTTTACTTGGTTGTATATGTTGCTTAA – E. granulosus ( G1- G8) and E. multilocularis typing |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| – Taenia solium and T. saginata GATGATTATAGGTGTTCCGACTGGTATAAAGGTGTTTACTTGGTTGTATATGTTGCTTAA TTCTAGTGTAAATAAGAGTGATCCTATTTTGTGGTGGGTTATTTCTTTTATAGTGTTGTT – Other Cestodes like Diphyllobotrium |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTCTAGTGTAAATAAGAGTGATCCTATTTTGTGGTGGGTTATTTCTTTTATAGTGTTGTT

TACGTTTGGTGGTGTTACTGGTATAGTTTTATCTGCTTGTGTGTTGGATAATGTTTTACA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TACGTTTGGTGGTGTTACTGGTATAGTTTTATCTGCTTGTGTGTTGGATAATGTTTTACA

CGATACTTGATTTGTGGTGGCTC-TTTTCATTATGTT 396 ||||||||||||||||||||||| ||||||||||||| CGATACTTGATTTGTGGTGGCTCATTTTCATTATGTT 530

14 PC, NC, RC pat Eg T.soliumpat.

Serology:

Echinococcus IgG and IgG ELISA (Em2plus) 1 4 LDBio Echinococcus We use immunoblot:

Bordier EM2plus ELISA and Specificity? Home made Eg ELISA Reagens control: positive band ca. 28 kD Home made immunoblot IgG1 and IgG4 T.solium : 26 kD band

E. multilocularis diagnostics Conclusion: ● E.multilocularis 1. ELISA Em2plus ( commercial kit)

– If Em2plus is positive and/or immunoblot only 28 kD positive: › confirmation in reference laboratory (Besançon, France or in Japan) But where did this patient acquire the infection? › Or PCR cystevloeistof. ESCMID Online Lecture LibraryWe don’t know 2. Always in combination with ELISA E.granulosus and Immunoblot Risk factors: IgG1 en IgG4 ● only 3 short holidays to Switzerland, Italy and Austria ● no gardening ● And always in combination with imaging! ● no contact with animals ● hated (forest) fruits.

van Dommelen L, Stoot JH, Cappendijk VC, Abdul Hamid MA, Stelma FF, Kortbeek LM, van der Giessen J, Oude Lashof AM.The first locally acquired human infection of Echinococcus multilocularis in The Netherlands.J Clin Microbiol. 2012 May;50(5):1818-20. Epub 2012 Feb 22.

15 End 2011 ● Two new cases of Echinococcus multilocularis – Women, living in the middle of the country, no infected foxes in the area – No known risk factors – Big lesions: probably the infection present for long time – No travel history: acquired in the Netherlands?

● One patient: Em2plus ELISA negative – Immunoblot Ldbio: no specific Em pattern

Fotos: met dank aan Annette 61 Stemerding UMCU

1. 1996 Patient from Switserland (LUMC) Echinococcus multilocularis Published in Raasveld ea, NTvG 1997;141:1007-10 ● Clinical symptoms: – Most cases asymptomatic with abortive infection 2. Dutch patient diagnosed in Germany – Symptoms depending on localisation and organs involved. 3. Dutch patient diagnosed in Belgium ESCMID Online Lecture● Tumor like lesions in the liver: necrosis, calcifications,Library no real cyst 4. Turkish woman treated as E.granulosus; Groningen – Growth destructive per continuitatem – From liver to lungs, brain etc. 5. 2008: Patient southern Limburg (MUMC) Published J.Clin Micr. 2012 v.Dommelen ea ● Immunocompromised patients: 6. 2011: Patient from Ermelo (AMC) – Rapid progression possible; response on Albendazol limited 7. 2011: Patient from Amersfoort (UMCU)

63 64

16 1990

E.multilocularis in Europa

1999

Human cases (Kern et al, EID, 2003) 2004 ECCMID Helsinki 2009: Peter Deplazes: role foxes and dogs in Global distribution of E. granulosus (black) and E. multilocularis (x) Switserland Lithuania: >60 cases per year (tot.pop <4 E.multilocularis only on northern hemisfere million) 66

