Emergence of Carbapenem-Resistant Pseudomonas Aeruginosa and Acinetobacter Baumannii Clinical Isolates Collected from Some Libyan Hospitals

UNIVERSITE DE TUNIS EL MANAR Ecole Doctorale des Sciences Biologiques et AIX-MARSEILLE UNIVERSITE Ecole Doctorale des Sciences de la Vie et de la Santé

THESE DE DOCTORAT EN COTUTELLE En Vue de l’obtention de grade de Docteur de l’Université de Tunis et d’Aix-Marseille Université

Spécialités: Microbiologie / Pathologie humaine et maladies infectieuses

Déterminisme du support moléculaire et de l’épidémiologie de la résistance aux ȕ-lactamines chez des bacilles à Gram négatif isolés dans des hôpitaux tunisiens et libyens

Présentée par: Najla MATHLOUTHI

Composition du Jury:

Pr. Imane ZOUARI Université Tunis el Manar Président de Jury Dr. Marie KEMPF Université d’Angers Rapporteur Dr. Taoufik GHRAIRI Université Tunis el Manar Rapporteur Pr. Philippe COLSON Université d’Aix-Marseille Examinateur Pr. Mr. Jean-Marc ROLAIN Université d’Aix-Marseille Directeur de Thèse Dr. Chedly CHOUCHANI Université de Carthage Directeur de Thèse

(8 Avril 2017)

SOMMAIRE

 AVANT PROPOS ...... 3  RESUME ...... 4  SUMMARY ...... 5  INTRODUCTION ...... 7  CHAPITRE I: Revue: L’émergence et la dissémination des carbapénèmases produites par les bacilles à Gram négatifs dans les pays du bassin méditerranéen ...... 15  Article 1: Prevalence and emergence of carbapenemases producing Gram-negative bacteria in Mediterranean basin ..... 17  CHAPITRE II: Etude du déterminisme génétique et de l’épidémiologie moléculaire de la résistance aux β-lactamines chez des souches d’Esherichia coli et de Klebsiella pneumonaie isolées dans des hôpitaux tunisiens et libyens ...... 39  Article 2: Characteristics of Carbapenemase-and Extended- Spectrum β-Lactamase-producing Enterobacteriaceae isolated from Tunisian and Libyan Hospitals ...... 49  CHAPITRE III: Etude du déterminisme génétique et de l’épidémiologie moléculaire de la résistance aux β-lactamines chez des souches d’Acinetobacter baumannii et de Pseudomonas aeruginosa isolées dans des hôpitaux tunisiens et libyens ...... 61

1  Article 3: Emergence of Carbapenem-Resistant Pseudomonas aeruginosa and Acinetobacter baumannii Clinical Isolates Collected from Some Libyan Hospitals ...... 77  Article4: Early detection of metallo--lactamase NDM-1 and OXA-23 carbapenemase-producing Acinetobacter baumannii in Libyan hospitals ...... 87  Article 5: Incidence of OXA-23 and OXA-58 carbapenemases co-expressed in clinical isolates of Acinetobacter baumannii in Tunisia ...... 95  Chapitre VI (Annexe): Travaux sur la description et le séquençage des génomes de nouvelles espèces ...... 123  Article 6: Genome sequence and description of Mobilicoccus massiliensis sp. nov. isolated from the stool of a Nigerien male suffering from a severe form of acute malnutrition ‘‘kwashiorkor’’ ...... 127  Article 7: Genome sequence and description of Paenibacillus ihuae strain GD6 sp. nov. isolated from the stool of a 62-year-old man, France ...... 157  CONCLUSION ET PERSPECTIVES ...... 185  REMERCIEMENTS ...... 191

2 AVANT PROPOS

Le format de présentation de cette thèse correspond à une recommandation à la spécialité Pathologie Humaine et Maladies infectieuses, à l’intérieur du Master des Sciences de la Vie et de la Santé qui dépend de l’Ecole Doctorale des Sciences de la Vie de Marseille.

Le candidat est amené à respecter les règles qui lui sont imposées et qui comportent un format de thèse utilisé dans le Nord de l’Europe et qui permet un meilleur rangement que les thèses traditionnelles. Par ailleurs, la partie introduction et bibliographie est remplacée par une revue envoyée dans un journal afin de permettre une évaluation extérieure de la qualité de la revue et de permettre à l’étudiant de commencer le plus tôt possible une bibliographie sur le domaine de cette thèse.

Par ailleurs, la thèse est présentée sur article publié, accepté, ou soumis associé d’un bref commentaire donnant le sens général du travail. Cette forme de présentation a paru plus en adéquation avec les exigences de la compétition internationale et permet de se concentrer sur des travaux qui bénéficieront d’une diffusion internationale.

Professeur Didier RAOULT

3 RESUME

L’augmentation et la dissémination de la résistance aux β-lactamines chez les bacilles à Gram négatif, particulièrement les Entérobactéries, les bactéries du genre Pseudomonas et Acinetobacter, représentent un problème majeur de santé publique. Les infections nosocomiales causées par ces bactéries multi-résistantes (BMR) ont conduit à une augmentation de la mortalité, de la morbidité et du coût de traitement. L’utilisation abusive et non contrôlée de ces antibiotiques a grandement contribué à la large diffusion de cette résistance. Ainsi, face à cette préoccupation mondiale et suite à de nombreuses recommandations, plusieurs études épidémiologiques et moléculaires ont été rapportées afin de contrôler et de surveiller la diffusion et la dissémination des BMR. Contrairement à de nombreuses régions dans le monde, il existe peu d’informations concernant la caractérisation moléculaire des gènes de résistance aux β-lactamines des bacilles à Gram négatif isolés en Tunisie et surtout en Libye. C’est dans cette optique que ce projet de Thèse de Doctorat s’articule avec comme objectifs: (i) mettre en évidence la prévalence des bacilles à Gram négatifs multi-résistants isolés aux niveaux des hôpitaux tunisiens et libyens (ii) identifier le support génétique de la résistance aux β-lactamines de ces souches cliniques (iii) étudier la diversité clonale des souches multi-résistantes par typage moléculaire (iiii) étudier l’épidémiologie moléculaire de ces BMR en Tunisie et en Libye ainsi que dans le bassin méditerranéen afin de maîtriser le processus décisionnel du traitement et de limiter la dissémination des épidémies. Mots clés: bacilles à Gram-négatif, bassin méditerranéen, isolats cliniques multi-résistants aux β-lactamines, études moléculaires des mécanismes de résistance aux β-lactamines, études épidémiologiques.

4 SUMMARY

The increase and spread of β-lactam resistance in gram negative bacteria especially Enterobacteriaceae, Pseudomonas and Acinetobacter (E.P.A) species have become a major concern worldwide. The hospital-acquired infections caused by MDR bacteria have led to an increase in mortality, morbidity and cost of treatment. The frequent misuse of antibiotic drug has greatly contributed to worldwide dissemination of antibiotics resistance. Front of this worldwide concern, and various recommendations, several epidemiological and molecular studies have been reported in order to control the spread and the dissemination of these MDR.

Unlike many parts of the world, there is little information concerning the molecular characterization of the β-lactam resistance genes of Gram-negative bacilli isolated in Tunisia and especially in Libya. Therefore, it is in this context that the project of this thesis was conducted with essential objectives: (i) highlight the prevalence of multi-resistant Gram negative bacilli isolated in Tunisian and Libyan hospitals (ii) identify the genetic support of resistance to β-lactams of these clinical strains (iii) study the molecular epidemiology of these BMR in Tunisia and Libya as well as in the Mediterranean basin in order to control the decision-making process and to limit the spread of epidemics.

Keywords: Gram-negative bacilli, mediterranean basin, clinical isolates multi-resistant to β-lactams, molecular studies of the mechanisms of β-lactam resistance, epidemiological studies.

INTRODUCTION

La découverte des antibiotiques, notamment la pénicilline en 1928 a sans doute été l’une des avancées thérapeutiques les plus importantes du vingtième siècle. L’utilisation de ces agents anti- infectieux depuis les années 1940 a considérablement réduit le taux de morbidité et de mortalité liés aux maladies infectieuses [1]. Cependant, leur utilisation à grande échelle a également conduit à l’émergence de la résistance aux antibiotiques. Les premières bactéries résistantes ont été identifiées dès les années 1940, avec notamment l’émergence des Staphylococcus aureus résistants à la pénicilline dès 1947, soit seulement quatre années après l’utilisation à grande échelle de cet antibiotique [2]. A partir des années 1950, de nombreux antibiotiques ont été découverts ou synthétisés et le développement de chaque nouvelle classe a été suivi par l’apparition de l’émergence de nouveaux mécanismes de résistance entraînant la diffusion de bactéries pathogènes de plus en plus difficiles à traiter, comme ce fut le cas pour la méticilline G qui a été mise sur le marché en 1961 et suivie de la découverte de S. aureus résistant en 1962, pareillement pour l’ampicilline G qui a été mise sur le marché en 1962 et suivie de l’émergence d’Entérobactéries résistantes en 1964 puis des céphalosporines mis sur le marché en 1980 et suivis de l’émergence d’entérobactéries résistantes en 1981 [1].

7 L’âge d’or de la recherche pharmaceutique sur les antibiotiques a duré jusqu’aux années 1980, expliquant le fait qu’à cette époque, la résistance aux antibiotiques, bien que connue et largement répandue, ne représentait pas encore une menace. Cependant à partir des années 2000, selon les données de l’organisation mondiale de la santé (OMS), les maladies infectieuses causées par les bactéries multi-résistantes (BMR) ont été à l’origine de 25% des décès dans le monde entier, dont 50% provenaient des pays en voie de développement. En Europe en 2007, 400000 infections ont été causées par les BMR dont 25000 décès ont été liés à ces bactéries qui n’ont pu être traitées faute d’antibiotiques efficaces. Le coût annuel du traitement de ces infections est estimé à 1.5 milliard d’euros [3].

L’augmentation et la dissémination de la résistance aux antibiotiques chez les bacilles à Gram négatif, particulièrement les entérobactéries, les bactéries du genre Pseudomonas et Acinetobacter représentent un problème majeur de santé publique au niveau mondial. Les infections nosocomiales causées par ces BMR ont non seulement conduit à une augmentation de la mortalité, de la morbidité et du coût de traitement, mais aussi continuent de mettre en danger la vie des patients surtout immunodéprimés en milieu hospitalier. Il est évident de noter que l’utilisation abusive et non contrôlée des antibiotiques a longtemps contribué à l’émergence et à la large diffusion des déterminants de la résistance « résistome », défini comme étant tous

8 les gènes impliqués directement ou indirectement dans la résistance aux agents antimicrobiens [4].

Face à cette préoccupation mondiale correspondant à l’émergence des BMR pathogènes résultant d’une part du mésusage des antibiotiques et d’autre part de la capacité des bactéries à échanger du matériel génétique dans des conditions de pressions antibiotiques, il est primordial de conduire des études d’épidémiologie moléculaire afin de comprendre et de contrôler la diffusion et l’augmentation de la résistance aux antibiotiques. En effet, parmi les stratégies de surveillance, particulièrement dans le domaine de la microbiologie, nous assistons ces dernières années au développement de nouvelles techniques de surveillance de la résistance aux antibiotiques impliquant d'importantes ressources financières et intellectuelles à travers le monde. Cette surveillance demeure actuellement prioritaire pour les sociétés scientifiques et celles de santé publique afin de détecter les épidémies dans leur stade précoce surtout dans les pays en voie de développement, tels que la Tunisie et surtout la Libye où les données épidémiologiques de la résistance des bacilles à Gram négatif aux antibiotiques sont limitées et éparses. L’acquisition de ces données dans ces pays est nécessaire pour une meilleur prise en charge thérapeutique des infections et pour élaborer une stratégie de contrôle de la résistance antimicrobienne surtout que la course mondiale engagée entre l’apparition de la résistance et la mise au point de nouvelles molécules d’antibiotiques est très inégale.

9 C’est dans cette optique que ce projet de thèse s’inscrit avec comme principaux objectifs la caractérisation des mécanismes de la résistance aux β-lactamines chez des bacilles à Gram négatif isolés chez des patients hospitalisés dans des hôpitaux tunisiens et libyens ainsi que l’étude de l’épidémiologie moléculaire de ces isolats cliniques multi-résistants dans un but ultime de développer de nouveaux outils de surveillance pour maitriser la dissémination des BMR dans ces pays méditerranéens.

Ainsi ce manuscrit s’articule autour de quatre chapitres présentés comme suit:

Chapitre I: Notre travail de Thèse de Doctorat ayant été réalisé dans un environnement méditerranéen, entre la France et la Tunisie, nous avons rédigé une revue de littérature reprenant toutes les publications qui ont été rapportées dans tous les pays méditerranéens concernant la résistance des bacilles à Gram négatif aux carbapénèmes. Dans cette revue, nous avons présenté un aperçu sur les mécanismes moléculaires de la résistance aux carbapénèmes chez tous les bacilles à Gram négatif tout en accordant une attention particulière sur l'épidémiologie moléculaire des gènes de résistance à ces antibiotiques décrits jusqu'ici dans le bassin méditerranéen (Article 1).

Chapitre II: Dans cette partie, nous nous sommes intéressés à la caractérisation des mécanismes de la résistance aux β-lactamines chez des bacilles à Gram négatif fermentants isolés de patients hospitalisés

10 dans des hôpitaux tunisiens et libyens. Les objectifs de ce chapitre consistent à évaluer le niveau de la résistance aux antibiotiques des souches d’Escherichia coli et de Klebsiella peneumoniae isolées au niveau des hôpitaux tunisiens et libyens, de mettre en évidence la prévalence des souches productrices de BLSE, d’identifier le support génétique de la résistance aux β-lactamines et enfin d’étudier le typage moléculaire des souches multi-résistantes de K. pneumoniae (Article 2).

Chapitre III: Dans ce chapitre, nous avons présenté l’ensemble des travaux réalisés sur l’étude de l’épidémiologie moléculaire afin d’investiguer les supports génétiques de la résistance aux β-lactamines et particulièrement aux carbapénèmes de différentes collections d’isolats cliniques de bactéries multi-résistantes de Pseudomonas aeruginosa et d’Acinetobacter baumannii isolées de patients hospitalisés dans des hôpitaux tunisiens et libyens (Articles 3, 4 et 5).

Chapitre VI (Annexe): et enfin, dans ce chapitre, nous présentons des travaux concernant la description, le séquençage et l’analyse des génomes de nouvelles espèces découvertes pour la première fois (Articles 6 et 7).

Reference List

1. van Hoek AH, Mevius D, Guerra B, Mullany P, Roberts AP, Aarts HJ. Acquired antibiotic resistance genes: an overview. Front Microbiol 2011; 2:203.

2. Hall RM, Collis CM. Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist Updat 1998; 1(2):109-119.

3. Bush K, Courvalin P, Dantas G, Davies J, Eisenstein B, Huovinen P, et al. Tackling antibiotic resistance. Nat Rev Microbiol 2011; 9(12):894-896.

4. Diene SM, Merhej V, Henry M, El FA, Roux V, Robert C, et al. The rhizome of the multidrug-resistant Enterobacter aerogenes genome reveals how new "killer bugs" are created because of a sympatric lifestyle. Mol Biol Evol 2013; 30(2):369-383.

CHAPITRE I:

Revue:

L’émergence et la dissémination des carbapénèmases produites par les bacilles à Gram négatifs dans les pays du bassin méditerranéen

Article 1:

Prevalence and emergence of carbapenemases producing Gram-negative bacteria in Mediterranean basin

Najla Mathlouthi, Charbel Al-Bayssari, Sofiane Bakour, Jean Marc Rolain and Chedly Chouchani*

Published in Critical Reviews in Microbiology (CRM) Impact factor: 8.19

CRITICAL REVIEWS IN MICROBIOLOGY, 2016 http://dx.doi.org/10.3109/1040841X.2016.1160867

REVIEW ARTICLE Prevalence and emergence of carbapenemases-producing Gram-negative bacteria in Mediterranean basin

Najla Mathlouthia,b,c, Charbel Al-Bayssarib, Sofiane Bakourb, Jean Marc Rolainb and Chedly Chouchania,c aUniversite Tunis El-Manar, Faculte des Sciences de Tunis, Laboratoire des Microorganismes et Biomolecules Actives, Campus Universitaire, El-Manar II, Tunisia; bUnite de recherche sur les maladies infectieuses et tropicales emergentes (URMITE), UM 63, CNRS 7278, IRD 198, INSERM 1095, IHU Mediterranee Infection, FacultedeMedecine et de Pharmacie, Aix-Marseille-Universite, Marseille, France; cUniversite de Carthage, Institut Superieur des Sciences et Technologies de l’Environnement de Borj-Cedria, Technop^ole de Borj- Cedria, BP-1003, Hammam-Lif, Tunisia

ABSTRACT ARTICLE HISTORY The emergence and the global spread of carbapenemases concern to health services worldwide. Received 1 November 2015 Their celestial rise among Gram-negative bacilli has challenged both the scientific and pharma- Revised 23 February 2016 ceutical sectors. Indeed, infections caused by these bacteria have limited treatment options and Accepted 29 February 2016 have been associated with high mortality and morbidity rates. Carbapenemase producers are Published online 15 June 2016 mainly identified among Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa, and Acinetobacter baumannii and still mostly in hospital settings and rarely in the community. They KEYWORDS are closely related to KPC, VIM, IMP, NDM, and OXA-48 types. The encoding genes are mostly plas- Carbapenemases; mid located and associated with various mobile genetic elements. The Mediterranean area is of Gram-negative bacteria; interest due to a great diversity and population mixing. The prevalence of carbapenemases is par- Mediterranean countries ticularly high and variant among countries, partially depending on the population exchange relationship between the regions and the possible reservoirs of each carbapenemase. This review described the epidemiology of carbapenemases in this region of the world highlighting the worri- some situation and the need to screen and detect these enzymes to prevent and control their dissemination especially as it is clear that very few novel antibiotics will be introduced in the next few years, making the dissemination of carbapenem-resistant Gram-negative bacteria of crucial importance worldwide.

Introduction production has now become a major concern world- Carbapenems are the b-lactam group of drugs that are wide (Carmeli et al., 2010; Cornaglia et al., 2011). They often used as antibiotics of last resort for treating infec- are an increasing concern for global healthcare due to tion due to multidrug-resistant Gram-negative bacilli. their association with resistance to b-lactam antibiotics

Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 During their introducing in clinical therapy, they are sta- and to other classes of antibiotics such as aminoglyco- ble even in response to extended-spectrum (ESBL) and sides, fluoroquinolones, and cotrimoxazole (Souli et al., AmpC b-lactamases. However, this scenario has changed 2008). Thus they reduce the possibility of treating infec- with the emergence, in the last few years, of carbape- tions due to multidrug-resistant strains (Giamarellou & nem-resistant bacteria both in non-fermenters Poulakou, 2009). The first description of carbapene- (Acinetobacter baumannii and Pseudomonas aeruginosa) mase-producing enterobacteria (NmcA) was reported in and in fermenters (Enterobacteriaceae) Gram-negative 1993 (Naas & Nordmann, 1994). Since then, large vari- bacilli (Jesudason et al., 2005). Resistance to carbape- eties of carbapenemases have been identified belong- nems is mediated mostly by two main mechanisms: ing to three molecular classes: the Ambler class A, B, (i) production of b-lactamases (derepressed cephalo- and D b-lactamases (Queenan & Bush, 2007). In last sporinases or ESBLs) with non-significant carbapene- years, they have emerged and diffused worldwide, mase activity combined with decreased permeability including Mediterranean countries (Giamarellou & due to porin loss or alteration; (ii) production of carba- Poulakou, 2009; Nordmann et al., 2011a; Walsh, 2010). penem-hydrolyzing b-lactamases (Nordmann et al., These enzymes are encoded by genes located on 2011a). Bacterial resistance by carbapenemases chromosome or plasmids (Nahid et al., 2013). In this

CONTACT Professor Chedly Chouchani [email protected] Universite de Carthage, ISSTE-Borj-Cedria, Technopole de Borj-Cedria, BP-1003, Hammam- Lif 2050, Tunisia ß 2016 Informa UK Limited, trading as Taylor & Francis Group 2 N. MATHLOUTHI ET AL.

review, we attempt to describe the prevalence and the health concern (Nordmann et al., 2009). Thirteen var- epidemiology of the main carbapenemases circulating iants of KPC are known so far, KPC-2 and KPC-3 are the in the Mediterranean countries, a region of the world most frequent worldwide variants (Pfeifer et al., 2010). with a great diversity and population mixing. This region KPC enzymes have been reported mostly from nosoco- includes 11 European countries (Albania, Bosnia, mial K. pneumoniae isolates and to a much lesser extent Herzegovina, Croatia, Spain, France, Greece, Italia, Malta, from other enterobacterial species (Nordmann et al., Montenegro, Monaco, and Slovenia), five Asian countries 2009). In several cases, attributed mortality was due to (Cyprus, Israel, Lebanon, Syria, and Turkey), and five infections by KPC-producing strains (Borer et al., 2009; African countries (Algeria, Egypt, Libya, Morocco, and Patel et al., 2008; Schwaber et al., 2008), partly due to Tunisia). the fact that KPC-producing strains are usually multidrug resistant leading to failure in first-line therapy and to very limited therapeutic options (Nordmann et al., Class A carbapenemases 2009). The first outbreak of KPC-producing K. pneumo- Class A carbapenemases can be broadly divided into niae outside the United States was described in Israel in five major groups principally based on the phyloge- 2006 (Samra et al., 2007). Indeed, small polyclonal out- netics: SME, IMI, NMC-A, GES, and KPC (Poirel et al., breaks of KPC-2-producing K. pneumoniae were 2007; Queenan & Bush, 2007; Walther-Rasmussen & detected in Israeli hospitals, shortly followed by a multi- Hoiby, 2007). The SME enzymes have been only identi- center outbreak caused primarily by a single KPC-3 fied in Serratia marcescens. This family includes three clone (Samra et al., 2007). The nationwide nature of this variants (SME-1, -2, and -3), they are all chromosomally outbreak was identified only in early 2007, and a encoded (Naas et al., 1994). The chromosomally national intervention to limit the spread of KPC-produc- encoded IMI and NmcA enzymes have been detected in ing Enterobacteriaceae was initiated only after 1275 rare isolates of Enterobacter spp. in France (Naas et al., cases had already occurred in 27 acute-care hospitals. 1994). The first detection of the GES family enzymes At the peak of the outbreak, 186 new cases were identi- was reported in 2000 and that family now includes 20 fied monthly. However, KPC enzymes have not yet been variants (Poirel et al., 2000a, 2007). All the GES variants detected in Gram-negative non-fermenters in Israel possess the ability to hydrolyze broad-spectrum cepha- (Samra et al., 2007). losporins, but some variants possess amino acid substi- Since this endemicity in Israel, many studies have tutions within their active sites that enlarge their reported outbreaks of KPC in many Mediterranean coun- spectrum of activity against carbapenems (Kotsakis tries, in which most cases have been reported so far in et al., 2010). This is the case for GES-2, -4,-5, -6, -11, and Greece, where the situation can be described as -14. GES-4, -5, and -6 have been reported in endemic (Giakkoupi et al., 2011; Souli et al., 2010). Enterobacteriaceae, whereas GES-2, -11, and -14 are still Indeed, KPC-2-producing K. pneumoniae was reported in restricted to Pseudomonaceae or Acinetobacter (Picao Greece in 2008 (Tsakris et al., 2008). Since then, the con- et al., 2010; Vourli et al., 2004). In some Mediterranean tinuous spread of these multidrug-resistant isolates, countries, for instance in France and Greece, a GES-14- later demonstrated to belong to the sequence type (ST) Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 producing A. baumannii clinical strain was isolated 258 lineage, has led to a nationwide epidemic in Greece (Bonnin et al., 2011) and also the GES-5 and GES-6 were (Samuelsen et al., 2009). Additionally to that, outbreaks found to be plasmid mediated, respectively, in E. coli caused by E. coli strains producing KPC-2 in long-term- and K. pneumoniae (Queenan & Bush, 2007; Walsh, care facilities have recently been reported (Mavroidi 2010). Very recently, an emergence of GES-11 was also et al., 2012). These findings show the ability of the KPC- reported in Turkish area (Zeka et al., 2014). According to positive Enterobacteriaceae isolates to spread outside scattered reports, GES enzymes have not been reported the hospital environment and to circulate in the com- previously in North Africa except a recent study of munity. Unlike in other European countries, KPC-3 pro- Charfi-Kessis et al. (2014) who showed the first descrip- ducers have not yet been reported in Greece. tion of the GES-type b-lactamase (GES-11) in A. bauman- In Italy, a different evolution has been observed with nii in a neonatology center in Tunisia. The clinically K. pneumoniae-producing KPC-type enzymes. Reported most important subgroup is the increasingly emerging for the first time in late 2008, where the likely source KPC enzymes (Nordmann et al., 2009). Since the first was a medical trainee from Israel (Giani et al., 2009), report of this enzyme in 1996 produced by a clinical KPC-producing K. pneumoniae has since undergone isolate of K. pneumoniae in North Carolina, USA (Yigit rapid and extensive dissemination in this country, with et al., 2001), the KPC producers had spread around the several reports of hospital outbreaks (Agodi et al., 2011; world and are becoming a major clinical and public Ambretti et al., 2010; Di et al., 2011; Fontana et al., 2010; CRITICAL REVIEWS IN MICROBIOLOGY 3

KP EC KP AB

AB AB AB

CF KP PE KP AB AB

AB KP KP

GES-5 KPC-2 AB: Acinetobacter baumannii GES-6 KPC-3 PE: Pseudomonas aeruginosa GES-11 KPC-4 KP: Klebsiella pneumoniae GES-14 KPC-10 EC: Escherichia coli CF: Citrobacter freundii Figure 1. Geographic prevalence of class A carbapenemases and their correspondent producing Gram-negative bacteria in Mediterranean basin.

Gaibani et al., 2011b; Marchese et al., 2010; Mezzatesta (Carbonne et al., 2010; Naas et al., 2010). Most KPC pro- et al., 2011; Richter et al., 2011). Indeed, KPC producers ducers have been nosocomial K. pneumoniae belonged became the most prevalent carbapenemase found in to the clone ST258 and, to a lesser extent, E. coli and this country (Di et al., 2011). More recently studies other enterobacterial species (Cuzon et al., 2012; showed a wide dissemination of KPC-producing strains Nordmann et al., 2009). KPC-2 is clearly the most preva- to many healthcare Italian institutions (Grundmann lent variant in France, indeed Dortet et al. (2008) et al., 2010; Nordmann et al., 2011a). reported a KPC-positive (KPC-2) isolate. Croatia is In Spain, several cases have been recently described, another Mediterranean country affected by KPC-2 Gram- indeed, KPC-2, KPC-3, KPC-4, and KPC-10 variants were negative bacteria producers (Bedenic et al., 2012). In Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 identified in 10 A. baumannii clinical isolates collected North African countries, Bakour et al. (2015b) reported during 2009 from 17 hospitals in Puerto Rico (Robledo the first incidence of KPC-3-producing K. pneumoniae et al., 2010). In addition, KPC-3-producing K. pneumoniae meningitis in a 6-month-old child in Algeria. In (Curiao et al., 2010) and KPC-2-producing C. freundii Egypt, KPC-producing K. pneumoniae strains (n ¼ 14) have also emerged (Gomez-Gil et al., 2010). All these were recovered from patients admitted to different descriptions confirmed the dissemination of carbapene- wards at the Suez Canal University hospital (Metwally mase-producing isolates in Spain. et al., 2013). In Tunisia, Charfi-Kessis et al. (2014) The first KPC-producing isolate was identified from a showed recently the first description of the GES- patient transferred directly from New York in February type b-lactamase (GES-11) produced by A. baumannii 2005 (Naas et al., 2005). In France, KPC-producing K. (Figure 1). pneumoniae isolates remain rare and have always been linked to patients transferred from a countries where Class B carbapenemases KPC enzymes are endemic (Israel, Greece, the USA and, recently, Italy) (Cuzon et al., 2012). In some cases, hos- Class B metallo-b-lactamases (MBLs) are mostly of the pital outbreaks have been described, but nosocomial Verona integron-encoded metallo-b-lactamase (VIM), regional interhospital dissemination mediated by a con- IMP types, the New Delhi metallo-b-lactamases (NDM) taminated duodenoscope has also been reported type, and more recently tripoli metallo-b-lactamase 4 N. MATHLOUTHI ET AL.

(TMB) (El-Herte et al., 2012; Queenan & Bush, 2007; majority of VIM producers harbored variants of a self- Walsh et al., 2005). MBLs can hydrolyze all b-lactams transmissible plasmids of the IncN family that contained except monobactam (e.g., aztreonam). Their activities the Tn-541 transposon (Miriagou et al., 2010). In 2000, are inhibited by EDTA but not by clavulanic acid (Walsh Tsakris et al. (2000) reported an outbreak of infections et al., 2005). IMP-1 was the first MBL reported in Serratia caused by P. aeruginosa-producing VIM-1 carbapene- marcescens from Japan in 1991 (Ito et al., 1995). mase in a Greek university hospital. In addition to Since then, MBLs have been observed worldwide and that, Giakkoupi et al. (2003a) reported the spread of specially in Mediterranean basin (Queenan & Bush, integron-associated VIM-2 genes among imipenem- 2007; Walsh et al., 2005). resistant P. aeruginosa strains in 15 Greek hospitals. Italy was the first Mediterranean country to report Liakopoulos et al. (2013) also reported that 80 out of the acquired metallo-b-lactamases. Indeed, the first VIM- 568 P. aeruginosa isolates recovered from clinical speci- type MBLs were reported in 1999 in Italy in a P. mens in three hospitals in the Thessaly region of Greece aeruginosa (Lauretti et al., 1999). The early reports were VIM producers (VIM-2, VIM-4, and VIM-17).

included IMP-2 from A. baumannii (Cornaglia et al., Moreover, Pournaras et al. (2003) detected blaVIM-2 and 1999; Riccio et al., 2000), VIM-1 from P. aeruginosa blaVIM-4 genes in 47 of the 53 (88.7%) carbapenem- (Cornaglia et al., 2000; Lauretti et al., 1999; Riccio et al., resistant P. aeruginosa isolates in a tertiary Greek 2005), and Achromobacter xylosoxidans Italian isolates hospital in Central Greece. Finally, an emergence of (Riccio et al., 2001), and represented the first descrip- NDM-producing K. pneumoniae was recently reported in

tions of these enzymes. The blaVIM-1 gene has been Greece (Giakkoupi et al., 2013; Voulgari et al., 2014). detected in a stored strain of P. mosselii and P. aerugi- In France, a VIM-1-producing K. pneumoniae isolate nosa isolated in Italy (Ciofi Degli et al., 2014; Giani et al., was reported in 2004 and subsequently in a nosocomial 2012b). VIM-14 is a novel VIM-type detected in a P. aeru- outbreak (Kassis-Chikhani et al., 2006; Lartigue et al.,

ginosa clinical isolate from a neonatal intensive care unit 2004). The blaVIM-1 gene was part of a class 1 integron in Palermo (Mazzariol et al., 2011). Sporadic isolates of that also included the aac6, dhfrI, and aadA genes, and VIM-4-producing K. pneumoniae and Enterobacter cloa- was similar to those reported from strains isolated in cae were also detected in Italy (Luzzaro et al., 2004; Greece. VIM-1-producing isolates have rarely been Queenan & Bush, 2007). Several reports have docu- reported, and have always been associated with patients mented the presence of various Enterobacteriaceae transferred from Greece. Whereas IMP-producing (mostly K. pneumoniae, Enterobacter, and E. coli) produc- Enterobacteriaceae have only been isolated once in ing VIM-1-like enzymes in various Italian areas France, a study performed in 2010 showed dissemination (Aschbacher et al., 2008; Di et al., 2011). More recently, of VIM-1 and IMP-1 (Vidal-Navarro et al., 2010). This study isolates of E. coli and K. pneumoniae-producing NDM-1, addressed the prevalence of MDR Gram-negative bacilli of likely cross-border origin, have also been reported in and ESBL-producing isolates in stool specimens obtained Italy, but the dissemination of these carbapenemases from French patients hospitalized for acute diarrhea in a appears to be still very limited (Gaibani et al., 2011a; university hospital during a non-outbreak situation. Mammina et al., 2010). Surprisingly, it revealed a high prevalence of carbapene- Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 In Mediterranean basin, Greece is the country with mases-producing Enterobacteriaceae fecal carriers (2.6% the highest incidence of carbapenemases-producing of patients). All isolates were E. cloacae with the produc- Enterobacteriaceae isolates, and has been considered to tion of VIM-1 or IMP-1. In addition to that, VIM-19 with be the epicenter of the spread of VIM-producing extended carbapenemase activity was isolated in France Enterobacteriaceae, mainly K. pneumoniae, to other from E. coli and K. pneumoniae from a patient transferred countries (Cuzon et al., 2008; Kassis-Chikhani et al., from Algeria (Rodriguez-Martinez et al., 2010). The VIM-2 2006). Indeed, recent reports show that up to 49% of K. variant was reported also in France from a P. aeruginosa pneumoniae invasive isolates in Greece exhibit resist- isolate (Armand-Lefevre et al., 2013;Aubronetal.,2005; ance to carbapenems, but this percentage can be even Poirel et al., 2000b). higher in intensive-care units (ICUs) (Vatopoulos, 2008). The first identification of NDM-1 in Marseille, France, In 2002, distinct VIM-1-producing K. pneumoniae strains was reported in K. pneumoniae isolate in patient trans- exhibiting various carbapenem resistance levels were ferred from India (Rolain et al., 2010). Subsequently, recovered from ICU patients in three tertiary-care institu- most NDM-1 cases were of Indian origin, those data tions in Athens (Giakkoupi et al., 2003b). Since then, indicate that the Indian subcontinent is a reservoir of

polyclonal outbreaks of VIM-positive K. pneumoniae iso- blaNDM-1 genes (Poirel et al., 2011c, 2011e). In addition, lates have been described in hospitals throughout this in 2011, the first reported case of community-acquired country (Ikonomidis et al., 2005; Vatopoulos, 2008). The NDM-1 producing Enterobacteriaceae was identified in CRITICAL REVIEWS IN MICROBIOLOGY 5

the southern part of France (Nordmann et al., 2012a), isolate produced the VIM-2 enzyme. Recently in 2014, and this was followed by another possible case of Ocampo-Sosa et al. (2015) reported the isolation of VIM- autochthonous acquisition (Denis et al., 2012). NDM-1 2-producing P. monteilii clinical strains disseminated in a has been found in K. pneumoniae using real-time PCR Tertiary Hospital in Northern Spain. More recently in directly in clinical samples (Diene et al., 2011; Naas et al., 2015, San Millan et al. (2015) detected two new plas- 2011), and with both phenotypic and molecular mids harbored the VIM-1-encoding gene from methods in different E. coli strains (Birgy et al., 2011). An P. aeruginosa and reported that the presence of three

NDM-1 carbapenemase-producing P. aeruginosa isolate copies of blaVIM-1 in pAMBL2 produces high-level resist- was also recovered from a patient hospitalized in France ance to carbapenems. after a previous hospitalization in Serbia (Janvier et al., In Turkey, resistance to carbapenems is not currently 2013). Very recently, a novel variant NDM-7 was well recorded. Nevertheless, a few available data detected in E. coli in France (Cuzon et al., 2013). showed that carbapenem resistance in K. pneumoniae Like other Mediterranean countries (Greece, Italy, and was 3% similar to that in Italy (http://ecdc.europa.eu/en/ France), in Spain, the first description of MBLs con- activities/surveillance/EARSNet/database/Pages/data- cerned the VIM type, and was published in 2005 base.aspx). This situation, as that in other Mediterranean (Tortola et al., 2005). In this study, an E. coli isolated countries, might have changed in the last few years from urinary tract infection and a K. pneumoniae isolate, with the increasing prevalence of MBLs. Indeed, in 2004, recovered in 2003 during a surveillance study of fecal Bahar et al. (2004) reported the first case of a VIM-5 met- ESBLs carriers in Barcelona, were shown to produce VIM- allo-b-lactamases producing P. aeruginosa clinical isolate 1. Since then, continuous penetration of different carba- from Turkey. One year after, Altoparlak et al. (2005) penemases from different molecular classes has been reported the prevalence of metallo-b-lactamase among observed, and both sporadic cases and important out- P. aeruginosa and A. baumannii isolated from burn breaks have been described (Curiao et al., 2010; Gomez- wounds. Very recently in 2014, Iraz et al. (2014) charac- Gil et al., 2010; Sanchez-Romero et al., 2012; Sole et al., terized a novel VIM carbapenemase, VIM-38, in P. 2011; Tato et al., 2007). The first outbreak involving VIM- aeruginosa collected from a Turkish hospital. 1 occurred at Ramony Cajal University Hospital (Madrid) In Lebanon, carbapenem-resistant E. coli and K. in 2005 and 2006 (Tato et al., 2007). Twenty-five patients pneumoniae-producing NDM-1 was reported. (52% from the ICU) were infected and/or colonized with Interestingly, this was the first report of Iraqi patients single or multiple MBL-producing Enterobacteriaceae iso- referred to Lebanon from whom carbapenem-resistant lates, including K. pneumoniae, E. cloacae, E. coli, and Enterobacteriaceae were recovered (El-Herte et al., 2012). Klebsiella oxytoca. In 2009, only VIM-1 and IMP-22 were Recently in 2014, Al Bayssari et al. (2014) reported the found in specific areas (Madrid, Catalonia, Andalusia, emergence of VIM-2 and IMP-15 in a series of clinical and Balearic Islands), with a local prevalence of <0.2% isolates of carbapenem-resistant P. aeruginosa. of tested isolates. This situation might have changed, as In Israel, a few cases of NDM-1 have been introduced several descriptions of outbreaks caused by VIM pro- by tourism (Adler et al., 2011), and single cases have ducers have been published since then, as well as spor- been detected with no apparent foreign travel relation- Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 adic cases affecting non-hospitalized patients (Cendejas ship. A single case of VIM-1-producing P. aeruginosa was et al., 2010; Miro et al., 2010; Oteo et al., 2010; Sanchez- also detected in 2001 (Carmeli, unpublished data). Romero et al., 2012; Sorli et al., 2011; Tato et al., 2010; Few data are available on the dissemination of Trevino et al., 2011). One of these outbreaks was associ- acquired carbapenemases in countries bordering the ated with the VIM-2 (Zhao & Hu, 2011). Indeed, recently eastern coast of the Adriatic Sea such as Croatia and in 2013, the VIM-2-producing multidrug-resistant high- Slovenia. Most of them are associated with P. aeruginosa risk clone P. aeruginosa was isolated in the setting of a and Acinetobacter (Bosnjak et al., 2010; Franolic-Kukina large outbreak in Hospital Universitario 12 de Octubre. et al., 2011; Goic-Barisic et al., 2011; Sardelic et al., 2003). This strain was resistant to all b-lactams, fluoroquino- It is of note that dissemination of NDM-1 is highly sus- lones, and aminoglycosides, with the exception of ami- pected in this area, as there are different reports of the kacin, and has become an endemic clone in this isolation of NDM-1-producing Enterobacteriaceae in institution (Viedma et al., 2013). In 2008, Juan et al. patients from Balkan countries but admitted to other (2008) characterized a new metallo-b-lactamases VIM-13 European countries (Bogaerts et al., 2011; Nordmann and its integron-borne gene from a P. aeruginosa clinical et al., 2011b). strains collected from hospitals in Majorca. In 2011, Sorli Concerning African region, four metallo-b-lactamases et al. (2011) found that E. cloacae and K. oxytoca isolates (NDM, VIM, TMB, and IMP) were mainly reported among produced the VIM-1 enzyme and the P. aeruginosa several countries. In Tunisia, many studies showed the 6 N. MATHLOUTHI ET AL.

