Coordination of Mrna and Trna Methylations by TRMT10A
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
By Submitted in Partial Satisfaction of the Requirements for Degree of in In
Developments of Two Imaging based Technologies for Cell Biology Researches by Xiaowei Yan DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biochemistry and Molecular Biology in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Ronald Vale Chair ______________________________________________________________________________Jonathan Weissman ______________________________________________________________________________Orion Weiner ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2021 By Xiaowei Yan ii DEDICATION Everything happens for the best. To my family, who supported me with all their love. iii ACKNOWLEDGEMENTS The greatest joy of my PhD has been joining UCSF, working and learning with such a fantastic group of scientists. I am extremely grateful for all the support and mentorship I received and would like to thank: My mentor, Ron Vale, who is such a great and generous person. Thank you for showing me that science is so much fun and thank you for always giving me the freedom in pursuing my interest. I am grateful for all the guidance from you and thank you for always supporting me whenever I needed. You are a person full of wisdom, and I have been learning so much from you and your attitude to science, science community and even life will continue inspire me. Thank you for being my mentor and thank you for being such a great mentor. Everyone else in Vale lab, past and present, for making our lab a sweet home. I would like to give my special thank to Marvin (Marvin Tanenbaum) and Nico (Nico Stuurman), two other mentors for me in the lab. I would like to thank them for helping me adapt to our lab, for all the valuable advice and for all the happiness during the time that we work together. -
Epigenetic Mechanisms of Lncrnas Binding to Protein in Carcinogenesis
cancers Review Epigenetic Mechanisms of LncRNAs Binding to Protein in Carcinogenesis Tae-Jin Shin, Kang-Hoon Lee and Je-Yoel Cho * Department of Biochemistry, BK21 Plus and Research Institute for Veterinary Science, School of Veterinary Medicine, Seoul National University, Seoul 08826, Korea; [email protected] (T.-J.S.); [email protected] (K.-H.L.) * Correspondence: [email protected]; Tel.: +82-02-800-1268 Received: 21 September 2020; Accepted: 9 October 2020; Published: 11 October 2020 Simple Summary: The functional analysis of lncRNA, which has recently been investigated in various fields of biological research, is critical to understanding the delicate control of cells and the occurrence of diseases. The interaction between proteins and lncRNA, which has been found to be a major mechanism, has been reported to play an important role in cancer development and progress. This review thus organized the lncRNAs and related proteins involved in the cancer process, from carcinogenesis to metastasis and resistance to chemotherapy, to better understand cancer and to further develop new treatments for it. This will provide a new perspective on clinical cancer diagnosis, prognosis, and treatment. Abstract: Epigenetic dysregulation is an important feature for cancer initiation and progression. Long non-coding RNAs (lncRNAs) are transcripts that stably present as RNA forms with no translated protein and have lengths larger than 200 nucleotides. LncRNA can epigenetically regulate either oncogenes or tumor suppressor genes. Nowadays, the combined research of lncRNA plus protein analysis is gaining more attention. LncRNA controls gene expression directly by binding to transcription factors of target genes and indirectly by complexing with other proteins to bind to target proteins and cause protein degradation, reduced protein stability, or interference with the binding of other proteins. -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
