Aldose Reductase Inhibitor Epalrestat Alleviates High Glucose-Induced Cardiomyocyte Apoptosis Via ROS

European Review for Medical and Pharmacological Sciences 2019; 23 (3 Suppl): 294-303 Aldose reductase inhibitor Epalrestat alleviates high glucose-induced cardiomyocyte apoptosis via ROS X. WANG1, F. YU2, W.-Q. ZHENG3 1Department of Pharmacy, Weihai Central Hospital, Weihai, China 2Department of Dermatology, Weihai Central Hospital, Weihai, China 3Department of Cardiology, Weihai Central Hospital, Weihai, China Abstract. – OBJECTIVE: To clarify the role of die of cardiovascular diseases and that the mor- aldose reductase inhibitor (ARI) in the high glu- tality rate is 2-4 times that in non-diabetic popu- cose-induced cardiomyocyte apoptosis and its lation1. Therefore, diabetes-related cardiovascular mechanism. complications are a leading cause of death in di- MATERIALS AND METHODS: In this study, H9c2 cardiomyocytes were employed as ob- abetic patients. Currently, scholars in China and jects, high-glucose medium as stimulus, and elsewhere have considered diabetes as an inde- ARI Epalrestat as a therapeutic drug. The cell pendent risk factor for cardiovascular diseases2. apoptosis and activity changes of nitric oxide High-glucose toxicity is the main factor damag- synthase (NOS), NO, and reactive oxygen spe- ing the heart and vessels, and the degree of such cies (ROS) were evaluated via Hoechst staining, damage is closely correlated with the duration of enzyme-linked immunosorbent assay (ELISA), hyperglycemia and level of blood glucose polymerase chain reaction (PCR), and Western 3-5 blotting. In addition, the mitochondrial mem- Reports have manifested that long-term brane potential was measured via fluorescence high-glucose cannot only activate the renin-an- counting. giotensin-aldosterone system (RAAS), produce RESULTS: Epalrestat inhibited the activity of reactive oxygen species (ROS), and increase the AR to improve high glucose-induced oxidative advanced glycation end products (AGEs), as well stress in cardiomyocytes, weaken ROS activ- as their receptors (RAGEs), but also activate in- ity, relieve the inhibition on NO activity, allevi- ate mitochondrial membrane potential damage, flammatory response and endoplasmic reticulum reduce the level of high glucose-induced car- stress response, thereby promoting the damage diomyocyte apoptosis, and suppress the ex- and death of cardiomyocytes and vascular endo- pression and activity of Caspase-3, thereby pre- thelial cells through various pathways. Hence, venting high glucose-induced cardiomyocyte the current research hotspot is to explore the new apoptosis. CONCLUSIONS: mechanism of high glucose-induced damage to ARI protects against high cardiomyocytes and vessels, and provide novel glucose-induced cardiomyocyte apoptosis. targets and measures for the prevention and treat- Key Words: ment of diabetes-related cardiovascular complica- Aldose reductase inhibitor, High blood glucose, tions. Apoptosis, ROS. The pathogenesis of diabetes is that glucose fails to be normally transformed into glycogen stores for a long time in the body of patients, Introduction thereby triggering the abnormally active reduction pathway of aldose. As a key enzyme in the With the aging of the population, as well as polyol metabolism pathway, aldose reductase changes in people’s lifestyle, the incidence rate (AR) can reduce glucose into sorbitol which, with of diabetes is increasing year by year in China, strong polarity, does not easily pass through cell which has become a major public health issue. A membranes, but rather it accumulates in cells to survey revealed that over 70% of diabetic patients alter the permeability of cells and weaken the 294 Corresponding Author: Wenqing Zheng, MM; e-mail: [email protected] Epalrestat protects cardiomyocytes cultured in high glucose Na+-K+-ATPase activity. This resulting in inositol Louis, MO, USA) at 37°C for 4 h. Next, with the loss and cell metabolism, as well as function im- supernatant sucked away carefully, each well of pairment6. Since the drugs that block or attenuate cells was added with 150 μL of dimethyl sulfoxide AR activity can be used to prevent or delay the (DMSO; Sigma-Aldrich, St. Louis, MO, USA), occurrence of diabetic complications, AR inhib- shaken, and mixed evenly. Finally, the optical itors (ARIs) have become therapeutic factors in density (OD) of each well was measured at the the treatment of diabetes7. wavelength of 570 nm using a microplate reader. Thus, it was wondered whether high glu- The experiment was repeated for three times. cose-induced myocardial injury mechanism in diabetes involves aberrantly active aldose reduction Determination of Lactate pathways and whether ARIs are capable of im- Dehydrogenase (LDH) Content proving high glucose-induced myocardial injury. The cells in the logarithmic growth phase were Based on this hypothesis, this work aims to in- digested, harvested, and prepared into the sus- vestigate the influence of ARIs on cardiomyocyte pension at the concentration of 1×105cells/mL. apoptosis and the regulatory mechanism of ROS Then, they were seeded into a 96-well plate (100 therein, by establishing the high glucose-induced μL/well). In the experiment, triplicate wells and cardiomyocyte apoptosis model using ARIs and a control group was set. After cell attachment, detecting AR activity, cell survival rate, ROS lev- the culture plates were placed in the incubator at el, and changes in apoptosis-related indicators. 