occurrence of MBLs due to the fact that carbapenems Algeria (Mesli et al., 2013). The second study showed

antibiotics were introduced as a therapy in Tunisian hos- the identification of a blaNDM-1 gene in a clinical A. pitals. The first study was published in 2006 on the baumannii isolate originating from Algeria, with no obvi- emergence of clinical isolates multidrug-resistant ous link with the Indian subcontinent, suggesting that K. pneumoniae-producing VIM-4 MBL. These isolates NDM-producing A. baumannii isolates may have were moreover highly resistant to carbapenems and spread already in North Africa (Boulanger et al., 2012). were closely related as shown by PFGE. Molecular stud- Very recently in 2014, Sassi et al. (2014) reported the

ies showed that blaVIM-4-encoding gene was part of class first autochthonous cases of infections caused by NDM- 1 integron (Ktari et al., 2006). The emergence of the 5-producing E. coli strains recovered from urine and VIM-4-encoding gene suggested the wide circulation of blood specimens of three patients from Algeria MBL-encoding genes and possesses challenges for the Moreover, Bakour et al. (2014) reported also the rapid treatment of hospital infections due to Gram-negative spread of metallo-b-lactamase NDM-1 in clinical multi- bacteria. Three years later, another study presented, in drug-resistant A. baumannii isolated from patients in addition to VIM-4 gene that previously described, the Algeria. detection of other MBL producers among a collection of In Morocco, four IMP-1 carbapenemase producers non-repetitive carbapenem-resistant P. aeruginosa from (one uropathogenic E. coli, one K. pneumoniae, and two the University Hospital Sahloul. Five isolates that pro- E. cloacae) were isolated from community-acquired urin- duced the MBL VIM-2 were clonally related according to ary tract infections. Three of these four isolates (one K. PFGE analysis. This gene cassette was located in class 1 pneumoniae and two E. cloacae) were isolated from integron and very likely to been chromosomally located Casablanca (Barguigua et al., 2012, 2013b). In addition, (Mansour et al., 2009). A 2010 study showed the diver- some studies reported the spread of NDM-1-producing sity of VIM-2 genes in isolates of a persistent MDR P. K. pneumoniae. NDM-producing Enterobacteriaceae aeruginosa strains. This study demonstrated the (mainly K. pneumoniae) were identified in hospital set- incidence of the MBLs type VIM-2-encoding gene as tings, mostly among adult patients hospitalized in ICUs gene cassette located in class 1 integron in P. aeruginosa or medical or surgical wards (Barguigua et al., 2013a; collected from different wards at Charles Nicolle hospital Poirel et al., 2011a).

of Tunis (Hammami et al., 2010). In 2011, Hammami In Egypt, Poirel et al. (2013) detected the blaVIM-1 et al. (2011a) reported an outbreak of VIM-2-producing gene in strains of Enterobacteriaceae (E. coli and E. P. aeruginosa in a kidney transplantation unit of Charles cloacae) isolated from stool, blood, pus, and urine of Nicolle Hospital of Tunis. More recently in 2015, Belotti patients. Another work published in the same year et al. (2015) detected a VIM-2-producing P. aeruginosa reported the emergence of VIM-1 and VIM-29 in a series collected from a burn unit of a hospital in Tunis. In of clinical isolates of cephalosporin-resistant E. coli from Tunisia also, IMP-1-producing K. pneumoniae isolates cancer patients in Cairo (Abdelaziz et al., 2013a,b). (n ¼ 9) were isolated from swabs taken from the hospital Additionally, Dimude et al. described the molecular environmental (ICU and toilet) (Chouchani et al., 2011b). characterization and diversity in E. cloacae from Egypt Finally Ben Nasr et al. (2013) reported the first case of carrying the bla gene (Dimude & Amyes, 2013). Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 VIM-4 NDM-1-producing K. pneumoniae infection in Tunisia, Moreover, Diab et al. (2013) reported the occurrence of the isolate was recovered from a 73-year-old female VIM-2 MBL in imipenem-resistant P. aeruginosa clinical Libyan patient who was admitted to the ICU in a hos- isolates from Egypt. More recently in 2014, Zafer et al. pital in Tunis. This report, in addition to recent observa- (2014a) demonstrated also the incidence of VIM-2 tions in neighboring countries (Chouchani et al., 2011a; among P. aeruginosa strains isolated from cancer El Salabi et al., 2013), indicates the emergence of this Egyptian patients. NDM-1 was also identified in Egypt resistance mechanism in North Africa. (El-Sayed-Ahmed et al., 2015). Indeed, a paper was pub- In Algeria, reports of VIM-2 enzymes were mainly lished in 2013 identifying NDM-1-producing K. restricted to P. aeruginosa isolates (Sefraoui et al., 2014; pneumoniae isolates in Cairo (Abdelaziz et al., 2013a,b). Touati et al., 2013). However Robin et al. (2010) found Another report of Hrabak et al. (2012) reported the isola- VIM-19 in clinical isolates of Enterobacteriaceae (E. coli, tion of an NDM-1-producing A. baumannii in a Czech K. pneumoniae, and P. stuartii) from Algeria (Robin et al., patient repatriated in 2011 from Egypt. Addition to that, 2010). NDM-1 enzyme is also detected in Algerian hospi- another clone of NDM variant, NDM-2, was found in A. tals, indeed three studies reported the emergence baumannii isolates in Egypt during 2011 (Kaase et al., of NDM-1. The first study was published in 2013 and 2011). In 2014, Zafer et al. (2014b) reported the first represented the first description of autochthonous case of NDM-1-producing P. aeruginosa in Egypt. Finally,

Acinetobacter sp harboring blaNDM-1-like gene in western data obtained in a recent study conducted in Egypt CRITICAL REVIEWS IN MICROBIOLOGY 7

showed the high prevalence rate of blaNDM-1 among A. patients severely burned in war and hospitalized in baumannii clinical isolates, with 59/150 (39.3%) isolates some hospitals in two different cities in Libya (Tripoli

being blaNDM-1 positive (El-Sayed-Ahmed et al., 2015). and Benghazi) (Figure 2). Libya represents the last zone in Mediterranean basin without description of the metallo-b-lactamases. Indeed, Class D carbapenemases to the best of our knowledge, there are few reports of resistance to carbapenems in clinical isolates in this Class D b-lactamases, also named OXAs for oxacillinases, country. Recently in 2013, Nasr et al. demonstrated the include 232 enzymes with few variants, possessing the identification of NDM-1 in K. pneumoniae from patient same carbapenemase activity (Nordmann et al., 2012b). transferred from Libya to Tunisia (Ben et al., 2013), indi- Initially, OXA-b-lactamases were reported in P. cating the emergence of this variant of MBLs in aeruginosa but until now, these carbapenemases have Mediterranean countries. Hammerum et al. (2012) been detected in many other Gram-negative bacteria, reported that patients transferred from Libya to including Enterobacteriaceae (Pfeifer et al., 2010). Among Denmark carried NDM-1-producing A. baumannii, this oxacillinases, OXA-48 represents the main enzyme reflects that importation of carbapenemases in Europe, reported worldwide. This enzyme was initially identified as a consequence of cross-border transfer of patients, in K. pneumoniae isolate from Turkey in 2001 (Poirel travel, medical tourism, and refugees, might play also an et al., 2004). Since then, OXA-48-producing strains have important role in the outburst. In addition to that, TMB- been extensively reported as sources of nosocomial out- 1 (a novel variant of MBLs) was first detected in Libya (El breaks in many parts of the world notably in et al., 2012). More recently in 2015, Mathlouthi et al. Mediterranean countries (Benouda et al., 2010; Carrer

(2015) detected the blaVIM-2 gene in 19 imipenem-resist- et al., 2008, 2010; De Boer et al., 1990; Poirel et al., ant P. aeruginosa isolates recovered from Libyan 2011d; Potron et al., 2013).

EC PE KP KP PE EN EN AB EC EC AB EC PE KP PE PE EC KP KP EC PE KP KO PE PE EN KP AX EN PE EC KO PM KP PE PE KP PE PP AB PE AB PE EN PE PE KO PE AB PE KP PE KP EC Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 KP AB PE AB EC EN KP PE AB KP PE KP EN PE EC AX EN KP EC PS PE AB

AB: Acinetobacter baumannii KO: Klebsiella oxytoca PE: Pseudomonas aeruginosa PM: Pseudomonas mosselii VIM-1 VIM-14 IMP-1 NDM-2 VIM-2 VIM-17 KP: Klebsiella pneumoniae PS: Pseudomonas monteilii IMP-2 NDM-5 EC: Escherichia coli PR: Providencia stuari VIM-4 VIM-19 IMP-15 NDM-7 EN: Enterobacter cloacae PP: Pseudomonas puda VIM-5 VIM-29 IMP-28 TMB-1 PM: Proteus mirabilis PR : Providencia regeri VIM-13 VIM-38 NDM-1 AX: Achromobacter xylosoxidans MM: Morganella morganii

Figure 2. Geographic prevalence of class B carbapenemases and their correspondent producing Gram-negative bacteria in Mediterranean basin. 8 N. MATHLOUTHI ET AL.

In France, the first OXA-48-producing K. pneumoniae NDM-1 genes in Turkish hospitals (Cakirlar et al., 2015; was identified in Paris in 2009 from the sputum of a Heydari et al., 2015), the two isolates producing NDM- patient transferred from Tunisia (Cuzon et al., 2010). 1 were from a Syrian refugee and from a patient Subsequently, other OXA-48-producing K. pneumoniae who had never traveled outside Turkey (Heydari et al., isolates were found in patients transferred from coun- 2015). tries around the Mediterranean sea (Turkey, Egypt, In Spain, an outbreak caused by a porin-deficient K. Algeria, Libya, Tunisia, and Morocco) (Aktas et al., 2006; pneumoniae isolate co-producing OXA-48 and CTX-M-15 Cuzon et al., 2011; Decre et al., 2010; Levast et al., 2011; was recognized (Pitart et al., 2011). The reported case Poirel et al., 2011d; Ruppe et al., 2011). They were asso- was a patient transferred from an ICU in a hospital in ciated with several outbreaks (Kristof et al., 2010). OXA- Marrakech (Morocco) to Barcelona. Sequence-typing 48 is mainly found in unrelated K. pneumoniae clones study revealed that OXA-48 and CTX-M-15-producing K. detected across Europe and in E. coli isolates associated pneumoniae isolates were belonged to the ST101 clone with clones previously linked with ESBLs in French that was previously found in North African countries patients without a history of prior hospitalization (Poirel and was responsible for the spread of this enzyme in et al., 2011b). However, very recently, an identical or clo- other European countries (Cuzon et al., 2011). Moreover, nally related K. pneumoniae OXA-48 producer was iden- Sevillano et al. (2009) reported the first detection of the tified in France (Potron et al., 2011a). A point mutant OXA-40 carbapenemase in P. aeruginosa isolates, located derivative, OXA-181, has been isolated in France from on a plasmid also found in A. baumannii. Recently in patients transferred from India (Potron et al., 2011b). In 2015, a carbapenem-resistant A. baumannii expressing

2012, Bonnin et al. (2012a) characterized a carbapenem- blaOXA-23 was recovered from an ICU patient in a third- hydrolyzing b-lactamase OXA-229 from Acinetobacter level hospital from Spain (Guerrero-Lozano et al., 2015). bereziniae recovered from a skin sample of a patient All these descriptions confirmed the dissemination of hospitalized in Paris. Recently, OXA-23, OXA-24, and carbapenemase-producing isolates in Spain (Scotta OXA-58-producing A. baumannii were also detected in et al., 2011). France (Jeannot et al., 2014; Pantel et al., 2015). In Greece, carbapenem resistance due to MBLs and In Italy, several isolates of E. coli and K. pneumoniae- carbapenemases is currently on an endemic scale; how- producing OXA-48 have also been reported (Giani et al., ever, in 2013, Voulgari et al. (2013) described the charac- 2012a). Other derivative of OXA able to hydrolyze carba- teristics of the first outbreak caused by OXA-48- penems identified as OXA-23, Principe et al. (2014) producing K. pneumoniae in Greece. OXA-58 was also reported an epidemic diffusion of OXA-23-producing A. detected in this country (Castanheira et al., 2014; Loli baumannii isolates. Additional to that, the study of et al., 2008). Additional to that, Liakopoulos et al. (2012) Migliavacca et al. described the resistance mechanisms reported the first description of A. baumannii strains of 21 carbapenem-resistant A. baumannii blood isolates producing OXA-23 in Greece, which they rapidly collected in Italy during 1-year multicenter prospective ‘‘replaced’’ the previously predominant OXA-58-positive surveillance study and showed that the carbapenem A. baumannii strains in this Greek hospital. During 2015, resistance was consistently related to the production of Mavroidi et al. (2015) reported the first case of the Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 oxacillinases, mostly the plasmid-mediated OXA-58 acquisition of tigecycline and colistin resistance among enzyme. Strains producing the OXA-23 enzyme were OXA-23-producing A. baumannii in Greece. also detected in many studies (Castanheira et al., 2014; In Lebanon, a nosocomial carbapenem-non-suscep- Compain et al., 2014; Migliavacca et al., 2013; Perilli tible Enterobacteriaceae are moderately spread in 10 et al., 2015). Lebanese hospitals over a 1-year period and the pre- In Turkey, this class D carbapenemase has been dominant mechanism is OXA-48 production (Hammoudi found in different genus of Enterobacteriaceae, such as et al., 2014). Another article was published in the same Citrobacter freundii (Nazic et al., 2005), Providencia year describing the evolution via endemic spread of rettgeri, and E. cloacae (Carrer et al., 2008), and even in OXA-48-producing Enterobacteriaceae in North Lebanon E. coli (Gulmez et al., 2008; Kilic et al., 2011). Although between 2008 and 2012 (Beyrouthy et al., 2014). Indeed, the majority of these descriptions were associated with the rate of Enterobacteriaceae exhibiting a decrease in single cases, important outbreaks have also been susceptibility or resistance to ertapenem by OXA-48 pro- described (Carrer et al., 2010). In addition, OXA-48 has duction increased from 0.4% between 2008 and 2010 to been found in patients transferred from Turkey to other 1.6% in 2012 for the clinical isolates recovered from hos- European countries (Levast et al., 2011). Recently in pitalized Lebanese patients. Additionally to that, Baroud 2015, two studies reported that carbapenem-resistant et al. (2013) reported that mechanisms of carbapenem A. baumannii were positive for OXA-23, OXA-58, and resistance in ESBL-producing K. pneumoniae and E. coli CRITICAL REVIEWS IN MICROBIOLOGY 9

isolates at a tertiary care center in Lebanon are due to two hospitals in two different cities in France from the production of OXA-48 carbapenemase. Recently in patients who had been transferred from Morocco, 2015, Rafei et al. (2015) investigated the molecular epi- where they had been hospitalized. More recently in demiology and carbapenem resistance mechanisms of 2015, Girlich et al. detected OXA-23, OXA-40, and OXA- A. baumannii in Tripoli, Northern Lebanon, and they 58 in Acinetobacter (Girlich & Nordmann, 2015). detect that among 70 isolates, the production of OXA- Additionally to that, several studies concerning 23 was the major carbapenem resistance mechanism the emergence of OXA-48-producing K. pneumoniae and detected in 65 isolates and five isolates were posi- have been reported in Tunisia (Cuzon et al., 2010;

tive for the blaNDM-1. Ktari et al., 2011; Lahlaoui et al., 2012; Saidani et al., In Slovenia, few data are available on the dissemin- 2012). In 2010, two carbapenem-resistant K. pneumoniae ation of acquired carbapenemases but a case of OXA- isolates were identified to be producing the plasmid- 48-producing K. pneumoniae imported from Libya has encoded OXA-48. These isolates were recovered from been recently found (Pirs et al., 2011). OXA-64 was also two patients hospitalized in two different hospitals in detected in this country (Bonnin et al., 2012b). In Israel Tunisia (Lahlaoui et al., 2012). One year after, Ktari et al. also, a few cases of OXA-48 have been detected. In (2011) reported the spread of K. pneumoniae isolates 2011, Enterobacteriaceae OXA-48 producers have been producing OXA-48 b-lactamase in a Tunisian university reported as a cause of infection of medical tourism hospital. These data showed the outbreak of imipenem- patient (Adler et al., 2011). Recently in 2014, the same resistant K. pneumoniae occurred in Tunisian Hospitals. authors detected four OXA-48 carbapenemases-produc- In 2012, a new paper screened 21 ESBL-producing ing K. pneumoniae in post-acute-care hospitals in Israel. Enterobacteriaceae with reduced susceptibility to carba- All these OXA-48 producers were acquired either dir- penems by carbapenemase production. Five strains ectly or indirectly from patients transferred from the (four K. pneumoniae and one C. freundii) showed carba- Palestinian Authority or Syria (Adler et al., 2015). OXA-23 penemase production, which was identified as OXA-48 and OXA-24-producing A. baumannii were also detected (Saidani et al., 2012). Carbapenem resistance in entero- in Israel (Castanheira et al., 2014). In Croatia, many oxa- bacteria should be suggested as an emerging clinical cillinases-producing A. baumannii were reported in sev- problem in Tunisian hospital and need rigorous surveil- eral studies (Goic-Barisic et al., 2007, 2009, 2011; Vranic- lance in order to limit its spread. Moreover, many stud- Ladavac et al., 2014). ies described the dissemination of OXA-23-producing Concerning North Africa, it is considered as reservoirs carbapenem-resistant A. baumannii in Tunisia. Indeed, of oxacillinases producers and particularly OXA-48, to during 2008, the dissemination of OXA-23-producing A. date, this enzyme represents the most common carba- baumannii 13 isolates in a University Hospital in Tunisia penemase type circulating in this region. was reported. These strains were recovered from In the last few years, a nosocomial dissemination of patients hospitalized between October 2005 and OXA-48-producing Enterobacteriaceae has been reported January 2007 at the University Hospital Sahloul in in different hospitals in Morocco, suggesting that this Sousse. All the OXA-23-positive isolates were clonally enzyme is endemic in this country (Hays et al., 2012). related, and the bla gene was found to be chro- Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 OXA-23 Indeed, other works suggest the first detection of oxacil- mosomally located and associated with an upstream- linases (OXA-48- and OXA-1) mediated resistance to car- located insertion sequence ISAba1 (Mansour et al., bapenems in K. pneumoniae from Morocco (Benouda 2008). et al., 2010). In addition, a report was released in 2012 In 2011, another work was published reporting the

describing the occurrence of OXA-48-producing entero- presence of blaOXA-23 and blaOXA-69 genes among imi- bacterial isolates in a Moroccan hospital (Hays et al., penem-resistant A. baumannii recovered from different 2012). In the same year, another article was published wards at Charles Nicolle Hospital (Hammami et al., reporting the emergence of carbapenem-resistant 2011b). One year later, emergence of carbapenem- Enterobacteriaceae isolates in the Moroccan community. resistant and OXA-23-producing A. baumannii isolate in

The blaOXA-48 carbapenemase genes were detected Tunisian hospital was described (Mugnier et al., 2008). among five carbapenem-resistant E. coli (Barguigua More recently, Charfi-Kessis et al. (2014) reported the et al., 2012). One year later, another study showed production of OXA-23 in A. baumannii clinical the high prevalence of multidrug-resistant isolates recovered in a neonatology center in the cen- Enterobacteriaceae, and particularly of OXA-48 producers ter-east of Tunisia. The emergence of carbapenem at a university hospital in Morocco (Girlich et al., 2014). resistance in Tunisia is worrying, since carbapenems Moreover, Poirel et al. (2011d) reported the identifica- are often the last resort for treating infections due to

tion of blaOXA-48 positive E. cloacae isolates recovered at third-generation cephalosporin-resistant isolates. 10 N. MATHLOUTHI ET AL.

Strengthening of prevention measures are so required Egypt, suggesting that the MDR Gram-negative bacteria to control further spread of carbapenemases in this seriously affect healthcare, especially in immunocom- country. promised hosts, such as cancer patients. Three acquired The situation in Algeria is not better, indeed several class D carbapenemases (OXA-23, OXA-40, and OXA-58) studies reported the emergence and spread of carbape- were also identified among these strains correlating nemases in this Mediterranean country. In 2010, a single with resistance to carbapenems. In addition, this study

isolate of A. baumannii carrying blaOXA-23 gene from an reports the first identification of ISAba2 up-stream of unknown origin was recovered from a patient in Algeria blaOXA-51-like gene contributing to high-level carbape- (Mugnier et al., 2010). In 2012, other work was published nem resistance dissemination (Al-Hassan et al., 2013).

reporting the emergence of blaOXA-23 and blaOXA-58 car- During the same year, a paper was published reporting bapenemase genes in multidrug-resistant A. baumannii the first alarming spread of OXA-23 carbapenemase in from University Hospital of Annaba (Touati et al., 2012). A. baumannii in Egyptian ICUs (Fouad et al., 2013). More In the same year, Bakour et al. showed that all 71 A. bau- recently in 2014, Al-Agamy et al. investigated the mannii strains, recovered over a 17-month period from molecular characterization of carbapenem-resistant A. March 2010 to July 2011 in two university hospitals, baumannii isolates collected from two hospitals in Egypt

were positive for the blaOXA-51 gene. The blaOXA-23-like between January and March 2012. The blaOXA-51-like gene was also detected in 29 imipenem-resistant strains. gene was detected in the entire collection. The preva-

Moreover, the blaOXA-72 gene was detected in five imi- lence of blaOXA-23, blaOXA-24, and blaOXA-58 was, respect- penem-resistant strains isolated in an Algerian intensive ively, 50%, 7.5%, and 5% (Al-Agamy et al., 2014). care unit (Bakour et al., 2012). In 2013, Mesli et al. More recently in 2015, El-Sayed-Ahmed et al. (2015)

reported the description of autochthonous found that 115/150 (76.7%) isolates were blaOXA-23-like Acinetobacter spp harbored blaOXA-23-like and blaOXA-24-like positive in A. baumannii clinical isolates collected from genes in western Algeria. Among the 113 isolates, 80 July 2012 to September 2013 in Egypt. The spread of (70.8%) were found to be resistant to imipenem with such strains has serious health consequences and

MICs ranging from 64 to 512 mg/ml. The blaOXA-23-like requires the application of strict infection control meas- gene was detected in 50% (40/80) of the isolates ures in Egypt.

and the blaOXA-24-like gene was detected in 21.2% (17/ In Libya, there is a little information on the current 80) of the isolates (Mesli et al., 2013). Recently, Agabou rate of infection and the spread of resistant strains of et al. reported the first description of OXA-48-producing Gram-negative bacteria. The most cases are transferred E. coli and the pandemic clone ST131 from patients Libyan patients in Europe for treatment. Indeed, a paper hospitalized at the Regional Military Hospital of was published in 2011 and described the first docu- Constantine. This strain was isolated from a patient mented case of OXA-48-producing K. pneumoniae in coming from a border province with Tunisia, where this Slovenia isolated from rectal surveillance cultures (Pirs carbapenemase is endemic (Agabou et al., 2014). More et al., 2011). Another article was published in 2012 con- recently in 2015, OXA-23 and OXA-24 were again cerning the patients transferred from Libya to Denmark reported in many locations in Algeria (Bakour et al., carried OXA-48-producing K. pneumoniae (Hammerum Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 2015a; Khorsi et al., 2015). et al., 2012). In 2013, a new paper reported the occur- The emergence of the class D Carbapenemases in rence of K. pneumoniae-harboring OXA48 carbapene- Egypt is also described and is especially worrying in this mase in a Libyan refugee in Italy (Kocsis et al., 2013). geographic area where particularly OXA-48 is endemic. During 2013, a report that described the OXA-48 carba- Effectively, two genetically unrelated OXA-163-produc- penemase-producing K. pneumoniae isolates recovered ing K. pneumoniae strains were identified from two from injured Libyan combatants was published infection cases between June 2009 and May 2010 in (Lafeuille et al., 2013). More recently in 2015, Mathlouthi Cairo. OXA-163-producing Enterobacteriaceae had been et al. (2015) reported the first case of identification of previously reported in Argentina only. Both patients had multidrug-resistant A. baumannii isolates harboring

no history of travel abroad so surveillance for antibiotic blaOXA-23-like, blaOXA-24-like, and blaOXA-48-like genes in resistance is largely unaffordable in this country of the Libyan isolates recovered from civilians severely burned Mediterranean basin (Abdelaziz et al., 2012). Another in war in Libya. These studies highlight the international case was reported during 2013 and showed the pres- transfer of resistance genes in Gram-negative bacteria

ence of blaOXA-48 in cephalosporin-resistant E. coli iso- and underscore the importance of an early warning sys- lates identified from cancer patients in Cairo (Abdelaziz tem on European level and screening upon admission et al., 2013a,b). Al Hassen et al. (2015) detected also the of patients transferred across borders and between

blaOXA-58 gene in A. baumannii from a cancer patient in healthcare systems. CRITICAL REVIEWS IN MICROBIOLOGY 11

AB AB KP AB AB EC KP AB AB AB AB AB Ab AB AB EC Ap KP KP AB AB AB AB KP EC AB PE AB AB EN AB AB AB AB AB AB Pr KP EC KP CF AB AB EC AB AB AB KP KP AB KP AB AB CF AB AB AB AB KP PE AB AB KP AB AB EC AB AB KP

OXA-107 AB: Acinetobacter baumannii EN: Enterobacter cloacae OXA-1 OXA-40 OXA-66 OXA-10 OXA-163 PE: Pseudomonas aeruginosa PR: Providencia regeri OXA-48 OXA-69 OXA-58 OXA-181 KP: Klebsiella pneumoniae Ab: Acinetobacter bereziniae OXA-23 OXA-72 OXA-207 EC: Escherichia coli Ap: Acinetobacter pii OXA-24 OXA-64 OXA-90 OXA-229 CF: Citrobacter freundii

Figure 3. Geographic prevalence of class D carbapenemases and their correspondent producing Gram-negative bacteria in Mediterranean basin.

Conclusion population mixing explaining the importance of the dissemination of carbapenemase producers. This situation The detection, monitoring, and dissemination of bacter- imposes a series of measures as soon as possible. These ial resistance to antibiotics are a major issue worldwide need the over-the-counter sale of indistinctly antibiotics, since the discovery and spread of MDR bacteria, in par- improving basic and extended knowledge on hygiene, ticular resistance to carbapenems, specifically among the reinforcement of infection control measures, and Enterobacteriaceae, Pseudomonas, and Acinetobacter. The the early and accurate detection, with restriction of the emergence and dissemination of carbapenem-resistant usage of carbapenems, to control the spread of these Gram-negative pathogens is one of the significant con- multidrug-resistant organisms. Fortunately, in May 2015,

Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 tributors to patient morbidity and mortality in several the Sixty-eighth World Health Assembly adopted the cases. Despite radical efforts in infection control and global action plan on antimicrobial resistance. One of improvements in molecular diagnostics, carbapenem- the five strategic objectives of the action plan is to resistant Gram-negative bacilli remain a formidable strengthen the evidence base through enhanced global threat as few antimicrobial agents are reliably active and surveillance and research. The Global Antimicrobial very little is expected to be available in the near future. Resistance Surveillance System (GLASS) is being However, the revival of the ‘‘old antibiotics’’ can repre- launched to support a standardized approach to the col- sent a promising strategy to fight antimicrobial resist- lection, analysis, and sharing of data on antimicrobial ance. In the Mediterranean region, during recent years, resistance at a global level, in order to inform decision- the emergence of carbapenem-resistant Gram-negative making, drive local, national, and regional action, and bacilli becomes an alarming problem. The prevalence of provide the evidence base for action and advocacy these carbapenem-resistant Gram-negative bacilli is vari- (Figure 3). able across Mediterranean countries; a high prevalence can be found in Italy, Greece, Turkey, and Israel, whereas a low prevalence is still reported in Croatia, Slovenia, and Libya. This part of the world is the cradle of western Disclosure statement civilization representing nearly 475 million inhabitants The authors report no conflicts of interest. The authors alone (6.3% of world population). It is the location of a large are responsible for the content and writing of this article. 12 N. MATHLOUTHI ET AL.

References Aubron C, Poirel L, Fortineau N, et al. (2005). Nosocomial spread of Pseudomonas aeruginosa isolates expressing the Abdelaziz MO, Bonura C, Aleo A, et al. (2012). OXA-163-pro- metallo-beta-lactamase VIM-2 in a hematology unit of a ducing Klebsiella pneumoniae in Cairo, Egypt, in 2009 and French hospital. Microb Drug Resist 11:254–9. 2010. J Clin Microbiol 50:2489–91. Bahar G, Mazzariol A, Koncan R, et al. (2004). Detection of VIM-5 Abdelaziz MO, Bonura C, Aleo A, et al. (2013a). NDM-1- and metallo-beta-lactamase in a Pseudomonas aeruginosa clinical OXA-163-producing Klebsiella pneumoniae isolates in Cairo, isolate from Turkey. J Antimicrob Chemother 54:282–3. Egypt, 2012. J Clin Microbiol 50:2489–91. Bakour S, Kempf M, Touati A, et al. (2012). Carbapenemase- Abdelaziz MO, Bonura C, Aleo A, et al. (2013b). Cephalosporin producing Acinetobacter baumannii in two university hospi- resistant Escherichia coli from cancer patients in Cairo, tals in Algeria. J Med Microbiol 61:1341–3. Egypt. Microbiol Immunol 57:391–5. Bakour S, Olaitan AO, Ammari H, et al. (2015a). Emergence of Adler A, Hussein O, Ben-David D, et al. (2015). Persistence of colistin- and carbapenem-resistant Acinetobacter baumannii Klebsiella pneumoniae ST258 as the predominant clone of ST2 clinical isolate in Algeria: first case report. Microb Drug carbapenemase-producing enterobacteriaceae in post- Resist 21:279–85. acute-care hospitals in Israel, 2008–13. J Antimicrob Bakour S, Sahli F, Touati A, Rolain JM. (2015b). Emergence of Chemother 70:89–92. KPC-producing Klebsiella pneumoniae ST512 isolated from Adler A, Shklyar M, Schwaber MJ, et al. (2011). Introduction of cerebrospinal fluid of a child in Algeria. New Microbes New OXA-48-producing enterobacteriaceae to Israeli hospitals Infect 3:34–6. by medical tourism. J Antimicrob Chemother 66:2763–6. Bakour S, Touati A, Bachiri T, et al. (2014). First report of 16S Agabou A, Pantel A, Ouchenane Z, et al. (2014). First description RRNA methylase ArmA-producing Acinetobacter baumannii of OXA-48-producing Escherichia coli and the pandemic clone and rapid spread of metallo-b-lactamase NDM-1 in ST131 from patients hospitalised at a military hospital in Algerian hospitals. J Infect Chemother 20:696–701. Algeria. Eur J Clin Microbiol Infect Dis 33:1641–6. Barguigua A, El OF, Lakbakbi El YF, et al. (2013a). First report Agodi A, Voulgari E, Barchitta M, et al. (2011). Containment of of a Klebsiella pneumoniae strain coproducing NDM-1, VIM- an outbreak of KPC-3-producing Klebsiella pneumoniae in 1 and OXA-48 carbapenemases isolated in Morocco. APMIS Italy. J Clin Microbiol 49:3986–9. 121:675–7. Aktas Z, Bal C, Midilli K, et al. (2006). First IMP-1-producing Barguigua A, El OF, Talmi M, et al. (2012). Emergence of car- Klebsiella pneumoniae isolate in Turkey. Clin Microbiol bapenem-resistant enterobacteriaceae isolates in the Infect 12:695–6. Moroccan community. Diagn Microbiol Infect Dis 73:290–1. Al-Agamy MH, Khalaf NG, Tawfick MM, et al. (2014). Molecular Barguigua A, El OF, Talmi M, et al. (2013b). Prevalence and characterization of carbapenem-insensitive Acinetobacter types of extended spectrum beta-lactamases among urin- baumannii in Egypt. Int J Infect Dis 22:49–54. ary Escherichia coli isolates in Moroccan community. Microb Al Bayssari BC, Diene SM, Loucif L, et al. (2014). Emergence of Pathog 61–62:16–22. Baroud M, Dandache I, Araj GF, et al. (2013). Underlying VIM-2 and IMP-15 carbapenemases and inactivation of mechanisms of carbapenem resistance in extended-spec- OprD gene in carbapenem-resistant Pseudomonas aerugi- trum beta-lactamase-producing Klebsiella pneumoniae and nosa clinical isolates from Lebanon. Antimicrob Agents Escherichia coli isolates at a tertiary care centre in Lebanon: Chemother 58:4966–70. role of OXA-48 and NDM-1 carbapenemases. Int J Al-Hassan L, El MH, Amyes SG. (2013). Diversity in Antimicrob Agents 41:75–9. Acinetobacter baumannii isolates from paediatric cancer Bedenic B, Mazzariol A, Plecko V, et al. (2012). First report of patients in Egypt. Clin Microbiol Infect 19:1082–8. KPC-producing Klebsiella pneumoniae in Croatia. J Al-Hassan L, Opazo A, Lopes B, et al. (2015). Variations in IS6 Chemother 24:237–9. Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 promoters alter the expression of carbapenemresistance in Belotti PT, Thabet L, Laffargue A, et al. (2015). Description of an related strains of Acinetobacter baumannii. J Glob original integron encompassing BlaVIM-2, QnrVC1 and genes Antimicrob Resist 3:5–8. encoding bacterial group II intron proteins in Pseudomonas Altoparlak U, Aktas F, Celebi D, et al. (2005). Prevalence of aeruginosa. J Antimicrob Chemother 70:2237–40. metallo-beta-lactamase among Pseudomonas aeruginosa Ben NA, Decre D, Compain F, et al. (2013). Emergence of and Acinetobacter baumannii isolated from burn wounds NDM-1 in association With OXA-48 in Klebsiella pneumoniae and in vitro activities of antibiotic combinations against from Tunisia. Antimicrob Agents Chemother 57:4089–90. these isolates. Burns 31:707–10. Benouda A, Touzani O, Khairallah MT, et al. (2010). First detec- Ambretti S, Gaibani P, Caroli F, et al. (2010). A carbapenem- tion of oxacillinase-mediated resistance to carbapenems in resistant Klebsiella pneumoniae isolate harboring KPC-1 Klebsiella pneumoniae from Morocco. Ann Trop Med from Italy. New Microbiol 33:281–2. Parasitol 104:327–30. Armand-Lefevre L, Angebault C, Barbier F, et al. (2013). Beyrouthy R, Robin F, Dabboussi F, et al. (2014). Emergence of imipenem-resistant Gram-negative bacilli in Carbapenemase and virulence factors of enterobacteria- intestinal flora of intensive care patients. Antimicrob ceae in North Lebanon between 2008 and 2012: evolution Agents Chemother 57:1488–95. via endemic spread of OXA-48. J Antimicrob Chemother Aschbacher R, Doumith M, Livermore DM, et al. (2008). 69:2699–705. Linkage of acquired quinolone resistance (QnrS1) and met- Birgy A, Doit C, Mariani-Kurkdjian P, et al. (2011). Early detec- allo-beta-lactamase (BlaVIM-1) genes in multiple species of tion of colonization by VIM-1-producing Klebsiella enterobacteriaceae from Bolzano, Italy. J Antimicrob pneumoniae and NDM-1-producing Escherichia coli in two Chemother 61:515–23. children returning to France. J Clin Microbiol 49:3085–7. CRITICAL REVIEWS IN MICROBIOLOGY 13

Bogaerts P, Bouchahrouf W, de Castro RR, et al. (2011). Chouchani C, Marrakchi R, Ferchichi L, et al. (2011b). VIM and Emergence of NDM-1-producing enterobacteriaceae in IMP metallo-b-lactamases and other extended-spectrum b- Belgium. Antimicrob Agents Chemother 55:3036–8. lactamases in Escherichia coli and Klebsiella pneumoniae Bonnin RA, Nordmann P, Potron A, et al. (2011). Carbapenem- from environmental samples in a Tunisian hospital. APMIS hydrolyzing GES-type extended-spectrum beta-lactamase in 119:725–32. Acinetobacter baumannii. Antimicrob Agents Chemother Ciofi Degli AM, Bernaschi P, Carletti M, et al. (2014). An out- 55:349–54. break of extremely drug-resistant Pseudomonas aeruginosa Bonnin RA, Ocampo-Sosa AA, Poirel L, et al. (2012a). in a tertiary care pediatric hospital in Italy. BMC Infect Dis Biochemical and genetic characterization of carbapenem- 14:494. hydrolyzingb-lactamase OXA-229 from Acinetobacter Compain F, Decre D, Frazier I, et al. (2014). Carbapenemase- bereziniae. Antimicrob Agents Chemother 56:3923–7. producing bacteria in patients hospitalized abroad, France. Bonnin RA, Poirel L, Naas T, et al. (2012b). Dissemination of Emerging Infect Dis 20:1246–8. New Delhi metallo-b-lactamase-1-producing Acinetobacter Cornaglia G, Giamarellou H, Rossolini GM. (2011). Metallo-b- baumannii in Europe. Clin Microbiol Infect 18:E362–5. lactamases: a last frontier for b-lactams? Lancet Infect Dis Borer A, Saidel-Odes L, Riesenberg K, et al. (2009). 11:381–93. Attributable mortality rate for carbapenem-resistant Cornaglia G, Mazzariol A, Lauretti L, et al. (2000). Hospital Klebsiella pneumoniae bacteremia. Infect Control Hosp outbreak of carbapenem-resistant Pseudomonas Epidemiol 30:972–6. aeruginosa producing VIM-1, a novel transferable metallo- Bosnjak Z, Bedenic B, Mazzariol A, et al. (2010). VIM-2 beta- beta-lactamase. Clin Infect Dis 31:1119–25. lactamase in Pseudomonas aeruginosa isolates from Zagreb, Cornaglia G, Riccio ML, Mazzariol A, et al. (1999). Appearance Croatia. Scand J Infect Dis 42:193–7. of IMP-1 metallo-beta-lactamase in Europe. Lancet Boulanger A, Naas T, Fortineau N, et al. (2012). NDM-1-pro- 353:899–900. ducing Acinetobacter baumannii from Algeria. Antimicrob Curiao T, Morosini MI, Ruiz-Garbajosa P, et al. (2010). Agents Chemother 56:2214–15. Emergence of Bla KPC-3-Tn4401a associated with a PKPN3/ Cakirlar FK, Ciftci IH, Gonullu N. (2015). OXA-type carbapene- 4-like plasmid within ST384 and ST388 Klebsiella pneumo- mases and susceptibility of colistin and tigecycline among niae clones in Spain. J Antimicrob Chemother 65:1608–14. carbapenem-resistant Acinetobacter baumannii isolates Cuzon G, Bonnin RA, Nordmann P. (2013). First identification from patients with bacteremia in Turkey. Clin Lab 61:741–7. of novel NDM carbapenemase, NDM-7, in Escherichia coli in Carbonne A, Thiolet JM, Fournier S, et al. (2010). Control of a France. PLoS One 8:e61322. multi-hospital outbreak of KPC-producing Klebsiella Cuzon G, Naas T, Demachy MC, Nordmann P. (2008). Plasmid- pneumoniae type 2 in France, September to October 2009. mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in Euro Surveill 15:19734. Klebsiella pneumoniae isolate from Greece. Antimicrob Carmeli Y, Akova M, Cornaglia G, et al. (2010). Controlling the Agents Chemother 52:796–7. spread of carbapenemase-producing Gram-negatives: Cuzon G, Naas T, Demachy MC, Nordmann P. (2012). therapeutic approach and infection control. Clin Microbiol Nosocomial outbreak of Klebsiella pneumoniae harbouring Infect 16:102–11. Bla(KPC-3) in France subsequent to a patient transfer from Carrer A, Poirel L, Eraksoy H, et al. (2008). Spread of OXA-48- Italy. Int J Antimicrob Agents 39:448–9. positive carbapenem-resistant Klebsiella pneumoniae Cuzon G, Naas T, Lesenne A, et al. (2010). Plasmid-mediated isolates in Istanbul, Turkey. Antimicrob Agents Chemother carbapenem-hydrolysing OXA-48 beta-lactamase in 52:2950–4. Klebsiella pneumoniae from Tunisia. Int J Antimicrob Agents Carrer A, Poirel L, Yilmaz M, et al. (2010). Spread of OXA-48- 36:91–3. Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 encoding plasmid in Turkey and beyond. Antimicrob Cuzon G, Ouanich J, Gondret R, et al. (2011). Outbreak of Agents Chemother 54:1369–73. OXA-48-positive carbapenem-resistant Klebsiella Castanheira M, Costello SE, Woosley LN, et al. (2014). pneumoniae isolates in France. Antimicrob Agents Evaluation of clonality and carbapenem resistance mecha- Chemother 55:2420–3. nisms among Acinetobacter baumannii–Acinetobacter De Boer D, de Jong EG, Maes RA. (1990). Mass spectrometric calcoaceticus complex and enterobacteriaceae isolates col- characterization of different norandrosterone derivatives by lected in European and Mediterranean countries and low-cost mass spectrometric detectors using electron ion- detection of two novel b-lactamases, GES-22 and VIM-35. ization and chemical ionization. Rapid Commun Mass Antimicrob Agents Chemother 58:7358–66. Spectrom 4:181–5. Cendejas E, Gomez-Gil R, Gomez-Sanchez P, Mingorance J. Decre D, Birgand G, Geneste D, et al. (2010). Possible import- (2010). Detection and characterization of enterobacteria- ation and subsequent cross-transmission of OXA-48-pro- ceae producing metallo-beta-lactamases in a tertiary-care ducing Klebsiella pneumoniae, France, 2010. Euro Surveill hospital in Spain. Clin Microbiol Infect 16:181–3. 15:19718. Charfi-Kessis K, Mansour W, Ben Haj KA, et al. (2014). Denis C, Poirel L, Carricajo A, et al. (2012). Nosocomial trans- Multidrug-resistant Acinetobacter baumannii strains carrying mission of NDM-1-producing Escherichia coli within a non- the Bla(OxA-23) and the Bla(GES-11) genes in a neonat- endemic area in France. Clin Microbiol Infect 18:E128–30. ology center in Tunisia. Microb Pathog 74:20–4. Di CP, Pantuso G, Cusimano A, et al. (2011). Two cases of Chouchani C, Marrakchi R, El Salabi A. (2011a). Evolution of monomicrobial intraabdominal abscesses due to KPC–3 b-lactams resistance in Gram-negative bacteria in Tunisia. Klebsiella pneumoniae ST258 clone. BMC Gastroenterol Crit Rev Microbiol 37:167–77. 11:103. 14 N. MATHLOUTHI ET AL.