Coding RNA Genes
Review A guide to naming human non-coding RNA genes Ruth L Seal1,2,* , Ling-Ling Chen3, Sam Griffiths-Jones4, Todd M Lowe5, Michael B Mathews6, Dawn O’Reilly7, Andrew J Pierce8, Peter F Stadler9,10,11,12,13, Igor Ulitsky14 , Sandra L Wolin15 & Elspeth A Bruford1,2 Abstract working on non-coding RNA (ncRNA) nomenclature in the mid- 1980s with the approval of initial gene symbols for mitochondrial Research on non-coding RNA (ncRNA) is a rapidly expanding field. transfer RNA (tRNA) genes. Since then, we have worked closely Providing an official gene symbol and name to ncRNA genes brings with experts in the ncRNA field to develop symbols for many dif- order to otherwise potential chaos as it allows unambiguous ferent kinds of ncRNA genes. communication about each gene. The HUGO Gene Nomenclature The number of genes that the HGNC has named per ncRNA class Committee (HGNC, www.genenames.org) is the only group with is shown in Fig 1, and ranges in number from over 4,500 long the authority to approve symbols for human genes. The HGNC ncRNA (lncRNA) genes and over 1,900 microRNA genes, to just four works with specialist advisors for different classes of ncRNA to genes in the vault and Y RNA classes. Every gene symbol has a ensure that ncRNA nomenclature is accurate and informative, Symbol Report on our website, www.genenames.org, which where possible. Here, we review each major class of ncRNA that is displays the gene symbol, gene name, chromosomal location and currently annotated in the human genome and describe how each also includes links to key resources such as Ensembl (Zerbino et al, class is assigned a standardised nomenclature. -
Long Non-Coding RNA Lncshgl Recruits Hnrnpa1 to Suppress Hepatic Gluconeogenesis and Lipogenesis
Page 1 of 60 Diabetes Long non-coding RNA LncSHGL recruits hnRNPA1 to suppress hepatic gluconeogenesis and lipogenesis Junpei Wang1,2#, Weili Yang1,2#, Zhenzhen Chen1, Ji Chen1, Yuhong Meng1, Biaoqi Feng1, Libo Sun3, Lin Dou4, Jian Li4, Qinghua Cui2*, Jichun Yang1* 1Department of Physiology and Pathophysiology, School of Basic Medical Sciences Key Laboratory of Molecular Cardiovascular Sciences of the Ministry of Education Center for Non-coding RNA Medicine Peking University Health Science Center Beijing 100191, China 2Department of Biomedical Informatics, School of Basic Medical Sciences Key Laboratory of Molecular Cardiovascular Sciences of the Ministry of Education, Center for Non-coding RNA Medicine Peking University Health Science Center, Beijing 100191, China 3Beijing You An Hospital,Capital Medical University, Beijing 100069, China 4Key Laboratory of Geriatrics, Beijing Institute of Geriatrics & Beijing Hospital, Ministry of Health, Beijing 100730, China #These authors contributed equally to this work *Correspondence to: Jichun Yang, Ph.D. Department of Physiology and Pathophysiology, School of Basic Medical Sciences Peking University Health Science Center, Beijing 100191, China Email: [email protected]; Tel: (+86) 10-82801403 Or to: Qinghua Cui, Ph.D. Department of Biomedical Informatics, School of Basic Medical Sciences Peking University Health Science Center, Beijing 100191, China Email:[email protected]; Tel:(+86)10-82801585 1 Diabetes Publish Ahead of Print, published online January 30, 2018 Diabetes Page 2 of 60 Abstract Mammalian genomes encode a huge number of LncRNAs with unknown functions. This study determined the role and mechanism of a new LncRNA, LncRNA Suppressor of Hepatic Gluconeogenesis and Lipogenesis (LncSHGL), in regulating hepatic glucose/lipid metabolism. -
