Advances in RNA Cytosine-5 Methylation: Detection, Regulatory Mechanisms, Biological Functions and Links to Cancer
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
By Submitted in Partial Satisfaction of the Requirements for Degree of in In
Developments of Two Imaging based Technologies for Cell Biology Researches by Xiaowei Yan DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biochemistry and Molecular Biology in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Ronald Vale Chair ______________________________________________________________________________Jonathan Weissman ______________________________________________________________________________Orion Weiner ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2021 By Xiaowei Yan ii DEDICATION Everything happens for the best. To my family, who supported me with all their love. iii ACKNOWLEDGEMENTS The greatest joy of my PhD has been joining UCSF, working and learning with such a fantastic group of scientists. I am extremely grateful for all the support and mentorship I received and would like to thank: My mentor, Ron Vale, who is such a great and generous person. Thank you for showing me that science is so much fun and thank you for always giving me the freedom in pursuing my interest. I am grateful for all the guidance from you and thank you for always supporting me whenever I needed. You are a person full of wisdom, and I have been learning so much from you and your attitude to science, science community and even life will continue inspire me. Thank you for being my mentor and thank you for being such a great mentor. Everyone else in Vale lab, past and present, for making our lab a sweet home. I would like to give my special thank to Marvin (Marvin Tanenbaum) and Nico (Nico Stuurman), two other mentors for me in the lab. I would like to thank them for helping me adapt to our lab, for all the valuable advice and for all the happiness during the time that we work together. -
Epigenetic Mechanisms of Lncrnas Binding to Protein in Carcinogenesis
cancers Review Epigenetic Mechanisms of LncRNAs Binding to Protein in Carcinogenesis Tae-Jin Shin, Kang-Hoon Lee and Je-Yoel Cho * Department of Biochemistry, BK21 Plus and Research Institute for Veterinary Science, School of Veterinary Medicine, Seoul National University, Seoul 08826, Korea; [email protected] (T.-J.S.); [email protected] (K.-H.L.) * Correspondence: [email protected]; Tel.: +82-02-800-1268 Received: 21 September 2020; Accepted: 9 October 2020; Published: 11 October 2020 Simple Summary: The functional analysis of lncRNA, which has recently been investigated in various fields of biological research, is critical to understanding the delicate control of cells and the occurrence of diseases. The interaction between proteins and lncRNA, which has been found to be a major mechanism, has been reported to play an important role in cancer development and progress. This review thus organized the lncRNAs and related proteins involved in the cancer process, from carcinogenesis to metastasis and resistance to chemotherapy, to better understand cancer and to further develop new treatments for it. This will provide a new perspective on clinical cancer diagnosis, prognosis, and treatment. Abstract: Epigenetic dysregulation is an important feature for cancer initiation and progression. Long non-coding RNAs (lncRNAs) are transcripts that stably present as RNA forms with no translated protein and have lengths larger than 200 nucleotides. LncRNA can epigenetically regulate either oncogenes or tumor suppressor genes. Nowadays, the combined research of lncRNA plus protein analysis is gaining more attention. LncRNA controls gene expression directly by binding to transcription factors of target genes and indirectly by complexing with other proteins to bind to target proteins and cause protein degradation, reduced protein stability, or interference with the binding of other proteins. -
Three Optimized Workflows for Cpg Island Methylation Profiling