Diab M, Fam N, El-Dabaa E, et al. (2013). Occurrence of VIM-2 Giakkoupi P, Tryfinopoulou K, Kontopidou F, et al. (2013). metallo-ß-lactamases in imipenem-resistant and -suscep- Emergence of NDM-producing Klebsiella pneumoniae in tible Pseudomonas aeruginosa clinical isolates from Egypt. Greece. Diagn Microbiol Infect Dis 77:382–4. Afr J Microbiol Res 7:4465–72. Giakkoupi P, Xanthaki A, Kanelopoulou M, et al. (2003b). VIM- Diene SM, Bruder N, Raoult D, Rolain JM. (2011). Real- 1 metallo-beta-lactamase-producing Klebsiella pneumoniae time PCR assay allows detection of the New Delhi metallo- strains in Greek hospitals. J Clin Microbiol 41:3893–6. b-lactamase(NDM-1)-encoding gene in France. Int J Giamarellou H, Poulakou G. (2009). Multidrug-resistant Gram- Antimicrob Agents 37:544–6. negative infections: what are the treatment options? Drugs Dimude JU, Amyes SG. (2013). Molecular characterisation and 69:1879–901. diversity in Enterobacter cloacae from Edinburgh and Egypt Giani T, D’Andrea MM, Pecile P, et al. (2009). Emergence in carrying Bla(CTX-M-14) and Bla(VIM-4) b-lactamase genes. Italy of Klebsiella pneumoniae sequence type 258 producing Int J Antimicrob Agents 41:574–7. KPC-3 carbapenemase. J Clin Microbiol 47:3793–4. Dortet L, Radu I, Gautier V, et al. (2008). Intercontinental trav- Giani T, Conte V, Di P,V, et al., (2012a). Escherichia coli from els of patients and dissemination of plasmid-mediated car- Italy producing OXA-48 carbapenemase encoded by a bapenemase KPC-3 associated With OXA-9 and TEM-1. J novel Tn1999 transposon derivative. Antimicrob Agents Antimicrob Chemother 61:455–7. Chemother 56:2211–13. El-Herte RI, Araj GF, Matar GM, et al. (2012). Detection of car- Giani T, Marchese A, Coppo E, et al. (2012b). VIM-1-producing bapenem-resistant Escherichia coli and Klebsiella Pseudomonas mosselii isolates in Italy, predating known pneumoniae producing NDM-1 in Lebanon. J Infect Dev VIM-producing index strains. Antimicrob Agents Chemother Ctries 6:457–61. 56:2216–17. El Salabi A, Borra PS, Toleman MA, et al. (2012). Genetic and Girlich D, Bouihat N, Poirel L, et al. (2014). High rate of faecal biochemical characterization of a novel metallo-beta-lacta- carriage of extended-spectrum beta-lactamase and OXA-48 mase, TMB-1, from an Achromobacter xylosoxidans strain carbapenemase-producing enterobacteriaceae at a univer- isolated in Tripoli, Libya. Antimicrob Agents Chemother sity hospital in Morocco. Clin Microbiol Infect 20:350–4. 56:2241–5. Girlich D, Nordmann P. (2015). CHROMagar acinetobacter El Salabi A, Walsh TR, Chouchani C. (2013). Extended spec- medium for detection of carbapenemase-producing trum beta-lactamases, carbapenemases and mobile genetic Acinetobacter Spp. strains from spiked stools. Diagn elements responsible for antibiotics resistance in Gram- Microbiol Infect Dis 83:234–6. negative bacteria. Crit Rev Microbiol 39:113–22. Goic-Barisic I, Bedenic B, Tonkic M, et al. (2007). First report of El-Sayed-Ahmed MA, Amin MA, Tawakol WM, et al. (2015). molecular characterization of carbapenem-resistant High prevalence of Bla(NDM-1) carbapenemase-encoding Acinetobacter baumannii in different intensive care units in gene and 16S RRNA ArmA methyltransferase gene among University Hospital Split, Croatia. J Chemother 19:462–4. Acinetobacter baumannii clinical isolates in Egypt. Goic-Barisic I, Bedenic B, Tonkic M, et al. (2009). Occurrence Antimicrob Agents Chemother 59:3602–5. of OXA-107 and ISAba1 in carbapenem-resistant isolates of Fontana C, Favaro M, Sarmati L, et al. (2010). Emergence of Acinetobacter baumannii from Croatia. J Clin Microbiol KPC-producing Klebsiella pneumoniae in Italy. BMC Res 47:3348–9. Notes 3:40. Goic-Barisic I, Towner KJ, Kovacic A, et al. (2011). Outbreak in Fouad M, Attia AS, Tawakkol WM, Hashem AM. (2013). Croatia caused by a new carbapenem-resistant clone of Emergence of carbapenem-resistant Acinetobacter bauman- Acinetobacter baumannii producing OXA-72 carbapene- nii harboring the OXA-23 carbapenemase in intensive care mase. J Hosp Infect 77:368–9. units of Egyptian hospitals. Int J Infect Dis 17:e1252–4. Gomez-Gil MR, Pano-Pardo JR, Romero-Gomez MP, et al. Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 Franolic-Kukina I, Bedenic B, Budimir A, et al. (2011). Clonal (2010). Detection of KPC-2-producing Citrobacter freundii spread of carbapenem-resistant OXA-72-positive isolates in Spain. J Antimicrob Chemother 65:2695–7. Acinetobacter baumannii in a Croatian University Hospital. Grundmann H, Livermore DM, Giske CG, et al. (2010). Int J Infect Dis 15:e706–9. Carbapenem-non-susceptible enterobacteriaceae in Europe: Gaibani P, Ambretti S, Berlingeri A, et al. (2011a). Outbreak of conclusions from a meeting of national experts. Euro NDM-1-producing Enterobacteriaceae in Northern Italy, July Surveill 15:46. to August 2011. Euro Surveill 16:20027. Guerrero-Lozano I, Fernandez-Cuenca F, Galan-Sanchez F, Gaibani P, Ambretti S, Berlingeri A, et al. (2011b). Rapid et al. A (2015) description of the OXA-23 beta-lactamase increase of carbapenemase-producing Klebsiella gene located within Tn2007 in a clinical isolate of pneumoniae strains in a large Italian hospital: surveillance Acinetobacter baumannii from Spain. Microb Drug Resist period 1 March–30 September 2010. Euro Surveill 21:215–17. 16:19800. Gulmez D, Woodford N, Palepou MF, et al. (2008). Giakkoupi P, Papagiannitsis CC, Miriagou V, et al. (2011). An Carbapenem-resistant Escherichia coli and Klebsiella pneu- update of the evolving epidemic of BlaKPC-2-carrying moniae isolates from Turkey with OXA-48-like carbapene- Klebsiella pneumoniae in Greece (2009–10). J Antimicrob mases and outer membrane protein loss. Int J Antimicrob Chemother 66:1510–13. Agents 31:523–6. Giakkoupi P, Petrikkos G, Tzouvelekis LS, et al. (2003a). Spread Hammami S, Boutiba-Ben B,I, Ghozzi R, et al. (2011a). of integron-associated VIM-type metallo-beta-lactamase Nosocomial outbreak of imipenem-resistant Pseudomonas genes among imipenem-nonsusceptible Pseudomonas aeru- aeruginosa producing VIM-2 metallo-beta-lactamase in a ginosa Strains in Greek Hospitals. J Clin Microbiol 41:822–5. kidney transplantation unit. Diagn Pathol 6:106. CRITICAL REVIEWS IN MICROBIOLOGY 15

Hammami S, Gautier V, Ghozzi R, et al. (2010). Diversity in BlaVIM-1 and BlaSHV-5 in a French university hospital. VIM-2-encoding class 1 integrons and occasional BlaSHV2a J Antimicrob Chemother 57:142–5. carriage in isolates of a persistent, multidrug-resistant Khorsi K, Messai Y, Hamidi M, et al. (2015). High prevalence of Pseudomonas aeruginosa clone from Tunis. Clin Microbiol multidrug-resistance in Acinetobacter baumannii and dis- Infect 16:189–93. semination of carbapenemase-encoding genes BlaOXA-23- Hammami S, Ghozzi R, Saidani M, Ben RS. (2011b). like, BlaOXA-24-Like and BlaNDM-1 in Algiers Hospitals. Carbapenem-resistant Acinetobacter baumannii producing Asian Pac J Trop Med 8:438–46. the carbapenemase OXA-23 in Tunisia. Tunis Med Kilic A, Aktas Z, Bedir O, et al. (2011). Identification and char- 89:638–43. acterization of OXA-48 producing, carbapenem-resistant Hammerum AM, Larsen AR, Hansen F, et al. (2012). Patients enterobacteriaceae isolates in Turkey. Ann Clin Lab Sci transferred from Libya to Denmark carried OXA-48-produc- 41:161–6. ing Klebsiella pneumoniae, NDM-1-producing Acinetobacter Kocsis E, Savio C, Piccoli M, et al. (2013). Klebsiella pneumoniae baumannii and meticillin-resistant Staphylococcus aureus. harbouring OXA-48 carbapenemase in a Libyan refugee in Int J Antimicrob Agents 40:191–2. Italy. Clin Microbiol Infect 19:E409–11. Hammoudi D, Moubareck CA, Aires J, et al. (2014). Kotsakis SD, Miriagou V, Tzelepi E, Tzouvelekis LS. (2010). Countrywide spread of OXA-48 carbapenemase in Comparative biochemical and computational study of the Lebanon: surveillance and genetic characterization of car- role of naturally occurring mutations at ambler positions bapenem-non-susceptible enterobacteriaceae in 10 hospi- 104 and 170 in GES b-lactamases. Antimicrob Agents tals over a one-year period. Int J Infect Dis 29:139–44. Chemother 54:4864–71. Hays C, Benouda A, Poirel L, et al. (2012). Nosocomial occur- Kristof K, Toth A, Damjanova I, et al. (2010). Identification of a rence of OXA-48-producing enterobacterial isolates in a BlaVIM-4 gene in the internationally successful Klebsiella Moroccan Hospital. Int J Antimicrob Agents 39:545–7. pneumoniae ST11 clone and in a Klebsiella oxytoca strain in Heydari F, Mammina C, Koksal F. (2015). NDM-1-producing Hungary. J Antimicrob Chemother 65:1303–5. Acinetobacter baumannii ST85 now in Turkey, including one Ktari S, Arlet G, Mnif B, et al. (2006). Emergence of multidrug- isolate from a Syrian refugee. J Med Microbiol 64:1027–9. resistant Klebsiella pneumoniae isolates producing VIM-4 Hrabak J, Stolbova M, Studentova V, et al. (2012). NDM-1 pro- metallo-beta-lactamase, CTX-M-15 extended-spectrum ducing Acinetobacter baumannii isolated from a patient beta-lactamase, and CMY-4 AmpC beta-lactamase in a repatriated to the Czech Republic from Egypt, July 2011. Tunisian university hospital. Antimicrob Agents Chemother Euro Surveill 17:20085. 50:4198–201. Ikonomidis A, Tokatlidou D, Kristo I, et al. (2005). Outbreaks in Ktari S, Mnif B, Louati F, et al. (2011). Spread of Klebsiella distinct regions due to a single Klebsiella pneumoniae clone pneumoniae isolates producing OXA-48 beta-lactamase in a carrying a Bla VIM-1 metallo-{Beta}-lactamase gene. J Clin Tunisian university hospital. J Antimicrob Chemother Microbiol 43:5344–7. 66:1644–6. Iraz M, Duzgun AO, Cicek AC, et al. (2014). Characterization of Lafeuille E, Decre D, Mahjoub-Messai F, et al. (2013). OXA-48 novel VIM carbapenemase, VIM-38, and first detection of carbapenemase-producing Klebsiella pneumoniae isolated GES-5 carbapenem-hydrolyzing b-lactamases in from Libyan patients. Microb Drug Resist 19:491–7. Pseudomonas aeruginosa in Turkey. Diagn Microbiol Infect Lahlaoui H, Poirel L, Barguellil F, et al. (2012). Carbapenem- Dis 78:292–4. hydrolyzing class D b-lactamase OXA-48 in Klebsiella pneu- Ito H, Arakawa Y, Ohsuka S, et al. (1995). Plasmid-mediated moniae isolates from Tunisia. Eur J Clin Microbiol Infect Dis dissemination of the metallo-beta-lactamase gene BlaIMP 31:937–9. among clinically isolated strains of Serratia Marcescens. Lartigue MF, Poirel L, Nordmann P. (2004). First detection of a Antimicrob Agents Chemother 39:824–9. carbapenem-hydrolyzing metalloenzyme in an enterobac- Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 Janvier F, Jeannot K, Tesse S, et al. (2013). Molecular charac- teriaceae isolate in France. Antimicrob Agents Chemother terization of BlaNDM-1 in a sequence type 235 48:4929–30. Pseudomonas aeruginosa isolate from France. Antimicrob Lauretti L, Riccio ML, Mazzariol A, et al. (1999). Cloning and Agents Chemother 57:3408–11. characterization of BlaVIM, a new integron-borne metallo- Jeannot K, Diancourt L, Vaux S, et al. (2014). Molecular epi- beta-lactamase gene from a Pseudomonas aeruginosa clin- demiology of carbapenem non-susceptible Acinetobacter ical isolate. Antimicrob Agents Chemother 43:1584–90. baumannii in France. PLoS One 9:e115452. Levast M, Poirel L, Carrer A, et al. (2011). Transfer of OXA-48- Jesudason MV, Kandathil AJ, Balaji V. (2005). Comparison of positive carbapenem-resistant Klebsiella pneumoniae from two methods to detect carbapenemase & metallo- Turkey to France. J Antimicrob Chemother 66:944–5. beta- lactamase production in clinical isolates. Indian J Liakopoulos A, Mavroidi A, Katsifas EA, et al. (2013). Med Res 121:780–3. Carbapenemase-producing Pseudomonas aeruginosa from Juan C, Beceiro A, Gutierrez O, et al. (2008). Characterization Central Greece: molecular epidemiology and genetic ana- of the new metallo-beta-lactamase VIM-13 and its inte- lysis of class I integrons. BMC Infect Dis 13:505. gron-borne gene from a Pseudomonas aeruginosa clinical Liakopoulos A, Miriagou V, Katsifas EA, et al. (2012). isolate in Spain. Antimicrob Agents Chemother 52:3589–96. Identification of OXA-23-producing Acinetobacter baumannii Kaase M, Nordmann P, Wichelhaus TA, et al. (2011). NDM-2 in Greece, 2010 to 2011. Euro Surveill 17:20117. carbapenemase in Acinetobacter baumannii from Egypt. Loli A, Tzouvelekis LS, Gianneli D, et al. (2008). Outbreak of J Antimicrob Chemother 66:1260–2. Acinetobacter baumannii with chromosomally encoded Kassis-Chikhani N, Decre D, Gautier V, et al. (2006). First out- VIM-1 undetectable by imipenem-EDTA synergy tests. break of multidrug-resistant Klebsiella pneumoniae carrying Antimicrob Agents Chemother 52:1894–6. 16 N. MATHLOUTHI ET AL.

Luzzaro F, Docquier JD, Colinon C, et al. (2004). Emergence in Mugnier PD, Poirel L, Naas T, Nordmann P. (2010). Worldwide Klebsiella pneumoniae and enterobacter cloacae clinical iso- dissemination of the BlaOXA-23 carbapenemase gene of lates of the VIM-4 metallo-beta-lactamase encoded by a Acinetobacter baumannii. Emerging Infect Dis 16:35–40. conjugative plasmid. Antimicrob Agents Chemother Mugnier P, Poirel L, Pitout M, Nordmann P. (2008). 48:648–50. Carbapenem-resistant and OXA-23-producing Acinetobacter Mammina C, Palma DM, Bonura C, et al. (2010). Outbreak of baumannii isolates in the United Arab Emirates. Clin infection with Klebsiella pneumoniae sequence type 258 Microbiol Infect 14:879–82. producing Klebsiella pneumoniae carbapenemase 3 in an Naas T, Cuzon G, Babics A, et al. (2010). Endoscopy-associated intensive care unit in Italy. J Clin Microbiol 48:1506–7. transmission of carbapenem-resistant Klebsiella pneumoniae Mansour W, Poirel L, Bettaieb D, et al. (2008). Dissemination producing KPC-2 beta-lactamase. J Antimicrob Chemother of OXA-23-producing and carbapenem-resistant 65:1305–6. Acinetobacter baumannii in a university hospital in Tunisia. Naas T, Ergani A, Carrer A, Nordmann P. (2011). Real-time PCR Microb Drug Resist 14:289–92. for detection of NDM-1 carbapenemase genes from spiked Mansour W, Poirel L, Bettaieb D, et al. (2009). Metallo-beta- stool samples. Antimicrob Agents Chemother 55:4038–43. lactamase-producing Pseudomonas aeruginosa isolates in Naas T, Nordmann P. (1994). Analysis of a carbapenem- Tunisia. Diagn Microbiol Infect Dis 64:458–61. hydrolyzing class A beta-lactamase from Enterobacter cloa- Marchese A, Coppo E, Barbieri R, Debbia E. (2010). Emergence cae and of its LysR-type regulatory protein. Proc Natl Acad of KPC-2 carbapenemase-producing Klebsiella pneumoniae Sci USA 91:7693–7. strains and spread of an isolate of sequence type 258 Naas T, Nordmann P, Vedel G, Poyart C. (2005). Plasmid-medi- in the neuro-rehabilitation unit of an Italian Hospital. ated carbapenem-hydrolyzing beta-lactamase KPC in a J Chemother 22:212–14. Klebsiella pneumoniae isolate from France. Antimicrob Mathlouthi N, Areig Z, Al BC, et al. (2015). Emergence of car- Agents Chemother 49:4423–4. bapenem-resistant Pseudomonas aeruginosa and Naas T, Vandel L, Sougakoff W, et al. (1994). Cloning and Acinetobacter baumannii clinical isolates collected from sequence analysis of the gene for a carbapenem-hydrolyz- some Libyan Hospitals. Microb Drug Resist 21:335–41. ing class A beta-lactamase, Sme-1, from Serratia Mavroidi A, Likousi S, Palla E, et al. (2015). Molecular identifi- Marcescens S6. Antimicrob Agents Chemother 38:1262–70. cation of tigecycline- and colistin-resistant carbapenemase- Nahid F, Khan AA, Rehman S, Zahra R. (2013). Prevalence of producing Acinetobacter baumannii from a Greek hospital metallo-b-lactamase NDM-1-producing multi-drug resistant from 2011 to 2013. J Med Microbiol 64:993–7. bacteria at two Pakistani hospitals and implications for Mavroidi A, Miriagou V, Malli E, et al. (2012). Emergence of public health. J Infect Public Health 6:487–93. Escherichia coli sequence type 410 (ST410) with KPC-2 Nazic H, Poirel L, Nordmann P. (2005). Further identification b-lactamase. Int J Antimicrob Agents 39:247–50. of plasmid-mediated quinolone resistance determinant in Mazzariol A, Mammina C, Koncan R, et al. (2011). A novel enterobacteriaceae in Turkey. Antimicrob Agents VIM-type metallo-beta-lactamase (VIM-14) in a Chemother 49:2146–7. Pseudomonas aeruginosa clinical isolate from a neonatal Nordmann P, Couard JP, Sansot D, Poirel L. (2012a). intensive care unit. Clin Microbiol Infect 17:722–4. Emergence of an autochthonous and community-acquired Mesli E, Berrazeg M, Drissi M, et al. (2013). Prevalence of carbapenemase-encoding genes including New Delhi metallo- NDM-1-producing Klebsiella pneumoniae in Europe. Clin b-lactamase in acinetobacter species, Algeria. Int J Infect Infect Dis 54:150–1. Dis 17:e739–43. Nordmann P, Cuzon G, Naas T. (2009). The real threat of Metwally L, Gomaa N, Attallah M, Kamel N. (2013). High Klebsiella pneumoniae carbapenemase-producing bacteria. prevalence of Klebsiella pneumoniae carbapenemase-medi- Lancet Infect Dis 9:228–36. Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 ated resistance in K. pneumoniae isolates from Egypt. East Nordmann P, Dortet L, Poirel L. (2012b). Carbapenem resist- Mediterr Health J 19:947–52. ance in enterobacteriaceae: here is the storm!. Trends Mol Mezzatesta ML, Gona F, Caio C, et al. (2011). Outbreak of Med 18:263–72. KPC-3-producing, and colistin-resistant, Klebsiella pneumo- Nordmann P, Naas T, Poirel L. (2011a). Global spread of carba- niae infections in two Sicilian Hospitals. Clin Microbiol penemase-producing enterobacteriaceae. Emerging Infect Infect 17:1444–7. Dis 17:1791–8. Migliavacca R, Espinal P, Principe L, et al. (2013). Nordmann P, Poirel L, Toleman MA, Walsh TR. (2011b). Does Characterization of resistance mechanisms and genetic broad-spectrum beta-lactam resistance due to NDM-1 relatedness of carbapenem-resistant Acinetobacter Herald the end of the antibiotic era for treatment of infec- baumannii isolated from blood, Italy. Diagn Microbiol Infect tions caused by Gram-negative bacteria? J Antimicrob Dis 75:180–6. Chemother 66:689–92. Miriagou V, Papagiannitsis CC, Kotsakis SD, et al. (2010). Ocampo-Sosa AA, Guzman-Gomez LP, Fernandez-Martinez M, Sequence of PNL194, a 79.3-kilobase IncN plasmid carrying et al. (2015). Isolation of VIM-2-producing Pseudomonas the BlaVIM-1 metallo-beta-lactamase gene in Klebsiella monteilii clinical strains disseminated in a tertiary hospital pneumoniae. Antimicrob Agents Chemother 54:4497–502. in Northern Spain. Antimicrob Agents Chemother Miro E, Segura C, Navarro F, et al. (2010). Spread of plasmids 59:1334–6. containing the Bla(VIM-1) and Bla(CTX-M) genes and the Oteo J, Hernandez-Almaraz JL, Gil-Anton J, et al. (2010). Qnr determinant in Enterobacter cloacae, Klebsiella Outbreak of Vim-1-carbapenemase-producing Enterobacter pneumoniae and Klebsiella oxytoca isolates. J Antimicrob cloacae in a pediatric intensive care unit. Pediatr Infect Dis J Chemother 65:661–5. 29:1144–6. CRITICAL REVIEWS IN MICROBIOLOGY 17

Pantel A, Marchandin H, Prere MF, et al. (2015). Faecal car- Potron A, Kalpoe J, Poirel L, Nordmann P. (2011a). European riage of carbapenemase-producing Gram-negative bacilli in dissemination of a single OXA-48-producing Klebsiella pneu- hospital settings in Southern France. Eur J Clin Microbiol moniae clone. Clin Microbiol Infect 17:E24–6. Infect Dis 34:899–904. Potron A, Nordmann P, Lafeuille E, et al. (2011b). Patel G, Huprikar S, Factor SH, et al. (2008). Outcomes of car- Characterization of OXA-181, a carbapenem-hydrolyzing bapenem-resistant Klebsiella pneumoniae infection and the class D beta-lactamase from Klebsiella pneumoniae. impact of antimicrobial and adjunctive therapies. Infect Antimicrob Agents Chemother 55:4896–9. Control Hosp Epidemiol 29:1099–106. Potron A, Poirel L, Rondinaud E, Nordmann P. (2013). Perilli M, Sabatini A, Pontieri E, et al. (2015). OXA-23 carbape- Intercontinental spread of OXA-48 beta-lactamase-produc- nemase in multidrug-resistant Acinetobacter baumannii ST2 ing enterobacteriaceae over a 11-year period, 2001 to type: first identification in L’Aquila Hospital (Italy). Microb 2011. Euro Surveill 18:20549. Drug Resist 21:97–101. Pournaras S, Maniati M, Petinaki E, et al. (2003). Hospital out- Pfeifer Y, Cullik A, Witte W. (2010). Resistance to cephalospor- break of multiple clones of Pseudomonas aeruginosa carry- ins and carbapenems in Gram-negative bacterial patho- ing the unrelated metallo-beta-lactamase gene variants gens. Int J Med Microbiol 300:371–9. BlaVIM-2 and BlaVIM-4. J Antimicrob Chemother 51: Picao RC, Santos AF, Nicoletti AG, et al. (2010). Detection 1409–14. of GES-5-producing Klebsiella pneumoniae in Brazil. Principe L, Piazza A, Giani T, et al. (2014). Epidemic diffusion J Antimicrob Chemother 65:796–7. of OXA-23-producing Acinetobacter baumannii isolates in Pirs M, Andlovic A, Cerar T, et al. (2011). A case of OXA-48 Italy: results of the first cross-sectional countrywide survey. carbapenemase-producing Klebsiella pneumoniae in a J Clin Microbiol 52:3004–10. patient transferred to Slovenia from Libya, November 2011. Queenan AM, Bush K. (2007). Carbapenemases: the versatile Euro Surveill 16:20042. beta-lactamases. Clin Microbiol Rev 20:440–58. Pitart C, Sole M, Roca I, et al. (2011). First outbreak of a plas- Rafei R, Pailhories H, Hamze M, et al. (2015). Molecular epi- mid-mediated carbapenem-hydrolyzing OXA-48 beta-lacta- demiology of Acinetobacter baumannii in different hospitals mase in Klebsiella pneumoniae in Spain. Antimicrob Agents in Tripoli, Lebanon using Bla(OXA-51-Like) sequence based Chemother 55:4398–401. typing. BMC Microbiol 15:103. Poirel L, Abdelaziz MO, Bernabeu S, Nordmann P. (2013). Riccio ML, Franceschini N, Boschi L, et al. (2000). Occurrence of OXA-48 and VIM-1 carbapenemase-produc- Characterization of the metallo-beta-lactamase determinant ing enterobacteriaceae in Egypt. Int J Antimicrob Agents of Acinetobacter baumannii AC-54/97 reveals the existence 41:90–1. of Bla(IMP) allelic variants carried by gene cassettes of dif- Poirel L, Benouda A, Hays C, Nordmann P. (2011a). ferent phylogeny. Antimicrob Agents Chemother 44: Emergence of NDM-1-producing Klebsiella pneumoniae in 1229–35. Morocco. J Antimicrob Chemother 66:2781–3. Riccio ML, Pallecchi L, Docquier JD, et al. (2005). Clonal Poirel L, Bernabeu S, Fortineau N, et al. (2011b). Emergence relatedness and conserved integron structures in epidemio- of OXA-48-producing Escherichia coli clone ST38 in France. logically unrelated Pseudomonas aeruginosa strains produc- Antimicrob Agents Chemother 55:4937–8. ing the VIM-1 metallo-{beta}-lactamase from different Poirel L, Fortineau N, Nordmann P. (2011c). International Italian hospitals. Antimicrob Agents Chemother 49:104–10. transfer of NDM-1-producing Klebsiella pneumoniae from Riccio ML, Pallecchi L, Fontana R, Rossolini GM. (2001). In70 of Iraq to France. Antimicrob Agents Chemother 55:1821–2. plasmid PAX22, a Bla(VIM-1)-containing integron carrying a Poirel L, Heritier C, Tolun V, Nordmann P. (2004). Emergence new aminoglycoside phosphotransferase gene cassette. of oxacillinase-mediated resistance to imipenem in Antimicrob Agents Chemother 45:1249–53. Klebsiella pneumoniae. Antimicrob Agents Chemother Richter SN, Frasson I, Bergo C, et al. (2011). Transfer of KPC-2 Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 48:15–22. carbapenemase from Klebsiella pneumoniae to Escherichia Poirel L, Le T,I, Naas T, et al. (2000a). Biochemical sequence coli in a patient: first case in Europe. J Clin Microbiol analyses of GES-1, a novel class A extended-spectrum beta- 49:2040–2. lactamase, and the class 1 integron In52 from Klebsiella Robin F, Aggoune-Khinache N, Delmas J, et al. (2010). Novel pneumoniae. Antimicrob Agents Chemother 44:622–32. VIM metallo-beta-lactamase variant from clinical isolates of Poirel L, Naas T, Nicolas D, et al. (2000b). Characterization of enterobacteriaceae from Algeria. Antimicrob Agents VIM-2, a carbapenem-hydrolyzing metallo-beta-lactamase Chemother 54:466–470. and its plasmid- and integron-borne gene from a Robledo IE, Aquino EE, Sante MI, et al. (2010). Detection of Pseudomonas aeruginosa clinical isolate in France. KPC in Acinetobacter Spp. in Puerto Rico. Antimicrob Antimicrob Agents Chemother 44:891–7. Agents Chemother 54:1354–1357. Poirel L, Pitout JD, Nordmann P. (2007). Carbapenemases: Rodriguez-Martinez JM, Nordmann P, Fortineau N, Poirel L. molecular diversity and clinical consequences. Future (2010). VIM-19, a metallo-beta-lactamase with increased Microbiol 2:501–12. carbapenemase activity from Escherichia coli and Klebsiella Poirel L, Ros A, Carrer A, et al. (2011d). Cross-border transmis- pneumoniae. Antimicrob Agents Chemother 54:471–6. sion of OXA-48-producing Enterobacter cloacae from Rolain JM, Parola P, Cornaglia G. (2010). New Delhi metallo- Morocco to France. J Antimicrob Chemother 66:1181–2. beta-lactamase (NDM-1): towards a new pandemia? Clin Poirel L, Ros A, Carricajo A, et al. (2011e). Extremely drug- Microbiol Infect 16:1699–1701. resistant Citrobacter freundii isolate producing NDM-1 and Ruppe E, Armand-Lefevre L, Lolom I, et al. (2011). other carbapenemases identified in a patient returning Development of a phenotypic method for detection of from India. Antimicrob Agents Chemother 55:447–8. fecal carriage of OXA-48-producing enterobacteriaceae 18 N. MATHLOUTHI ET AL.