Fig. 4. ‘Old’ and ‘new’ endemic areas for human alveolar echinococcosis in Europe (adapted from the 67geographic location of human cases, according to Eg,EmKern et& Tsol2010al. (2003); data from the 68 EurEchinoReg).Vuitton Epidemiology of alveolar echinococcosis

17 E. multilocularis in the Netherlands in foxes ● First detected in foxes in 1996-1997 in Limburg and Groningen. ● Limburg: 3/39 foxes (8%, 95% CI 3-20%)

= negative = positive

70 Van der Giessen et al. 1999; Van der Giessen et al. 2004; Takumi et al. 2008

E. multilocularis in Zuid Limburg Risk map: prediction of human cases in Limburg 1996-1997 2002-2003 ESCMID Online LectureEm in foxes Library

R0: 1.6 (95% CI: 1.1-3.5) Takumi et al. 2008 E. multilocularis spreading 2.7 km/year 0 case (grey) First autochtoneous case in 2008 1 case (red) 2 cases (blue) 2005/2006: E. multilocularis in foxes near 3 cases (yellow) Maastricht

71 Takumi K, de Vries A, Chu ML, Mulder J, Teunis P, van der Giessen J. Evidence for 72 Takumi K, Hegglin D, Deplazes P, Gottstein B, Teunis P, van der Giessen J. Mapping an increasing presence of Echinococcus multilocularis in foxes in The Netherlands. the increasing risk of human alveolar echinococcosis in Limburg, The Netherlands. Int J Parasitol. 2008 Apr;38(5):571-8. Epidemiol Infect. 2011 Jul 7:1-5.

18 Recent study in South Limburg

Results in foxes ● 42 foxes recieved; 37 post mortem examined

– Microscopy: 11/37 positive (worm burden from 1 to 500-1000)

– Nested PCR: 20/36 positive

● Total (microscopy and/or PCR positive): 22/37 positive: 59% (95%CI 43- 74%)

● No significant difference in regio (WBE), sex or age of foxes

Good news: all dogs were negative.

Risk communication ● Echinococcus multilocularis is endemic in Groningen 1. Realistic risk perception by pro-active communication and Limburg 2. Focus on risk groups and regions 3. Information how people can minimize the infection risk 4. Information how to handle foxes (keep them at distance and shy) ● Prevalence in Groningen: 9.4% (95% CI: 5.2-16.5%) ESCMID(Hegglin et al. 2008) Online LectureLimburg 12,6% (95% BI: 7,6%-16,8%); Library now up to 59%!

● Em is spreading to the north ● R0 1.6 (95% CI: 1.1-3.5); in Limburg 2.7 km/year – Controle : R0 is proportional to the fox population density (Takumi & van der Giessen, Int. J. Parasitol. 2008)

19 Specificity Em2plus

Human samples

Positive foxes

77 Eg,Em & Tsol2010

results ● 169 out of 1581 sera tested positive in the ELISA LDBio Echinococcus immunoblot: – 6 were positive in both Eg and Em ELISA (0.4 %) – 120 sera (7,6%) Em2plus ELISA positive, Eg IgG ELISA negative, Specificity? – 43 sera (2,7%) Eg IgG ELISA positive and Em2plus ELISA negative Reagens control: ESCMID Online Lecturepositive band ca. 28 kD Library – 1412 sera (89,3%) all negative T.solium : 26 kD band The reactivity of the ELISA positive samples ( Eg or Em or both) could not be confirmed by westernblot.

