Echinococcosis and other zoonotic helminths Echinococcus, Toxocara en Trichinella Titia Kortbeek Titia Kortbeek thanks to [email protected] Joke van der Giessen Center for Disease Controle The Netherlands National institute Public Health 1 2 © by author ESCMID Online Lecture Library Bilthoven Centre for Infectious disease control Netherlands National Institute for Public Health and the environment 1 National Coordination Centre for Communicable Disease Control National Coordination Centre for Communicable Disease Control the Netherlands ● Joke van der Giessen, veterinarian-microbiologist/parasitologist and head of NRL- ● Titia Kortbeek; medical microbiologist, special focus on parasitology and public foodborne and zoonotic parasites health ● Reports of trends Echinococcus granulosus trends in NL :since 1992 – Research risk Echinococcus multilocularis in foxes since 1996 – Echinococcus multilocularis humans: seroprevalence study Pienter2 (2006-7) – International projects since 1998: EURreg and Echinorisk – ESCMID study group for clinical parasitology, subgroup Echinococcus ESCMID: Basic course parasitology Ankara 2011 5 6 19 april One Health © by author ESCMID Online Lecture Library For more information about the studygroup www.escmid.org/esgcp 7 2 This is only the beginning Reportable diseases humans: • Advanced courses (hopefully 2016) Different per country • ECCMID sessions: Educational workshops ; symposia etc. All Europese memberstates have to report yearly to ECDC (European Center of Desease Control) for a list of parasites. • Conferences and congresses : specific (tropical medicine; Toxoplasma, Giardia and Cryptosporidium etc) or general ● http://www.ecdc.europa.eu/ ● Surveillance reports (ICOPA : 2018 and EMOP : Finland 2016) ● FWBP initiative • National meetings: e.g. Echinococcus Romania October 2015 © by author Notification veterinary: Which parasites are notifiable in the NL? Per country different Human Veterinary Reportable zoonosis have to be notified to European Food Safety ● Trichinella ● Trichinella ESCMIDAuthority (EFSA) Parma Italy Online Lecture Library ● Malaria ● Echinococcus EU Reference laboratory parasitic diseases: Instituto Superiore Sanita in Rome: Eduardo Pozio ● Cysticercosis ( Taenia saginata) National Reference laboratories in all memberstates Regulation by OIA: including methods that have to be used. ● Toxoplasma 3 Case 1 Echinococcosis granulosus and multilocularis Dutch female, born 1961 ● Both zoonotic No travel history ● Both cestodes ● Public health concern (spreading by dogs and foxes ) Medical history: ● operated in 1975 for lung disease, due to contact with sheep Endemic in Europe and Northern hemisfere (diagnosis unknown at moment of presentation) – Echinococcus granulosus in mediterranean area – Echinococcus multilocularis in Central and Eastern Europe; endemic in ● Pain in the back and right upper quadrant ; increasing in few China days ● Echinococcus multilocularis is emerging in Europe and Asia What do you want to know? © by author Case 1 ● CRP 180; ● Eosinophiles:1.28 (N: 0.4); ESCMID● Liver function normal Online Lecture Library ● Gallbladder : N 4 Case 1 Case 1 Therapy: Old medical information: – Operation 1975: Echinococcus granulosus of the lungs ● PAIR (puncture, aspiration, injection, reaspiration) Serology: ● Albendazol 3 courses of three weeks. ● Echinococcus ELISA positive 1:80 – The procedure was complicated due to an infection – Immunoblot IgG1 and IgG4: IgG1 positive with S. aureus. She was treated with clindamycin oraly Cystfluid: Protoscolices positive PCR and sequencing: typing CO1 and NADH: G5 strain (Dutch ● 3 months later: The CRP had dropped to 12. cattle strain) Where did this echinococcus come from? © by author Patient was given a dog for her 11th birthday. The dog died when she was 17. There were no other contact with dogs or travels to endemic ESCMIDareas. Online Lecture Library 5 Dog Dog Sheep Echinococcus granulosus Cervid G1,G2, G3, E.granulosus s.s. ● Hydatic echinococcosis G8/10, ● Sheep strain G1, G2, G3 common in South Europe Dog Dog – Most pathogen to humans Cattle Pig – Not only in sheep: also in cattle › Romenian cattle imported in the Netherlands G6, E.ortoleppi G7, ● Pig strain : emerging in Eastern part of Europe (e.g. Dog Baltics) due to home slaughter ; close contact dogs – Horse, Donkey Dog humans G4, E.equinus Camel G6, Thompson, McManus Trends 22 Parasitology 2002 © by author E.granulosus Echinococcus granulosus Clinical symptoms : ● Depending on location and destruction ● Cysto-biliar fistula ● Obstruction of biliary duct Photo courtesy of Greg ESCMID● anafylactic reaction due to leakage Online cyst LectureNelsen Library ● Metastases due to ruptures ● secundary bacterial infections ● Invasion of other organs: – pulmonary obstructions, destruction of bones etc. http://med.ege.edu.tr/~norolbil/1999/Cysthydatid.jpg 6 Pictures courtesy Dr. Stoot, Maastricht liver spleen 25 © by author Lumbal vertebra Destruction of the bone ESCMID Online Lecture Library Femur Pictures courtesy Dr. Stoot, Maastricht 28 Eg,Em & Tsol2010 7 Classification of ultrasound Echinococcus cysts: http://www.who.int/emc-documents/zoonoses/docs/ whocdscsraph20016.pdf 29 Eg,Em & Tsol2010 © by author diagnostics Cyst and daughter Always combination: cysts ESCMID● Imaging Online Lecture Library ● Serology – If possible: PCR ● Clinical history 8 Diagnostics: serology Commercial kits protoscolices ● Haemagglutionation ● Immunoblotting We use: Home made ELISA Home made immunoblot IgG1 en IgG4 Why? – Long during experience: > 30 year same test, same antigens etc – Trends in time – Independent from producers: › Change of kit without informing client › Delivery problems (for Europa: EC mark/ transport problems) › Costs © by author Sensitivy Sera echinococcosis patients 24kD Therapy 16kD ● Uncomplicated single cyst: surgery 8k ESCMIDIgG1 OnlineD Lecture Library ● Multiple cysts or complicated cysts/patients – Albendazol – PAIR (puncture, aspiration, injection, reaspiration) 24kD 16kD IgG4 8k D 9 PAIR teaching 30-2742372 © by author Echinococcus granulosus in NL ● Tineke Herremans, Jaco J. Verweij, Hans G. Schipper, Mariël Casparie, Lisette van Lieshout, Elena Pinelli en Titia Kortbeek Afname van echinokokkose in Nederland; 1997-2008. Ned Tijdschr Geneeskd. 2010;154:A2297 ESCMID Online Lecture Library 39 10 See ECCMID website https://www.escmid.org/escmid_library/online_lecture_library S272: Symposium ● New trends in the management and treatment of Echinococcus granulosus ● Carmen Cretu, Bukarest, Romania S271 Symposium ● New trends in the management and treatment of Echinococcus multilocularis ● Beate Grüner, Ulm, Germany 41 © by author Echinococcose ESCMID Online Lecture Library Hippocrates 470-375 v Chr Rudolf Virchow 1821-1902 Since ancient times hydatide cysten known in humans and animals. Hippocrates descibed it as a liver full of water ( hydatis = drop of water). 43 44 11 Foto: dank aan Annette Stemerdink Echinococcus multilocularis= zoonosis ● Fox tapeworm ● Intestinal parasite ● Definite and intermediate host Small tapeworm (1,5-4,5 mm) Torgerson et al. 2010 45 46 © by author Echinococcus ESCMID Online Lecturemultilocularis Library 0.5 mm Echinococcus multilocularis isolated from a fox in Hungary. 12 case Hydatide E.multilocularis ● Female, 55 years old ● Medical history: – liposarcoma : first episode in 1993 – Several relapses ● Beginning of 2008 cervical pain – metastasis liposarcoma? ● Imaging April 2008: – PET-CT: PET negative but…. © by author Regular CT Case : continuation ● Start Chemotherapy june/july 2008 ● Imaging July 2008: no change ESCMID Online Lecture● Partial hepatectomy augustus Library 2008 – 3 lesions resected ● Pathology: Echinococcosis ? Cystic structures in necrotic leasions with a thick pink ( eosinophilic) wall Picture: courtesy Laura van Dommelen Maastricht 13 Case : continuation Serology E.granulosus positive Case : continuation ● Serology november 2008 (RIVM) ● Start Chemotherapy june/july 2008 – ELISA E.granulosus 1:80 ● Imaging July 2008: no change – Immunoblot IgG1 positive – Immunoblot IgG4 negative ● Partial hepatectomy augustus 2008 – 3 lesions resected plus – ELISA E.multilocularis Em2 negative ● Pathology: Echinococcosis ? © by author Molecular detection: Alignment with DQ979365 PCR CO1 PCR NADH PCR Echinococcus multilocularis isolate S6 cytochrome c oxidase subunit 1. Cestode PCR two targets: CO1 en NADH ( developed by CIb Dr. +P- - +P- - TGGATTTGGTATAATTAGTCATATTTGTTTAAGTATAAGTGGTAATTTTGATGCGTTTGG Joke van der Giessen, LZO 1999) |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGATTTGGTATAATTAGTCATATTTGTTTAAGTATAAGTGGTAATTTTGATGCGTTTGG 2. Other targets possible: PCR 12S, NAD5 and CO1 (Jeroen GTTTTATGGTTTGTTATTTGCTATGTTTTCTATAGTGTGTTTAGGGAGTAGTGTTTGGGG Roelfsema, 2011) |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ESCMID Online LectureGTTTTATGGTTTGTTATTTGCTATGTTTTCTATAGTGTGTTTAGGGAGTAGTGTTTGGGG Library TCATCATATGTTTACTGTTGGGTTGGATGTGAAGACGGCGGttttttttAGTTCTGTTAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 3. Sequencing TCATCATATGTTTACTGTTGGGTTGGATGTGAAGACGGCGGTTTTTTTTAGTTCTGTTAC GATGATTATAGGTGTTCCGACTGGTATAAAGGTGTTTACTTGGTTGTATATGTTGCTTAA – E. granulosus ( G1- G8) and E. multilocularis typing |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| – Taenia solium and T. saginata GATGATTATAGGTGTTCCGACTGGTATAAAGGTGTTTACTTGGTTGTATATGTTGCTTAA TTCTAGTGTAAATAAGAGTGATCCTATTTTGTGGTGGGTTATTTCTTTTATAGTGTTGTT – Other Cestodes like Diphyllobotrium ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||