after incidental detection from clinical specimen. J Clin Souli M, Galani I, Giamarellou H. (2008). Emergence of exten- Microbiol 49:2761–2. sively drug-resistant and pandrug-resistant Gram-negative Saidani M, Hammami S, Kammoun A, et al., (2012). bacilli in Europe. Euro Surveill 13:19045. Emergence of carbapenem-resistant OXA-48 carbapene- Tato M, Coque TM, Baquero F, Canton R. (2010). Dispersal of mase-producing enterobacteriaceae in Tunisia. J Med carbapenemase BlaVIM-1 gene associated with different Microbiol 61:1746–9. Tn402 variants, mercury transposons, and conjugative plas- Samra Z, Ofir O, Lishtzinsky Y, et al. (2007). Outbreak of carba- mids in enterobacteriaceae and Pseudomonas aeruginosa. penem-resistant Klebsiella pneumoniae producing KPC-3 in Antimicrob Agents Chemother 54:320–7. a tertiary medical centre in Israel. Int J Antimicrob Agents Tato M, Coque TM, Ruiz-Garbajosa P, et al. (2007). Complex 30:525–9. clonal and plasmid epidemiology in the first outbreak of Samuelsen O, Naseer U, Tofteland S, et al. (2009). Emergence enterobacteriaceae infection involving VIM-1 metallo-beta- of clonally related Klebsiella pneumoniae isolates of lactamase in Spain: toward endemicity? Clin Infect Dis sequence type 258 producing plasmid-mediated KPC car- 45:1171–8. bapenemase in Norway and Sweden. J Antimicrob Tortola MT, Lavilla S, Miro E, et al. (2005). First detection of a Chemother 63:654–8. carbapenem-hydrolyzing metalloenzyme in two enterobac- San Millan A, Toll-Riera M, Escudero JA, et al. (2015). teriaceae isolates in Spain. Antimicrob Agents Chemother Sequencing of plasmids PAMBL1 and PAMBL2 from 49:3492–4. Pseudomonas aeruginosa reveals a BlaVIM-1 amplification Touati M, Diene SM, Dekhil M, et al. (2013). Dissemination of causing high-level carbapenem resistance. J Antimicrob a class I integron carrying VIM-2 carbapenemase in Chemother 70:3000–3. Pseudomonas aeruginosa clinical isolates from a hospital Sanchez-Romero I, Asensio A, Oteo J, et al. (2012). intensive care unit in Annaba, Algeria. Antimicrob Agents Nosocomial outbreak of VIM-1-producing Klebsiella Chemother 57:2426–7. pneumoniae isolates of multilocus sequence type 15: Touati M, Diene SM, Racherache A, et al. (2012). Emergence molecular basis, clinical risk factors, and outcome. of BlaOXA-23 and BlaOXA-58 carbapenemase-encoding Antimicrob Agents Chemother 56:420–7. genes in multidrug-resistant Acinetobacter baumannii iso- Sardelic S, Pallecchi L, Punda-Polic V, Rossolini GM. (2003). lates from university hospital of Annaba, Algeria. Int J Carbapenem-resistant Pseudomonas aeruginosa-carrying Antimicrob Agents 40:89–91. VIM-2 metallo-beta-lactamase determinants, Croatia. Trevino M, Navarro D, Barbeito G, et al. (2011). Molecular and Emerging Infect Dis 9:1022–3. epidemiological analysis of nosocomial carbapenem-resist- Sassi A, Loucif L, Gupta SK, et al. (2014). NDM-5 carbapene- ant Klebsiella spp. using repetitive extragenic palindromic- mase-encoding gene in multidrug-resistant clinical isolates polymerase chain reaction and matrix-assisted laser of Escherichia coli from Algeria. Antimicrob Agents desorption/ionization-time of flight. Microb Drug Resist Chemother 58:5606–8. 17:433–42. Schwaber MJ, Klarfeld-Lidji S, Navon-Venezia S, et al. (2008). Tsakris A, Kristo I, Poulou A, et al. (2008). First occurrence Predictors of carbapenem-resistant Klebsiella pneumoniae of KPC-2-possessing Klebsiella pneumoniae in a Greek acquisition among hospitalized adults and effect of acquisition on mortality. Antimicrob Agents Chemother hospital and recommendation for detection with 52:1028–33. boronic acid disc tests. J Antimicrob Chemother 62: Scotta C, Juan C, Cabot G, et al. (2011). Environmental micro- 1257–60. biota represents a natural reservoir for dissemination of Tsakris A, Pournaras S, Woodford N, et al. (2000). Outbreak of clinically relevant metallo-beta-lactamases. Antimicrob infections caused by Pseudomonas aeruginosa producing Agents Chemother 55:5376–9. VIM-1 carbapenemase in Greece. J Clin Microbiol Downloaded by [Chouchani Chedly] at 16:15 07 July 2016 Sefraoui I, Berrazeg M, Drissi M, Rolain JM. (2014). 38:1290–2. Molecular epidemiology of carbapenem-resistant Vatopoulos A. (2008). High rates of metallo-beta-lactamase- Pseudomonas aeruginosa clinical strains isolated from producing Klebsiella pneumoniae in Greece – a review of Western Algeria between 2009 and 2012. Microb Drug the current evidence. Euro Surveill 13:8023. Resist 20:156–61. Vidal-Navarro L, Pfeiffer C, Bouziges N, et al. (2010). Faecal Sevillano E, Gallego L, Garcia-Lobo JM. (2009). First detection carriage of multidrug-resistant Gram-negative bacilli during of the OXA-40 carbapenemase in P. aeruginosa isolates, a non-outbreak situation in a french university hospital. located on a plasmid also found in A. baumannii. Pathol J Antimicrob Chemother 65:2455–8. Biol (Paris) 57:493–5. Viedma E, Juan C, Otero JR, et al. (2013). Draft genome Sole M, Pitart C, Roca I, et al. (2011). First description of an sequence of VIM-2-producing multidrug-resistant Escherichia coli strain producing NDM-1 carbapenemase in Pseudomonas aeruginosa ST175, an epidemic high-risk Spain. Antimicrob Agents Chemother 55:4402–4. clone. Genome Announc 1:e0011213. Sorli L, Miro E, Segura C, et al. (2011). Intra- and inter-species Voulgari E, Gartzonika C, Vrioni G, et al. (2014). The Balkan spread of carbapenemase genes in a non-hospitalized Region: NDM-1-producing Klebsiella pneumoniae ST11 clo- patient. Eur J Clin Microbiol Infect Dis 30:1551–5. nal strain causing outbreaks in Greece. J Antimicrob Souli M, Galani I, Antoniadou A, et al. (2010). An outbreak of Chemother 69:2091–7. infection due to beta-lactamase Klebsiella pneumoniae car- Voulgari E, Zarkotou O, Ranellou K, et al. (2013). Outbreak of bapenemase 2-producing K. pneumoniae in a Greek univer- OXA-48 carbapenemase-producing Klebsiella pneumoniae in sity hospital: molecular characterization, epidemiology, and Greece involving an ST11 clone. J Antimicrob Chemother outcomes. Clin Infect Dis 50:364–73. 68:84–8. CRITICAL REVIEWS IN MICROBIOLOGY 19

Vourli S, Giakkoupi P, Miriagou V, et al. (2004). Novel GES/IBC carbapenem-resistant strain of Klebsiella pneumoniae. extended-spectrum beta-lactamase variants with carbape- Antimicrob Agents Chemother 45:1151–61. nemase activity in clinical enterobacteria. FEMS Microbiol Zafer MM, Al-Agamy MH, El-Mahallawy HA, et al. (2014a). Lett 234:209–13. Antimicrobial resistance pattern and their beta-lactamase Vranic-Ladavac M, Bedenic B, Minandri F, et al. (2014). encoding genes among Pseudomonas aeruginosa strains Carbapenem resistance and acquired class D beta-lacta- isolated from cancer patients. Biomed Res Int 2014: mases in Acinetobacter baumannii from Croatia 2009–2010. 101635. Eur J Clin Microbiol Infect Dis 33:471–8. Zafer MM, Amin M, El MH, et al. (2014b). First report of NDM- Walsh TR. (2010). Emerging carbapenemases: a global per- 1-producing Pseudomonas aeruginosa in Egypt. Int J Infect spective. Int J Antimicrob Agents 36(Suppl 3):S8–14. Dis 29:80–1. Walsh TR, Toleman MA, Poirel L, Nordmann P. (2005). Metallo- Zeka AN, Poirel L, Sipahi OR, et al. (2014). GES-type beta-lactamases: the quiet before the storm? Clin Microbiol and OXA-23 carbapenemase-producing Acinetobacter Rev 18:306–25. baumannii in Turkey. J Antimicrob Chemother 69: Walther-Rasmussen J, Hoiby N. (2007). Class A carbapene- 1145–6. mases. J Antimicrob Chemother 60:470–82. Zhao WH, Hu ZQ. (2011). Epidemiology and genetics of VIM- Yigit H, Queenan AM, Anderson GJ, et al. (2001). Novel carba- type metallo-b-lactamases in Gram-negative bacilli. Future penem-hydrolyzing beta-lactamase, KPC-1, from a Microbiol 6:317–33. Downloaded by [Chouchani Chedly] at 16:15 07 July 2016

CHAPITRE II:

Etude du déterminisme génétique et de l’épidémiologie moléculaire de la résistance aux β-lactamines chez des souches d’Esherichia coli et de Klebsiella pneumoniae isolées dans des hôpitaux tunisiens et libyens

AVANT PROPOS

La fréquence des bactéries multi-résistantes aux antibiotiques a atteint, partout dans le monde, des proportions inquiétantes et est devenue un problème majeur de santé publique. Au cours des dernières décennies, une attention particulière vis-à-vis des agents pathogènes multi-résistants a été accordée aux bactéries à Gram négatif fermentants, notamment productrices de β-lactamases à spectre étendu (BLSE). C’est en 1983, en Allemagne que la première souche productrice de BLSE a été signalée [1]. Depuis, la fréquence de ces souches n’a cessé d’augmenter dans le monde entier [2].

Le traitement des infections causées par ces organismes affiche un plus grand défi pour les cliniciens [3-5]. Parmi ces germes, Esherichia coli et Klebsiella pneumonaie ont longtemps constitué les espèces d’entérobactéries chez lesquelles la production de BLSE était la plus fréquemment décrite [6], d’où l’intérêt porté par ce chapitre à ces deux espèces bactériennes. Ces deux bactéries se distinguent comme des agents pathogènes opportunistes importants causant des infections nosocomiales surtout au sein des populations ayant un système immunitaire affaibli. Elles constituent une cause fréquente d'infections urinaires, de pneumonies et de bactériémies [7].

41 Les objectifs de ce chapitre consistent à évaluer le niveau de la résistance aux antibiotiques des souches d’E. coli et de K. pneumoniae isolées au niveau des hôpitaux tunisiens et libyens, de mettre en évidence la prévalence des souches productrices de BLSE, d’identifier le support génétique de la résistance aux β-lactamines et enfin d’étudier le typage moléculaire des souches multi-résistantes de K. pneumoniae. Notre étude a porté sur 87 entérobactéries (51 E. coli et 36 K. pneumoniae) collectées durant une période d’un an (mars 2013- mars 2014) à partir de prélèvements isolés de patients hospitalisés au sein des unités de soins intensifs dans deux hôpitaux: un hôpital tunisien (Avicenne) et un hôpital libyen (Centre Médical de Benghazi).

La recherche moléculaire des β-lactamases a montré que 58 souches isolées dans cette étude (soit 66.6% des souches) se sont avérées productrices d’au moins un gène qui code pour une BLSE. Le support génétique des enzymes BLSE produits par les souches d’E. coli et de K. pneumoniae isolées était diversifié. Le variant CTX-M-15 était majoritaire et a été détecté chez 47 (72.30%) isolats, le variant TEM-1 chez 31 (47.69%) isolats et 18 (27.69%) isolats hébergeaient divers variants du gène blaSHV. Notre étude souligne donc, d’une part l’importance de la fréquence de la production de BLSE par les souches d’E. coli et de K. pneumoniae, et d’autre part la confirmation de la propagation mondiale de l’enzyme CTX-M-15[8].

42 Plusieurs de ces variants, déjà décrits en Tunisie (CTX-M-15, TEM-1, SHV-1, SHV-2, SHV-11, SHV-12, SHV-28) [9-18], ont été détectés pour la première fois en Libye. Cependant, d’autres variants ont été signalés pour la première fois en Tunisie et en Libye (SHV-26, SHV-38, SHV-132, SHV-187). Il est important d’indiquer que cette étude est la première étude comparative qui met en évidence des BLSE communs entre des souches tunisiennes et des souches libyennes telles que CTX-M-15, TEM-1 et SHV-28. Ces résultats suggèrent que les patients libyens et tunisiens partagent probablement le même pool génétique et que les patients libyens pourraient être un réservoir ambulant de ces gènes de résistance du fait de leurs voyages fréquents en Tunisie pour des raisons essentiellement médicales, surtout suite à la guerre actuelle en Libye.

Par ailleurs, nous nous sommes intéressés aux 10 souches de K. pneumoniae résistantes à l’imipénème. Nous avons réalisé une étude moléculaire afin de détecter le type de carbapénèmase exprimé. Les résultats issus de cette expérience ont montré que toutes les souches de

K. pneumoniae résistantes à cet antibiotique portent le gène blaOXA-48. Notre étude est la première qui décrit l’émergence de l’OXA-48 dans des hôpitaux libyens. Néanmoins, cette oxacillinase a été déjà détectée dans des hôpitaux tunisiens. Les résultats de notre étude confirment donc que les pays de l'Afrique du Nord, parmi lesquels la Tunisie et la Libye, sont une zone endémique de l’OXA-48.

43 L’étude de la relation clonale entre les 36 souches KpBLSE a été réalisée en utilisant la technique génotypique multi-locus sequence type (MLST). Les résultats ont révélé que nos souches appartenaient à 15 différents clones ou séquences types (ST) dont 12 ST déjà connues (ST20, ST17, ST29, ST100, ST101, ST111, ST414, ST969, ST1065, ST1112, ST1322 et ST 1657) et 3 nouvelles ST décrites pour la première fois dans cette étude (1949, 1950 et 1951). Il faut signaler que ces trois nouvelles ST correspondent à trois souches de K. pneumoniae qui hébergent l’enzyme OXA-48 et qui ont été isolées chez des patients hospitalisés au centre médical de Benghazi. Le clone le plus fréquent est ST101 et correspond aux souches résistantes à l’imipénème. A notre connaissance, c'est la première fois que ce clone est détecté chez des souches de K. pneumoniae en Libye, cependant ce clone a été déjà décrit en Tunisie [19].

Globalement, le typage moléculaire de toutes les souches de K. pneumoniae, productrices ou non de l’OXA-48, isolées dans les hôpitaux tunisiens et libyens montre une diversité clonale indiquant que l’émergence de la résistance est principalement due à une dissémination horizontale des déterminants de la résistance ou/et à la mobilisation de ces gènes par des éléments mobiles [20, 21]. Ceci est stimulé sans doute, comme il a bien été décrit dans la littérature, par la grande plasticité du génome de K. pneumoniae qui lui permet d’être doté d’une grande capacité à échanger et à acquérir du matériel génétique exogène, mais aussi d’évoluer dans des niches écologiques très variées [22, 23]. 44 De plus, le manque d’hygiène au sein des hôpitaux tunisiens et libyens, aggravé par la guerre actuelle en Libye, facilite la transmission des bactéries multi-résistantes (via les mains du personnel par exemple). En outre, les patients concernés par cette étude (qui sont tous hospitalisés dans l’unité des soins intensifs de ces hôpitaux) sont particulièrement des hôtes sensibles en raison de leur système immunitaire affaibli en particulier lorsque des dispositifs invasifs (une source de contamination) ont été utilisés [24].

45 Reference List

1. Knothe H, Shah P, Krcmery V, Antal M, Mitsuhashi S. Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens. Infection 1983; 11(6):315-317. 2. Paterson DL, Bonomo RA. Extended-spectrum beta-lactamases: a clinical update. Clin Microbiol Rev 2005; 18(4):657-686. 3. de Kraker ME, Davey PG, Grundmann H. Mortality and hospital stay associated with resistant Staphylococcus aureus and Escherichia coli bacteremia: estimating the burden of antibiotic resistance in Europe. PLoS Med 2011; 8(10):e1001104. 4. Hagel S, Stallmach A, Keller P, Pletz M. [Multiresistant Organisms]. Zentralbl Chir 2015; 140(4):417-425. 5. Kamath S, Mallaya S, Shenoy S. Nosocomial infections in neonatal intensive care units: profile, risk factor assessment and antibiogram. Indian J Pediatr 2010; 77(1):37-39. 6. Colodner R, Rock W, Chazan B, Keller N, Guy N, Sakran W, et al. Risk factors for the development of extended-spectrum beta-lactamase- producing bacteria in nonhospitalized patients. Eur J Clin Microbiol Infect Dis 2004; 23(3):163-167. 7. Decre D, Verdet C, Emirian A, Le GT, Petit JC, Offenstadt G, et al. Emerging severe and fatal infections due to Klebsiella pneumoniae in two university hospitals in France. J Clin Microbiol 2011; 49(8):3012- 3014. 8. Carrer A, Nordmann P. [CTX-M-15-producing Klebsiella pneumoniae: a change in the epidemiology of ESBL]. Pathol Biol (Paris) 2011; 59(6):e133-e135. 9. Abbassi MS, Torres C, Achour W, Vinue L, Saenz Y, Costa D, et al. Genetic characterisation of CTX-M-15-producing Klebsiella pneumoniae and Escherichia coli strains isolated from stem cell transplant patients in Tunisia. Int J Antimicrob Agents 2008; 32(4):308- 314.

46 10. Ben-Hamouda T, Foulon T, Ben-Mahrez K. Involvement of SHV-12 and SHV-2a encoding plasmids in outbreaks of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in a Tunisian neonatal ward. Microb Drug Resist 2004; 10(2):132-138.

11. Ben AN, Mercuri PS, Ben MM, Galleni M, Belhadj O. Characterization of a novel extended-spectrum TEM-type beta- lactamase, TEM-164, in a clinical strain of Klebsiella pneumoniae in Tunisia. Microb Drug Resist 2009; 15(3):195-199.

12. Chouchani C, Ben AN, M'Charek A, Belhadj O. First characterization in Tunisia of a TEM-15, extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolate. Microb Drug Resist 2007; 13(2):114- 118.

13. Dahmen S, Bettaieb D, Mansour W, Boujaafar N, Bouallegue O, Arlet G. Characterization and molecular epidemiology of extended-spectrum beta-lactamases in clinical isolates of Enterobacteriaceae in a Tunisian University Hospital. Microb Drug Resist 2010; 16(2):163-170.

14. Elhani D, Bakir L, Aouni M, Passet V, Arlet G, Brisse S, et al. Molecular epidemiology of extended-spectrum beta-lactamase- producing Klebsiella pneumoniae strains in a university hospital in Tunis, Tunisia, 1999-2005. Clin Microbiol Infect 2010; 16(2):157-164.

15. Ferjani S, Saidani M, Ennigrou S, Hsairi M, Slim AF, Ben Boubaker IB. Multidrug resistance and high virulence genotype in uropathogenic Escherichia coli due to diffusion of ST131 clonal group producing CTX-M-15: an emerging problem in a Tunisian hospital. Folia Microbiol (Praha) 2014; 59(3):257-262.

16. Hammami S, Saidani M, Ferjeni S, Aissa I, Slim A, Boutiba-Ben B, I. Characterization of extended spectrum beta-lactamase-producing Escherichia coli in community-acquired urinary tract infections in Tunisia. Microb Drug Resist 2013; 19(3):231-236.

17. Ktari S, Mnif B, Louati F, Rekik S, Mezghani S, Mahjoubi F, et al. Spread of Klebsiella pneumoniae isolates producing OXA-48 beta- lactamase in a Tunisian university hospital. J Antimicrob Chemother 2011; 66(7):1644-1646. 47 18. Mamlouk K, Boutiba-Ben B, I, Gautier V, Vimont S, Picard B, Ben RS, et al. Emergence and outbreaks of CTX-M beta-lactamase- producing Escherichia coli and Klebsiella pneumoniae strains in a Tunisian hospital. J Clin Microbiol 2006; 44(11):4049-4056.

19. Charfi K, Mansour W, Khalifa AB, Mastouri M, Aouni M, Mammeri H. Emergence of OXA-204 beta-lactamase in Tunisia. Diagn Microbiol Infect Dis 2015; 82(4):314-317.

20. Brinas L, Moreno MA, Teshager T, Saenz Y, Porrero MC, Dominguez L, et al. Monitoring and characterization of extended- spectrum beta-lactamases in Escherichia coli strains from healthy and sick animals in Spain in 2003. Antimicrob Agents Chemother 2005; 49(3):1262-1264.

21. Hernandez JR, Martinez-Martinez L, Canton R, Coque TM, Pascual A. Nationwide study of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum beta-lactamases in Spain. Antimicrob Agents Chemother 2005; 49(5):2122-2125.

22. Doorduijn DJ, Rooijakkers SH, van SW, Bardoel BW. Complement resistance mechanisms of Klebsiella pneumoniae. Immunobiology 2016; 221(10):1102-1109.

23. Lee CR, Lee JH, Park KS, Kim YB, Jeong BC, Lee SH. Global Dissemination of Carbapenemase-Producing Klebsiella pneumoniae: Epidemiology, Genetic Context, Treatment Options, and Detection Methods. Front Microbiol 2016; 7:895.

24. Wong MR, Del RP, Heine L, Volpe V, Lee L, Kornblum J, et al. An outbreak of Klebsiella pneumoniae and Enterobacter aerogenes bacteremia after interventional pain management procedures, New York City, 2008. Reg Anesth Pain Med 2010; 35(6):496-499.

Article 2:

Characteristics of Carbapenemase-and Extended-Spectrum β-Lactamase-producing Enterobacteriaceae isolated from Tunisian and Libyan Hospitals

Najla Mathlouthi, Charbel Al-Bayssari, Allaaeddin El Salabi, Sofiane Bakour, Salha Ben Gwierif, Abdulaziz A Zorgani, Yahia Jridi, Karim Ben Slama, Jean-Marc Rolain, Chedly Chouchani*

Published in Journal of Infection in Developing Countries (JIDC) Impact factor: 1.3

Original Article

Carbapenemases and extended-spectrum β-lactamases producing Enterobacteriaceae isolated from Tunisian and Libyan hospitals

Najla Mathlouthi1,2, Charbel Al-Bayssari1, Allaaeddin El Salabi4,5, Sofiane Bakour1, Salha Ben Gwierif6, Abdulaziz A Zorgani7, Yahia Jridi8, Karim Ben Slama2, Jean-Marc Rolain1, Chedly Chouchani2,3

1 Unité de recherche sur les maladies infectieuses et tropicales émergentes (URMITE), IHU Méditerranée Infection, Faculté de Médecine et de Pharmacie, Aix-Marseille-Université, Marseille, France 2 Laboratoire des Microorganismes et Biomolécules Actives, Université Tunis El-Manar, Faculté des Sciences de Tunis, El-Manar II, Tunisie. 3 Université de Carthage, Institut Supérieur des Sciences et Technologies de l’Environnement de Borj-Cedria, Hammam-Lif, Tunisie 4 Department of Environmental Health, Faculty of Public Health, University of Benghazi, Benghazi, Libya 5 Infection Control Office, Benghazi Medical Centre, Benghazi, Libya 6 Department of Microbiology, The Libyan Academy, Benghazi, Libya 7 Department of Medical Microbiology and Immunology, Faculty of Medicine, University of Tripoli, Libya 8 Université de Sousse, Service de Chirurgie Orthopédique et Traumatologique, Hôpital Régionale de Kasserine, Kasserine, Tunisie

Abstract Introduction: The aim of the study was to investigate the prevalence of extended-spectrum β-lactamase (ESBL) and carbapenemase production among clinical isolates of Enterobacteriaceae recovered from Tunisian and Libyan hospitals. Methodology: Bacterial isolates were recovered from patients in intensive care units and identified by biochemical tests and MALDI-TOF. Antibiotic susceptibility testing was performed by disk diffusion and the E-test method. ESBL and carbapenemase activities were detected using standard microbiological tests. Antibiotic resistance-encoding genes were screened by PCR and sequencing. Clonal relationships between Klebsiella pneumoniae strains were carried out using multi-locus sequence typing (MLST). Results: A total of 87 isolates were characterized, with 51 and 36, respectively, identified as E. coli and K. pneumoniae. Overall the resistance prevalence was high for aminoglycosides (> 60%), fluoroquinolones (> 80%), and extended-spectrum cephalosporins (> 94%), and was low for imipenem (11.4%). Among this collection, 58 strains (66.6%) were ESBL producers and 10 K. pneumoniae strains (11.4%) were carbapenemase producers. The antibiotic resistance-encoding genes detected werebla CTX-M-15 (51.7%), blaTEM-1 (35.6%), several variants of blaSHV (21.8%), andbla OXA-48 (11.4%). The MLST typing ofK. pneumoniae isolates revealed the presence of multiple clones and three novel sequence types. Also, close relationships between the OXA-48-producing strains from Tunisia and Libya were demonstrated. Conclusions: This study is the first paper describing the emergence of carbapenemase- and ESBL-producing Enterobacteriaceae, sensitive to colistin, isolated in Tunisia and Libya. Active surveillance and testing for susceptibility to colistin should be implementing because resistance to colistin, mainly in Klebsiella, has been recently reported worldwide.

Key words: Escherichia coli; Klebsiella pneumoniae; ESBLs; carbapenemases; Tunisia; Libya.

J Infect Dev Ctries 2016; 10(7):718-727. doi:10.3855/jidc.7426

(Received 14 July 2015 – Accepted 26 August 2015)

Copyright © 2016 Mathlouthi et al. This is an open-access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction frequent cause of urinary tract infections, and K. Enterobacteriaceae are the most common pneumoniae is an important cause of pneumonia [3]. pathogens causing both community-acquired and Emerging resistance in Enterobacteriaceae is a hospital-acquired infections, including infections of the significant problem that requires immediate attention. urinary and gastrointestinal tracts, peritonitis, Indeed, resistance phenotype due to the production of meningitis, sepsis, and medical device-associated extended-spectrum β-lactamases (ESBLs) and infections [1]. The infections caused by these bacteria carbapenemases is becoming a major public health are associated with significant morbidity and mortality. concern worldwide [1,4]. ESBLs include class A β- In fact, a previous report in Israel demonstrated that the lactamases, namely TEM and SHV, which confer mortality rates investigated in clinical studies ranged resistance to ampicillin, amoxicillin, and other from 22% to 72% [2]. Within this family, E. coli is a penicillins, as well as cephalosporins [3]. Mathlouthi et al. –Carbapenemases and ESBLs in Tunisia and Libya J Infect Dev Ctries 2016; 10(7):718-727.

Enterobacteriaceae may also express ESBLs that are matrix-assisted laser desorption and ionization time-of- not closely related to TEM- or SHV-related species, flight mass spectrometry (MALDI-TOF MS). including CTX-M- and OXA-type ESBLs. These ESBLs are typically plasmid-mediated rather than Antibiotic susceptibility testing chromosomally mediated β-lactamases [5]. ESBLs that Antibiotic susceptibility was determined on hydrolyze carbapenems should be distinguished from Mueller-Hinton agar using the standard disk diffusion other β-lactamases [3]. Indeed, they have broader-range method as described by the Antibiogram Committee of activity, covering carbapenems as well as extended- the French Society for Microbiology (CA-SFM) spectrum cephalosporins [6]. The clinically most (www.sfm-microbiologie.org). Sixteen antibiotics were important groups are the increasingly emerging NDM- tested, including ceftazidime, cefotaxime, amoxicillin- 1, KPC, and OXA-48 enzymes; their producers are clavulanic acid, ceftriaxon, amoxicillin, aztreonam, spread around the world, becoming an alarming public ertapenem, imipenem, gentamicin, amikacin, health problem [7]. ESBL- and carbapenemase- ciprofloxacin, nalidixic acid, nitrofurantoin, cefoxitin, producing Enterobacteriaceae strains are being trimethoprim-sulfamid, and colistin (BIORAD, increasingly reported in Europe, South America, Asia, Marnes-la-Coquette, France). Oceania, and Africa [8]. The situation is still worse in For all isolates, minimum inhibitory concentrations low-income countries, where there is a lack of (MICs) of ceftazidime and imipenem were determined antimicrobial-resistance surveys and an absence of using an E-test strip (AB BioMerieux, Grenoble, adequate policies on antibiotics use [9,10]. The poor France). MICs values were interpreted according to the state of health has undoubtedly exacerbated the CA-SFM breakpoints. problem of antimicrobial resistance in these countries [10]. In Tunisia and Libya, misuse of antimicrobial Phenotypic detection of ESBLs and carbapenemases agents by the public is widespread. Indeed, in both ESBL production was detected by a double-disk countries, antimicrobials can be purchased from synergy test (DDST). Enhancement of the inhibition pharmacies without a prescription, which has led to the zone between the disks containing clavulanic acid and rapid emergence of many resistant bacteria. In addition, cefotaxime, ceftazidime, or aztreonam indicated the there is a lack of infection prevention policies and presence of ESBL production [14]. Imipenem-resistant simple control measures, such as hand hygiene, to avoid isolates were screened for carbapenemase production the spread of pathogens in the hospital setting [9,10]. using the modified Hodge test (MHT), the modified In view of the emergence of ESBLs and Carba NP test (MCNP) and the EDTA test as previously carbapenemases in Tunisia [9,11-13] and because there described [15-18]. is no detailed information on the occurrence of these enzymes in Libyan hospitals, this study was undertaken Molecular detection of antibiotic-resistance-encoding to investigate the prevalence of antibiotic resistance and genes to characterize the molecular mechanisms of these Conventional polymerase chain reaction (PCR) was resistances in E. coli and K. pneumoniae clinical performed to identify Ambler class A ESBL genes isolates collected from Libyan and Tunisian hospitals. using specific primers for blaCTX, blaTEM, blaSHV, blaPER, Herein, we describe the first multiclonal spreadK. of blaVEB, and blaGES genes. Real-time PCR and pneumoniae-harbored blaOXA-48 and ESBL-encoding conventional PCR were performed for the blaKPC, genes in Libyan hospitals. blaOXA-48, and blaNDM genes for imipenem-resistant strains [4]. Primers used for PCR and RT-PCR Methodology amplification of carbapenemases, ESBLs, and metallo- Bacterial isolates β-lactamases (MBLs) genes are listed in Table 1. A total of 87 clinical isolates were collected over 12 Strains used as positive controls wereK. pneumoniae months, between March 2014 and March 2015. Among KPNASEY (CTX-M, TEM, SHV, and NDM producer), these strains, 47 were recovered from Benghazi E. coli CMUL64 (OXA-48 producer), K. and Medical Center (BMC), Benghazi, Libya, and 40 strains pneumoniae ST512 (KPC producer). were isolated from Avicenne Clinic in Tunisia. All strains were isolated from hospitalized patients in DNA sequencing intensive care units (ICUs). The isolates were PCR products were purified and sequenced using previously identified using biochemical tests, a Phoenix the Big Dye terminator chemistry on an ABI 3730 automated microbiology system, and confirmed by automated sequencer (Applied Biosystems, Foster City,

719 Mathlouthi et al. –Carbapenemases and ESBLs in Tunisia and Libya J Infect Dev Ctries 2016; 10(7):718-727.

Table 1. Primers used for PCR and real-time PCR amplification of carbapenemases, ESBLs, and MBLs genes. Amplicon Gene name Type of PCR Primer name Primer sequence (5’ 3’) Î size (bp) CTX-F TTTGCGATGTGCAGTACCAGTAA blaCTX-M Standard PCR 544 CTX-R CGATATCGTTGGTGGTGCCATA TEM-F ATGAGTATTCAACATTTCCGTG blaTEM Standard PCR 861 TEM-R TTACCAATGCTTAATCAGTGAG SHV-F TTTATGGCGTTACCTTTGACC blaSHV Standard PCR 1051 SHV-R ATTTGTCGCTTCTTTACTCGC OXA-48-F TTGGTGGCATCGATTATCGG Standard PCR 744 OXA-48-R GAGCACTTCTTTTGTGATGGC blaOXA-48 OXA-48-F TCTTAAACGGGCGACCAAG Real-time PCR 125 OXA-48-R GCGTCTGTCCATCCACTTA NDM-1-F CATTTGCGGGGTTTTTATG Standard PCR 1022 NDM-1-R CTGGGTCGAGGTCAGGATAG blaNDM-1 NDM-1-F GCGCAACACAGCCTGACTTT Real-time PCR 155 NDM-1-R CAGCCACCAAAAGCGATGTC KPC-F ATGTCACTGTATCGCCGTCT Standard PCR 893 KPC-R TTTTCAGAGCCTTACTGCCC blaKPC KPC-F GATACCACGTTCCGTCTGGA Real-time PCR 180 KPC-R GGTCGTGTTTCCCTTTAGCC PCR : polymerase chain reaction ; ESBL : extended-spectrum β-lactamase ; MBL : metallo β-lactamase.

USA). The obtained nucleotide sequences and their the genes encoding these enzymes. As shown in Table deduced amino acids sequences were compared against 2, the nucleotide sequences of the amplicons revealed the NCBI database using, respectively, BlastN and the presence of sequences that were 100% similar to BlastP functionalities. (www.ncbi.nlm.nih.gov). that of blaCTX-M-15, blaTEM-1 and many variants of blaSHV (Table 3). None of the isolates harbored either the Molecular strain typing blaPER, blaVEB or blaGES genes. The results of The clonal relationships between imipenem- carbapenemase production tests showed that all resistant K. pneumonie isolates were studied by multi- imipenem-resistant isolates were positive by MHT and locus sequence typing (MLST). Isolates were attributed MCNP, suggesting carbapenemase production. to a sequence type (ST) number according to the allelic However, the activity of β-lactamases was not inhibited profiles available in the Institute Pasteur's MLST web by EDTA, an indicated that the imipenem-resistant site (www.pasteur.fr/mlst). isolates were not MBL producers.

Results After identification, it was possible to conclude that Figure 1. Antibiotic susceptibility of Escherichia coli and Klebsiella pneumoniae clinical strains. the collection of 87 isolates included 51 strains of E. coli and 36 of K. pneumoniae. Antibiotic susceptibility testing for the 87 isolates is summarized in Figure 1. In general, a high prevalence of resistance was observed against the greater part of antibiotics, especially third- generation cephalosporins. Eighty percent of the isolates were very highly resistant to ceftazidime, cefotaxime, amoxicillin-clavulanic acid, amoxicillin, and ciprofloxacin. In addition, 10 strains of K. pneumoniae showed a high level of resistance to carbapenems, with MICs for imipenem > 16 mg/L (Table 2). In the present study, only ESBLs and carbapenemase-producing Enterobacteriaceae were presented in Table 2 and Table 3. All isolates were susceptible to colistin. The double-disk synergy test CAZ: Ceftazidime, CTX: Cefotaxime, AMC: Amoxicillin-Clavulanic showed that 66.6% of isolates were ESBL positive. Acid, CRO: Cefriaxon, AX: Amoxicillin, ATM: Aztreonam, ETP: bla Ertapenem, IMP: Imipenem, CN: Gentamicin, AK: Amikacin, CIP: Detection of CTX-M, blaSHV and blaTEM using PCR Ciprofloxacin, NA: Nalidixic Acid, F: Nitrofurantoin, FOX: Cefoxitin, amplification showed that 58 strains were positive for SXT: Trimethoprim-Sulfamid, CT: Colistin.

720 Table 2. Phenotypic and genotypic characteristics features of the Tunisian and Libyan Klebsiella pneumoniae clinical isolates producing ESBLs and carbapenemases. IMP Date of Type of ESBL Isolate Location Ward MIC ESBLs and carbapenemases isolation swab synergy test (μg/mL) CTX-M-U TEM SHV OXA ST

2016; 10(7):718-727. 2251 Tunis 4-2014 ICU Tracheal + > 16 CTX-M-15 TEM-1 SHV-11 OXA-48 101 8119 Tunis 4-2014 ICU Tracheal + > 16 SHV-28 OXA-48 101 1676 Tunis 4-2014 ICU Tracheal + > 16 CTX-M-15 TEM-1 SHV-11 OXA-48 101 5236 Tunis 4-2014 ICU Tracheal + < 2 CTX-M-15 TEM-1 SHV-38 29 J Infect Dev Ctries Ctries Dev J Infect 9142 Tunis 4-2014 ICU Tracheal + < 2 CTX-M-15 TEM-1 SHV-1 1065 5933 Tunis 4-2014 ICU Tracheal + < 2 CTX-M-15 TEM-1 SHV-11 969 2295 Tunis 4-2014 ICU Tracheal + < 2 CTX-M-15 TEM-1 SHV-11 17 8332 Tunis 4-2014 ICU Tracheal + < 2 CTX-M-15 SHV-132 111 6086 Tunis 4-2014 ICU Tracheal + < 2 CTX-M-15 TEM-1 SHV-1 1657 6163 Tunis 4-2014 ICU Tracheal + < 2 CTX-M-15 SHV-132 1112 58 Benghazi 4-2014 ICU Tracheal - > 16 OXA-48 100 694 Benghazi 4-2014 ICU Tracheal - > 16 OXA-48 101 330 Benghazi 4-2014 ICU Tracheal - > 16 OXA-48 1949 695 Benghazi 4-2014 ICU Tracheal - > 16 OXA-48 101 76 Benghazi 4-2014 ICU Tracheal - > 16 OXA-48 101 203 Benghazi 4-2014 ICU Tracheal - > 16 OXA-48 1950 82 Benghazi 4-2014 ICU Tracheal - > 16 OXA-48 1951 2 Benghazi 4-2014 ICU Tracheal - < 2 CTX-M-15 TEM-1 SHV-187 20 51 Benghazi 4-2014 ICU Tracheal + < 2 CTX-M-15 TEM-1 414 79 Benghazi 4-2014 ICU Tracheal + < 2 CTX-M-15 SHV-26 101 33 Benghazi 4-2014 ICU Tracheal + < 2 CTX-M-15 1322 88 Benghazi 4-2014 ICU Tracheal + < 2 CTX-M-15 1322 Carbapenemases and ESBLs in Tunisia and Libya Libya and Tunisia in ESBLs and Carbapenemases ICU: intensive care unit; IMP: imipenem; MIC: minimum inhibitory concentration; ST: sequence type. et al. – Mathlouthi Mathlouthi et al. –Carbapenemases and ESBLs in Tunisia and Libya J Infect Dev Ctries 2016; 10(7):718-727.