APPLICATION NOTE Three Optimized Workflows for CpG Island Methylation Profiling Three Optimized Workflows for CpG Island Methylation Profiling DNA methylation is involved in the Discovery regulation of many cellular processes SOLiD™ Do you know your candidate gene? including X chromosome inactivation, No System chromosome stability, chromatin structure, Yes embryonic development, and transcription. Validation/Screening with Capillary Electrophoresis Do you know your candidate region or In mammals only the 5' carbons of the methylation state of that region? cytosines adjacent to guanines (CpG Yes No dinucleotides: cytosine-phospho-guanine) MSMSA Bisulfite Conversion Bisulfite Conversion are substrates for DNA methylation. (MethylSEQr™ Kit) (MethylSEQr™ Kit) Importance of CpG Islands Are there a high number Bisulfite Specific (BSP) CpG islands are 300−3000 base pair of poly T or A, or large Primer Design fragment size (>300 bps)? (Methyl Primer® Express) stretches of DNA that are CG rich, and are often found within unmethylated Yes No regions of promoters. Profiling of CpG Clone based Sequencing Direct PCR Sequencing island methylation indicates that some Fluorescent BSP PCR genes are more frequently methylated Bisulfite Specific (BSP) Primer Design Bisulfite Specific (BSP) Primer Design Data Analysis (Methyl Primer® Express) (Methyl Primer® Express) than others [1]. Hence, CpG islands play a (GeneMapper® Software v. 4.0) critical role in regulating gene expression. CpG islands found outside promoter BSP PCR BSP PCR Identification of a candidate region or the No regions are commonly methylated, and methylation state of Yes that region? are believed to be responsible for silencing Cloning Yes transcription of repetitive sequences Cycle Sequencing Direct PCR Cycle Sequencing Are there a high number and parasitic sequence elements, such of poly T or A, or large No as viral DNA. -
DNA Methylation Analysis: Choosing the Right Method
biology Review DNA Methylation Analysis: Choosing the Right Method Sergey Kurdyukov 1,* and Martyn Bullock 2 Received: 8 July 2015; Accepted: 22 December 2015; Published: 6 January 2016 Academic Editor: Melanie Ehrlich 1 Genomics Core facility, Kolling Institute of Medical Research, University of Sydney, Sydney 2065, Australia 2 Cancer Genetics Laboratory, Kolling Institute of Medical Research, University of Sydney, Sydney 2065, Australia; [email protected] * Correspondence: [email protected]; Tel.: +61-299-264-756 Abstract: In the burgeoning field of epigenetics, there are several methods available to determine the methylation status of DNA samples. However, choosing the method that is best suited to answering a particular biological question still proves to be a difficult task. This review aims to provide biologists, particularly those new to the field of epigenetics, with a simple algorithm to help guide them in the selection of the most appropriate assay to meet their research needs. First of all, we have separated all methods into two categories: those that are used for: (1) the discovery of unknown epigenetic changes; and (2) the assessment of DNA methylation within particular regulatory regions/genes of interest. The techniques are then scrutinized and ranked according to their robustness, high throughput capabilities and cost. This review includes the majority of methods available to date, but with a particular focus on commercially available kits or other simple and straightforward solutions that have proven to be useful. Keywords: DNA methylation; 5-methylcytosine; CpG islands; epigenetics; next generation sequencing 1. Introduction DNA methylation in vertebrates is characterized by the addition of a methyl or hydroxymethyl group to the C5 position of cytosine, which occurs mainly in the context of CG dinucleotides. -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
Coding RNA Genes