Em2plus not specific – the kit has changed the antigen but there is no information in the kit brochure Commercial Blot: problematic

79 interpretation and expensive

20 Conclusion population based study: No indication of E. multilocularis infection but • small sample size • no imaging

Population at risk : farmers, hunters, dog owners

Human cases might occur in coming years

Trichinella spiralis

● Notifiable diasease in humans www.med-chem.com/.../ ESCMID OnlineProb%20of%20Month%2012%20December.htm Lecture Library – Unknown to most medical docters Toxocara sp:

www.biosci.ohio-state.edu/.../ toxocara_canis_adults.gif ● Rapporting in EU obligatory (both veterinary and human) Not notifiable diasease in humans Tissue parasite ● Testing of meat compulsory (in The Netherlands > 4 milj endemic in NL: T.canis and T.cati pigs /year) symptoms are divers and not known

83 84

21 Toxocara sp Toxocara canis: the infection is acquired from ingestion of embryonated eggs released in the soil.

Eggs measure 75 by 90 µm.

Courtesy of Doctor Jean-Francois Magnaval. Laboratoire de Parasitologie CHU Purpan 31059 Toulouse, France

Clinical symptoms: b ● Visceral larva migrans (VLM) with high eosinophilia, hepatosplenomegaly, fever, hypergammaglobulinaemia and pulmonal involvement;

● Ocular larva migrans (OLM) with posterior chorioretinitis (unilateral) ESCMID Online Lectureor uveitis or granuloma; Library

● Neurological toxocariasis with eosinophilic meningo-encephalitis or c myelitis ;

● Covert toxocariasis eosinophilia and non-specific symptoms and signs in different organs like lungs (asthma; acute bronchitis; Loeffler syndrome), skin (urticaria; eczema), arthralgia or myositis. a E.Pinelli/D.Hoek-van Deursen ● Asymptomatic toxocariasis with only specific antibodies and with or without eosinophilia. Fig. 2 d

22 Toxocara : effect in lungs in experimental infections Ocular Larva Migrans (OLM)

Ocular toxocariasis: posterior retinal granuloma

Controle mice Toxocara mice

Foto’s: E.Pinelli rivm/lis

Oculaire Toxocariasis Ocular Toxocariasis

ESCMID Online LectureLarve in eye child 2 Library years old

www.janssenpharmaceutica.be/ ../fotosrechts/dogs05.jpg

23 Visceral Larva Migrans (VLM) Larva migrans Toxocariasis

Visceral Larva Migrans (VLM) characterized by ● fever ● malaise ● leucocytosis with hypereosinophilia ● hepatomegaly ● cough ● myalgias ● other manifestation include myocarditis, encephalitis and pneumonia;

Larva migrans Toxocariasis in liver Toxocara diagnostics

Direct: biopsy: – Very small chance to detect larva

ESCMID Online LectureIndirect: antibody testing Library

● ELISA IgG antibodies Toxocara species (no differentiation between T. canis and T. cati) ● Western blot as confirmation test ● antigen: Excretion Secretion (ES) antigen larvae (cross reactivity other helmints with crude antigens)

www.parasiticdiseases.com/ Voorjaarsvergadering NVMM2008 histology.html

24 Toxocara antibodies in Dutch polulation Pienter 2005-2006 1995 (Pienterpilot n=800)

45 40 35 30 25 20 15 10 5 0 0 1-4y 5-9y 10- 15- 20- 25- 30- 35- 40- 45- 50- 55- 60- 65- 70- 75> 14y 19y 24y 29y 34y 39y 44y 49 54 59 64 69 74

Therapy: ● Albendazol versus Diethylcarbamazine (DEC) of Thiabendazol ● No randomised studies ● Albendazol: effective – Less side effects ● Most drugs not available in our country ESCMID Online Lecture– Better penetration in brain Library – Higher serum concentration of active components (albendazole ● Effectivity different for different clinical symptoms sulfoxide).

● VLM, OLM or neurological toxocariasis – Albendazol (10-15 mg/kg/day; adults 800 mg, 2 dd, 10-14 d) – in combination with corticosteroiden.