Table 3. Phenotypic and genotypic characteristics features of the Tunisian and Libyan Escherichia coli clinical isolates producing ESBLs. Date of isolation Isolate Location ESBLs (mm-yyyy) CTX- M-U TEM SHV 9671 Tunis 4-2014 CTX -M-15 SHV-12 8069 Tunis 4-2014 CTX- M-15 TEM-1 7592 Tunis 4-2014 CTX- M-15 TEM-1 SHV-11 7898 Tunis 4-2014 CTX- M-15 TEM-1 6042 Tunis 4-2014 CTX -M-15 5868 Tunis 4-2014 CTX -M-15 TEM-1 2631 Tunis 4-2014 CTX -M-15 TEM-1 SHV-11 2360 Tunis 4-2014 CTX -M-15 4316 Tunis 4-2014 CTX -M-15 9160 Tunis 4-2014 TEM-1 8892 Tunis 4-2014 CTX -M-15 6576 Tunis 4-2014 CTX -M-15 2584 Tunis 4-2014 CTX -M-15 5728 Tunis 4-2014 CTX -M-15 8853 Tunis 4-2014 CTX -M-15 6194 Tunis 4-2014 CTX -M-15 1111 Tunis 4-2014 CTX -M-15 1 Benghazi 4-2014 CTX -M-15 TEM-1 2 Benghazi 4-2014 TEM-1 3 Benghazi 4-2014 CTX -M-15 TEM-1 SHV-2 4 Benghazi 4-2014 CTX -M-15 5 Benghazi 4-2014 CTX -M-15 6 Benghazi 4-2014 CTX -M-15 TEM-1 7 Benghazi 4-2014 TEM-1 8 Benghazi 4-2014 CTX -M-15 9 Benghazi 4-2014 TEM-1 10 Benghazi 4-2014 TEM-1 11 Benghazi 4-2014 TEM-1 12 Benghazi 4-2014 CTX -M-15 TEM-1 13 Benghazi 4-2014 CTX -M-15 14 Benghazi 4-2014 CTX -M-15 15 Benghazi 4-2013 CTX -M-15 TEM-1 16 Benghazi 4-2013 CTX -M-15 17 Benghazi 4-2013 CTX -M-15 18 Benghazi 4-2013 CTX -M-15 213 Benghazi 4-2013 TEM-1 184 Benghazi 4-2013 TEM-1 113 Benghazi 4-2013 TEM-1 608 Benghazi 4-2013 TEM-1 560 Benghazi 4-2013 CTX -M-15 TEM-1 SHV-28 690 Benghazi 4-2013 CTX -M-15 TEM-1 SHV-28 635 Benghazi 4-2013 CTX -M-15 340 Benghazi 4-2013 CTX -M-15 ESBL: extended-spectrum β-lactamase

722 Mathlouthi et al. –Carbapenemases and ESBLs in Tunisia and Libya J Infect Dev Ctries 2016; 10(7):718-727.

Screening for carbapenemase-encoding genes by Discussion PCR showed that all 10 isolates contained a blaOXA-48- In this study, we characterized carbapenemase- and like gene (Table 2). All of the isolates were negative ESBLs-producing E. coli and K. pneumoniae clinical against blaKPC-like or blaNDM genes. isolates isolated from patients admitted to Tunisian and All 36 K. pneumoniae isolates were analyzed by Libyan hospitals. Among the 87 isolates, about two- MLST, and different STs were observed (Table 2). This thirds produced ESBLs. Several studies have also analysis showed that the 36 isolates ofK. pneumoniae shown the emerging problem of ESBL-producingE. belong to 15 different STs. The most frequent clone was coli and K. pneumoniae isolates in different geographic ST101, corresponding to imipenem-resistant K. regions, including the Mediterranean basin [19] and pneumoniae strains (Table 2). North Africa [9,20-23]. In our work, blaCTX-M-15 was the Using MLST analysis, three isolates of K. most frequently detected (54%) gene in the ESBL- pneumoniae collected from BMC, Libya, were found to positive Tunisian and Libyan isolates. These results have novel STs. K. pneumoniae 330 was assigned as suggest that blaCTX-M-15 is the most common gene ST1949, K. pneumoniae 203 was assigned as ST1950, responsible for mediating extended-spectrum and K. pneumoniae 82 was assigned as ST1951. It is cephalosporin resistance in these isolates. These data worth mentioning that those isolates were positive for confirm previous studies showing that this enzyme is OXA-48. widely present in Tunisia [11,21,24-31] (Table 4). Indeed, Mamlouk et al. detected the blaCTX-M-15 gene in

Table 4. Studies reporting ESBL-producing Enterobacteriaceae in Tunisia and Libya. Country Location Year Species Enzymes described Journal Reference Tunisia Tunis 2004 K. pneumoniae SHV-12, SHV-2a Microb Drug Resist [25] Antimicrob Agents Tunisia Sfax 2006 K. pneumoniae CTX-15, CMY-4 [11] Chemother Tunisia Tunis 2006 K. pneumoniae, E. coli CTX-M-15, CTX-M-16 J Clin Microbiol [30] Diag Microbiol Tunisia Tunis 2007 E. coli TEM-15 [22] Infect Dis OXA-1, TEM-1, SHV-1, Int J Antimicrob Tunisia Tunis 2008 K. pneumoniae, E. coli SHV-11, SHV-27, SHV-103, [24] Agents CTX-M-15 Tunisia Tunis 2009 K. pneumoniae TEM-164 Microb Drug Resist [21] K. pneumoniae, CTX-M-15, SHV-2a, SHV- Clin Microbiol Tunisia Sousse 2009 [26] C. freundii, E. coli 12, SHV-28, TEM-1 Infect CTX-M-15, SHV-12, SHV- Tunisia Sousse 2010 K. pneumoniae, E. coli Microb Drug Resist [27] 2a CTX-M-15, CTX-M-14, Clin Microbiol Tunisia Monastir 2010 K. pneumoniae [31] CTX-27, SHV-12, SHV-2a Infect Tunisia Mahdia 2012 E. cloacae SHV-12 Microb Pathog [23] Tunisia Tunis 2013 E. coli CTX-M-15, SHV-12 Microb Drug Resist [29] Tunisia Tunis 2014 E. coli CTX-M-15 Folia Microbiol [28] Libya Zawiya 2015 E. coli TEM, CTX Libyan J Med [32]

Table 5. Studies reporting OXA-48 producing Enterobacteriaceae in North Africa. Carbapenemase Country Year Isolate source Species References described Tunisia 2012 Urine K. pneumoniae OXA-48 [23] Tunisia 2012 NA K. pneumoniae OXA-48 [36] K. pneumoniae, C. Tunisia 2012 Pus, urine, blood freundii OXA-48 [13] Morocco 2011 Urine, rectal swab Enterobacteriaceae OXA-48 [46] Morocco 2012 NA Enterobacteriaceae OXA-48 [45] Morocco 2012 NA E. coli OXA-48 [44] Morocco 2014 Rectal swabs Enterobacteriaceae OXA-48 [34] Egypt 2013 Feces, exudate, blood E. coli OXA-48 [43] Algeria 2014 NA E. coli OXA-48 [33] NA: not available

723 Mathlouthi et al. –Carbapenemases and ESBLs in Tunisia and Libya J Infect Dev Ctries 2016; 10(7):718-727.

30% of Enterobacteriaceae (35 E. coli and 27 K. screened 21 ESBL-producing Enterobacteriaceae with pneumoniae) collected from different wards of Charles reduced susceptibilities to carbapenems; they found that Nicolle Hospital in Tunis [30]. More recently, in 2014, 5 of the 21 isolates investigated were OXA-48 positive Ferjani et al. reported that 88% of cefotaxime-resistant [13]. More recently, among enterobacterial clinical E. coli strains, isolated from urine of patients in a isolates recovered in the Center of Maternity and Tunisian hospital, harbored thebla CTX-M-15 gene [28]. Neonatology of Monastir, Tunisia, Charfi et al. These studies confirm the current spread of the CTX- identified one isolate positive for the OXA-48 gene that M-15 encoding-gene, which encodes the most prevalent co-expressed the blaCTX-M-15 gene [37]. These data β-lactamase detected among ESBL-positive K. showed the dissemination of imipenem-resistantK. pneumoniae and E. coli strains in Tunisian hospitals pneumoniae carrying the blaOXA-48 gene in Tunisian (Table 4). The increased consumption of cefotaxime hospitals (Table 5). and ceftazidime might have contributed to the Concerning Libya, to the best of our knowledge, our emergence of ESBLs, and particularly these CTX-M- study is the first that detected the emergence of OXA- type enzymes. The occurrence of thebla SHV-11 encoding 48-producing K. pneumoniae in this country. However, gene among the ESBL-positive Tunisian strains is three studies reported the presence of OXA-48- consistent with the finding of Abbassiet al., who producing K. pneumoniae isolated from Libyan patients reported thebla SHV-11 encoding gene inK. pneumoniae transferred to Europe for treatment. Indeed, Kocsis et ESBL-positive isolates recovered in the Centre of Bone al. reported that a carbapenem-resistant K. pneumoniae Marrow Transplantation of Tunisia [24] (Table 4). carrying the blaOXA-48 gene was recovered from the However, in Libya, few articles have been published blood culture of a Libyan patient hospitalized in the describing the presence of ESBL-producing ICU of the Sacro Cuore-Don Calabria Hospital in Enterobacteriaceae [32] (Table 4). In this study, similar Negrar, Italy [38]. Italy is the country with the highest phenotypes and genotypes related to antibiotic incidence of OXA-48-producing K. pneumoniae resistance were found in Tunisia and Libya. Indeed, in isolates, and has been considered to be the epicenter of North Africa, many studies also demonstrated the the spread of this enzyme in Mediterranean basin [39]. incidence of ESBL-producing E. coli and K. Indeed, several isolates K. of pneumoniae producing pneumoniae. Agabou et al. demonstrated the frequency OXA-48 have been reported, proving that the situation and diversity of ESBLs produced by E. coli isolates in this country is becoming endemic [39,40]. In from patients hospitalized in the Regional Military addition, Pirš et al. reported the first case of OXA-48- Hospital of Constantine in Algeria [33]. Additionally, producing K. pneumoniae in Slovenia, isolated from a in Morocco, Girlich et al. reported the high rate of fecal rectal swab collectedfrom a patient transferred from carriage of ESBL-producing Enterobacteriaceae at a Libya. The patient was colonized by both ESBL- university hospital [34]. In Egypt, a neighboring producing E. coli and ESBL- and OXA-48-producing country of Libya, the CTX-M-15 encoding-gene has K. pneumoniae [41]. Hammerum et al. reported that been found in clinical isolates of E. coli from Cairo patients transferred from Libya to Denmark carried [35]. OXA-48-producing K. pneumoniae [42].These studies Interestingly, we identified the presence of the underscore the importance of an early warning system blaOXA-48 gene in ten imipenem-resistantK. pneumoniae at the European level and screening upon admission of isolates in our study. Indeed, three Tunisian and seven patients transferred across countries. These findings Libyan K. pneumoniae isolates resistant to imipenem may also confirm that North Africa, including Tunisia were found to produce OXA-48 (Table 3). Several and Libya, are considered to be reservoirs of studies concerning the emergence of OXA-48- oxacillinase producers, particularly OXA-48; to date, producing K. pneumoniae have been reported in Tunisia this enzyme represents the most common (Table 5), but our study is the first that detected OXA- carbapenemase type circulating in this region [43-46] 48-positive K. pneumoniae isolated directly from (Table 5). Recently, in 2014, Agabouet al. reported the patients hospitalized in Libyan hospitals. Indeed, infirst description of OXA-48-producing E. coli and the Tunisia, two carbapenem-resistantK. pneumoniae pandemic clone ST131 from patients hospitalized at the clinical isolates carrying the plasmid-harbored OXA-48Regional Military Hospital of Constantine [33]. In carbapenemase gene were reported in 2010 [12]. KtariMorocco, Girlich et al. showed a high prevalence of et al. reported the spread of 21 (13.7%) K. pneumoniae multidrug-resistant Enterobacteriaceae, and isolates producing the blaOXA-48 encoding-gene in a particularly OXA-48 producers, at a university hospital Tunisian university hospital [36]. In 2012, Saidani et al. [34] (Table 5). MLST analysis of Tunisian and Libyan

724 Mathlouthi et al. –Carbapenemases and ESBLs in Tunisia and Libya J Infect Dev Ctries 2016; 10(7):718-727. isolates showed the occurrence of multiple clones, with References clones belonging to ST101 being the most frequent. 1. Paterson DL (2006) Resistance in Gram-negative bacteria: Enterobacteriaceae This is the first report using MLST analysis for . Am J Infect Control 34 Suppl 1: 20-28. 2. Borer A, Saidel-Odes L, Riesenberg K, Eskira S, Peled N, typing of K. pneumoniae isolates in Libya, but MLST Nativ R, Schlaeffer F, Sherf M (2009) Attributable mortality analysis studies have reported that ST101 is the most rate for carbapenem-resistant Klebsiella pneumoniae prevalent ST type in Tunisia. Indeed, the results of this bacteremia. Infect Control Hosp Epidemiol 30: 972-976. work are consistent with the studies of Charfiet al., who 3. Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P (2008) Molecular characterization and epidemiology of extended- assigned the K. pneumoniae KP51 strain to ST101, a spectrum-beta-lactamase-producing Escherichia coli and widespread clone harboring various β-lactamases, Klebsiella pneumoniae isolates causing health care-associated mostly OXA-48, which had been already reported in infection in Thailand, where the CTX-M family is endemic. Tunisia and which had also accounted for an outbreak Antimicrob Agents Chemother 52: 2818-2824. in Spain [37,47]. In addition, Cuzonet al. reported a 4. Diene SM, Rolain JM (2014) Carbapenemase genes and genetic platforms in Gram-negative bacilli: plasmid-mediated OXA-48 in K. pneumoniae ST101 Enterobacteriaceae, Pseudomonas and Acinetobacter species. from Tunisia [48]. Three novel STs were found among Clin Microbiol Infect 20: 831-838. the K. pneumoniae isolates from Benghazi, Libya: 5. N G M, Math C, Nagshetty K, Patil SA, Gaddad SM, ST1949, ST1950, and ST1951. These isolates were Shivannavar CT (2014) Antibiotic susceptibility pattern of ESβL producing Klebsiella pneumoniae isolated from urine positive for OXA-48, as were other isolates assigned to samples of pregnant women in Karnataka. J Clin Diagn Res8: previously described STs (20, 100, 101, 414, and 1322). DC08-DC11. These findings show that BMC, which is a tertiary6. Nordmann P, Dortet L, Poirel L (2012) Carbapenem resistance hospital in Benghazi and covers the eastern part of in Enterobacteriaceae: here is the storm! Trends Mol Med 18: Libya in terms of providing healthcare services, may 263-272. 7. Hrabak J, Chudackova E, Papagiannitsis CC (2014) Detection suffer from multiclonal spread of nosocomial of carbapenemases in Enterobacteriaceae: a challenge for pathogens; more importantly, the CTX-M-15 and diagnostic microbiological laboratories. Clin Microbiol Infect OXA-48-producing K. pneumoniae detected in this 20: 839-853. study demonstrates the long-standing infection control 8. Nordmann P, Poirel L (2014) The difficult-to-control spread of carbapenemase producers among Enterobacteriaceae problems needing urgent attention. worldwide. Clin Microbiol Infect 20: 821-830. 9. Chouchani C, Marrakchi R, El Salabi A(2011) Evolution of Conclusions beta-lactams resistance in Gram-negative bacteria in unisia.T This study described the emergence of ESBL- and Crit Rev Microbiol 37: 167-177. carbapenemase-producing Enterobacteriaceae in 10. Ghenghesh KS, Rahouma A, Tawil K, Zorgani A, Franka E (2013) Antimicrobial resistancein Libya: 1970-2011. Libyan J Tunisian and Libyan hospitals. These findings are of Med 8: 1-8. great concern because of the rapid dissemination of 11. Ktari S, Arlet G, Mnif B, Gautier V, Mahjoubi F, Ben JM, multidrug-resistant bacteria, particularly carbapenem- Bouaziz M, Hammami A (2006) Emergence of multidrug- resistant strains, which represent a major therapeutic resistant Klebsiella pneumoniae isolates producing VIM-4 metallo-beta-lactamase, CTX-M-15 extended-spectrum beta- and epidemiological threat. The implementation of lactamase, and CMY-4 AmpC beta-lactamase in a Tunisian strict infection prevention and control precautions in university hospital. Antimicrob Agents Chemother 50: 4198- addition to regular surveillance studies is urgently 4201. needed to contain the increasing spread of nosocomial 12. Lahlaoui H, Poirel L, Barguellil F, Moussa MB, Nordmann P pathogens in these countries. (2012) Carbapenem-hydrolyzing class D beta-lactamase OXA- 48 inKlebsiella pneumoniae isolates from Tunisia. Eur J Clin Microbiol Infect Dis 31: 937-939. 13. Saidani M, Hammami S, Kammoun A, Slim A, Boutiba-Ben Acknowledgements Boubaker I(2012) Emergence of carbapenem-resistant OXA- We thank Linda Hadjadj, a technician in URMITE (Unité de 48 carbapenemase-producing Enterobacteriaceae in Tunisia. J Recherche sur les Maladies Infectieuses et Tropicales Med Microbiol 61: 1746-1749. Emergentes), for her grateful assistance. This work was 14. Bakour S, Touati A, Bachiri T, Sahli F, Tiouit D, Naim M, partly funded by CNRS and IHU Méditerranée Infection. Azouaou M, Rolain JM (2014) First report of 16S rRNA methylase ArmA-producing Acinetobacter baumannii and This work was supported by the Ministry of Higher rapid spread of metallo-beta-lactamase NDM-1 in Algerian Education and Scientific Research of Tunisia, offering a hospitals. J Infect Chemother 20: 696-701. scholarship to Najla Mathlouthi in Aix-Marseille-University, 15. Dortet L, Poirel L, Errera C, Nordmann P (2014) CarbAcineto France. NP test for rapid detection of carbapenemase-producing Acinetobacter Spp. J Clin Microbiol 52: 2359-2364. 16. Dortet L, Poirel L, Nordmann P (2012) Rapid identification of carbapenemase types in Enterobacteriaceae and Pseudomonas

725 Mathlouthi et al. –Carbapenemases and ESBLs in Tunisia and Libya J Infect Dev Ctries 2016; 10(7):718-727.

Spp. by using a biochemical test. Antimicrob Agents beta-lactamase-producing Escherichia coli and Klebsiella Chemother 56: 6437-6440. pneumoniae strains in a Tunisian hospital. J Clin Microbiol 44: 17. Lee K, Kim CK, Yong D, Jeong SH, Yum JH, Seo YH, 4049-4056. Docquier JD, Chong Y (2010) Improved performance of the 31. Elhani D, Bakir L, Aouni M, Passet V, Arlet G, Brisse S, Weill modified hodge test with MacConkey agar for screening FX (2010) Molecular epidemiology of extended-spectrum carbapenemase-producing Gram-negative bacilli. J Microbiol beta-lactamase-producing Klebsiella pneumoniae strains in a Methods 83: 149-152. university hospital in Tunis, Tunisia, 1999-2005. Clin 18. Yong D, Lee K, Yum JH, Shin HB, Rossolini GM, Chong Y Microbiol Infect 16: 157-164. (2002) Imipenem-EDTA disk method for differentiation of 32. Abujnah AA, Zorgani A, Sabri MA, El-Mohammady H, metallo-beta-lactamase-producing clinical isolates of Khalek RA, Ghenghesh KS (2015) Multidrug resistance and pseudomonas Spp. and Acinetobacter Spp. J Clin Microbiol 40: extended-spectrum beta-lactamases genes amongEscherichia 3798-3801. coli from patients with urinary tract infections in Northwestern 19. Canton R, Novais A, Valverde A, Machado E, Peixe L, Libya. Libyan J Med 10: 26412. Baquero F, Coque TM (2008) Prevalence and spread of 33. Agabou A, Pantel A, Ouchenane Z, Lezzar N, Khemissi S, extended-spectrum beta-lactamase-producing Satta D, Sotto A, Lavigne JP (2014) First description of OXA- Enterobacteriaceae in Europe. Clin Microbiol Infect 14 Suppl 48-producing Escherichia coli and the pandemic clone ST131 1: 144-153. from patients hospitalised at a military hospital in Algeria. Eur 20. Baba Ahmed-Kazi TZ, Arlet G (2014) News of antibiotic J Clin Microbiol Infect Dis 33: 1641-1646. resistance among Gram-negative bacilli in Algeria. Pathol Biol 34. Girlich D, Bouihat N, Poirel L, Benouda A, Nordmann P 62: 169-178. (2014) High rate of faecal carriage of extended-spectrum beta- 21. Ben AN, Mercuri PS, Ben MM, Galleni M, Belhadj O (2009) lactamase and OXA-48 carbapenemase-producing Characterization of a novel extended-spectrum TEM-type Enterobacteriaceae at a university hospital in Morocco. Clin beta-lactamase, TEM-164, in a clinical strain of Klebsiella Microbiol Infect 20: 350-354. pneumoniae in Tunisia. Microb Drug Resist 15: 195-199. 35. Khalaf NG, Eletreby MM, Hanson ND (2009) Characterization 22. Chouchani C, Ben AN, M'Charek A, Belhadj O (2007) First of CTX-M ESβLs in Enterobacter cloacae, Escherichia coli characterization in Tunisia of a TEM-15, extended-spectrum and Klebsiella pneumoniae clinical isolates from Cairo, Egypt. beta-lactamase-producing Klebsiella pneumoniae isolate. BMC Infect Dis 9: 84. Microb Drug Resist 13: 114-118. 36. Ktari S, Mnif B, Louati F, Rekik S, Mezghani S, Mahjoubi F, 23. Lahlaoui H, Anis BH, Mohamed K, Mohamed BM (2012)Hammami A (2011) Spread of Klebsiella pneumoniae isolates Emergence of SHV-12 extended spectrum beta-lactamase producing OXA-48 beta-lactamase in a Tunisian university among clinical isolates Enterobacter of cloacae in Tunisia. hospital. J Antimicrob Chemother 66: 1644-1646. Microb Pathog 53: 64-65. 37. Charfi K, Mansour W, Ben Haj KA, Mastouri M, Aouni M, 24. Abbassi MS, Torres C, Achour W, Vinue L, Saenz Y, Costa D, Mammeri H (2015) Emergence of OXA-204 beta-lactamase in Bouchami O, Ben HA (2008) Genetic characterisation of CTX- Tunisia. Diagn Microbiol Infect Dis 82: 314-317. M-15-producing Klebsiella pneumoniae and Escherichia coli 38. Kocsis E, Savio C, Piccoli M, Cornaglia G, Mazzariol A (2013) strains isolated from stem cell transplant patients in Tunisia. Int Klebsiella pneumoniae harbouring OXA-48 carbapenemase in J Antimicrob Agents 32: 308-314. a Libyan refugee in Italy. Clin Microbiol Infect 19: E409-E411. 25. Ben-Hamouda T, Foulon T, Ben-Mahrez K (2004) 39. Aschbacher R, Giani T, Corda D, Conte V, Arena F, Pasquetto Involvement of SHV-12 and SHV-2a encoding plasmids in V, Scalzo K, Nicoletti M, Rossolini GM, Pagani E (2013) outbreaks of extended-spectrum beta-lactamase-producing Carbapenemase-producing Enterobacteriaceae during 2011- Klebsiella pneumoniae in a Tunisian neonatal ward. Microb 12 in the Bolzano area (northern Italy): increasing diversity in Drug Resist 10: 132-138. a low-endemicity setting. Diagn Microbiol Infect Dis 77: 354- 26. Dahmen S, Bettaieb D, Mansour W, Boujaafar N, Bouallegue 356. O, Arlet G (2010) Characterization and molecular 40. Giani T, Conte V, Di Pilato V, Aschbacher R, Weber C, epidemiology of extended-spectrum beta-lactamases in clinical Larcher C, Rossolini GM (2012) Escherichia coli from Italy isolates of Enterobacteriaceae in a Tunisian university producing OXA-48 carbapenemase encoded by a novel hospital. Microb Drug Resist 16: 163-170. Tn1999 transposon derivative. Antimicrob Agents Chemother 27. Dahmen S, Poirel L, Mansour W, Bouallegue O, Nordmann P 56: 2211-2213. (2010) Prevalence of plasmid-mediated quinolone resistance 41. Pirs M, Andlovic A, Cerar T, Zohar-Cretnik T, Kobola L, determinants in Enterobacteriaceae from Tunisia. Clin Kolman J, Frelih T, Presern-Strukelj M, Ruzic-Sabljic ,E Seme Microbiol Infect 16: 1019-1023. K (2011) A case of OXA-48 carbapenemase-producing 28. Ferjani S, Saidani M, Ennigrou S, Hsairi M, Slim AF, Ben Klebsiella pneumoniae in a patient transferred to Slovenia from Boubaker IB (2014) Multidrug resistance and high virulence Libya, November 2011. Euro Surveill 16: 20042. genotype in uropathogenicEscherichia coli due to diffusion of 42. Hammerum AM, Larsen AR, Hansen F, Justesen US, Friis- ST131 clonal group producing CTX-M-15: an emerging Moller A, Lemming LE, Fuursted K, Littauer P, Schonning K, problem in a Tunisian hospital. Folia Microbiol 59: 257-262. Gahrn-Hansen B, Ellermann-Eriksen S, Kristensen B (2012) 29. Hammami S, Saidani M, Ferjeni S, Aissa I, Slim A, Boutiba- Patients transferred from Libya to Denmark carried OXA-48- Ben Boubaker I(2013) Characterization of extended spectrum producing Klebsiella pneumoniae, NDM-1-producing beta-lactamase-producing Escherichia coli in community- Acinetobacter Baumannii and meticillin-resistant acquired urinary tract infections in Tunisia. Microb Drug Staphylococcus Aureus. Int J Antimicrob Agents 40: 191-192. Resist 19: 231-236. 43. Abdelaziz MO, Bonura C, Aleo A, Fasciana T, Cala C, 30. Mamlouk K, Boutiba-Ben B, I, Gautier V, Vimont S, , Picard B Mammina C (2013) Cephalosporin resistant Escherichia Ben RS, Arlet G (2006) Emergence and outbreaks of CTX-M

726 Mathlouthi et al. –Carbapenemases and ESBLs in Tunisia and Libya J Infect Dev Ctries 2016; 10(7):718-727.

Colifrom cancer patients in Cairo, Egypt. Microbiol Immunol Enterobacteriaceaeto Israeli hospitals by medical tourism. J 57: 391-395. Antimicrob Chemother 66: 2763-2766. 44. Barguigua A, El Otmani F, Talmi M, Zerouali K, Timinouni M 48. Cuzon G, Naas T, Lesenne A, Benhamou M, Nordmann P (2012) Emergence of carbapenem-resistant (2010) Plasmid-mediated carbapenem-hydrolysing OXA-48 Enterobacteriaceae isolates in the Moroccan community. beta-lactamase in Klebsiella pneumoniae from Tunisia. Int J Diagn Microbiol Infect Dis 73: 290-291. Antimicrob Agents 36: 91-93. 45. Hays C, Benouda A, Poirel L, Elouennass M, Nordmann P (2012) Nosocomial occurrence of OXA-48-producing Corresponding author enterobacterial isolates in a Moroccan hospital. Int J Dr. Chedly CHOUCHANI Antimicrob Agents 39: 545-547. Université de Carthage, Institut Supérieur des Sciences et 46. Poirel L, Ros A, Carrer A, Fortineau N, Carricajo A, Berthelot Technologies de l’Environnement de Borj-Cedria, Technopôle de P, Nordmann P (2011) Cross-border transmission of OXA-48- Borj-Cedria, BP-1003, Hammam-Lif 2050, Tunisie producing Enterobacter Cloacae from Morocco to France. J Phone: +21694114443 Antimicrob Chemother 66: 1181-1182. Fax: +21679325333 47. Adler A, Shklyar M, Schwaber MJ, Navon-Venezia S, Dhaher Email: [email protected] Y, Edgar R, Solter E, Benenson S, Masarwa S, Carmeli Y (2011) Introduction of OXA-48-producing Conflict of interests: No conflict of interests is declared.

727 CHAPITRE III:

Etude du déterminisme génétique et de l’épidémiologie moléculaire de la résistance aux β-lactamines chez des souches d’Acinetobacter baumannii et de Pseudomonas aeruginosa isolées dans des hôpitaux tunisiens et libyens

AVANT PROPOS

Les bactéries à Gram négatif non fermentants, particulièrement Acinetobacter baumannii et Pseudomonas aeruginosa, posent actuellement un problème de multirésistance aux antibiotiques, notamment aux β-lactamines. Au sein de cette famille d’antibiotique, la résistance aux carbapénèmes est d’incidence croissante alors que ces molécules étaient considérées il y a encore peu de temps les plus actives pour le traitement des infections sévères causées par ces pathogènes opportunistes [1]. Face à cette situation, il est indispensable surtout dans les pays non développés, d’être capable d’identifier le plus rapidement possible les souches résistantes aux carbapénèmes afin d’adapter au mieux une thérapeutique efficace pour les patients infectés et de limiter la diffusion des BMR en milieu hospitalier, particulièrement dans les unités de soins intensifs.

Dans ce cadre, nous nous sommes intéressés, dans ce chapitre, à l’étude épidémiologique et moléculaire des supports et des déterminants génétiques responsables de la résistance aux carbapénèmes chez des souches d’A. baumannii et de P. aeruginosa isolées de patients hospitalisés dans des hôpitaux tunisiens et libyens. Ceci nous a ainsi conduits à étudier:

- D’une part une collection de 86 souches d’A. baumannii résistantes aux carbapénèmes (imipénème) qui a été isolée au niveau de 4 hôpitaux: trois hôpitaux libyens (24 du centre médical de Tripoli, 19 de l’hôpital des brûlures et de la chirurgie plastique à Tripoli et 18 du centre médical de Benghazi) et un hôpital tunisien (25 de l’institut orthopédique Mohamed Kassab à Tunis) et ce pendant trois années consécutives entre septembre 2013 et juin 2016. L’étude de la sensibilité aux antibiotiques des souches d’A. baumannii isolées en Tunisie et en Libye a révélé un phénotype de multirésistance aux antibiotiques et en particulier aux β-lactamines à l’exception de la colistine. Face à ces BMR, nous avons essayé de comprendre l’origine et les supports génétiques de cette multirésistance en caractérisant les mécanismes de la résistance aux carbapénèmes.

Après l’analyse moléculaire des déterminants de cette résistance, les résultats de notre étude ont montré la production d’enzymes carbapénèmases de deux types: les oxacillinases (OXA-23, OXA-24, OXA-58 et OXA-48) et les métallo-β-lactamases (NDM-1). Il faut signaler que les OXA-23 ont été retrouvées chez les souches tunisiennes et libyennes, l’OXA-58 chez une souche tunisienne, et les OXA-24, une OXA-48 ainsi que les NDM-1 chez les souches libyennes.

64 La détection dans notre étude de l’OXA-23 chez des souches isolées de patients hospitalisés à l’institut orthopédique Mohamed Kassab à Tunis confirme la dissémination des OXA-23 en Tunisie. En Libye, concernant la résistance des A. baumannii aux carbapénèmes, aucune étude n’a été réalisée. Notre étude est donc la première qui rapporte des OXA-23 produites chez des souches d’A. baumannii isolées dans des hôpitaux libyens (21 du centre médical de Tripoli, 15 de l’hôpital des brûlures et de la chirurgie plastique de Tripoli et 12 du centre médical de Benghazi). La découverte du gène blaOXA-23 pour la première fois dans cette région du monde confirme l’émergence et la diffusion rapide au niveau mondial de ce gène responsable d’une véritable situation pandémique qui est de plus en plus inquiétante [2].

On tient également à signaler que notre investigation moléculaire des carbapénèmases révèle une forte prévalence du gène blaOXA-23. En effet, 78.6% (48/61) des souches d’A. baumannii isolées en Libye et 100% (25/25) de celles isolées en Tunisie produisent des OXA-23. En outre, nos résultats ont montré que cette enzyme « OXA-23» a été détectée non seulement chez les souches tunisiennes mais aussi libyennes. Ces résultats suggèrent que ces souches partagent probablement le même pool génétique, ceci pourrait être expliqué par un échange de souches par le biais des voyages. La proximité géographique de ces deux pays voisins facilite en effet le déplacement

65 des voyageurs ainsi que le transfert des patients surtout lors de la guerre actuelle en Libye.

En outre, nous avons également détecté l’enzyme «OXA-58» chez une souche d’A. baumannii collectée à l’institut orthopédique Mohamed Kassab à Tunis. Cette souche a été isolée d’un patient hospitalisé dans le service de réanimation et co-exprime une OXA-23.

La co-expression chez une seule souche des deux gènes blaOXA-23 et blaOXA-58 n'a jamais été signalée en Tunisie, bien qu'elle ait été rapportée en Algérie [3], en Chine et en Thaïlande [4]. Dans cette étude nous présentons donc la première description en Tunisie des OXA-23 et OXA-58 exprimées chez une même souche d’A. baumannii résistante à l’imipénème.

En Libye, en plus des OXA-23 trouvées, nous avons détecté, pour la première fois aussi, l’enzyme de type OXA-24 chez trois souches d’A. baumannii isolées de patients hospitalisés à l’unité des soins intensifs du centre médical de Benghazi. Au sein de ce même service, nous avons également signalé la co-occurrence des enzymes OXA-23 et une OXA-48 chez une souche d’A. baumannii. Récemment, Goncalves et al. ont rapporté la première détection d’OXA-48 produite chez A. baumannii au niveau de la flore fécale des résidents dans un foyer de soins au nord du Portugal [5]. Nos résultats corroborent les travaux de Goncalves et al, ainsi notre étude restitue la deuxième

66 description d’OXA-48 produite chez des souches d’A. baumannii dans le monde.

En plus des enzymes de types oxacillinases, une enzyme de type métallo-β-lactamase (NDM-1) a été détectée chez nos souches collectées en Libye. Dans notre étude, l’enzyme NDM-1 a été détectée chez 8 souches d’A. baumannii isolées en Libye: 4 au centre médical de Tripoli et 4 à l’hôpital des brûlures et de la chirurgie plastique à Tripoli. En Tunisie et en Libye, aucune NDM n’a été décrite chez des souches autochtones d’A. baumannii. Notre étude est donc la première qui rapporte des NDM-1 produites chez des souches d’A. baumannii isolées dans des hôpitaux libyens [6]. En outre, il faut signaler qu’en Libye, au sein du même hôpital (l’hôpital des brûlures et de la chirurgie plastique à Tripoli), la première carbapénèmase détectée chez les souches d’A. baumannii lors de notre première étude réalisée en Avril 2014, était l’OXA-23 [7]. Un an plus tard, l’enzyme NDM-1 a été trouvée au sein de ce même hôpital. Ces résultats reflètent la détérioration de la situation hygiénique au sein des hôpitaux libyens (la guerre actuelle empire la situation) et révèlent aussi une évolution au niveau de l'épidémiologie des infections nosocomiales chez A. baumannii non seulement en Libye mais aussi en Afrique du nord [8].

Le génotypage de nos souches a été déterminé par la méthode MLST. En Tunisie, une seule étude antérieure a rapporté qu’une souche

67 d’A. baumannii isolée à l’étranger à partir d’un patient tunisien appartenait au clone de séquence type ST85 [9]. Dans notre étude, d'autres clones non signalés auparavant en Tunisie ont été détectés pour la première fois comme ST1, ST2, ST164, ST310, ST570, ST602, ST623 et ST636. Ces résultats confirment la diversité clonale des souches d’A. baumannii isolées au niveau des hôpitaux tunisiens. En outre, le ST majoritaire dans notre étude est le ST2. Ce ST a été rapporté dans plusieurs pays de la région méditerranéenne [10].

En Libye, nos travaux sont les premiers qui ont étudié le typage moléculaire par MLST chez des isolats d’A. baumannii. Notre première étude, réalisée en 2014 dans deux hôpitaux (l’hôpital des brûlures et de la chirurgie plastique à Tripoli et le centre médical à Benghazi) a révélé la présence de plusieurs clones décrits pour la première fois en Libye (ST1, ST2, ST81) et dans le monde (ST588, ST589, ST590, ST591, ST592, ST593, ST594, ST595, ST596, ST597, ST598, ST599, ST600 et ST601) [7]. Les clones ST1 et ST2 sont majoritaires dans notre étude et correspondent aux clones les plus répandus chez A. baumannii en méditerranée selon plusieurs études [10].

Notre seconde étude, réalisée en 2015 dans deux hôpitaux (l’hôpital des brûlures et de la chirurgie plastique et le centre médical) à Tripoli a aussi révélé de multiples STs à savoir le ST1, ST2, ST20, ST85, ST164, ST588, ST589 et ST602. Le ST majoritaire correspond

68 toujours au ST2 (16/36; 44.4%). Ce clone circulait dans les deux hôpitaux et a été associé à la co-production des enzymes OXA-23 et NDM-1 [6]. Il s’agit probablement d’une petite épidémie causée par ce clone dans l'unité de soins intensifs. En effet, en général le caractère monoclonal d’une souche évoquerait plutôt une épidémie de souches alors que le caractère polyclonal serait en faveur d’une diffusion de plasmides ou d’autres éléments génétique mobiles [11].

- D’autre part une collection de 24 P. aeruginosa a été isolée de deux hôpitaux libyens (14 de l’hôpital des brûlures et de la chirurgie plastique à Tripoli et 10 du centre médical de Benghazi). Parmi ces souches, 66.7% ont été isolées du service de traumatisme (il s’agit de blessés brûlés lors de la guerre en Libye) et 33.3% du service de soins intensifs.

L’étude de la sensibilité aux antibiotiques a révélé que 87.5% de nos souches sont résistantes à l’imipénème. Cette résistance élevée vis- à-vis de cet antibiotique, souvent considéré comme le dernier recours pour les infections nosocomiales à P. aeruginosa, prouve que nos souches sont des bactéries multi-résistantes (BMR) qui constituent, ainsi, un problème majeur de santé publique. Face à cette situation, il nous est donc paru essentiel de rechercher les supports génétiques et le type de la résistance chez ces BMR. L’investigation moléculaire de la résistance aux carbapénèmes a permis la détection dans 19 des

21 souches étudiées d’une métallo-β-lactamase de type VIM-2. Notre étude est donc la première qui rapporte l’enzyme «VIM-2» chez des souches de P. aeruginosa isolées en Libye.

En rapportant cette nouvelle description de VIM-2 dans ce pays, nos résultats mettent l'accent sur la diffusion moniale de cette MBL. La propagation de VIM-2 représente en effet un risque épidémiologique universel vu que les gènes blaVIM-2 sont habituellement portés par des éléments génétiques mobiles tels que les plasmides, les intégrons et les transposons ce qui rend leur dissémination très rapide. En outre, les résultats de l’amplification, du séquençage et de l’analyse du gène oprD ont montré que toutes nos P. aeruginosa résistantes à l'imipénème présentent des mutations au niveau de leurs séquences du gène oprD codant pour la porine OprD et ce en comparaison avec les séquences d’une souche de référence PAO1. Ceci a conduit à plusieurs "codon stop" prématurés au niveau de la séquence protéique traduite engendrant la perte de cette porine, ce qui a conféré la résistance à l’imipénème [12]. Ceci pourrait expliquer la résistance à l’imipénème observée chez les souches VIM-2 négatives (2 des 19 souches). En effet le principal mécanisme par lequel P. aeruginosa acquiert une résistance aux carbapénèmes est la réduction de la perméabilité par perte de la porine OprD, voie préférentielle de la pénétration de ces antibiotiques [13]. Nos résultats confirment donc que contrairement à A. baumannii, chez qui la production de carbapénèmases est le mécanisme de

70 résistance aux carbapénèmes le plus répandu [14], chez P. aeruginosa, la résistance aux carbapénèmes est majoritairement due à des associations de mécanismes de résistance, associant fréquemment la production de β-lactamases (dans notre étude la VIM-2) à un déficit ou une altération des porines (dans notre étude la porine D2) [15]. La présente étude est la première en Libye qui rapporte donc une co- occurence de la production de la VIM-2 avec l’altération de la porine OprD et ce au niveau des mêmes souches de P. aeruginosa. Nos résultats sont en accord avec d’autres travaux qui ont confirmé les mêmes conclusions pour des souches de P. aeruginosa isolées dans des hôpitaux algériens et libanais [16, 17].

Finalement, le typage génomique multilocus (MLST) [18] a été réalisé pour toutes nos 21 souches de P. aeruginosa résistantes à l’imipénème et a révélé que celles-ci appartiennent à 13 différents types de ST, dont 8 types de ST déjà connus (ST227, ST235, ST593, ST660, ST662, ST699, ST911 et ST1582) et 5 nouvelles séquence type (ST1924, ST1925, ST1926, ST1927 et ST1928). Le ST majoritaire dans notre étude est le ST911 suivi du ST235. Des études antérieures ont également rapporté ces ST chez P. aeruginosa dans des pays du bassin méditerranéen [19, 20]. La construction de l’arbre phylogénétique nous a permis de discerner une petite épidémie causée par les souches cliniques de P. aeruginosa ayant la séquence type 911, et ce au niveau de l’unité de soins intensifs du centre médical à

Benghazi en Libye. Par ailleurs, selon les résultats obtenus, les multiples clones déterminés par l’analyse MLST sont dotés d’une stabilité illustrée par une analogie entre la séquence du gène OprD et le clone considéré et ce au niveau des mêmes souches de P. aeruginosa. On a pu donc démontrer que les mutations au niveau du gène oprD peuvent être utilisées comme un outil pour étudier la clonalité chez P. aeruginosa.