37°C with 5% CO2 and cultured for 24 h. A total of 20 μL of the supernatant was obtained from each well, grouped, added with the corresponding Materials and Methods reagents according to the kit instructions, mixed evenly, and let stand at room temperature for 3 Culture of Cardiomyocytes min. Subsequently, a 1 cm light path cuvette was H9c2 cells were purchased from the Shanghai zeroed at the wavelength of 440 nm using dou- Institute of Biochemistry and Cell Biology, at the ble distilled water, and the OD was determined Chinese Academy of Sciences (Shanghai, China). by means of the microplate reader. The unit is The cell suspension was transferred into a 10 mL defined as follows: 1,000 mL of culture solution centrifuge tube and added with 5 mL of Dulbec- reacts with matrices at 37°C for 15 min and 1 g/ co’s Modified Eagle Medium (DMEM; Gibco, mol pyruvic acid produced in the reaction system Rockville, MD, USA) containing 10% fetal bo- is regarded as 1 unit. Finally, the content of LDH vine serum (FBS; Gibco, Rockville, MD, USA). in the medium was calculated using the formula. After centrifugation at 1,000 rpm for 10 min, with the supernatant discarded, the cells were added Hoechst Staining with an appropriate volume of DMEM containing All groups of cells cultured were inoculated 10% FBS, pipetted and mixed evenly, and their into coverslips and treated in different groups, concentration was adjusted to 1×105 cells/mL. and once the supernatant was removed, they Next, the cells were inoculated into a 25 mL cul- were washed using phosphate-buffered saline ture flask and cultured in an incubator with 5% (PBS), fixed in Carnoy’s solution and rinsed us- CO2 at 37°C, and 24 h later, the medium was re- ing PBS for 5 min. Then, the cells were stained placed. with Hoechst 33258 working solution, let stand at room temperature for 15 min, rinsed with PBS Cell Counting Kit (CCK)-8 Assay again and sealed in the mixture of glycerin and The cells in the logarithmic growth phase were PBS (1:1) or water-soluble mounting medium. digested, harvested, and prepared into the suspen- Finally, the cells were observed under a fluores- sion at the concentration of 1×105cells/mL. Sub- cence microscope. It was found that the cell nuclei sequently, they were seeded into a 96-well plate displayed the blue fluorescence spots because the (100 μL/well). In the experiment, triplicate wells Hoechst stains are the specific fluorescence probe and blank controls were set. After inoculation of deoxyribonucleic acid (DNA). overnight, the cells were observed under a microscope to verify whether they adhered well. After Polymerase Chain Reaction (PCR) treatment, each well of cells was cultured with 20 The cells treated were collected from each μL of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-di- group to extract total ribonucleic acids (RNAs) phenyl tetrazolium bromide; Sigma-Aldrich, St. using TRIzol (Invitrogen, Carlsbad, CA, USA). 295 X. Wang, F. Yu, W.-Q. Zheng After the concentration of samples was measured, 1 h, while the protein bands were cut according RNAs were reversely transcribed into cDNAs in to molecular weight and incubated with prima- the first 40 cycles using the reverse transcription ry antibodies in a refrigerator at 4°C overnight. system according to the concentration. Then, On the second day, the PVDF membranes were PCR amplification was performed with the re- taken out, rinsed using Tris-Buffered Saline verse transcription reaction conditions set. After and Tween-20 (TBST), and incubated with the each cycle, the fluorescence signals were collect- secondary antibody IgG (1:5,000) at room tem- ed in a real-time way, while the amplification and perature for 1 h. After incubation, the products dissolution curves were plotted. Primer sequenc- were rinsed again using TBST, followed by de- es used in this study were as follows: caspase 3, velopment and measurement of grayscale using F: 5’-GTCCGGTACTCTCACTATACAC-3’, R: Tannon 5200 fluorescent immuno-development 5’-CGGTAAGGTTGTGTCACTTGGA-3’; NOS, system. F: 5’-GCCTGACACGGATACTACGGCAG-3’, R: 5’-GGATTACAGTCATGGCGCCAAG-3’; Measurement of Inhibition Rate of AR GAPDH: F: 5’- CGCTCTCTGCTCCTCCTGTTC After being lysed in an ice bath, cells in each -3’, R: 5’-ATCCGTTGACTCCGACCTTCAC-3’. group were centrifuged at 4°C. The colorless and transparent supernatant was absorbed. Detection of Caspase-3 Activity Then, the supernatant was added into a 96-well After all groups of cells were collected, washed plate for a reaction which was initiated with in PBS, and lysed with trypsin via an ice bath, the the addition of reductive coenzyme II (0.16 cell lysates were extracted to absorb cell medium mmol/L) and DL-glyceraldehyde substrate (10 for later use.

Load more