25 To treat or not to treat? Effect of therapy Covert toxocariasis: – eosinophilia ; 4-6 weeks after therapy: – non-specific symptoms and signs in different organs like lungs (asthma; acute bronchitis; Loeffler syndrome), skin (urticaria; ● Improvement clinical symptoms eczema), arthralgia or myositis ● Decrease eosinophilia

Literature: In covert toxocariasis non-specific treatment may be required, Serology: and there is still no consensus on the need to treat with anti-helminthic drugs and/ or corticosteroids. follow up not helping for effect of treatment:

Pawlowski Z.Toxocariasis in humans: clinical expression and treatment dilemma.J Helminthol. 2001 ● Anti-Toxocara antibodies detecable months-years Dec;75(4):299-305. Review ● Activity of infection : then consecutive samples and simultaneous testing usefull

Casus ● 3 patients A,B en C from Bosnia arrive in the Netherlands in January 1992 › Patient A and B op January 13th › Patient C January 15th by car ESCMID Online LectureOn arrival: meeting and safe arrival Library celebration

4-5 days later: all 3 are ill › Intestinal complains, vomiting, fever and collaps

Few days later: facial oedema, swollen hands and muscular pain ● Patient C: painfull nails

103

26 Casus Casus (cont.) ● Februari 7th (= 3 weeks after arrival) : referral to What do you want to know? hospital ● How long were they travelling? ● Dyspneu? ● Pat A en B : no symptoms (A loss of weight) ● Food items ? ● Pat C: vague dizziness, headage, muscular pain right arm and loss of weight  5 kg Lab examination: ● Hypereosinophilia (patient C) ● Physical examniation: no special symptoms ● CPK  ● X thorax: normal; ● ECG: normal

© by author Casus Casus What do you want to know? ● How long travelling? 1 day Serology: ● Dyspneu? no ● Food items ? Half a pig (smoked) in the car: they Trichinella Igtotaal ( IgG.IgM,IgA) ESCMIDhad eaten it together at theOnline get together party LectureABC Library Day 25 10 10 20 Day 39 20 320 80 ● Mother: in hospital in Bosnia: she had eaten from the Day 55 10 160 ND other part.

27 Casus

treatment: Trichinella spiralis ● Mebendazol 3 x dd 300 mg during 3 days ● Muscular larvae in meat of carnivors and omnivor ● Followed by: 3 x dd 500 mg during 10 days

● Two weeks later: clinical improvement

Trichinella ESCMID Online Lecture Library

28 Trichinella spiralis

3 infectious stadia: ● intestinal phase muscular larvae develop and become adult worms Diarhoea (vomiting); 10 hours-6days

● Migration phase New Born Larvae in blood Fever, oedema, headage, itching, bleeding and start of eosinophilie! (high: >70 % ) ● Tissue phase Encapsulation of larvae in tissue muscular pains after 2-6 weeks

29 Symptoms depend on : ● Trichinella is a chronic infection – Number of larvae ● Diagnostic old infections: only serology – Trichinella species ● History: raw or undercooked meat – Does not have to be pig meat: can be horse meat or other meat; ● Poor prognosis: CZS and myocarditis – Other family members same symptoms ● Eosinophilia: marked increase of number eo’s >30 % (N: max. 4%) ● CPK and LDH ↑↑(muscular damage)  ● Mild infections can be asysmptomatic. ● Very rarely adult worms in feces or larvae in blood Beaver ea Clinical Parasitology 1984; Despommier in Topley 1995. ● tissue biopt : digestion (1% pepsin–1% HCl ;few ours 37 °C) is more sensitive than pressed biopsy but: young larvae will be damaged by acid; low sensitivity in mild inifection

Therapy: Thank you ● Joke van der Giessen (RIVM: Z&O) Very few/ no effective drugs ● Elena Pinelli Ortiz (RIVM: IIV) ● ANOVEL ● Anti worm drugs are not effective against tissue larvae ● Denise Hoek, Nahid Nozari, Lia van de Berg, Sietze Brandes, Jeroen ● Muscular pain can hardly be treated by drugs ESCMID Online LectureRoelfsema (RIVM: LIS) Library ● Conclusion: no good options for drug therapy Prevention !! Is better than curing Meat inspection!!

● Think of food items that are shipped from endemic areas of taken by travellers in luggage 119 120