Review A guide to naming human non-coding RNA genes Ruth L Seal1,2,* , Ling-Ling Chen3, Sam Griffiths-Jones4, Todd M Lowe5, Michael B Mathews6, Dawn O’Reilly7, Andrew J Pierce8, Peter F Stadler9,10,11,12,13, Igor Ulitsky14 , Sandra L Wolin15 & Elspeth A Bruford1,2 Abstract working on non-coding RNA (ncRNA) nomenclature in the mid- 1980s with the approval of initial gene symbols for mitochondrial Research on non-coding RNA (ncRNA) is a rapidly expanding field. transfer RNA (tRNA) genes. Since then, we have worked closely Providing an official gene symbol and name to ncRNA genes brings with experts in the ncRNA field to develop symbols for many dif- order to otherwise potential chaos as it allows unambiguous ferent kinds of ncRNA genes. communication about each gene. The HUGO Gene Nomenclature The number of genes that the HGNC has named per ncRNA class Committee (HGNC, www.genenames.org) is the only group with is shown in Fig 1, and ranges in number from over 4,500 long the authority to approve symbols for human genes. The HGNC ncRNA (lncRNA) genes and over 1,900 microRNA genes, to just four works with specialist advisors for different classes of ncRNA to genes in the vault and Y RNA classes. Every gene symbol has a ensure that ncRNA nomenclature is accurate and informative, Symbol Report on our website, www.genenames.org, which where possible. Here, we review each major class of ncRNA that is displays the gene symbol, gene name, chromosomal location and currently annotated in the human genome and describe how each also includes links to key resources such as Ensembl (Zerbino et al, class is assigned a standardised nomenclature. -
High-Resolution Bisulfite-Sequencing of Peripheral Blood DNA Methylation in Early-Onset and Familial Risk Breast Cancer Patients
Author Manuscript Published OnlineFirst on June 7, 2019; DOI: 10.1158/1078-0432.CCR-18-2423 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. High-Resolution Bisulfite-Sequencing of Peripheral Blood DNA Methylation in Early- Onset and Familial Risk Breast Cancer Patients Justin Chen1*, Maria K. Haanpää2*, Joshua J. Gruber1,2, Natalie Jäger1, James M. Ford1,2ǂ, and Michael P. Snyder1ǂ 1Department of Genetics 2Department of Medicine, Oncology Division Stanford University, Stanford, CA 94305, USA. * These authors contributed equally to this work. ǂ Co-corresponding authors Running Title: DNA Methylation and High-Risk Breast Cancer Keywords: DNA Methylation; Breast Cancer; Epigenetics; Cancer Predisposition; Allelic Methylation Additional Information: Financial Support: This work used the Genome Sequencing Service Center by Stanford Center for Genomics and Personalized Medicine Sequencing Center, supported by the grant award NIH S10OD020141. MKH is supported by grants from Sigrid Juselius Foundation, Orion Research Foundation, Päivikki ja Sakari Sohlberg Foundation and Instrumentarium Science Foundation. JJG was supported by fellowships from the Jane Coffin Childs Memorial Fund for Medical Research, Stanford Cancer Institute and Susan G. Komen Foundation, as well as funding from ASCO, the Conquer Cancer Foundation and the Breast Cancer Research Foundation. NJ was supported by an EMBO Long-Term Fellowship (ALTF 325-2014). JMF is supported by the BRCA Foundation and the Breast Cancer Research Foundation. MPS is supported by grants from the NIH including a Centers of Excellence in Genomic Science award (5P50HG00773504). Correspondence: Michael P. Snyder James M. Ford Department of Genetics 269 Campus Dr. Stanford University School of Medicine CCSR Room 1115 300 Pasteur Dr. -
Long Non-Coding RNA Lncshgl Recruits Hnrnpa1 to Suppress Hepatic Gluconeogenesis and Lipogenesis