NSUN2 As the Methyltransferase and ALYREF As an M5c Reader
Cell Research (2017) 27:606-625. ORIGINAL ARTICLE www.nature.com/cr 5-methylcytosine promotes mRNA export — NSUN2 as the methyltransferase and ALYREF as an m5C reader Xin Yang1, 2, 3, *, Ying Yang2, *, Bao-Fa Sun2, *, Yu-Sheng Chen2, 3, *, Jia-Wei Xu1, 2, *, Wei-Yi Lai3, 4, *, Ang Li2, 3, Xing Wang2, 5, Devi Prasad Bhattarai2, 3, Wen Xiao2, Hui-Ying Sun2, Qin Zhu2, 3, Hai-Li Ma2, 3, Samir Adhikari2, Min Sun2, Ya-Juan Hao2, Bing Zhang2, Chun-Min Huang2, Niu Huang6, Gui-Bin Jiang4, Yong-Liang Zhao2, Hai-Lin Wang4, Ying-Pu Sun1, Yun-Gui Yang2, 3 1Center for Reproductive Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450000, China; 2Key Laboratory of Genomic and Precision Medicine, Collaborative Innovation Center of Genetics and Development, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China; 3School of Life Science, University of Chinese Academy of Sciences, Beijing 100049, China; 4State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China; 5Sino-Danish College, University of Chinese Academy of Sciences, Beijing 100049, China; 6National Institute of Biological Sciences, Beijing 102206, China 5-methylcytosine (m5C) is a post-transcriptional RNA modification identified in both stable and highly abundant tRNAs and rRNAs, and in mRNAs. However, its regulatory role in mRNA metabolism is still largely unknown. Here, we reveal that m5C modification is enriched in CG-rich regions and in regions immediately downstream of trans- lation initiation sites and has conserved, tissue-specific and dynamic features across mammalian transcriptomes. -
44056 NSUN2 Antibody
Revision 1 C 0 2 - t NSUN2 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] 6 Support: 877-678-TECH (8324) 5 0 Web: [email protected] 4 www.cellsignal.com 4 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB, IP H M R Mk Endogenous 100 Rabbit Q08J23 54888 Product Usage Information 2. Bohnsack, K.E. et al. (2019) Genes (Basel) 10, pii: E102. doi: 10.3390/genes10020102. Application Dilution 3. Bourgeois, G. et al. (2015) PLoS One 10, e0133321. 4. Brzezicha, B. et al. (2006) Nucleic Acids Res 34, 6034-43. Western Blotting 1:1000 5. Tuorto, F. et al. (2012) Nat Struct Mol Biol 19, 900-5. Immunoprecipitation 1:50 6. Tang, H. et al. (2015) Aging (Albany NY) 7, 1143-58. 7. Xing, J. et al. (2015) Mol Cell Biol 35, 4043-52. 8. Hussain, S. et al. (2013) Cell Rep 4, 255-61. Storage 9. Okamoto, M. et al. (2012) DNA Cell Biol 31, 660-71. Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% 10. Sakita-Suto, S. et al. (2007) Mol Biol Cell 18, 1107-17. glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity NSUN2 Antibody recognizes endogenous levels of total NSUN2 protein. Species Reactivity: Human, Mouse, Rat, Monkey Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Val690 of human NSUN2 protein. -
A Mouse Model for Intellectual Disability Caused by Mutations in the X-Linked 2′‑O‑Methyltransferase Ftsj1 Gene
Accepted Manuscript A mouse model for intellectual disability caused by mutations in the X-linked 2′'O'methyltransferase Ftsj1 gene Lars R. Jensen, Lillian Garrett, Sabine M. Hölter, Birgit Rathkolb, Ildikó Rácz, Thure Adler, Cornelia Prehn, Wolfgang Hans, Jan Rozman, Lore Becker, Juan Antonio Aguilar-Pimentel, Oliver Puk, Kristin Moreth, Monika Dopatka, Diego J. Walther, Viola von Bohlen und Halbach, Matthias Rath, Martin Delatycki, Bettina Bert, Heidrun Fink, Katharina Blümlein, Markus Ralser, Anke Van Dijck, Frank Kooy, Zornitza Stark, Sabine Müller, Harry Scherthan, Jozef Gecz, Wolfgang Wurst, Eckhard Wolf, Andreas Zimmer, Martin Klingenspor, Jochen Graw, Thomas