Reference List

1. Kempf M, Bakour S, Flaudrops C, Berrazeg M, Brunel JM, Drissi M, et al. Rapid detection of carbapenem resistance in Acinetobacter baumannii using matrix-assisted laser desorption ionization-time of flight mass spectrometry. PLoS One 2012; 7(2):e31676. 2. Kempf M, Rolain JM. Emergence of resistance to carbapenems in Acinetobacter baumannii in Europe: clinical impact and therapeutic options. Int J Antimicrob Agents 2012; 39(2):105-114. 3. Ramoul A, Loucif L, Bakour S, Amiri S, Dekhil M, Rolain JM. Co-occurrence of blaNDM-1 with blaOXA-23 or blaOXA-58 in clinical multidrug-resistant Acinetobacter baumannii isolates in Algeria. J Glob Antimicrob Resist 2016; 6:136-141. 4. Mendes RE, Bell JM, Turnidge JD, Castanheira M, Jones RN. Emergence and widespread dissemination of OXA-23, -24/40 and -58 carbapenemases among Acinetobacter spp. in Asia- Pacific nations: report from the SENTRY Surveillance Program. J Antimicrob Chemother 2009; 63(1):55-59. 5. Evans BA, Amyes SG. OXA beta-lactamases. Clin Microbiol Rev 2014; 27(2):241-263. 6. Mathlouthi N, El Salabi AA, Ben Jomaa-Jemili M, Bakour S, Al-Bayssari C, Zorgani AA, et al. Early detection of metallo- beta-lactamase NDM-1- and OXA-23 carbapenemase- producing Acinetobacter baumannii in Libyan hospitals. Int J Antimicrob Agents 2016; 48(1):46-50. 7. Mathlouthi N, Areig Z, Al BC, Bakour S, Ali El SA, Ben GS, et al. Emergence of Carbapenem-Resistant Pseudomonas

aeruginosa and Acinetobacter baumannii Clinical Isolates Collected from Some Libyan Hospitals. Microb Drug Resist 2015; 21(3):335-341. 8. Bakour S, Touati A, Bachiri T, Sahli F, Tiouit D, Naim M, et al. First report of 16S rRNA methylase ArmA-producing Acinetobacter baumannii and rapid spread of metallo-beta- lactamase NDM-1 in Algerian hospitals. J Infect Chemother 2014; 20(11):696-701. 9. Bonnin RA, Cuzon G, Poirel L, Nordmann P. Multidrug- resistant Acinetobacter baumannii clone, France. Emerg Infect Dis 2013; 19(5):822-823. 10. Bartual SG, Seifert H, Hippler C, Luzon MA, Wisplinghoff H, Rodriguez-Valera F. Development of a multilocus sequence typing scheme for characterization of clinical isolates of Acinetobacter baumannii. J Clin Microbiol 2005; 43(9):4382- 4390. 11. Cornaglia G, Rossolini GM. The emerging threat of acquired carbapenemases in Gram-negative bacteria. Clin Microbiol Infect 2010; 16(2):99-101. 12. Ocampo-Sosa AA, Cabot G, Rodriguez C, Roman E, Tubau F, Macia MD, et al. Alterations of OprD in carbapenem- intermediate and -susceptible strains of Pseudomonas aeruginosa isolated from patients with bacteremia in a Spanish multicenter study. Antimicrob Agents Chemother 2012; 56(4):1703-1713. 13. Strateva T, Yordanov D. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol 2009; 58(Pt 9):1133-1148. 14. Poirel L, Nordmann P. Carbapenem resistance in Acinetobacter baumannii: mechanisms and epidemiology. Clin Microbiol Infect 2006; 12(9):826-836.

15. Rodriguez-Martinez JM, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2009; 53(11):4783-4788. 16. Al BC, Diene SM, Loucif L, Gupta SK, Dabboussi F, Mallat H, et al. Emergence of VIM-2 and IMP-15 carbapenemases and inactivation of oprD gene in carbapenem-resistant Pseudomonas aeruginosa clinical isolates from Lebanon. Antimicrob Agents Chemother 2014; 58(8):4966-4970. 17. Sefraoui I, Berrazeg M, Drissi M, Rolain JM. Molecular epidemiology of carbapenem-resistant Pseudomonas aeruginosa clinical strains isolated from western Algeria between 2009 and 2012. Microb Drug Resist 2014; 20(2):156- 161. 18. Curran B, Jonas D, Grundmann H, Pitt T, Dowson CG. Development of a multilocus sequence typing scheme for the opportunistic pathogen Pseudomonas aeruginosa. J Clin Microbiol 2004; 42(12):5644-5649. 19. Gomila M, Del Carmen GM, Fernandez-Baca V, Pareja A, Pascual M, Diaz-Antolin P, et al. Genetic diversity of clinical Pseudomonas aeruginosa isolates in a public hospital in Spain. BMC Microbiol 2013; 13:138. 20. Ranellou K, Kadlec K, Poulou A, Voulgari E, Vrioni G, Schwarz S, et al. Detection of Pseudomonas aeruginosa isolates of the international clonal complex 11 carrying the blaPER-1 extended-spectrum beta-lactamase gene in Greece. J Antimicrob Chemother 2012; 67(2):357-361.

Article 3:

Emergence of Carbapenem-Resistant Pseudomonas aeruginosa and Acinetobacter baumannii Clinical Isolates Collected from Some Libyan Hospitals

Najla Mathlouthi, Zaynab Areig, Charbel Al Bayssari, Sofiane Bakour, Allaaeddin Ali El Salabi, Salha Ben Gwierif, Abdulaziz A. Zorgani, Karim Ben Slama, Chedly Chouchani and Jean-Marc Rolain*

Published in Microbial Drug Resistance (MDR) Impact factor: 2.6

MICROBIAL DRUG RESISTANCE Volume 21, Number 3, 2015 ª Mary Ann Liebert, Inc. DOI: 10.1089/mdr.2014.0235

Emergence of Carbapenem-Resistant Pseudomonas aeruginosa and Acinetobacter baumannii Clinical Isolates Collected from Some Libyan Hospitals

Najla Mathlouthi,1,2 Zaynab Areig,3,4 Charbel Al Bayssari,1 Soﬁane Bakour,1 Allaaeddin Ali El Salabi,3,5 Salha Ben Gwierif,4,6 Abdulaziz A. Zorgani,7 Karim Ben Slama,2 Chedly Chouchani,2,8 and Jean-Marc Rolain1

The aim of the present study was to investigate the molecular mechanism of carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates recovered from Libyan hospitals between April 2013 and April 2014. In total, 49 strains (24 P. aeruginosa and 25 A. baumannii) were isolated, including 21 P. aeruginosa and 22 A. baumannii isolates (87.75%) resistant to imipenem (minimum inhibitory concentrations ‡ 16 mg/ml). The blaVIM-2 gene was detected in 19 P. aeruginosa isolates. All imipenem- resistant P. aeruginosa isolates showed the presence of OprD mutations. Acquired OXA-carbapenemase- encoding genes were present in all A. baumannii isolates: blaOXA-23 (n = 19) and blaOXA-24 (n = 3). Finally, a total of 13 and 17 different sequence types were assigned to the 21 P. aeruginosa and the 22 A. baumannii carbapenem-resistant isolates, respectively. This study is the first report describing imipenem-resistant P. aeruginosa and A. baumannii isolated from patients in Libya. We report the first case of co-occurrence of blaVIM-2 with oprD porin loss in identical isolates of P. aeruginosa in Libya and demonstrate that these oprD mutations can be used as a tool to study the clonality in P. aeruginosa isolates. We also report the first identification of multidrug-resistant A. baumannii isolates harboring blaOXA-23-like, blaOXA-24-like, and blaOXA-48-like genes in Libya.

Introduction several multidrug efflux systems,27 and (4) the presence of transferable resistance determinants, in particular, carbapenem- he increase and spread of multidrug-resistant (MDR) hydrolyzing enzymes (mainly metallo-b-lactamases [MBLs])19 Tgram-negative bacteria have become major concerns and also aminoglycoside-hydrolyzing enzymes. worldwide. Pseudomonas aeruginosa and Acinetobacter bau- The main porin for uptake of carbapenems in P. aeruginosa mannii are among the most common pathogens causing noso- is the outer membrane protein OprD. Inactivating mutations comial infections.12 The ability to develop multidrug resistance in the oprD gene is the most common molecular mechanism makes these infections difficult to treat, and they are associated known to confer resistance to carbapenems.15 Carbapenem with high mortality rates ranging from 18% to 61%.29 Indeed, resistance can also arise from MBL production, but this P. aeruginosa is characterized by an innate resistance to mul- mechanism is a less commonly found mechanism than the tiple classes of antimicrobials. mutation-driven resistance mechanisms.6 The most common The broad-spectrum resistance of P. aeruginosa is mainly MBLs found in P. aeruginosa include VIM, IMP, GIM, FIM- due to a combination of different factors: (1) low outer 1, and SPM. In particular, blaVIM-2 has emerged as a dominant membrane permeability,23 (2) the presence of the inducible MBL variant in North Africa8 and worldwide.9 The VIM AmpC chromosomal b-lactamase,24 (3) synergistic action of types have been identified in carbapenem-resistant isolates of

1Unite´ de recherche sur les maladies infectieuses et tropicales e´mergentes (URMITE), UM 63, CNRS 7278, IRD 198, INSERM 1095, IHU Me´diterraneé Infection, Faculte´ de Me´decine et de Pharmacie, Aix-Marseille-Universite´, Marseille, France. 2Laboratoire des Microorganismes et Biomolećules Actives, Faculte´ des Sciences de Tunis, Campus Universitaire, Universite´ de Tunis El-Manar, El-Manar, Tunisie. 3Infection Control Office, Benghazi Medical Centre, Benghazi, Libya. 4Department of Microbiology, The Libyan Academy, Benghazi, Libya. 5Department of Environmental Health, Faculty of Public Health, University of Benghazi, Benghazi, Libya. 6Department of Botany, University of Benghazi, Benghazi, Libya. 7Department of Medical Microbiology and Immunology, Faculty of Medicine, University of Tripoli, Libya. 8Universite´ de Carthage, Institut Supe´rieur des Sciences et Technologies de l’Environnement de Borj-Cedria, Hammam-Lif, Tunisie.

335 336 MATHLOUTHI ET AL.

P. aeruginosa from African countries (Tunisia, Algeria, and Merieux). The results were interpreted according to the CA- Egypt)7,36,37,39 and from countries in the Mediterranean basin SFM breakpoints. (Italy, France, Lebanon, Spain, and Greece).1,10,26,34 MDR A. baumannii are also associated with a wide spectrum of in- Phenotypic detection of carbapenemases fectious diseases, ranging from nosocomial and community- Isolates were screened for carbapenemase production using acquired infections to those acquired in natural disasters or the modified Hodge test (MHT), the modified Carba NP test wars.33 The most important mechanism of carbapenem re- (MCNP), and the EDTA test, as previously described.13,14,22,38 sistance in A. baumannii is the enzymatic hydrolysis mediated by carbapenem-hydrolyzing b-lactamases, belonging to class Molecular detection of carbapenemases D(blaOXA-23-like, blaOXA-24-like, blaOXA-51-like, blaOXA-58- 3 like, blaOXA-104, blaOXA-143, blaOXA-164,andblaOXA-182). For P. aeruginosa strains, carbapenemase-encoding genes Carbapenemase-producing A. baumannii strains are in- were detected using specific primers for blaIMP, blaVIM, blaKPC, creasingly reported in Europe, South America, Asia, and blaNDM. Concerning A. baumannii strains, carbapenemase- Oceania, and Africa.11,30 encoding genes were detected using specific primers for In Libya, to the best of our knowledge, there are few reports blaOXA-23, blaOXA-24, blaOXA-48, blaOXA-58,andblaNDM. of resistance to carbapenems in clinical isolates. As very little Sequence analyses were performed using Big DyeÒ ter- information is known regarding the antibiotic resistance in minator chemistry on an automated ABI 3730 Sequencer nonfermenting gram-negative bacteria in addition to the des- (PE Applied Biosystems). All sequences obtained were perate need for insight into antibiotic resistance in Libyan analyzed using BlastN and BlastP to search the NCBI da- hospitals, this study was undertaken to investigate the molec- tabase (www.ncbi.nlm.nih.gov/blast).36 ular mechanism of resistance to carbapenems in P. aeruginosa and A. baumannii clinical isolates resistant to imipenem. Few PCR amplification and sequencing of oprD 16,17 reports described carbapenem resistance in nonfermenters. PCR amplification of oprD was performed on imipenem- The occurrence of a novel MBL (blaTMB-1) was reported resistant P. aeruginosa strains using specific primers. PCR from Achromobacter xylosoxidans isolated from Tripoli products were fully sequenced as described above, and the Central Hospital, Tripoli, Libya, reflecting the lack of hos- 16 resulting sequences were compared to the PAO1 reference pital hygiene. This study will hopefully provide useful strain sequence (GenBank accession number CAA7844).36 insight into the problem of antibiotic resistance to provide a therapeutic alternative when clinicians are facing such Molecular strain typing MDR bacteria. The epidemiological relatedness of P. aeruginosa and A. baumannii was studied by multilocus sequence typing 3,36 Materials and Methods (MLST) as described. Isolates were attributed to a sequence-type (ST) number according to the allelic profiles Bacterial isolates available in the Institute Pasteur’s MLST website (www A total of 49 nonreplicate clinical isolates were collected .pasteur.fr/mlst). over 12 months between April 2013 and April 2014 from Results two hospitals (Burn and plastic Surgery Hospital [BPSH] and Benghazi Medical Center [BMC]) in two different cities A total of 24 P. aeruginosa and 25 A. baumannii were in Libya (Tripoli and Benghazi). These strains were isolated identified by the MALDI-TOF MS. These strains were isolated from different pathological specimens, primarily wounds, from different pathological specimens, including wounds recovered from hospitalized patients in various hospital (47.8%), tracheal suctioning (25.1%), and urinary tracts departments, generally intensive care units and burns units. (15.9%), and recovered from hospitalized patients in various These patients were civilians severely burned in war in hospital units, including intensive care (44.9%), trauma Libya. The isolates were identified using biochemical tests, (20.4%), surgery (14.4%), cardiology (7.8%), pediatrics Phoenix, and confirmed by matrix-assisted laser desorption (7%), and internal medicine (5.5%). The results of antibiotic and ionization time-of-flight mass spectrometry (MALDI- susceptibility testing revealed that the isolates were resistant TOF MS). Among this collection, 24 P. aeruginosa and 25 to almost all antibiotics, including b-lactams, aminoglyco- A. baumannii were identified. sides, and fluoroquinolones. All isolates were sensitive to colistin (Fig. 1). All imipenem-resistant A. baumannii and 19 imipenem-resistant P. aeruginosa were positive using the Antibiotic susceptibility testing MHT and MCNP, suggesting carbapenemase production Antibiotic susceptibility was determined on Mueller–Hinton (Tables 1 and 2). In addition, the activity of b-lactamase agar using a standard disk diffusion procedure, as described by was inhibited by the EDTA solution in 19 P. aeruginosa, the Antibiogram Committee of the French Society for Micro- showing the production of MBL (Table 1). The majority of biology (CA-SFM) (www.sfm-microbiologie.org/). Fifteen an- these strains were isolated from wounds of patients hospi- tibiotics were tested, including ticarcillin, ticarcillin–clavulanic talized at burn units from BPSH in Tripoli. These patients acid, piperacillin, piperacillin–tazobactam, ceftazidime, cefo- were civilians severely burned during the revolution, in taxime, cefepime, aztreonam, amikacin, tobramycin, genta- Libya, in 2013. micin, ciprofloxacin, meropenem, imipenem, and colistin Acquired OXA-carbapenemase-encoding genes were (Bio-Rad). For all isolates, minimum inhibitory concentrations present in all A. baumannii isolates, including blaOXA-23 Ò of imipenem were determined using an Etest strip (AB Bio- (n = 19) and blaOXA-24 (n = 3). Among these strains, one CARBAPENEM RESISTANCE IN P. AERUGINOSA AND A. BAUMANNII 337

FIG. 1. Antibiotic susceptibility of Pseudomonas aeruginosa and Acinetobacter baumannii clinical strains.

Table 1. Phenotypic and Genotypic Features of the 21 Imipenem-Resistant Pseudomonas aeruginosa Clinical Isolates

Date of OprD isolation Type IMP MIC Hodge EDTA Carba mutational Isolate Location (mo-yr) Ward of swabs (lg/ml) test test test VIM-2 groups ST Z22 Benghazi 11-2013 ICU Tracheal > 32 ++++ G1 911 Z27 Benghazi 11-2013 ICU Tracheal > 32 ++++ G1 911 Z26 Benghazi 11-2013 ICU Tracheal > 32 ++++ G1 911 Z29 Benghazi 11-2013 ICU Tracheal > 32 ++++ G1 911 Z24 Benghazi 11-2013 ICU Tracheal > 32 ++++ G1 911 451 Tripoli 4-2013 Burn Wound > 32 ++++ G2 227 761 Tripoli 4-2013 Burn Wound > 32 ---- G2 227 Z10 Tripoli 4-2013 Burn Wound > 32 ++++ G2 227 139 Tripoli 4-2013 Burn Wound > 32 ++++ G3 235 401 Tripoli 4-2013 Burn Wound > 32 ++++ G3 235 101 Tripoli 4-2013 Burn Wound > 32 ++++ G4 1584 222 Tripoli 4-2013 Burn Wound > 32 ++++ G4 1584 759 Tripoli 4-2013 Burn Wound > 32 ++++ G5 699 605 Tripoli 4-2013 Burn Wound > 32 ---- G6 539 151 Tripoli 4-2013 Burn Wound > 32 ++++ G7 622 224 Tripoli 4-2013 Burn Wound > 32 ++++ G8 660 52 Tripoli 4-2013 Burn Wound > 32 ++++ G9 1924 762 Tripoli 4-2013 Burn Wound > 32 ++++ G10 1925 Z9 Benghazi 11-2013 ICU Tracheal > 32 ++++ G11 1926 Z30 Benghazi 11-2013 ICU Tracheal > 32 ++++ G12 1927 760 Tripoli 4-2013 Burn Wound > 32 ++++ G13 1928

ICU, intensive care unit; IMP, imipenem; mo, month; yr, year; ST, sequence type; MICs, minimum inhibitory concentrations; G1, deletion of G in nucleotide position 326 leading to a premature stop codon TGA in oprD resulting in a truncated polypeptide of 110 amino acid residues; G2, several mutation types leading to the premature stop codon TAA in oprD resulting in a truncated polypeptide of 219 amino acid residues; G3, insertion of G in nucleotide positions 19 and 36 leading to the premature stop codon TAG in oprD resulting in a truncated polypeptide of 17 amino acid residues; G4, several mutation types leading to the premature stop codon TGA in oprD resulting in a truncated polypeptide of 239 amino acid residues; G5, several mutation types leading to the premature stop codon TGA in oprD resulting in a truncated polypeptide of 349 amino acid residues; G6, insertion of C in nucleotide position 185 leading to the premature stop codon TGA in oprD resulting in a truncated polypeptide of 74 amino acid residues; G7, G to A substitution in nucleotide position 622 leading to the premature stop codon TAA in oprD resulting in a truncated polypeptide of 222 amino acid residues; G8, G to C substitution in nucleotide position 952 leading to the premature stop codon TGA in oprD resulting in a truncated polypeptide of 318 amino acid residues; G9, several mutation types leading to the premature stop codon TAA in oprD resulting in a truncated polypeptide of 220 amino acid residues; G10, insertion of C in nucleotide position 129 leading to the premature stop codon TGA in oprD resulting in a truncated polypeptide of 55 amino acid residues; G11, insertion of C in nucleotide position 1318 leading to the premature stop codon TAA in oprD resulting in a truncated polypeptide of 451 amino acid residues; G12, several mutation types leading to the premature stop codon TGA in oprD resulting in a truncated polypeptide of 438 amino acid residues; G13, C to T substitution in nucleotide position 355 leading to the premature stop codon TGA in oprD resulting in a truncated polypeptide of 119 amino acid residues. 338 MATHLOUTHI ET AL.

Table 2. Phenotypic and Genotypic Features of the 22 Imipenem-Resistant A. baumannii Clinical Isolates

Date of Type IMP MIC Hodge EDTA Carba Carbapenemase Isolate Location isolation (mo-yr) Ward of swabs (lg/ml) test test test genes ST 466 Tripoli 4-2013 Burn Wound > 32 +-+OXA-23 588 631 Tripoli 4-2013 Burn Wound > 32 +-+OXA-23 1 410 Tripoli 4-2013 Burn Wound > 32 +-+OXA-23 589 60 Tripoli 4-2013 Burn Wound > 32 +-+OXA-23 590 436 Tripoli 4-2013 Burn Wound > 32 +-+OXA-23 591 459 Tripoli 4-2013 Burn Wound > 32 +-+OXA-23 588 363 Tripoli 4-2013 Burn Wound > 32 +-+OXA-23 1 Z1 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 2 Z47 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 1 Z64 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-24 592 Z74 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 593 Z6 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 594 Z40 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23, OXA-48 595 Z45 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 596 Z46 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-24 2 Z14 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-24 2 Z39 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 81 Z68 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 597 78 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 598 79 Benghazi 11-2013 ICU Tracheal > 32 +-+OXA-23 599 121 Benghazi 11-2013 ICU Tracheal > 16 +-+OXA-23 600 7588 Benghazi 11-2013 ICU Tracheal > 16 +-+OXA-23 601

isolate coexpressed the blaOXA-23 and the blaOXA-48 genes positive P. aeruginosa isolates (Table 1). Because of various (Table 2). This strain was isolated from intensive care mutations, all carbapenem-resistant P. aeruginosa isolates units in BMC in Benghazi. None of the strains contained the had a modiﬁcation in the amino-acid sequence of the OprD blaNDM, blaIMP, blaVIM,orblaKPC gene. PCR followed by protein based on comparison to the sequence of the PAO1 sequence analysis revealed a blaVIM-2 gene in all MBL- reference strain. Indeed, all the isolates had modiﬁcations of

FIG. 2. Phylogenetic tree of the 21 imipenem-resistant P. aeruginosa clinical isolates based on the multilocus sequence typing (MLST) concatenated gene sequences of each isolate aligned with the PAO1 strain. CARBAPENEM RESISTANCE IN P. AERUGINOSA AND A. BAUMANNII 339

FIG. 3. Phylogenetic tree of the 22 imipenem-resistant A. baumannii clinical isolates based on the MLST concatenated gene sequences of each isolate aligned with reference strains SDF and AYE.

their oprD gene sequence with a stop codon. Based on the report of coexpressing VIM-2 and OprD porin loss in identical mutations in the oprD gene sequences, carbapenem-resistant clinical isolates of P. aeruginosa in Libya. P. aeruginosa isolates could be classified into 13 oprD These results indicated that the mutational inactivation of mutational groups (Table 1). A total of 13 and 17 different the oprD gene was the main mechanism for imipenem re- STs were assigned to the investigated 21 P. aeruginosa and sistance in P. aeruginosa clinical isolates, as previously 22 A. baumannii imipenem-resistant strains, respectively described in many studies.1,36 Members of an identical clone (Figs. 2 and 3). maintained an identical sequence of the oprD gene, illus- trating the stability of these clonal complexes, as previously demonstrated by Sefraoui et al.36 In our study, MLST Discussion analysis revealed that the presence of multiple clones, with In this study, we investigated the molecular mechanism of clones belonging to ST911 and to ST235 being the most resistance to carbapenems in P. aeruginosa and A. baumannii frequent. Other MLST analysis studies reported ST235 in clinical isolates recovered from Tripoli and Benghazi hospitals Mediterranean countries.35 The results of this work are in Libya. All MBL-positive P. aeruginosa produced blaVIM-2. consistent with the studies of Nho et al., who reported the These data confirm previous studies performed in the Medi- dissemination of genetically unrelated isolates of P. aeru- 28 terranean basin, which concluded that the main MBL pro- ginosa carrying blaVIM-2 in Korea. duced by P. aeruginosa is VIM-2. Indeed, Sefraoui et al. A PubMed search did not identify any published report detected the blaVIM-2 gene in two strains of P. aeruginosa describing the occurrence or spread of blaOXA-23- and 36 isolated from three hospitals in western Algeria in 2013. blaOXA-24-producing A. baumannii in Libya. In this study, Recently, Al Bayssari et al. reported the emergence of VIM-2 we report for the first time the presence of imipenem- in a series of clinical isolates of carbapenem-resistant resistant A. baumannii producing these oxacillinases in Libya. P. aeruginosa in Lebanon.1 Additionally, in Tunisia, Hammami Several studies have shown the dissemination of carbapenem- et al. demonstrated the incidence of the MBL VIM-2 as a resistant A. baumannii isolates in different geographic re- gene cassette in class 1 integron in P. aeruginosa collected gions, including the neighboring countries of Libya, such as from different wards at Charles Nicolle hospital of Tunis.20 Tunisia and Egypt. In Tunisia, Mansour et al. reported the In addition, data obtained in a previous study conducted in dissemination of the blaOXA-23 gene in 99 clinical strains of Egypt, a neighboring country of Libya, showed that the A. baumannii.25 In Egypt, Al-Agamy et al. reported that the 39 blaVIM-2 gene was the most prevalent gene in P. aeruginosa. A. baumannii carrying blaOXA-23- and blaOXA-24-like genes These findings may reflect the current spread of MBLs in were found to be the most prevalent type of b-lactamase- clinically relevant gram-negative strains throughout northern encoding genes in A. baumannii.2 In North Africa, the re- Africa and also show that the Libyan isolates share the same sistance rate of A. baumannii to imipenem was found to be genetic pool with bacterial species worldwide. In the absence 47.9% in Algeria,4 45% in Tunisia,25 and 75% in Egypt.2 In of MBL, mutational inactivation of the oprD gene is the major this study, the most prevalent CHDL-encoding gene in determinant of resistance to carbapenem, particularly to imi- A. baumannii was blaOXA-23, with a prevalence rate of penem, in P. aeruginosa strains.31 The present study is the first 86.36% (n = 19), which is in agreement with previous 340 MATHLOUTHI ET AL. studies.11,21,32 In this study, we also detected the co-occur- terization of clinical isolates of Acinetobacter baumannii.J. rence of blaOXA-23 and blaOXA-48 in one A. baumannii iso- Clin. Microbiol. 43:4382–4390. late. Recently Evans et al., reported that Gonçalves et al. 6. Cabot, G., A.A. Ocampo-Sosa, F. Tubau, M.D. Macia, C. described the first detection of OXA-48-like-producing A. Rodriguez, B. Moya, L. Zamorano, C. Suarez, C. Pena, L. baumannii in the fecal flora of nursing home residents in Martinez-Martinez, and A. Oliver. 2011. Overexpression Northern Portugal.18 This report coincided with our study; thus, of AmpC and efflux pumps in Pseudomonas aeruginosa this is the second description of OXA-48-producing A. bau- isolates from bloodstream infections: prevalence and impact mannii. OXA-48 and its variants are widespread in Klebsiella on resistance in a Spanish multicenter study. Antimicrob. pneumoniae and other Enterobacteriaceae and have now been Agents Chemother. 55:1906–1911. reported in A. baumannii as well, and they represent one of the 7. Chouchani, C., R. Marrakchi, and A. El Salabi. 2011. Evolution of beta-lactams resistance in Gram-negative most concerning developments in carbapenem resistance in the bacteria in Tunisia. Crit. Rev. Microbiol. 37:167–177. last decade.18 Finally, MLST analysis for A. baumannii isolates 8. Chouchani, C., R. Marrakchi, L. Ferchichi, A. El Salabi, revealed also the presence of multiple clones in our study. The and T.R. Walsh. 2011. VIM and IMP metallo-beta- clones belonging to ST1 and ST2 were the most frequent and lactamases and other extended-spectrum beta-lactamases in correspond to the most prevalent Mediterranean A. baumannii 5 Escherichia coli and Klebsiella pneumoniae from environ- clone according to a study conducted in Spanish hospitals. mental samples in a Tunisian hospital. APMIS 119:725–732. In conclusion, this study described the first detection of 9. Cornaglia, G., H. Giamarellou, and G.M. Rossolini. VIM-2- and OXA-23/OXA-24/OXA-48-producing P. aer- 2011. Metallo-beta-lactamases: a last frontier for beta-lac- uginosa and A. baumannii in Libya. These findings are of tams? Lancet Infect. Dis. 11:381–393. great concern because the rapid dissemination of carbapenem- 10. Corvec, S., L. Poirel, J.W. Decousser, P.Y. Allouch, resistant strains represents a major therapeutic and epide- H. Drugeon, and P. Nordmann. 2006. Emergence of miological threat and requires the implementation of strict carbapenem-hydrolysing metallo-beta-lactamase VIM-1 in hygiene procedures and regular surveillance studies, espe- Pseudomonas aeruginosa isolates in France. Clin. Micro- cially in Libyan hospitals, where the adherence to interna- biol. Infect. 12:941–942. tionally accepted infection control policies is not optimal. 11. Diene, S.M., B. Fall, M. Kempf, F. Fenollar, K. Sow, B. Niang, B. Wade, D. Raoult, and J.M. Rolain. 2013. Acknowledgments Emergence of the OXA-23 carbapenemase-encoding gene in multidrug-resistant Acinetobacter baumannii clinical The authors thank Linda Hadjadj for technical assistance. isolates from the Principal Hospital of Dakar, Senegal. Int. This work was partly funded by CNRS and IHU Me´di- J. Infect. Dis. 17:209–210. terraneé Infection. This work was supported by the Ministry 12. Diene, S.M., and J.M. Rolain. 2014. Carbapenemase of Higher Education, Scientific Research and Information genes and genetic platforms in Gram-negative bacilli: En- and Communication Technologies of Tunisia offering a terobacteriaceae, Pseudomonas and Acinetobacter species. Scholarship to Miss. Najla Mathlouthi in Aix-Marseille- Clin. Microbiol. Infect. 20:831–838. University, France. 13. Dortet, L., L. Poirel, C. Errera, and P. Nordmann. 2014. CarbAcineto NP test for rapid detection of carbapenemase- Disclosure Statement producing Acinetobacter spp. J. Clin. Microbiol. 52:2359– 2364. No competing financial interests exist. 14. Dortet, L., L. Poirel, and P. Nordmann. 2012. Rapid identification of carbapenemase types in Enterobacteriaceae References and Pseudomonas spp. by using a biochemical test. Anti- 1. Al Bayssari, C., S.M. Diene, L. Loucif, S.K. Gupta, F. microb. Agents Chemother. 56:6437–6440. Dabboussi, H. Mallat, M. Hamze, and J.M. Rolain. 15. El, A.N., C.G. Giske, S. Jalal, B. Keijser, G. Kronvall, 2014. Emergence of VIM-2 and IMP-15 carbapenemases and B. Wretlind. 2005. Carbapenem resistance mecha- and inactivation of oprD gene in carbapenem-resistant nisms in Pseudomonas aeruginosa: alterations of porin Pseudomonas aeruginosa clinical isolates from lebanon. OprD and efflux proteins do not fully explain resistance Antimicrob. Agents Chemother. 58:4966–4970. patterns observed in clinical isolates. APMIS 113:187–196. 2. Al-Agamy, M.H., N.G. Khalaf, M.M. Tawfick, A.M. 16. El, S.A., P.S. Borra, M.A. Toleman, O. Samuelsen, and Shibl, and A. El Kholy. 2014. Molecular characterization T.R. Walsh. 2012. Genetic and biochemical characteriza- of carbapenem-insensitive Acinetobacter baumannii in tion of a novel metallo-beta-lactamase, TMB-1, from an Egypt. Int. J. Infect. Dis. 22:49–54. Achromobacter xylosoxidans strain isolated in Tripoli, Li- 3. Bakour, S., S.A. Alsharapy, A. Touati, and J.M. Rolain. bya. Antimicrob. Agents Chemother. 56:2241–2245. 2014. Characterization of Acinetobacter baumannii clinical 17. Ellabib, M.S., M. Aboshkiwa, N. Almargani, A. Zorgani, isolates carrying bla carbapenemase and 16S rRNA meth- A. El Salabi, and M. El-Gumati. 2013. Detection of ylase armA genes in Yemen. Microb. Drug Resist. 20:604– metallo-b-lactamase in Pseudomonas aeruginosa from 609. Tripoli, Libya. J. Biomed. Sci. 2:1–6. 4. Bakour, S., M. Kempf, A. Touati, A.A. Ait, D. Haou- 18. Evans, B.A., and S.G. Amyes. 2014. OXA beta-lacta- chine, F. Sahli, and J.M. Rolain. 2012. Carbapenemase- mases. Clin. Microbiol. Rev. 27:241–263. producing Acinetobacter baumannii in two university 19. Gutierrez, O., C. Juan, E. Cercenado, F. Navarro, E. hospitals in Algeria. J. Med. Microbiol. 61:1341–1343. Bouza, P. Coll, J.L. Perez, and A. Oliver. 2007. Mole- 5. Bartual, S.G., H. Seifert, C. Hippler, M.A. Luzon, H. cular epidemiology and mechanisms of carbapenem resis- Wisplinghoff, and F. Rodriguez-Valera. 2005. Develop- tance in Pseudomonas aeruginosa isolates from Spanish ment of a multilocus sequence typing scheme for charac- hospitals. Antimicrob. Agents Chemother. 51:4329–4335. CARBAPENEM RESISTANCE IN P. AERUGINOSA AND A. BAUMANNII 341

20. Hammami, S., V. Gautier, R. Ghozzi, C.A. Da, S. Ben- and M. Kempf. 2014. First report of blaNDM-1-producing Redjeb, and G. Arlet. 2010. Diversity in VIM-2-encoding Acinetobacter baumannii isolated in Lebanon from civil- class 1 integrons and occasional blaSHV2a carriage in ians wounded during the Syrian war. Int. J. Infect. Dis. isolates of a persistent, multidrug-resistant Pseudomonas 21:21–23. aeruginosa clone from Tunis. Clin. Microbiol. Infect. 16: 34. Rojo-Bezares, B., V. Estepa, R. Cebollada, T.M. de, S. 189–193. Somalo, C. Seral, F.J. Castillo, C. Torres, and Y. Saenz. 21. Kempf, M., and J.M. Rolain. 2012. Emergence of resis- 2014. Carbapenem-resistant Pseudomonas aeruginosa tance to carbapenems in Acinetobacter baumannii in Europe: strains from a Spanish hospital: characterization of metallo- clinical impact and therapeutic options. Int. J. Antimicrob. beta-lactamases, porin OprD and integrons. Int. J. Med. Agents 39:105–114. Microbiol. 304:405–414. 22. Lee, K., C.K. Kim, D. Yong, S.H. Jeong, J.H. Yum, Y.H. 35. Sanbongi, Y., A. Shimizu, T. Suzuki, H. Nagaso, T. Ida, Seo, J.D. Docquier, and Y. Chong. 2010. Improved per- K. Maebashi, and N. Gotoh. 2009. Classification of OprD formance of the modified Hodge test with MacConkey agar sequence and correlation with antimicrobial activity of for screening carbapenemase-producing Gram-negative carbapenem agents in Pseudomonas aeruginosa clinical bacilli. J. Microbiol. Methods 83:149–152. isolates collected in Japan. Microbiol. Immunol. 53:361– 23. Lister, P.D., D.J. Wolter, and N.D. Hanson. 2009. Anti- 367. bacterial-resistant Pseudomonas aeruginosa: clinical im- 36. Sefraoui, I., M. Berrazeg, M. Drissi, and J.M. Rolain. pact and complex regulation of chromosomally encoded 2014. Molecular epidemiology of carbapenem-resistant resistance mechanisms. Clin. Microbiol. Rev. 22:582–610. Pseudomonas aeruginosa clinical strains isolated from 24. Livermore, D.M. 2002. Multiple mechanisms of antimi- western Algeria between 2009 and 2012. Microb. Drug crobial resistance in Pseudomonas aeruginosa: our worst Resist. 20:156–161. nightmare? Clin. Infect. Dis. 34:634–640. 37. Touati, M., S.M. Diene, M. Dekhil, A. Djahoudi, A. 25. Mansour, W., L. Poirel, D. Bettaieb, O. Bouallegue, N. Racherache, and J.M. Rolain. 2013. Dissemination of a Boujaafar, and P. Nordmann. 2008. Dissemination of class I integron carrying VIM-2 carbapenemase in Pseu- OXA-23-producing and carbapenem-resistant Acineto- domonas aeruginosa clinical isolates from a hospital in- bacter baumannii in a University Hospital in Tunisia. Mi- tensive care unit in Annaba, Algeria. Antimicrob. Agents crob. Drug Resist. 14:289–292. Chemother. 57:2426–2427. 26. Mavroidi, A., A. Tsakris, E. Tzelepi, S. Pournaras, V. 38. Yong, D., K. Lee, J.H. Yum, H.B. Shin, G.M. Rossolini, Loukova, and L.S. Tzouvelekis. 2000. Carbapenem- and Y. Chong. 2002. Imipenem-EDTA disk method for hydrolysing VIM-2 metallo-beta-lactamase in Pseudomonas differentiation of metallo-beta-lactamase-producing clini- aeruginosa from Greece. J. Antimicrob. Chemother. 46: cal isolates of Pseudomonas spp. and Acinetobacter spp. J. 1041–1042. Clin. Microbiol. 40:3798–3801. 27. Nehme, D., X.Z. Li, R. Elliot, and K. Poole. 2004. As- 39. Zafer, M.M., M.H. Al-Agamy, H.A. El-Mahallawy, M.A. sembly of the MexAB-OprM multidrug efflux system of Amin, and M.S. Ashour. 2014. Antimicrobial resistance pat- Pseudomonas aeruginosa: identification and characteriza- tern and their beta-lactamase encoding genes among Pseudo- tion of mutations in mexA compromising MexA multi- monas aeruginosa strains isolated from cancer patients. merization and interaction with MexB. J. Bacteriol. 186: Biomed. Res. Int. doi: 10.1155/2014/101635. 2973–2983. 28. Nho, S.O., J.S. Jin, J.W. Kim, J.Y. Oh, J. Kim, Y.C. Lee, Address correspondence to: S.Y. Seol, D.T. Cho, and J.C. Lee. 2008. Dissemination of Chedly Chouchani, PhD the blaIMP-1 and blaVIM-2 metallo-beta-lactamase genes Laboratoire des Microorganismes et Biomolećules Actives among genetically unrelated Pseudomonas aeruginosa iso- Faculte´ des Sciences de Tunis lates in a South Korean hospital. Int. J. Antimicrob. Agents Campus Universitaire 31:586–588. Universite´ de Tunis El-Manar 29. Nordmann, P., and L. Poirel. 2014. The difficult-to-control El-Manar 2098 spread of carbapenemase producers in Enterobacteriaceae Tunisie worldwide. Clin. Microbiol. Infect. 20:821–830. 30. Nordmann, P., and L. Poirel. 2014. Emerging and im- E-mail: [email protected] portant antibiotic resistance in Gram negative bacteria: epidemiology, theory and practice. Rev. Med. Suisse 10: Jean-Marc Rolain, PhD 902–907. Unite´ de recherche sur les maladies infectieuses 31. Pirnay, J.P., V.D. De, D. Mossialos, A. Vanderkelen, P. et tropicales e´mergentes (URMITE) Cornelis, and M. Zizi. 2002. Analysis of the Pseudomonas UM 63, CNRS 7278, IRD 198, INSERM 1095 aeruginosa oprD gene from clinical and environmental IHU Me´diterraneé Infection isolates. Environ. Microbiol. 4:872–882. Faculte´ de Me´decine et de Pharmacie 32. Poirel, L., and P. Nordmann. 2006. Carbapenem resis- Aix-Marseille-Universite´ tance in Acinetobacter baumannii: mechanisms and epi- Marseille 13005 demiology. Clin. Microbiol. Infect. 12:826–836. France 33. Rafei, R., F. Dabboussi, M. Hamze, M. Eveillard, C. Lemarie, H. Mallat, J.M. Rolain, M.L. Joly-Guillou, E-mail: [email protected]