Page 1 of 60 Diabetes Long non-coding RNA LncSHGL recruits hnRNPA1 to suppress hepatic gluconeogenesis and lipogenesis Junpei Wang1,2#, Weili Yang1,2#, Zhenzhen Chen1, Ji Chen1, Yuhong Meng1, Biaoqi Feng1, Libo Sun3, Lin Dou4, Jian Li4, Qinghua Cui2*, Jichun Yang1* 1Department of Physiology and Pathophysiology, School of Basic Medical Sciences Key Laboratory of Molecular Cardiovascular Sciences of the Ministry of Education Center for Non-coding RNA Medicine Peking University Health Science Center Beijing 100191, China 2Department of Biomedical Informatics, School of Basic Medical Sciences Key Laboratory of Molecular Cardiovascular Sciences of the Ministry of Education, Center for Non-coding RNA Medicine Peking University Health Science Center, Beijing 100191, China 3Beijing You An Hospital,Capital Medical University, Beijing 100069, China 4Key Laboratory of Geriatrics, Beijing Institute of Geriatrics & Beijing Hospital, Ministry of Health, Beijing 100730, China #These authors contributed equally to this work *Correspondence to: Jichun Yang, Ph.D. Department of Physiology and Pathophysiology, School of Basic Medical Sciences Peking University Health Science Center, Beijing 100191, China Email: [email protected]; Tel: (+86) 10-82801403 Or to: Qinghua Cui, Ph.D. Department of Biomedical Informatics, School of Basic Medical Sciences Peking University Health Science Center, Beijing 100191, China Email:[email protected]; Tel:(+86)10-82801585 1 Diabetes Publish Ahead of Print, published online January 30, 2018 Diabetes Page 2 of 60 Abstract Mammalian genomes encode a huge number of LncRNAs with unknown functions. This study determined the role and mechanism of a new LncRNA, LncRNA Suppressor of Hepatic Gluconeogenesis and Lipogenesis (LncSHGL), in regulating hepatic glucose/lipid metabolism. -
HITTING the MARK in CANCER EPIGENETICS Research in Cancer Epigenetics Is Advancing Rapidly
HITTING THE MARK IN CANCER EPIGENETICS Research in cancer epigenetics is advancing rapidly. Here’s an overview of the tools and methods scientists use to drive progress in the field. For by CUSTOM MEDIA ADVERTISEMENT FEATURE ADVERTISEMENT FEATURE says. “We usually put these cytosine ring — is the best look and behave. Illumina’s Andrew Feber, a cancer patients on a watch and understood epigenetic marker methylation array covers geneticist at UCL Cancer HITTING THE MARK wait scheme. We could have today. Methylation typically 850,000 sites on the Institute in London, is one spared her all that therapy.” silences gene transcription genome, and analyses with of those scientists. He aims Pfister’s experience in patterns that are it, he says, “are sufficient to find epigenetic traces IN CANCER EPIGENETICS illustrates the growing characteristic to specific cell to capture the cancer cell’s of bladder cancer in urine, potential of genomic types and tissues. But when basic identity”. an endeavour he says is RESEARCH IN CANCER EPIGENETICS IS ADVANCING RAPIDLY. Here’s an overview of the tools technologies in epigenetics to it silences tumour suppressor Esteller points out that particularly well suited to and methods scientists use to drive progress in the field. contribute to understanding, genes, cancer may appear. methylation arrays have sequencing since it can diagnosing and treating The first epigenetic many positive aspects, such read the often fragmented cancer. Epigenetic technologies — methylation as low-cost and amenability arrangements of DNA modifications to DNA and arrays — emerged about 15 to formalin-fixed, paraffin- letters in liquid specimens. n 2013 Stefan Pfister, RNA regulate how and when years ago with the launch embedded tissue samples. -
NSUN2 As the Methyltransferase and ALYREF As an M5c Reader
Cell Research (2017) 27:606-625. ORIGINAL ARTICLE www.nature.com/cr 5-methylcytosine promotes mRNA export — NSUN2 as the methyltransferase and ALYREF as an m5C reader Xin Yang1, 2, 3, *, Ying Yang2, *, Bao-Fa Sun2, *, Yu-Sheng Chen2, 3, *, Jia-Wei Xu1, 2, *, Wei-Yi Lai3, 4, *, Ang Li2, 3, Xing Wang2, 5, Devi Prasad Bhattarai2, 3, Wen Xiao2, Hui-Ying Sun2, Qin Zhu2, 3, Hai-Li Ma2, 3, Samir Adhikari2, Min Sun2, Ya-Juan Hao2, Bing Zhang2, Chun-Min Huang2, Niu Huang6, Gui-Bin Jiang4, Yong-Liang Zhao2, Hai-Lin Wang4, Ying-Pu Sun1, Yun-Gui Yang2, 3 1Center for Reproductive Medicine, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450000, China; 2Key Laboratory of Genomic and Precision