Klopstock, Dirk Busch, Jerzy Adamski, Helmut Fuchs, Valérie Gailus-Durner, Martin Hrabě de Angelis, Oliver von Bohlen und Halbach, Hans-Hilger Ropers, Andreas W. Kuss PII: S0925-4439(18)30497-6 DOI: https://doi.org/10.1016/j.bbadis.2018.12.011 Reference: BBADIS 65360 To appear in: BBA - Molecular Basis of Disease Received date: 6 July 2018 Revised date: 6 December 2018 Accepted date: 10 December 2018 Please cite this article as: Lars R. Jensen, Lillian Garrett, Sabine M. Hölter, Birgit Rathkolb, Ildikó Rácz, Thure Adler, Cornelia Prehn, Wolfgang Hans, Jan Rozman, Lore Becker, Juan Antonio Aguilar-Pimentel, Oliver Puk, Kristin Moreth, Monika Dopatka, Diego J. Walther, Viola von Bohlen und Halbach, Matthias Rath, Martin Delatycki, Bettina Bert, Heidrun Fink, Katharina Blümlein, Markus Ralser, Anke Van Dijck, Frank Kooy, Zornitza Stark, Sabine Müller, Harry Scherthan, Jozef Gecz, Wolfgang Wurst, Eckhard Wolf, Andreas Zimmer, Martin Klingenspor, Jochen Graw, Thomas Klopstock, Dirk Busch, Jerzy Adamski, Helmut Fuchs, Valérie Gailus-Durner, Martin Hrabě de Angelis, Oliver von Bohlen und Halbach, Hans-Hilger Ropers, Andreas W. -
NSUN2 Polyclonal Antibody Catalog Number:20854-1-AP Featured Product 23 Publications
For Research Use Only NSUN2 Polyclonal antibody Catalog Number:20854-1-AP Featured Product 23 Publications www.ptglab.com Catalog Number: GenBank Accession Number: Purification Method: Basic Information 20854-1-AP BC001041 Antigen affinity purification Size: GeneID (NCBI): Recommended Dilutions: 150ul , Concentration: 500 μg/ml by 54888 WB 1:500-1:8000 Nanodrop and 307 μg/ml by Bradford Full Name: IP 0.5-4.0 ug for IP and 1:500-1:2000 method using BSA as the standard; NOL1/NOP2/Sun domain family, for WB Source: member 2 IHC 1:50-1:500 IF 1:10-1:100 Rabbit Calculated MW: Isotype: 767 aa, 86 kDa IgG Observed MW: Immunogen Catalog Number: 90-100 kDa AG14791 Applications Tested Applications: Positive Controls: IF, IHC, IP, WB, ELISA WB : HEK-293, COLO 320 cells, HeLa cells, HepG2 cells, Cited Applications: MCF-7 cells, SH-SY5Y cells IF, IHC, IP, WB IP : HeLa cells, Species Specificity: IHC : human breast cancer tissue, human testis tissue human Cited Species: IF : Hela cells, HepG2 cells human, mouse Note-IHC: suggested antigen retrieval with TE buffer pH 9.0; (*) Alternatively, antigen retrieval may be performed with citrate buffer pH 6.0 NSUN2, also known as SAKI or Misu (Myc-induced SUN-domain-containing protein), is a methyltransferase which Background Information catalyses (cytosine-5-)-methylation of tRNA. NSUN2 is direct target gene of c-Myc and may act downstream of Myc to regulate epidermal cell growth and proliferation. NSUN2 is overexpressed in various cancer tissues and may be a valuable target for cancer therapy and a cancer diagnostic marker. -
Nucleolar and Spindle‑Associated Protein 1 Promotes Non‑Small Cell Lung Cancer Progression and Serves As an Effector of Myocyte Enhancer Factor 2D
1044 ONCOLOGY REPORTS 45: 1044-1058, 2021 Nucleolar and spindle‑associated protein 1 promotes non‑small cell lung cancer progression and serves as an effector of myocyte enhancer factor 2D BO LING1,2, PENGYA WEI1, JUAN XIAO3, BINGKUI CEN1, HONG WEI1, XUEPING FENG1, GUANGBIN YE1,2, SONGBO LI1, ZHONGWEI ZHANG1,2, WEI LIANG1,2, SUOYI HUANG1,2 and WEI HUANG4 1College of Pharmacy, 2Key Laboratory of Guangxi's College for The Study of Characteristic Medicine in Youjiang River Basin, Youjiang Medical University for Nationalities, Baise, Guangxi 533000; 3Laboratory of Hepatobiliary and Pancreatic Surgery, Affiliated Hospital of Guilin Medical University, Guilin, Guangxi 541001; 4Department of Thoracic Surgery, Chongqing General Hospital, Chongqing 400013, P.R. China Received October 