Article 4:

Early detection of metallo--lactamase NDM-1 and OXA-23 carbapenemase-producing Acinetobacter baumannii in Libyan hospitals

Najla Mathlouthi, Allaaeddin El Salabi, Meriem Ben Jomaa-Jemili, Sofiane Bakour, Charbel Al-Bayssari, Abdulaziz A. Zorgani, Abdulmajeed Kraiemag,Omar Elahmerh, Liliane Okdaha, Jean-Marc Rolain and Chedly Chouchani*

Published in International Journal of Antimicrobial Agents (IJAA) Impact factor: 4.3

International Journal of Antimicrobial Agents 48 (2016) 46–50

Contents lists available at ScienceDirect

International Journal of Antimicrobial Agents

journal homepage: www.elsevier.com/locate/ijantimicag

Early detection of metallo-β-lactamase NDM-1- and OXA-23 carbapenemase-producing Acinetobacter baumannii in Libyan hospitals Najla Mathlouthi a,b, Allaaeddin Ali El Salabi c,d, Mariem Ben Jomàa-Jemili e, Soﬁane Bakour a, Charbel Al-Bayssari a, Abdulaziz A. Zorgani f, Abdulmajeed Kraiema g, Omar Elahmer h, Liliane Okdah a, Jean-Marc Rolain a,*, Chedly Chouchani b,i,** a Unité de recherche sur les maladies infectieuses et tropicales émergentes (URMITE), UM 63, CNRS 7278, IRD 198, INSERM 1095, IHU Méditerranée Infection, Faculté de Médecine et de Pharmacie, Aix-Marseille Université, Marseille, France b Laboratoire des Microorganismes et Biomolécules Actives, Faculté des Sciences de Tunis, Campus Universitaire, Université de Tunis El Manar, 2098 El Manar II, Tunis, Tunisia c Department of Environmental Health, Faculty of Public Health, University of Benghazi, Benghazi, Libya d Infection Control Oﬃce, Benghazi Medical Centre, Benghazi, Libya e Laboratoire de recherche Résistance aux antimicrobiens, Faculty of Medicine of Tunis, Université de Tunis El Manar, Tunis, Tunisia f Department of Medical Microbiology, Faculty of Medicine, Tripoli University, Tripoli, Libya g Postgraduate Academy, Tripoli, Libya h National Libyan Center for Infectious Disease Prevention and Control, Tripoli, Libya i Institut Supérieur des Sciences et Technologies de l’Environnement de Borj-Cedria, Technopôle de Borj-Cedria, Université de Carthage, BP-1003, Hammam-Lif, Tunis 2050, Tunisia

ARTICLE INFO ABSTRACT

Article history: Acinetobacter baumannii is an opportunistic pathogen causing various nosocomial infections. The aim of Received 21 January 2016 this study was to characterise the molecular support of carbapenem-resistant A. baumannii clinical iso- Accepted 23 March 2016 lates recovered from two Libyan hospitals. Bacterial isolates were identified by matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF/MS). Antibiotic susceptibility testing Keywords: was performed using disk diffusion and Etest methods, and carbapenem resistance determinants were Carbapenemase studied by PCR amplification and sequencing. Multilocus sequence typing (MLST) was performed for typing NDM-1 of the isolates. All 36 imipenem-resistant isolates tested were identified as A. baumannii. The bla OXA-23 OXA-23 Acinetobacter baumannii gene was detected in 29 strains (80.6%). The metallo-β-lactamase blaNDM-1 gene was detected in eight iso- Libya lates (22.2%), showing dissemination of multidrug-resistant (MDR) A. baumannii in Tripoli Medical Center and Burn and Plastic Surgery Hospital in Libya, including one isolate that co-expressed the blaOXA-23 gene. MLST revealed several sequence types (STs). Imipenem-resistant A. baumannii ST2 was the predominant clone (16/36; 44.4%). This study shows that NDM-1 and OXA-23 contribute to antibiotic resistance in Libyan hospitals and represents the first incidence of the association of these two carbapenemases in an autochthonous MDR A. baumannii isolated from patients in Libya, indicating that there is a longstanding infection control problem in these hospitals. © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

1. Introduction * Corresponding author. Unité de recherche sur les maladies infectieuses et tropicales émergentes (URMITE), UM 63, CNRS 7278, IRD 198, INSERM 1095, IHU Méditerranée Infection, Faculté de Médecine et de Pharmacie, Aix-Marseille Acinetobacter baumannii is an opportunistic pathogen that is being Université, Marseille, France. Tel.: +33491324375;fax:+33491387772. increasingly reported as the cause of nosocomial infections [1–4]. E-mail address: [email protected] (J.-M. Rolain). It is associated with a wide range of clinical complications, such as ** Corresponding author. Institut Supérieur des Sciences et Technologies de pneumonia, septicaemia, urinary tract infection, wound infection l’Environnement de Borj-Cedria, Technopôle de Borj-Cedria, Université de Carthage, and meningitis, particularly in immunocompromised patients [5]. BP-1003, Hammam-Lif, Tunis 2050, Tunisia. Tel.: +216 94 11 44 43; fax: +216 79 32 53 33. Carbapenems have been the mainstay of treatment for Acinetobacter E-mail address: [email protected] (C. Chouchani). infections for the past decade, but the emergence of carbapenem http://dx.doi.org/10.1016/j.ijantimicag.2016.03.007 0924-8579/© 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved. N. Mathlouthi et al. / International Journal of Antimicrobial Agents 48 (2016) 46–50 47 resistance is increasingly being documented worldwide in A. 2.4. Detection of antibiotic resistance genes baumannii isolates leading to limited therapeutic options [1]. Several mechanisms are responsible for resistance of A. baumannii to Real-time PCR and conventional PCR were performed to screen carbapenems, including reduced outer membrane permeability, for the presence of blaOXA-51, blaOXA-58, blaOXA-23, blaOXA-24, blaNDM-1, blaIMP, penicillin-binding protein alterations and, mostly, the production blaVIM, blaSIM and blaGIM genes. of carbapenemases [6]. Three types of enzymes capable of hydrolysing carbapenems have been reported in A. baumannii, belonging 2.5. DNA sequencing to class A (blaGES-14 and blaKPC), class B (blaIMP, blaVIM, blaSIM-1 and blaNDM) Positive PCR products were sequenced using BigDye® Termina- and class D (blaOXA-23-like, blaOXA-24-like, blaOXA-51-like, blaOXA-58-like, blaOXA-104, tor chemistry on an ABI 3730 Automated Sequencer (Applied blaOXA-143, blaOXA-164 and blaOXA-182) [6]. Outbreaks of carbapenem- resistant A. baumannii strains have been documented in diverse Biosystems, Foster City, CA). The sequences obtained were analysed geographical areas including Europe, South America and Asia [6–11], using BlastN and BlastP against the National Center for Biotechnol- but little information is available from North Africa [12–14].InLibya, ogy Information (NCBI) database (http://www.ncbi.nlm.nih.gov) and using ARG-ANNOT (Antibiotic Resistance Gene-ANNOTation) dissemination of carbapenemases, such as the blaOXA-23-like and (http://en.mediterranee-infection.com/article.php?laref=283&titre blaOXA-24-like genes, among A. baumannii isolates has been reported = in a previous study in 2015 [15]. Unlike oxacillinase genes, the arg-annot-). New Delhi metallo-β-lactamase 1 (NDM-1), one of the most re- 2.6. Molecular epidemiology cently discovered metallo-β-lactamases (MBLs) among various Gram- negative species including A. baumannii, has never been reported Sequence types (STs) and the clonal relatedness of the isolates in Libya. were determined by multilocus sequence typing (MLST) using the The aim of this study was to investigate the prevalence and to internal fragments of seven housekeeping genes (cpn60, fusA, gltA, identify the molecular mechanism of carbapenem resistance in clin- pyrG, recA, rplB and rpoB) according to the schemes available at ical imipenem-resistant A. baumannii strains collected in two Libyan Institut Pasteur’s MLST website (http://www.pasteur.fr/mlst). hospitals located in the capital, Tripoli. Here we present the first report documenting the detection of multidrug-resistant (MDR) A. 3. Results baumannii producing NDM-1 MBL and OXA-23 carbapenemase in autochthonous Libyan strains. All 36 isolates (24 from TMC and 12 from the BPSH) were identified as A. baumannii both by Phoenix and MALDI-TOF/MS (score 2. Materials and methods values >2.3 for all strains). Among these strains, 8 (22.2%) were isolated from the burn intensive care unit (BICU), followed by 6 (16.7%) 2.1. Bacterial isolates from the medical intensive care unit (MICU). The majority of A. baumannii isolates were recovered from wounds (15/36; 41.6%). The A total of 36 non-duplicate imipenem-resistant A. baumannii iso- results of antibiotic susceptibility testing demonstrated high-level lated in two Libyan hospitals [24 from Tripoli Medical Center (TMC) resistance to all antibiotics tested (>72%) except minocycline, and 12 from the Burn and Plastic Surgery Hospital (BPSH) in Tripoli] tigecycline and colistin (Table 1). All isolates showed high MICs for isolated between January 2015 and May 2015 were identified using imipenem (>32 μg/mL) and were positive in the modified Hodge test, a BD PhoenixTM System (BD Diagnostics, Franklin Lakes, NJ) and a suggesting carbapenemase production. Moreover, β-lactamase ac- matrix-assisted laser desorption/ionisation time-of-flight mass spec- tivity was inhibited by EDTA in seven A. baumannii (three strains trometry (MALDI-TOF/MS) method (Microflex; Bruker Daltonics, from TMC and four strains from BPSH), indicating the probable pro- Bremen, Germany) and were confirmed using PCR amplification and duction of class B MBL. sequencing of the intrinsic blaOXA-51-like gene.

Table 1 2.2. Antimicrobial susceptibility testing Antimicrobial resistance of carbapenem-resistant Acinetobacter baumannii isolated from two hospitals in Libya.

Antibiotic susceptibility was determined on Mueller–Hinton agar Antimicrobial agent % resistant (Oxoid Ltd., Basingstoke, UK) using the standard disk diffusion test TMC BPSH Total as described by the Antibiogram Committee of the French Society (n = 24) (n = 12) (n = 36) for Microbiology (CA-SFM) (http://www.sfm-microbiologie.org/). Ticarcillin 100 100 100 Twenty antibiotics were tested, including ticarcillin, ticarcillin/ Ticarcillin/clavulanic acid 100 100 100 clavulanic acid, piperacillin/tazobactam, ceftazidime, cefotaxime, Piperacillin/tazobactam 100 100 100 cefepime, aztreonam, sulbactam, amikacin, tobramycin, gentami- Ceftazidime 100 100 100 cin, ciprofloxacin, rifampicin, trimethoprim/sulfamethoxazole, Cefotaxime 83 66 77 ertapenem, meropenem, imipenem, minocycline, tigecycline and co- Cefepime 100 100 100 Aztreonam 79.1 58.3 72.2 listin (Bio-Rad, Marnes-la-Coquette, France). The minimum inhibitory Sulbactam 95.8 100 97.2 concentration (MIC) of imipenem was determined using the Amikacin 87.5 83.3 86.1 Etest method (AB BIODISK, Askim, Sweden). The results of antibi- Rifampicin 58.5 91.6 77.7 otic sensitivity testing were interpreted according to the CA-SFM Trimethoprim/sulfamethoxazole 83.3 91.6 86.1 Tobramycin 100 100 100 breakpoints. Gentamicin 100 100 100 Ciprofloxacin 100 100 100 2.3. Carbapenemase assays Ertapenem 100 100 100 Meropenem 100 100 100 Imipenem 100 100 100 Imipenem-resistant isolates were screened for carbapenemase Minocycline 0 0 0 production using the modified Hodge test, the modified Carba NP Tigecycline 0 0 0 test and the ethylene diamine tetra-acetic acid (EDTA) test as de- Colistin 0 0 0 scribed previously [16–18]. TMC, Tripoli Medical Center (Tripoli); BPSH, Burn and Plastic Surgery Hospital (Tripoli). 48 N. Mathlouthi et al. / International Journal of Antimicrobial Agents 48 (2016) 46–50

Table 2 Phenotypic and genotypic features of 36 clinical imipenem-resistant Acinetobacter baumannii strains from Libyan producing carbapenemases.

Isolate Hospital Sex Age Ward Sample IMP MIC Carbapenemase(s) ST (years) (μg/mL)

47 TMC M 30 MICU Wound >32 NDM-1/OXA-23 85 140 TMC F NA SCBU UVC >32 OXA-23 164 137 TMC M 37 MICU Blood >32 OXA-23 164 45 TMC F NA NICU Catheter >32 OXA-23 164 68 TMC M 70 GSICU Mouth >32 OXA-23 2 85 TMC F NA F.onco Septum >32 OXA-23 164 55 TMC F 60 Rheumatology Urine >32 OXA-23 164 69 TMC M 85 MICU Wound >32 OXA-23 2 242 TMC M 67 MICU Septum >32 OXA-23 602 247 TMC F 28 OPD Wound >32 OXA-23 602 151 TMC M 24 GSICU GT tube >32 OXA-23 2 147 TMC M 55 MICU Septum >32 OXA-23 2 141 TMC F 40 GSICU FC tip >32 OXA-23 1 56 TMC F 22 MICU Urine >32 OXA-23 2 184 TMC M NA MOW Wound >32 NDM-1 2 209 TMC M 21 MOW Swab >32 NDM-1 2 183 TMC M NA MOW Wound >32 NDM-1 2 236 TMC F 4 PICU CSF >32 OXA-23 589 162 TMC F 71 GSICU ET tip >32 OXA-23 2 197 TMC F NA SCBU Chest tube >32 OXA-23 2 164 TMC F NA NICU CSF >32 OXA-23 20 198 TMC M 42 MOW Swab >32 OXA-23 2 204 TMC F 70 GSICU Swab >32 OXA-23 588 168 TMC M 4 NSW Wound >32 OXA-23 588 48 BPSH M 20 MPS Wound >32 NDM-1 85 54 BPSH M 37 OPD Wound >32 OXA-23 588 243 BPSH M 23 BICU Wound >32 OXA-23 2 64 BPSH M 19 BICU Wound >32 OXA-23 1 219 BPSH M 23 BICU Blood >32 NDM-1 2 216 BPSH M 23 BICU Urine >32 NDM-1 2 238 BPSH F 46 OPD Wound >32 NDM-1 2 222 BPSH M 25 BICU Wound >32 OXA-23 602 182 BPSH M 17 BICU Wound >32 OXA-23 1 220 BPSH M 23 BICU Wound >32 OXA-23 1 77 BPSH F 6 BICU Wound >32 OXA-23 164 178 BPSH F 39 OPD Throat >32 OXA-23 2

IMP, imipenem; MIC, minimum inhibitory concentration; ST, sequence type; TMC, Tripoli Medical Center; BPSH, Burn and Plastic Surgery Hospital; NA, not available; MICU, medical intensive care unit; SCBU, special care baby unit; NICU, neonatal intensive care unit; GSICU, general surgical intensive care unit; F.onco, female oncology ward; OPD, outpatient department; MOW, male orthopaedic ward; PICU, paediatric intensive care Unit; NSW, neurology surgical ward; MPS, male plastic surgery; BICU, burn intensive care unit; UVC, umbilical vein catheter; GT, gastric tube; FC, Foley catheter; CSF, cerebrospinal ﬂuid; ET, endotracheal tube.

The acquired OXA carbapenemase blaOXA-23-like gene was de- [21,22]. Certainly, in Algeria several articles have described tected in 29 isolates (80.6%), including 21 strains from TMC and 8 carbapenem resistance in A. baumannii isolates in different loca- strains from BPSH. Eight isolates (22.2%) were positive for the MBL tions: blaOXA-23 and blaOXA-58 in Annaba [12]; blaOXA-24 and blaOXA-72 in blaNDM-1, including four from TMC and four from BPSH isolated Sétif [12]; blaOXA-23 in Tizi Ouzou [12]; blaOXA-23 and blaOXA-24 in Tlemcen between January 2015 and May 2015. All sequences of the blaNDM and Oran [13]; and blaOXA-23 in three hospitals in Algiers, Sétif and gene found in the eight strains were identiﬁed as blaNDM-1. Among Béjaïa [22]. In Tunisia, many studies have shown the dissemina- these strains, one isolate co-expressed the blaOXA-23 gene, which was tion of carbapenem-resistant A. baumannii in different cities: blaOXA-23 isolated in TMC from a 30-year-old male hospitalised in the MICU and blaOXA-97 in Sousse [23,24]; blaOXA-51, blaOXA-69 and blaOXA-23 in Tunis

(Table 2). None of the strains harboured blaOXA-24, blaOXA-58, blaIMP, [14]; and blaOXA-23 in central-eastern Tunisia [21]. In this study, the blaVIM, blaSIM or blaGIM genes. blaOXA-23 gene was found in 29 imipenem-resistant A. baumannii According to MLST analysis, several different STs were assigned strains (80.6%) recovered from two hospitals located in Tripoli. More- to the clinical A. baumannii isolates, including ST1, ST2, ST20, ST85, over, interestingly in this study we identiﬁed the presence of the

ST164, ST588, ST589 and ST602. The most common ST was ST2 (16/ blaNDM-1 gene in imipenem-resistant A. baumannii isolates. Only one 36; 44.4%) (Fig. 1). This clone was found circulating in the two study reported the occurrence of NDM-1 from a Libyan patient trans- hospitals (TMC and BPSH) and was associated with the produc- ferred to Denmark for treatment [25]. Here we reported for the ﬁrst tion of enzymes OXA-23 and NDM-1 (Fig. 1; Table 2). time the occurrence of autochthonous A. baumannii resistant to

imipenem by a combination of two carbapenemases genes (blaNDM-1

4. Discussion and blaOXA-23) in this country. Indeed, among the 36 imipenem- resistant A. baumannii strains, 8 (22.2%) were positive for the MBL Acinetobacter baumannii is an opportunistic pathogen and is the NDM-1: 4/24 (16.7%) from TMC (1 ST85 and 3 ST2) and 4/12 (33.3%) causative agent of nosocomial infections, mostly pneumonia [19]. from BPSH (1 ST85 and 3 ST2) (Table 2). These results show that

We recently reported the emergence of A. baumannii isolates that strains producing blaNDM-1 were isolated from several wards (MICU, were highly resistant to carbapenems worldwide, particularly in the male orthopaedic ward, male plastic surgery, BICU and outpatient Mediterranean basin [20]. Recently, the emergence and spread of department). The majority of strains producing NDM-1 (62.5%) were carbapenem resistance in A. baumannii in North Africa has been re- recovered from wounds of adult patients (Table 2). This situation ported, mostly owing to the production of OXA-like carbapenemases is especially serious because it reﬂects the emergence and spread N. Mathlouthi et al. / International Journal of Antimicrobial Agents 48 (2016) 46–50 49

Strain 198 ST 2:BlaOXA-23(TMC) Strain 178 ST 2:BlaOXA-23(BPSH) Strain 197 ST 2:BlaOXA-23(TMC) Strain 162 ST 2:BlaOXA-23(TMC) Strain 56 ST 2:BlaOXA-23(TMC) Strain 147 ST 2:BlaOXA-23(TMC) Strain 151 ST 2:BlaOXA-23(TMC)

95 Strain 243 ST 2:BlOXA-23(BPSH) Strain 69 ST 2:BlaOXA-23(TMC) Strain 68 ST 2:BlaOXA-23(TMC) Strain 238 ST 2:BlaNDM-1(BPSH) Strain 183 ST 2:BlaNDM-1(TMC) 94 Strain 184 ST 2:BlaNDM-1(TMC) Strain 219 ST 2:BlaNDM-1(BPSH) Strain 209 ST 2:BlaNDM-1(TMC) Strain 216 ST 2:BlaNDM-1(BPSH) Strain 54 ST 588:BlaOXA-23(BPSH) 65 Strain 204 ST 588:BlaOXA-23(TMC) 85 Strain 168 ST 588:BlaOXA-23(TMC) Strain 140 ST 164:BlaOXA-23(TMC) Strain 137 ST 164:BlaOXA-23(TMC)

57 Strain 45 ST 164:BlaOXA-23(TMC) 99 Strain 85 ST 164:BlaOXA-23(TMC) Strain 55 ST 164:BlaOXA-23(TMC) Strain 77 ST 164:BlaOXA-23(BPSH) Strain 242 ST 602:BlaOXA-23(TMC) Strain 247 ST 602:BlaOXA-23(TMC) 96 Strain 222 ST 602:BlaOXA-23(BPSH) Strain 48 ST 85:BlaNDM-1(BPSH) 94 Strain 47 ST 85:BlaOXA-23/BlaNDM-1(TMC) A.baumannii ST 17 SDF Strain 236 ST 589:BlaOXA-23(TMC) Strain 164 ST 20:BlaOXA-23(TMC) 90 A.baumannii ST 1 AYE 74 Strain 64 ST 1:BlaOXA-23(BPSH) Strain 141 ST 1:BlaOXA-23(TMC) 83 Strain 182 ST 1:BlaOXA-23(BPSH) Strain 220 ST 1:BlaOXA-23(BPSH)

Fig. 1. Phylogenetic tree of the 36 imipenem-resistant Acinetobacter baumannii clinical isolates from two different hospitals in Tripoli (Libya) based on the multilocus sequence typing (MLST) concatenated gene sequences of each isolate aligned with reference strains SDF and AYE. TMC, Tripoli Medical Center; BPSH, Burn and Plastic Surgery Hospital. of MBLs in North Africa. The first description of an NDM-1-producing carbapenem resistance in our previous publication in 2015 [15], A. baumannii isolate from Algerian patients was reported by reveals the worsening situation of antibiotic resistance in Libyan hos- Boulanger et al [26] and Bogaerts et al [27] in 2012. Moreover, Bonnin pitals, and moreover indicates that the epidemiology of nosocomial et al reported detection of the blaNDM-1 gene in A. baumannii linked pathogens in Libya needs more attention. Identification of several with North Africa. These strains were isolated from patients pre- clinical A. baumannii isolates that possessed the blaNDM-1 gene and viously hospitalised in North Africa after being transferred to different originating from North Africa, with no obvious link to the Indian towns in France: six strains from different cities in Algeria (includ- subcontinent, strongly suggests that the NDM-1-producing A. ing Algiers, Sétif, Constantine and Tlemcen), one from Tunisia and baumannii clone is probably widespread in North Africa and might one from Egypt [28]. In addition, there was a high prevalence rate act as a reservoir for blaNDM-1. of blaNDM-1 among A. baumannii clinical isolates, with 59/150 (39.3%) The most common ST in this study was ST2. This ST has been isolates being blaNDM-1-positive, recovered from patients admitted reported in several countries in the Mediterranean area. The results to some hospitals in Egypt [29]. of this work are consistent with the findings of Bakour et al in 2014, The first carbapenemase gene detected in A. baumannii was who also reported that imipenem-resistant A. baumannii belong- blaOXA-23 in April 2014 from BPSH in Tripoli. One year later, the blaNDM-1 ing to ST2 was the predominant clone among isolates recovered from gene was detected in this hospital. Detection of blaNDM-1, in com- some Algerian hospitals [22]. In addition, in 2015 El-Sayed-Ahmed parison with the detection of MBL and OXA genes responsible for et al found that the ST2 clonal group predominated (41.2%; 54/ 50 N. Mathlouthi et al. / International Journal of Antimicrobial Agents 48 (2016) 46–50

131) among other ST clonal groups in a large series of 150 A. [6] Kempf M, Rolain J-M. Emergence of resistance to carbapenems in Acinetobacter baumannii clinical isolates collected in Egypt [29]. This clone also baumannii in Europe: clinical impact and therapeutic options. Int J Antimicrob Agents 2012;39:105–14. corresponds to the most prevalent Mediterranean A. baumannii clone [7] Sevillano E, Fernandez E, Bustamante Z, Zabalaga S, Rosales I, Umaran A, et al. according to a study conducted in Spanish hospitals [30].Inthe Emergence and clonal dissemination of carbapenem-hydrolysing OXA-58- current study, in addition to the ST1, ST2, ST588 and ST589 clones producing Acinetobacter baumannii isolates in Bolivia. J Med Microbiol 2012;61:80–4. reported in our previous study [15], other clones not previously de- [8] Aljindan R, Bukharie H, Alomar A, Abdalhamid B. Prevalence of digestive tract tected in Libya were found, including ST20, ST85, ST164 and ST602 colonization of carbapenem-resistant Acinetobacter baumannii in hospitals in clones. These results confirm the clonal diversity of A. baumannii Saudi Arabia. J Med Microbiol 2015;64:400–6. [9] Hasan B, Perveen K, Olsen B, Zahra R. Emergence of carbapenem-resistant clinical isolates in Libya. Acinetobacter baumannii in hospitals in Pakistan. J Med Microbiol 2014;63:50–5. In addition, the description of the presence and emergence of [10] Nowak P, Paluchowska P-M, Budak A. Co-occurrence of carbapenem and aminoglycoside resistance genes among multidrug-resistant clinical isolates the blaNDM-1 gene in two hospitals in Tripoli suggests that the epi- of Acinetobacter baumannii from Cracow, Poland. Med Sci Monit Basic Res demiology may change as a result of the spread of this gene in other 2014;20:9–14. regions in Libya. Moreover, the ability of plasmid-mediated genes [11] Migliavacca R, Espinal P, Principe L, Drago M, Fugazza G, Roca I, et al. to move from A. baumannii to other Gram-negative bacteria, in par- Characterization of resistance mechanisms and genetic relatedness of ticular nosocomial pathogens circulating in hospital settings, needs carbapenem-resistant Acinetobacter baumannii isolated from blood, Italy. Diagn Microbiol Infect Dis 2013;75:180–6. special attention. Tracking antibiotic resistance determinants, iso- [12] Bakour S, Kempf M, Touati A, Ait A-A, Haouchine D, Sahli F, et al. lation of patients infected with nosocomial pathogens, in particular Carbapenemase-producing Acinetobacter baumannii in two university hospitals those carrying extended-spectrum β-lactamase (ESBL)- and MBL- in Algeria. J Med Microbiol 2012;61:1341–3. [13] Mesli E, Berrazeg M, Drissi M, Bekkhoucha SN, Rolain J-M. Prevalence of encoding genes, will consequently help to minimise the risk of the carbapenemase-encoding genes including New Delhi metallo-β-lactamase in occurrence of these MDR bacteria. Furthermore, collaboration Acinetobacter species, Algeria. Int J Infect Dis 2013;17:e739–43. between medical microbiology laboratories and infection preven- [14] Hammami S, Ghozzi R, Saidani M, Ben R-S. Carbapenem-resistant Acinetobacter baumannii producing the carbapenemase OXA-23 in Tunisia. Tunis Med tion and control teams at each hospital will increase awareness of 2011;89:638–43. the risk of transmission of nosocomial pathogens. This can be [15] Mathlouthi N, Areig Z, Al Bayssar C, Bakour S, Ali El Salabi A, Ben Gwierif S, achieved by introducing surveillance in order to contain any noso- et al. Emergence of carbapenem-resistant Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates collected from some Libyan hospitals. comial infection and control the spread of nosocomial pathogens Microb Drug Resist 2015;21:335–41. in hospital settings. [16] Dortet L, Poirel L, Errera C, Nordmann P. CarbAcineto NP test for rapid detection In conclusion, these results suggest that the epidemiology of of carbapenemase-producing Acinetobacter spp. J Clin Microbiol 2014;52:2359– A. baumannii 64. carbapenem resistance in in Libya has changed with [17] Yong D, Lee K, Yum J-H, Shin H-B, Rossolini G-M, Chong Y. Imipenem–EDTA the detection of the blaNDM-1 gene, usually carried by transposable disk method for differentiation of metallo-β-lactamase-producing clinical genetic elements, which makes its spread very rapidly even to other isolates of Pseudomonas spp. and Acinetobacter spp. J Clin Microbiol Gram-negative bacteria, in particular nosocomial pathogens. Fur- 2012;40:3798–801. [18] Lee K, Kim C-K, Yong D, Jeong S-H, Yum J-H, Seo Y-H, et al. Improved thermore, efforts to control the spread of carbapenemase-producing performance of the modified Hodge test with MacConkey agar for screening A. baumannii as well as surveillance measures are urgently needed carbapenemase-producing Gram-negative bacilli. J Microbiol Methods in Libya. 2010;83:149–52. [19] Peleg A-Y, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev 2008;21:538–82. Acknowledgement [20] Di Popolo A, Giannouli M, Triassi M, Brisse S, Zarrilli R. Molecular epidemiological investigation of multidrug-resistant Acinetobacter baumannii strains in four Mediterranean countries with a multilocus sequence typing The authors thank Linda Hadjadj [technician in URMITE (Unité scheme. Clin Microbiol Infect 2011;17:197–201. de recherche sur les maladies infectieuses et tropicales émergentes)] [21] Charfi-Kessis K, Mansour W, Ben Haj K-A, Mastouri M, Nordmann P, Aouni M, et al. Multidrug-resistant Acinetobacter baumannii strains carrying the blaOXA-23 for her assistance. and the blaGES-11 genes in a neonatology center in Tunisia. Microb Pathog Funding: This work was partly funded by CNRS and IHU 2014;74:20–4. Méditerranée Infection (France). This work was supported by the [22] Bakour S, Touati A, Bachiri T, Sahli F, Tiouit D, Naim M, et al. First report of 16S rRNA methylase ArmA-producing Acinetobacter baumannii and rapid spread Tunisian Ministry of Higher Education, Scientific Research and In- of metallo-β-lactamase NDM-1 in Algerian hospitals. J Infect Chemother formation and Communication Technologies, which offered a 2014;20:696–701. scholarship to NM to attend Aix-Marseille Université (Marseille, [23] Mansour W, Poirel L, Bettaieb D, Bouallegue O, Boujaafar N, Nordmann P. Dissemination of OXA-23-producing and carbapenem-resistant Acinetobacter France). baumannii in a university hospital in Tunisia. Microb Drug Resist 2008;14:289– Competing interests: None declared. 92. Ethical approval: Not required. [24] Poirel L, Mansour W, Bouallegue O, Nordmann P. Carbapenem-resistant Acinetobacter baumannii isolates from Tunisia producing the OXA-58-like carbapenem-hydrolyzing oxacillinase OXA-97. Antimicrob Agents Chemother References 2008;52:1613–17. [25] Hammerum A-M, Larsen A-R, Hansen F, Justesen U-S, Friis-Møller A, Lemming L-E, et al. Patients transferred from Libya to Denmark carried OXA-48-producing [1] Kempf M, Rolain J-M, Azza S, Diene S, Joly-Guillou M-L, Dubourg G, et al. Klebsiella pneumoniae, NDM-1-producing Acinetobacter baumannii and Investigation of Acinetobacter baumannii resistance to carbapenems in Marseille meticillin-resistant Staphylococcus aureus. Int J Antimicrob Agents 2012;40:191– hospitals, south of France: a transition from an epidemic to an endemic 2. situation. APMIS 2013;121:64–71. [26] Boulanger A, Naas T, Fortineau N, Figueiredo S, Nordmann P. NDM-1-producing [2] Kusradze I, Diene S-M, Goderdzishvili M, Rolain J-M. Molecular detection of Acinetobacter baumannii from Algeria. Antimicrob Agents Chemother OXA carbapenemase genes in multidrug-resistant Acinetobacter baumannii 2012;56:2214–15. isolates from Iraq and Georgia. Int J Antimicrob Agents 2011;38:164–8. [27] Bogaerts P, Rezende de Castro R, Roisin S, Deplano A, Huang T-D, Hallin M, et al. [3] Kempf M, Rolain J-M, Diatta G, Azza S, Samb B, Mediannikov O, et al. Emergence of NDM-1-producing Acinetobacter baumannii in Belgium. Carbapenem resistance and Acinetobacter baumannii in Senegal: the paradigm J Antimicrob Chemother 2012;67:1552–3. of a common phenomenon in natural reservoirs. PLoS ONE 2012;7:e39495. [28] Bonnin R-A, Cuzon G, Poirel L, Nordmann P. Multidrug-resistant Acinetobacter [4] Touati M, Diene S-M, Racherache A, Dekhil M, Djahoudi A, Rolain J-M. baumannii clone, France. Emerg Infect Dis 2013;19:822–3. Emergence of blaOXA-23 and blaOXA-58 carbapenemase-encoding genes in [29] El-Sayed-Ahmed M-A, Amin M-A, Tawakol W-M, Loucif L, Bakour S, Rolain J-M. multidrug-resistant Acinetobacter baumannii isolates from University Hospital High prevalence of blaNDM-1 carbapenemase-encoding gene and 16S rRNA armA of Annaba, Algeria. Int J Antimicrob Agents 2012;40:89–91. methyltransferase gene among Acinetobacter baumannii clinical isolates in Egypt. [5] Zarrilli R, Crispino M, Bagattini M, Barretta E, Di Popolo A, Triassi M, et al. Antimicrob Agents Chemother 2015;59:3602–5. Molecular epidemiology of sequential outbreaks of Acinetobacter baumannii in [30] Bartual S-G, Seifert H, Hippler C, Luzon M-A, Wisplinghoff H, Rodriguez-Valera an intensive care unit shows the emergence of carbapenem resistance. J Clin F. Development of a multilocus sequence typing scheme for characterization Microbiol 2004;42:946–53. of clinical isolates of Acinetobacter baumannii. J Clin Microbiol 2005;43:4382–90.

Article 5:

Incidence of OXA-23 and OXA-58 carbapenemases co-expressed in clinical isolates of Acinetobacter baumannii in Tunisia

Najla Mathlouthi, Yomna Ben lamine, Rania Somai, Sophia Bouhalila-Besbes, Sofiane Bakour, Jean-Marc Rolain, Chedly Chouchani*

Submitted in Microbial Drug Resistance (MDR) Impact factor: 2.6

Incidence of OXA-23 and OXA-58 carbapenemases co-expressed in clinical isolates of Acinetobacter baumannii in Tunisia

Najla Mathlouthi1,2,4, Yomna Ben lamine3, Rania Somai2, Sophia Bouhalila-Besbes3, Sofiane Bakour1, Jean-Marc Rolain1, Chedly Chouchani2,4

1 Unité de recherche sur les maladies infectieuses et tropicales émergentes, UM 63, CNRS 7278, IRD 198, INSERM 1095, IHU Méditerranée Infection, Faculté de Médecine et de Pharmacie, Aix- Marseille-Université, Marseille, France. 2 Laboratoire des Microorganismes et Biomolécules Actives. Faculté des Sciences de Tunis. Campus Universitaire, Université Tunis El- Manar, 2098 El-Manar II, Tunisie. 3 Laboratoire de Biologie clinique, unité de microbiologie, Institut Mohamed Kassab d’orthopédie Tunis, Tunisie. 4 Laboratoire de Recherche Sciences et Technologies de l’Environnement, Institut Supérieur des Sciences et Technologies de l’Environnement de Borj-Cedria, Université de Carthage, Technopôle de Borj-Cedria, BP-1003, Hammam-Lif 2050, Tunisie.

Corresponding authors

Email: [email protected] Phone: +216 94 11 44 43 Fax: +216 79 32 53 33

Email: [email protected] Phone : (33)4 9 13 24375 Fax: (33) 4 9 13 87772

Abstract word count = 203 Word count = 1942 Tables: 1

Figures: 2

References: 40 97 Abstract

Purpose. Acinetobacter baumannii is an important opportunistic and multidrug-resistant pathogen responsible for nosocomial infections in health facilities. The aim of this study was to characterize the molecular mechanisms of carbapenem resistance in A. baumannii strains isolated from Mohamed Kassab Orthopedic Institute in Tunis, Tunisia.

Methods. 25 imipenem-resistant A. baumannii clinical isolates collected between 2013 and 2016 were identified using API 20NE and were confirmed by matrix-assisted laser desorption/ionization time-of- flight mass spectrometry (MALDI-TOF/MS). Carbapenemase activity was detected using microbiological tests and PCR. The epidemiological relatedness of the strains was studied using multilocus sequence typing (MLST).

Results. The isolates were resistant to all antibiotics tested with increasing of MICs values (>32 mg/L). The microbiological tests showed that the 25 A. baumannii were positive for modified Hodge-test and for the Carba NP test, however, β-lactamase activity was not inhibited by EDTA. All the isolates harbored the naturally occurring blaOXA-51-like gene and the blaOXA-23-like carbapenemase gene. Among these strains, one isolate co-expressed the blaOXA-58 gene. MLST revealed several sequence types (STs) profile with the predominance of ST2 Imipenem-resistant A. baumannii (14/25; 56%).

Conclusions. Here we report the prevalence of ST2 Imipenem-resistant and for the first time the co-expression of blaOXA-23 and blaOXA-58 in clinical isolates of A. baumannii in a Tunisian hospital.

Keywords: Acinetobacter baumannii, carbapenemases, blaOXA-23, blaOXA-58, MLST, Tunisia.