Medicine, Collaborative Innovation Center of Genetics and Development, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China; 3School of Life Science, University of Chinese Academy of Sciences, Beijing 100049, China; 4State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China; 5Sino-Danish College, University of Chinese Academy of Sciences, Beijing 100049, China; 6National Institute of Biological Sciences, Beijing 102206, China 5-methylcytosine (m5C) is a post-transcriptional RNA modification identified in both stable and highly abundant tRNAs and rRNAs, and in mRNAs. However, its regulatory role in mRNA metabolism is still largely unknown. Here, we reveal that m5C modification is enriched in CG-rich regions and in regions immediately downstream of trans- lation initiation sites and has conserved, tissue-specific and dynamic features across mammalian transcriptomes. -
BS-Seq Data Processing Lecture (Pdf)
Bisulfite-Sequencing Theory and Quality Control [email protected] v2021-04 Bisulfite-Seq theory and Quality Control coffee a.m. Mapping and QC practical Visualising and Exploring talk Lunch Visualising and Exploring practical p.m. coffee Differential methylation talk & practical Epigenetics Studies changes in gene expression which are not encoded by the underlying DNA sequence Chromatin • histone modification • non-coding RNAs • higher order structure (accessibility/compaction) DNA cytosine methylation From The Cell Biology of Stem Cells (2010) Types of DNA methylation CG context non-CG context me me T C G T A T C A T A 5’ 5’ 5’ 5’ 3’ A G C A T 3’ 3’ A G T A T 3’ me Mammals Plants CG present present CHG (mostly) absent present H = T/A/C CHH (mostly) absent present DNA methylation is stably maintained from W. Reik & J. Walter, Nat. Rev. Genet. 2001 Regulation by DNA methylation Silencing of gene expression Tissue differentiation and embryonic development Faults in correct DNA methylation may result in - early development failure - epigenetic syndromes Repeat activity - cancer Genomic stability Imprinted Genes: mono-allelic expression Differential allelic DNA methylation CGI (CpG island) X methylated CpG unmethylated CpG Imprinted Genes: Mono-allelic expression with parent-of-origin specificity. Have key roles in energy metabolism, placenta functions. DNA Methylation DNA methyl-transferases DNA-demethylase(s)? TETs? Passive demethylation? Cytosine 5-methyl Cytosine Other cytosine modifications Miguel R. Branco, Gabriella Ficz & Wolf Reik Nature Reviews Genetics 13, 7-13 (January 2012) Measuring DNA methylation by Bisulfite-sequencing Image by Illumina Bisulfite Informatics me me CCAGTCGCTATAGCGCGATATCGTA Convert TTAGTTGCTATAGTGCGATATTGTA Map TTAGTTGCTATAGTGCGATATTGTA ||||||||||||||||||||||||| ...CCAGTCGCTATAGCGCGATATCGTA.. -
44056 NSUN2 Antibody
Revision 1 C 0 2 - t NSUN2 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] 6 Support: 877-678-TECH (8324) 5 0 Web: [email protected] 4 www.cellsignal.com 4 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB, IP H M R Mk Endogenous 100 Rabbit Q08J23 54888 Product Usage Information 2. Bohnsack, K.E. et al. (2019) Genes (Basel) 10, pii: E102. doi: 10.3390/genes10020102. Application Dilution 3. Bourgeois, G. et al. (2015) PLoS One 10, e0133321. 4. Brzezicha, B. et al. (2006) Nucleic Acids Res 34, 6034-43. Western Blotting 1:1000 5. Tuorto, F. et al. (2012) Nat Struct Mol Biol 19, 900-5. Immunoprecipitation 1:50 6. Tang, H. et al. (2015) Aging (Albany NY) 7, 1143-58. 7. Xing, J. et al. (2015) Mol Cell Biol 35, 4043-52. 8. Hussain, S. et al. (2013) Cell Rep 4, 255-61. Storage 9. Okamoto, M. et al. (2012) DNA Cell Biol 31, 660-71. Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% 10. Sakita-Suto, S. et al. (2007) Mol Biol Cell 18, 1107-17. glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity NSUN2 Antibody recognizes endogenous levels of total NSUN2 protein. Species Reactivity: Human, Mouse, Rat, Monkey Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Val690 of human NSUN2 protein.