19, 2019; Accepted October 15, 2020 DOI: 10.3892/or.2020.7918 Abstract. As a potential oncogene, nucleolar and spindle-asso- enhancer factor 2D (MEF2D) directly targeted the NUSAP1 ciated protein 1 (NUSAP1) is involved in the regulation promoter, thereby enhancing the mRNA and protein expres- of tumor cell proliferation, metastasis and drug resistance. sion levels of NUSAP1. Moreover, the results demonstrated However, the role of NUSAP1 in non-small cell lung cancer that MEF2D expression was upregulated in NSCLC tissues (NSCLC) remains unclear. The present study aimed to and was positively correlated with NUSAP1 expression. investigate the biological function and underlying molecular MEF2D-knockdown decreased NSCLC cell proliferation, mechanisms of NUSAP1 in NSCLC. NUSAP1 expression was colony formation and invasion. NUSAP1 upregulation reversed measured in NSCLC tissues and cell lines via immunohisto- the effects of MEF2D-knockdown on NSCLC progression. chemistry and western blotting, respectively. -
D Isease Models & Mechanisms DMM a Ccepted Manuscript
© 2014. Published by The Company of Biologists Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed. 1 Full title: 2 Histopathology Reveals Correlative and Unique Phenotypes in a High Throughput Mouse Phenotyping 3 Screen 4 Short title: 5 Histopathology Adds Value to a High Throughput Mouse Phenotyping Screen 6 Authors: 1,2,4* 3 3 3 3 7 Hibret A. Adissu , Jeanne Estabel , David Sunter , Elizabeth Tuck , Yvette Hooks , Damian M 3 3 3 3 1,2,4 8 Carragher , Kay Clarke , Natasha A. Karp , Sanger Mouse Genetics Project , Susan Newbigging , 1 1,2 3‡ 1,2,4‡ 9 Nora Jones , Lily Morikawa , Jacqui K. White , Colin McKerlie 10 Affiliations: Accepted manuscript Accepted 1 11 Centre for Modeling Human Disease, Toronto Centre for Phenogenomics, 25 Orde Street, Toronto, 12 ON, Canada, M5T 3H7 DMM 2 13 Physiology & Experimental Medicine Research Program, The Hospital for Sick Children, 555 University 14 Avenue, Toronto, ON, Canada, M5G 1X8 3 15 Mouse Genetics Project, Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, 16 Cambridge, CB10 1SA, UK 4 17 Department of Laboratory Medicine & Pathobiology, Faculty of Medicine, University of Toronto, 18 Toronto, ON, Canada, M5S 1A8 19 *Correspondence to Hibret A. Adissu, Centre for Modeling Human Disease, Toronto Centre for Disease Models & Mechanisms 20 21 Phenogenomics, 25 Orde Street, Toronto, ON, Canada, M5T 3H7; [email protected] ‡ 22 Authors contributed equally 23 24 Keywords: 25 Histopathology, High Throughput Phenotyping, Mouse, Pathology 26 1 DMM Advance Online Articles. -
NSUN2 (NM 017755) Human Tagged ORF Clone – RG214459 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG214459 NSUN2 (NM_017755) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: NSUN2 (NM_017755) Human Tagged ORF Clone Tag: TurboGFP Symbol: NSUN2 Synonyms: MISU; MRT5; SAKI; TRM4 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 NSUN2 (NM_017755) Human Tagged ORF Clone – RG214459 ORF Nucleotide >RG214459 representing NM_017755 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGCGGCGGTCGCGGGGTCGGCGGCTCCAGCAACAGCAGCGGCCGGAGGACGCGGAGGATGGCGCCG AGGGTGGTGGAAAGCGCGGCGAGGCGGGCTGGGAAGGAGGCTACCCCGAGATCGTCAAGGAGAACAAGCT GTTCGAGCACTACTACCAGGAGCTCAAGATCGTGCCCGAGGGCGAGTGGGGCCAGTTCATGGACGCTCTC AGGGAGCCGCTCCCGGCCACTTTAAGAATTACTGGTTACAAAAGCCACGCAAAAGAGATTCTCCATTGCT TAAAGAACAAATATTTTAAGGAATTGGAGGACCTGGAGGTGGACGGTCAGAAAGTTGAAGTTCCACAGCC ACTGAGTTGGTATCCTGAAGAACTTGCCTGGCACACAAATTTAAGTCGAAAAATCTTGAGAAAATCGCCA CACTTGGAAAAGTTTCATCAGTTTCTAGTTAGTGAAACAGAATCTGGAAATATTAGTCGTCAAGAAGCTG TTAGCATGATCCCACCACTGCTCCTCAACGTGCGGCCTCATCATAAGATCTTAGATATGTGTGCAGCACC TGGCTCAAAGACCACACAGTTAATTGAAATGCTACATGCCGACATGAATGTCCCCTTTCCAGAGGGATTT