98 1. Introduction

Acinetobacter baumannii is recognized as one of the most problematic nosocomial pathogens. Its clinical impact is controversial because the issue of attribute mortality frequently remains unsettled 31,35. Indeed, the bacteria colonize and often infect critically patients with a poor prognosis and secondary infective complications21. Treatment is complicated by the ability of A. baumannii to acquire resistance to multiple classes of antimicrobials 20. A. baumannii is naturally resistant to cephalosporins and chloramphenicol. However, it has a great ability to develop resistance against many antibiotics, including aminoglycosides, fluoroquinolones and carbapenems by acquisition of mobile genetic elements (plasmids, transposons, integrons...) 10. Carbapenem resistance in A. baumannii is increasingly being observed worldwide and the most important resistance mechanism is enzymatic hydrolysis mediated by carbapenem-hydrolyzing β-lactamases, belonging to class A, class B and class D19. The frequency of carbapenem-resistant A. baumannii incidence has risen in many parts of the world. Large and sustained outbreaks caused by this bacteria have been described in Europe 7,18,28, South America 33, North America 1, Australia 37, Asia 2, and even in Africa 13,30 and North Africa 2,26,40. In Tunisia, there are only few reports describing the emergence of carbapenem resistance in A. baumannii 8,24,32. The aim of our study was to identify molecular support of imipenem resistance in A. baumannii

99 clinical isolates collected in Mohamed Kassab Orthopedic Institute of Tunis. This study shows the first co-expression of OXA-23 and OXA- 58 in carbapenemase-producing A. baumannii in Tunisia. Moreover, our report is the first in this country that uses multilocus sequence typing (MLST) to study the epidemiological relatedness of an autochthonous MDR A. baumannii. This report, in addition to recent observations in neighboring countries 13,25, confirms the emergence of this resistance mechanism in North Africa.

2. Materials and methods

2.1. Bacterial isolates and antibiotics susceptibility testing

25 A. baumannii clinical isolates from bronchial aspirate, pus, blood and urine were collected from February 2013 to March 2016 in Mohamed Kassab Orthopedic Institute of Tunis. Strains were identified using an API 20NE system (bioMérieux, Marcy-l’Étoile, France) and confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS) using the Biotyper database and a Microflex spectrometer (Bruker Daltonics, Bremen, Germany). Correct identification at the species level was defined as a MALDI-TOF score >1.9 as previously described 34.

100 Antibiotic susceptibility testing was performed on Mueller-Hinton agar (bioMérieux, Craponne, France) by the standard disk-diffusion procedure according to the Antibiogram Committee of the French Society for Microbiology (CA-SFM) (http://www.sfm.micro biologie.org/). 17 antibiotics were tested: ticarcillin, ticarcillin/clavulanic acid, piperacillin/tazobactam, ceftazidime, cefotaxime, cefepime, aztreonam, amikacin, tobramycin, gentamicin, ciprofloxacin, rifampicin, trimethoprim/sulfamethoxazole, ertapenem, meropenem, imipenem, and colistin (Bio-Rad, France). Isolates were considered resistant to imipenem if the diameter of the inhibition zone was <17 mm. For isolates with inhibition diameter <17 mm, minimum inhibitory concentrations (MICS) for imipenem were determined by E- test (AB BIODISK, Solna, Sweden) and resistant strains were defined as isolates with an imipenem MIC > 8 µg/mL (CA-SFM). MICS for colistin were also evaluated. Disk diffusion susceptibility testing and the MICs of antibiotics were measured in accordance with CA-SFM guidelines.

2.2. Phenotypic detection of carbapenemase activity

Imipenem-resistant isolates were screened for carbapenemase production using the modified Hodge test, the modified Carba NP test and the ethylenediaminetetraacetic acid (EDTA) test as described 3,11,23,38.

101 2.3. PCR amplification and sequencing

Real-time PCR was performed to screen the presence of blaOXA-51, blaOXA-23, blaOXA-24, blaOXA-58 and blaOXA-48 genes. Conventional PCR was performed for blaNDM, blaKPC, blaIMP, blaVIM, blaSIM and blaGIM genes as previously described 27. Positive PCR products for any carbapenemase-encoding gene were sequenced using BigDye® terminator chemistry on an automated ABI 3130 sequencer (PE Applied Biosystems, Foster City, CA). The sequences of the obtained genes were analyzed using BlastN and BlastP available at the National Center for Biotechnology Information (NCBI) database (http:/www.ncbi.nlm.nih.gov/blast) and using ARG-ANNOT (Antibiotic Resistance Gene-ANNOTation) for identification 16.

2.4. Multilocus sequence typing (MLST)

Molecular typing of the isolates was determined by full MLST using the seven housekeeping genes (cpn60, fusA, gltA, pyrG, recA, rplB and rpoB) as described on the Institut Pasteur MLST website (http://www.pasteur.fr/mlst).

102 3. Results

From February 2013 to March 2016, 25 clinical isolates, identified as A. baumannii by the API20 NE identification system and confirmed by MALDI-TOF/MS, were recovered from Tunisian patients (16 male and 9 female) hospitalized in Mohamed Kassab Orthopedic Institute and isolated from different services, mostly Anesthesiology (40%).

Among the 25 isolates, 10 (40%) were recovered from urine, 5 (20%) from tracheas, 3 (12%) from bedsores, 2 (8%) from pus, 2 (8%) from catheters, 2 (8%) from blood and 1 (4%) from expectoration (Table 1). The results of antibiotic susceptibility testing revealed that the isolates were resistant to almost all antibiotics, including β-lactams, aminoglycosides and fluoroquinolones (Figure 1). All isolates showed high-level resistance to carbapenems with MICs for imipenem >32 mg/L. Colistin was the only antibiotic active against all the isolates (Figure 1). Using the modified Hodge test, the modified Carba NP test and the EDTA-disk test, all imipenem-resistant A. baumannii were modified Hodge and Carba NP test positive, suggesting carbapenemase production. However β-lactamase activity was not inhibited by EDTA, indicating that imipenem-resistant A. baumannii isolates do not produce metallo-β-lactamases.

Screening for carbapenemase-encoding genes by PCR showed that all the isolates produced the naturally occurring blaOXA-51-like gene and the

103 acquired OXA-carbapenemase blaOXA-23-like genes (Table 1). In addition, among these strains, one isolate co-expressed the blaOXA-58 gene, which was isolated from a male hospitalized in the Anesthesiology service (Table 1). None of the isolates contained blaOXA-24-like and blaOXA-48 -like or metallo-β-lactamase-encoding genes.

According to MLST analysis, several different sequence type STs were assigned to the clinical imipenem-resistant A. baumannii isolates, including ST1, ST2, ST164, ST310, ST570, ST602, ST623 and ST636. The most common ST was ST2 (14/25; 56%) (Figure 2). This clone was found circulating in all services and was associated with the production of OXA-23 enzymes (Table 1). It is worth mentioning that the only isolate that harbored blaOXA-23 and blaOXA-58 belonged to ST1 and the patient treated during three days with imipenem and colistin died at the age of 20 after being hospitalized for a month in the ICU (Table 1).

104 4. Discussion

Antimicrobial resistance in A. baumannii is one of the most problematic nosocomial threats worldwide. A. baumannii has been associated with healthcare-associated infections, often isolated from urine and/or respiratory specimens obtained from hospitalized patients, as confirmed in this study, in which 40% of A. baumannii strains were isolated from urine followed by 20% from tracheal 9,15. Here we report a high prevalence of imipenem resistance (100%) in A. baumannii clinical isolates recovered recently in Tunis, over a 3-year period. Carbapenems are the most potent β-lactams against Gram-negative bacteria and the drugs of choice for serious A. baumannii infections 14. However, resistance to these antibiotics is increasing, owing to the production of cabapenem-hydrolysing β-lactamases including metallo-β-lactamases, and particularly OXA-type carbapenemases39. Indeed, in this study, the blaOXA-23 gene was found in all imipenem-resistant A. baumannii strains. These data confirm previous studies performed recently in North Africa that concluded that the main oxacillinase produced by A. baumannii is OXA-234, 30, 5, 22. In fact, in Algeria, several studies have shown also the dissemination of OXA-23 producing carbapenem- resistant A. baumannii by the detection of blaOXA-23-like gene in 29 imipenem-resistant A. baumannii isolated from Sétif as well as in two imipenem-resistant strains isolated from Tizi-Ouzou 4. Other work published in the same year reported that 22 imipenem-resistant clinical

105 isolates of A. baumannii from the University Hospital of Annaba also 36 harbored blaOXA-23 gene . One year later, blaOXA-23-like gene was identified among 50% (40/80) of Acinetobacter spp clinical isolates recovered from three different hospitals in western Algeria 29. Recently, blaOXA-23 gene was again detected in carbapenem-resistant A. baumannii clinical isolates recovered Algerian hospitals 5. More recently, high prevalence of imipenem-resistant A. baumannii in 22 Algerian hospitals, mediated mainly by blaOXA-23-like was reported . In Tunisia, only few studies described the dissemination of OXA-23- producing carbapenem-resistant A. baumannii. The first description of OXA-23 producing carbapenem-resistant A.baumannii was reported in thirteen isolates during 2008. All the OXA-23-positive isolates were clonally related, and the blaOXA-23 gene was found to be chromosomally located and associated with an upstream-located insertion sequence ISAba24. In 2011, a second work was published reporting the presence of blaOXA-23 gene among imipenem resistant A. baumannii recovered from different wards at Charles Nicolle Hospital17. More recently, another work reported the production of OXA-23 in A. baumannii clinical isolates recovered in a neonatology center in the center-east of Tunisia8. In Libya, only two recent publications described the emergence of OXA-23-producing carbapenem-resistant A. baumannii 25,26. These findings may reflect the current spread of OXAs and especially OXA-23 in clinically relevant A. baumannii strains throughout northern Africa and also show that the Tunisian isolates

106 share the same genetic pool with A. baumannii species worldwide. Moreover, interestingly in our study we identified one strain that harbored both blaOXA-58 and blaOXA-23 genes. In Tunisia, to the best of our knowledge, only one publication reported the blaOXA-58-like gene in multidrug-resistant A. baumannii isolates recovered from hospitalized patients at the Sahloul Hospital in Sousse in 2008. Sequencing of the blaOXA-58-positive amplicons obtained from all isolates identified a gene with a single base-pair substitution with respect to the blaOXA-58 sequence. This substitution gave rise to OXA-9732. However, the coexistence in a strain of both blaOXA-23 and blaOXA-58 genes has never been reported in Tunisia. So here we present the first report showing the emergence of multidrug-resistant (MDR) A. baumannii with the coexistence of blaOXA-58 and blaOXA-23-like carbapenemase encoding gene in Tunisia. This may suggest that the epidemiology of carbapenemase-encoding genes has changed in Tunisia with the occurrence of the blaOXA-58 gene, because carbapenem antibiotics were intensively introduced as a therapy in Tunisian hospitals.

The blaOXA-58 gene has been reported worldwide, but in North African countries, such as Libya and Morocco, no studies on the emergence and spreading of OXA-58 producing MDR A. baumannii have been reported, by contrast with Algeria where two studies reported strains 12,36 harboring blaOXA-58 collected from Annaba and Tlemcen . All of the isolates were analyzed by MLST and different sequence types (STs)

107 were obtained; this analysis showed that the 25 isolates are belonged to eight different ST. These results confirm the clonal diversity of A. baumannii clinical isolates in Tunisia. The most common ST in this study was ST2 (Table 1). This ST has been reported in several countries in the Mediterranean area. The results of this work are consistent with a recent study who also reported that imipenem-resistant A. baumannii belonging to ST2 was the predominant clone among isolates recovered from some Algerian hospitals5. In addition, in 2015 other study found that the ST2 clonal group predominated (41.2%; 54/131) among other ST clonal groups in a large series of 150 A. baumannii clinical isolates collected in Egypt13. This clone also corresponds to the most prevalent Mediterranean A. baumannii clone according to a study conducted in Spanish hospitals 6.

In conclusion, these results re-emphasize the worldwide dissemination of OXA-23 carbapenemase gene carbapenem-resistant clinical isolates of A. baumannii and the emergence of carbapenem resistance due also to the blaOXA-58 gene in Tunisia. Because of the extensive use of carbapenems within Tunisian hospitals, as the last resort for treating infections due to third generation cephalosporin-resistant isolate, the emergence of multidrug-resistant (MDR) A. baumannii strains has become alarming. Strengthening prevention measures is required to control further spread of carbapenemases in this country.

108 Acknowledgment: The authors thank Linda Hadjadj [Technician in URMITE (Unité de recherche sur les maladies infectieuses et tropicales émergentes)] for her assistance.

Funding: This work was partly funded by CNRS and IHU Méditerranéen Infection (France). This work was supported by the Tunisian Ministry of Higher Education, Scientific Research and Information and Communication Technologies, which offered a scholarship to NM to attend Aix-Marseille Université (Marseille, France).

Competing interests: None declared.

Ethical approval: Not required.

109 Figure Legends

Figure.1.. Antibiotic susceptibility of A.baumannii clinical strains.

Figure.2. Phylogenetic tree of the 25 imipenem-resistant

Acinetobacter baumannii clinical isolates from Mohamed

Kassab Orthopedic Institute (Tunis) based on the MLST concatenated gene sequences of each isolate aligned with reference strains SDF and AYE.

Tables Legends

Table.1. Phenotypic and genotypic features of 25 clinical imipenem- resistant A. baumannii Tunisian strains producing carbapenemases.

110

Strain 27 ST 2:BlaOXA-23 )LJXUH Phylogenetic tree of the 25 imipenem-resistant Strain 29 ST 2:BlaOXA-23 Acinetobacter baumannii clinical isolates from Mohamed Strain 21 ST 2:BlaOXA-23 Kassab Orthopedic Institute (Tunis) based on the MLST Strain 19 ST 2:BlaOXA-23 concatenated gene sequences of each isolate aligned with Strain 13 ST 2:BlaOXA-23 reference strains SDF and AYE. Strain 7 ST 2:BlaOXA-23 86 Strain 6 ST 2:BlaOXA-23 Strain 5 ST 2:BlaOXA-23 Strain 4 ST 2:BlaOXA-23 Strain 3 ST 2:BlaOXA-23 96 Strain 2 ST 2:BlaOXA-23 Strain 1 ST 2:BlaOXA-23

92 Strain 32 ST 2:BlaOXA-23 Strain 9 ST 2:BlaOXA-23 Strain 31 ST 570:BlaOXA-23 48 Strain 24 ST 636:BlaOXA-23 Strain 8 ST 602:BlaOXA-23 112 Strain 14 ST 602:BlaOXA-23 69 Strain 15 ST 602:BlaOXA-23 97 StrainSt 18 ST 602:BlaOXA-23 StrainSt 25 ST 602:BlaOXA-23 Strain 20 ST 164:BlaOXA-23 A.baumannii ST 17 SDF Strain 10 ST 623:BlaOXA-23 A.baumannii ST 1 AYE 99 Strain 23 ST 1:BlaOXA-23/BlaOXA-58 89 Strain 10 ST 310:BlaOXA-23

0.0005 Strain 27 ST 2:BlaOXA-23 )LJXUH Phylogenetic tree of the 25 imipenem-resistant Strain 29 ST 2:BlaOXA-23 Acinetobacter baumannii clinical isolates from Mohamed Strain 21 ST 2:BlaOXA-23 Kassab Orthopedic Institute (Tunis) based on the MLST Strain 19 ST 2:BlaOXA-23 concatenated gene sequences of each isolate aligned with Strain 13 ST 2:BlaOXA-23 reference strains SDF and AYE. Strain 7 ST 2:BlaOXA-23 86 Strain 6 ST 2:BlaOXA-23 Strain 5 ST 2:BlaOXA-23 Strain 4 ST 2:BlaOXA-23 Strain 3 ST 2:BlaOXA-23 96 Strain 2 ST 2:BlaOXA-23 Strain 1 ST 2:BlaOXA-23

92 Strain 32 ST 2:BlaOXA-23 Strain 9 ST 2:BlaOXA-23 Strain 31 ST 570:BlaOXA-23 48 Strain 24 ST 636:BlaOXA-23 Strain 8 ST 602:BlaOXA-23 113 Strain 14 ST 602:BlaOXA-23 69 Strain 15 ST 602:BlaOXA-23 97 StrainSt 18 ST 602:BlaOXA-23 StrainSt 25 ST 602:BlaOXA-23 Strain 20 ST 164:BlaOXA-23 A.baumannii ST 17 SDF Strain 10 ST 623:BlaOXA-23 A.baumannii ST 1 AYE 99 Strain 23 ST 1:BlaOXA-23/BlaOXA-58 89 Strain 10 ST 310:BlaOXA-23

0.0005 7DEOHPhenotypic and genotypic features of 25 clinical imipenem-resistant A. baumannii Tunisian strains producing carbapenemases.

,VRODWH 'DWHRI *HQGHU :DUG 7\SHRI ,03 0+7 ('7$ &DUED &DUEDSHQHPDVHVJHQHV 67 LVRODWLRQ VDPSOHV 0,& 7HVW 7HVW GDPR ȝJP/ \U > 32 + - - OXA-51,OXA-23 25/03/2013 H Anesthesiology Tracheal > 32 + - - OXA-51, OXA-23 03/04/2013 HPMAIRBedsore > 32 + - - OXA-51OXA-23 14/05/2013 F Septic surgery Sepsis > 32 + - - OXA-51, OXA-23, 23/05/2013 H Anesthesiology catheter OXA-58 > 32 + - - OXA-51, OXA-23 22/08/2013 H Septic surgery Sepsis > 32 + - - OXA-51, OXA-23 16/09/2013 H PMAIR Urine

114 > 32 + - - OXA-51, OXA-23 17/09/2013 H Anesthesiology Blood culture > 32 + - - OXA-51, OXA-23 21/09/2013 H Septic surgery Urine > 32 + - - OXA-51, OXA-23 06/11/2013 F PMAIR Urine > 32 + - - OXA-51, OXA-23 17/11/2013 F PMAIR Urine > 32 + - - OXA-51, OXA-23 02/12/2013 F PMAIR Urine > 32 + - - OXA-51, OXA-23 23/12/2013 H Anesthesiology Catheter > 32 + - - OXA-51, OXA-23 25/03/2014 H Anesthesiology Tracheal > 32 + - - OXA-51, OXA-23 02/04/2014 F Anesthesiology Blood culture > 32 + - - OXA-51, OXA-23 13/06/2014 H Septic surgery Bedsore > 32 + - - OXA-51, OXA-23 01/12/2014 F Anesthesiology Tracheal Adult > 32 + OXA-51, OXA-23 25/03/2015 F orthopedic Bedsore - - surgery > 32 + - - OXA-51, OXA-23 30/03/2015 H Trauma Urine Adult > 32 + OXA-51, OXA-23 27/05/2015 F orthopedic Urine - - surgery > 32 + - - OXA-51, OXA-23 08/06/2015 H PMAIR Urine >32 + - - OXA-51, OXA-23 07/09/2015 H PMAIR Urine >32 + - - OXA-51, OXA-23 07/09/2015 H PMAIR Urine 115 Expectoration >32 + - - OXA-51, OXA-23 15/03/2016 F Anesthesiology Tracheal >32 + - - OXA-51, OXA-23 H Anesthesiology 18/03/2016 Tracheal > 32 + - - OXA-51, OXA-23 H Anesthesiology 22/03/2016 M, Male; F, Female; PMAIR, Physical Medicine and Internal Rehabilitation; IMP, imipenem; MHT, modified Hodge test;

Reference List

1. Abdallah, M., O. Olafisoye, C. Cortes, C. Urban, C. Charles, D. Landman, and J. Quale. 2015. Reduction in the prevalence of carbapenem-resistant Acinetobacter baumannii and Pseudomonas aeruginosa in New York City. Am.J.Infect.Control 43:650-652.

2. Bakour, S., S. A. Alsharapy, A. Touati, and J. M. Rolain. 2014. Characterization of Acinetobacter baumannii clinical isolates carrying bla(OXA-23) carbapenemase and 16S rRNA methylase armA genes in Yemen. Microb.Drug Resist. 20:604-609.

3. Bakour, S., V. Garcia, L. Loucif, J. M. Brunel, A. Gharout-Sait, A. Touati, and J. M. Rolain. 2015. Rapid identification of carbapenemase-producing Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii using a modified Carba NP test. New Microbes.New Infect. 7:89-93.

4. Bakour, S., M. Kempf, A. Touati, A. A. Ait, D. Haouchine, F. Sahli, and J. M. Rolain. 2012. Carbapenemase-producing Acinetobacter baumannii in two university hospitals in Algeria. J.Med.Microbiol. 61:1341-1343.

5. Bakour, S., A. Touati, T. Bachiri, F. Sahli, D. Tiouit, M. Naim, M. Azouaou, and J. M. Rolain. 2014. First report of 16S rRNA methylase ArmA-producing Acinetobacter baumannii and rapid spread of metallo-beta-lactamase NDM-1 in Algerian hospitals. J.Infect.Chemother. 20:696-701.

6. Bartual, S. G., H. Seifert, C. Hippler, M. A. Luzon, H. Wisplinghoff, and F. Rodriguez-Valera. 2005. Development of a multilocus sequence typing scheme for characterization of clinical isolates of Acinetobacter baumannii. J.Clin.Microbiol. 43:4382- 4390.

117 7. Castanheira, M., S. E. Costello, L. N. Woosley, L. M. Deshpande, T. A. Davies, and R. N. Jones. 2014. Evaluation of clonality and carbapenem resistance mechanisms among Acinetobacter baumannii-Acinetobacter calcoaceticus complex and Enterobacteriaceae isolates collected in European and Mediterranean countries and detection of two novel beta-lactamases, GES-22 and VIM-35. Antimicrob.Agents Chemother. 58:7358- 7366.

8. Charfi-Kessis, K., W. Mansour, K. A. Ben Haj, M. Mastouri, P. Nordmann, M. Aouni, and L. Poirel. 2014. Multidrug-resistant Acinetobacter baumannii strains carrying the bla(OxA-23) and the bla(GES-11) genes in a neonatology center in Tunisia. Microb.Pathog. 74:20-24.

9. Da Silva, G. J., N. Mendonca, G. Batista, and A. Duarte. 2010. Sequence types of Portuguese carbapenem-resistant Acinetobacter baumannii isolates collected over 10 years. J.Antimicrob.Chemother. 65:2254-2256.

10. Dijkshoorn, L., A. Nemec, and H. Seifert. 2007. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat.Rev.Microbiol. 5:939-951.

11. Dortet, L., L. Poirel, C. Errera, and P. Nordmann. 2014. CarbAcineto NP test for rapid detection of carbapenemase- producing Acinetobacter spp. J.Clin.Microbiol. 52:2359-2364.

12. Drissi, M., L. Poirel, P. D. Mugnier, A. Z. Baba, and P. Nordmann. 2010. Carbapenemase-producing Acinetobacter baumannii, Algeria. Eur.J.Clin.Microbiol.Infect.Dis. 29:1457-1458.

13. El-Sayed-Ahmed, M. A., M. A. Amin, W. M. Tawakol, L. Loucif, S. Bakour, and J. M. Rolain. 2015. High prevalence of bla(NDM- 1) carbapenemase-encoding gene and 16S rRNA armA methyltransferase gene among Acinetobacter baumannii clinical Isolates in Egypt. Antimicrob.Agents Chemother. 59:3602-3605.

118 14. Falagas, M. E., S. K. Kasiakou, and A. Michalopoulos. 2005. Treatment of multidrug-resistant Pseudomonas aeruginosa and Acinetobacter baumannii pneumonia. J.Cyst.Fibros. 4:149-150.

15. Gogou, V., S. Pournaras, M. Giannouli, E. Voulgari, E. T. Piperaki, R. Zarrilli, and A. Tsakris. 2011. Evolution of multidrug-resistant Acinetobacter baumannii clonal lineages: a 10 year study in Greece (2000-09). J.Antimicrob.Chemother. 66:2767- 2772.

16. Gupta, S. K. and J. M. Rolain. 2014. Reply to "Comparison of the web tools ARG-ANNOT and ResFinder for detection of resistance genes in bacteria". Antimicrob.Agents Chemother. 58:4987.

17. Hammami, S., R. Ghozzi, M. Saidani, and R. S. Ben. 2011. Carbapenem-resistant Acinetobacter baumannii producing the carbapenemase OXA-23 in Tunisia. Tunis Med. 89:638-643.

18. Jeannot, K., L. Diancourt, S. Vaux, M. Thouverez, A. Ribeiro, B. Coignard, P. Courvalin, and S. Brisse. 2014. Molecular epidemiology of carbapenem non-susceptible Acinetobacter baumannii in France. PLoS.One. 9:e115452.

19. Karah, N., A. Sundsfjord, K. Towner, and O. Samuelsen. 2012. Insights into the global molecular epidemiology of carbapenem non- susceptible clones of Acinetobacter baumannii. Drug Resist.Updat. 15:237-247.

20. Kempf, M. and J. M. Rolain. 2012. Emergence of resistance to carbapenems in Acinetobacter baumannii in Europe: clinical impact and therapeutic options. Int.J.Antimicrob.Agents 39:105-114.

21. Kempf, M., J. M. Rolain, S. Azza, S. Diene, M. L. Joly-Guillou, G. Dubourg, P. Colson, L. Papazian, H. Richet, P. E. Fournier, A. Ribeiro, and D. Raoult. 2013. Investigation of Acinetobacter baumannii resistance to carbapenems in Marseille hospitals, south of France: a transition from an epidemic to an endemic situation. APMIS 121:64-71.

119 22. Khorsi, K., Y. Messai, M. Hamidi, H. Ammari, and R. Bakour. 2015. High prevalence of multidrug-resistance in Acinetobacter baumannii and dissemination of carbapenemase-encoding genes blaOXA-23-like, blaOXA-24-like and blaNDM-1 in Algiers hospitals. Asian Pac.J.Trop.Med. 8:438-446.

23. Lee, K., C. K. Kim, D. Yong, S. H. Jeong, J. H. Yum, Y. H. Seo, J. D. Docquier, and Y. Chong. 2010. Improved performance of the modified Hodge test with MacConkey agar for screening carbapenemase-producing Gram-negative bacilli. J.Microbiol.Methods 83:149-152.

24. Mansour, W., L. Poirel, D. Bettaieb, O. Bouallegue, N. Boujaafar, and P. Nordmann. 2008. Dissemination of OXA-23- producing and carbapenem-resistant Acinetobacter baumannii in a University Hospital in Tunisia. Microb.Drug Resist. 14:289-292.

25. Mathlouthi, N., Z. Areig, B. C. Al, S. Bakour, S. A. Ali El, G. S. Ben, A. A. Zorgani, S. K. Ben, C. Chouchani, and J. M. Rolain. 2015. Emergence of Carbapenem-Resistant Pseudomonas aeruginosa and Acinetobacter baumannii Clinical Isolates Collected from Some Libyan Hospitals. Microb.Drug Resist. 21:335-341.

26. Mathlouthi, N., A. A. El Salabi, M. Ben Jomaa-Jemili, S. Bakour, C. Al-Bayssari, A. A. Zorgani, A. Kraiema, O. Elahmer, L. Okdah, J. M. Rolain, and C. Chouchani. 2016. Early detection of metallo-beta-lactamase NDM-1- and OXA-23 carbapenemase- producing Acinetobacter baumannii in Libyan hospitals. Int.J.Antimicrob.Agents.

27. Mendes, R. E., K. A. Kiyota, J. Monteiro, M. Castanheira, S. S. Andrade, A. C. Gales, A. C. Pignatari, and S. Tufik. 2007. Rapid detection and identification of metallo-beta-lactamase-encoding genes by multiplex real-time PCR assay and melt curve analysis. J.Clin.Microbiol. 45:544-547.

120 28. Merino, M., M. Poza, I. Roca, M. J. Barba, M. D. Sousa, J. Vila, and G. Bou. 2014. Nosocomial outbreak of a multiresistant Acinetobacter baumannii expressing OXA-23 carbapenemase in Spain. Microb.Drug Resist. 20:259-263.

29. Mesli, E., M. Berrazeg, M. Drissi, S. N. Bekkhoucha, and J. M. Rolain. 2013. Prevalence of carbapenemase-encoding genes including New Delhi metallo-beta-lactamase in Acinetobacter species, Algeria. Int.J.Infect.Dis. 17:e739-e743.

30. Olaitan, A. O., M. Berrazeg, O. E. Fagade, O. O. Adelowo, J. A. Alli, and J. M. Rolain. 2013. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 carbapenemase, Nigeria. Int.J.Infect.Dis. 17:e469-e470.

31. Peleg, A. Y., H. Seifert, and D. L. Paterson. 2008. Acinetobacter baumannii: emergence of a successful pathogen. Clin.Microbiol.Rev. 21:538-582.

32. Poirel, L., W. Mansour, O. Bouallegue, and P. Nordmann. 2008. Carbapenem-resistant Acinetobacter baumannii isolates from Tunisia producing the OXA-58-like carbapenem-hydrolyzing oxacillinase OXA-97. Antimicrob.Agents Chemother. 52:1613- 1617.

33. Saavedra, S. Y., R. Cayo, A. C. Gales, A. L. Leal, and C. H. Saavedra. 2014. Early dissemination of OXA-72-producing Acinetobacter baumannii strain in Colombia: a case report. Braz.J.Infect.Dis. 18:678-680.

34. Seng, P., M. Drancourt, F. Gouriet, S. B. La, P. E. Fournier, J. M. Rolain, and D. Raoult. 2009. Ongoing revolution in bacteriology: routine identification of bacteria by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Clin.Infect.Dis. 49:543-551.

121 35. Sunenshine, R. H., M. O. Wright, L. L. Maragakis, A. D. Harris, X. Song, J. Hebden, S. E. Cosgrove, A. Anderson, J. Carnell, D. B. Jernigan, D. G. Kleinbaum, T. M. Perl, H. C. Standiford, and A. Srinivasan. 2007. Multidrug-resistant Acinetobacter infection mortality rate and length of hospitalization. Emerg.Infect.Dis. 13:97-103.

36. Touati, M., S. M. Diene, A. Racherache, M. Dekhil, A. Djahoudi, and J. M. Rolain. 2012. Emergence of blaOXA-23 and blaOXA-58 carbapenemase-encoding genes in multidrug-resistant Acinetobacter baumannii isolates from University Hospital of Annaba, Algeria. Int.J.Antimicrob.Agents 40:89-91.

37. Valenzuela, J. K., L. Thomas, S. R. Partridge, T. van der Reijden, L. Dijkshoorn, and J. Iredell. 2007. Horizontal gene transfer in a polyclonal outbreak of carbapenem-resistant Acinetobacter baumannii. J.Clin.Microbiol. 45:453-460.

38. Yong, D., K. Lee, J. H. Yum, H. B. Shin, G. M. Rossolini, and Y. Chong. 2002. Imipenem-EDTA disk method for differentiation of metallo-beta-lactamase-producing clinical isolates of Pseudomonas spp. and Acinetobacter spp. J.Clin.Microbiol. 40:3798-3801.

39. Zarrilli, R., S. Pournaras, M. Giannouli, and A. Tsakris. 2013. Global evolution of multidrug-resistant Acinetobacter baumannii clonal lineages. Int.J.Antimicrob.Agents 41:11-19.

40. Zenati, K., A. Touati, S. Bakour, F. Sahli, and J. M. Rolain. 2016. Characterization of NDM-1- and OXA-23-producing Acinetobacter baumannii isolates from inanimate surfaces in a hospital environment in Algeria. J.Hosp.Infect. 92:19-26.

122 Chapitre VI (Annexe):

Travaux sur la description et le séquençage des génomes de nouvelles espèces

123

AVANT PROPOS

Nous présentons dans cette partie annexe de ce document deux travaux concernant la description et l’analyse génomique de deux nouvelles souches Mobilicoccus massiliensis et Paenibacillus ihuae isolées pour la première fois au sein de l’URMITE. Dans la première étude nous avons isolé une nouvelle bactérie à partir des selles d'un mâle nigérien âgé de 2 ans et souffrant d'une forme grave de malnutrition aiguë appelée «kwashiorkor». Nous avons décrit dans ce travail les caractéristiques de cette bactérie et nous avons également réalisé le séquençage complet et l’annotation de son génome. En se basant sur les analyses phénotypiques, phylogénétiques et génomiques (taxonogénomique), nous avons désigné le nom « Mobilicoccus massiliensis » à cette nouvelle espèce du genre Mobilicoccus. Ce travail a été soumis dans le journal New Microbes and New Infections (article 6). Dans la seconde étude, nous avons participé dans la caractérisation, le séquençage complet et l’annotation du génome d’une nouvelle souche désignée sous le nom de « Paenibacillus ihuae ». Cette bactérie a été isolée à partir des selles d'un patient français âgé de 69 ans, hospitalisé à l’unité de soins intensifs et ayant subi un traitement à l’imipénème pendant 10 jours. Ce travail a été également soumis dans le journal New Microbes and New Infections (article 7). 125

Article 6:

Genome sequence and description of Mobilicoccus massiliensis sp. nov. isolated from the stool of a Nigerien male suffering from a severe form of acute malnutrition ‘‘kwashiorkor’’

Najla Mathlouthi, Sory Ibrahima Traore, Teresa Cimmino,

Saber Khelaifia, Thi Tien Nguyen, Frédéric Cadoret,

Carine Couderc, Didier Raoult and Jean-Marc Rolain

Submitted in New Microbes and New Infections (NMNI) Impact factor: 2.6 127

Genome sequence and description of Mobilicoccus massiliensis sp. nov. isolated from the stool of a Nigerien male suffering from a severe form of acute malnutrition ‘‘kwashiorkor’’

Najla Mathlouthi1, Sory Ibrahima Traore1, Teresa Cimmino1, Saber Khelaifia1, Thi Tien Nguyen1, Frédéric Cadoret1, Carine Couderc1, Didier Raoult1 and Jean-Marc Rolain1,*

1Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63 CNRS 7278 IRD 198 INSERM U1905, IHU Méditerranée Infection, Facultés de Médecine et de Pharmacie, Marseille, France. *Corresponding author Phone: (33) 4 91 32 43 75. Fax: (33) 4 91 38 77 72 Email: [email protected] Abstract: 99/100 (max) Number of words: 1476/1500 (max) Figures: 5 Tables: 4 References: 11/25 (max)

129

Abstract

Mobilicoccus massiliensis strain SIT2 (= CSUR P1306 = DSM 29065) is the new type strain of Mobilicoccus sp. nov. This bacterium was isolated from the stool of a 2-year-old Nigerien male suffering from a severe form of acute malnutrition ‘‘kwashiorkor’’. Mobilicoccus massiliensis is a Gram-positive, facultatively anaerobic, non- sporulating and motile. We describe here the features of this bacterium, together with the complete genome sequencing and annotation. The 3, 842, 438 bp long genome contains 3, 362 protein- coding and 49 RNA genes, including one gene 5S rRNA, one gene 16S rRNA, one gene 23S rRNA and fourty six tRNA genes.

Key words: Mobilicoccus massiliensis, genome, culturomics, taxonogenomics.

Mobilicoccus massiliensis strain SIT2 (= CSUR P1306 = DSM 29065) is the type strain of mobilicoccus sp. nov. This bacterium was isolated from the stool of a 2-year-old Nigerien male suffering from a severe form of acute malnutrition ‘‘kwashiorkor’’ and is part of an effort named culturomics to cultivate all bacterial species from the human gut (2,6). It is a Gram-positive, aerobic or facultatively anaerobic, motile and non-sporulating. The family Dermatophilaceae was first proposed by Austwick (1958) and later emended by Stackebrandt et al. (1997), Stackerbrandt and Schumann (2000) and Zhi et al (2009).

131 This family currently contains two genera: Dermatophilus and Kineosphaera. The genus Dermatophilus was proposed by Gordon (1954) as organisms that form branching mycelia with several transverse and longitudinal divisions which leads to the formation of packets or clusters or cuboid cells or coccoids. Species of the genus Dermatophilus are bacteria isolated from the causative organism of a skin disease (4) and was reported to affect a wide variety of mammalian species. The ruling taxonomic classification of prokaryotes is based on a combination of phenotypic and genotypic criteria (10,11). However, the three essential criteria that are used, comprising 16S rRNA gene based phylogeny(10) G + C content and DNA–DNA hybridization (DDH) (11) exhibit several drawbacks. We recently proposed a new method (taxono-genomics) which uses genomic data in a polyphasic approach to describe new bacterial species (9). This strategy combines phenotypic characteristics including MALDI-TOF MS spectrum and genomic analysis (5,7,8).

In this paper, we report for the first time the isolation and characterization of a novel species of the genus Dermatophilus, Mobilicoccus massiliensis sp. nov. with the description of phylogenetic characteristics and the complete genomic sequencing and annotation to distinguish this species from other Dermatophilus species.

132 Mobilicoccus massiliensis SIT2 was isolated from the stool of a 2- year-old Nigerien male suffering from a severe form of acute malnutrition ‘‘kwashiorkor’’. The study was approved by the local Ethics Committee of the Institut Fédératif de Recherche IFR48, Faculty of Medicine, Marseille, France, under agreement number 09- 022. Strain SIT2 was isolated in March 2014 by cultivation on chocolate agar PolyViteX (PVX) (bioMérieux, Marcy-l’Etoile, France) in anaerobic and aerobic condition using GasPak™ EZ Anaerobe Container System Sachets (BD) at 37°C. This strain exhibited a 98 % 16S rRNA nucleotide sequence similarity with Mobilicoccus pelagius (NZ-BAFF00000000.1) phylogenetically neighboring valid Dermatophilus species type strain (Figure 1).

Optimal growth occurred at 37°C after 24 hours of inoculation. Growth was observed under aerobic and anaerobic conditions already after 24h. Colonies were 0.2 to 0.5 mm in diameter and gras appearance on blood-enriched Columbia agar. Cells are coccus- shaped, Gram-positive, non-sporulating (Figure 2) and the motility test was positive. SIT2 showed catalase activity but was negative for oxidase.

The commercially available Api ZYM, Api 50CH (BioMerieux, Marcy l’Etoile, France), were used to characterize the biochemical properties of the strain according to the manufacturer’s instructions. Using an API 50 CH Mobilicoccus massiliensis SIT2 presented

133 positive reactions for Glycérol, Erythritol, D-arabinose, L-arabinose, D-ribose, D-xylose, L-xylose, D-adonitol, methyl-αD- mannopyranoside, D-galactose, D-glucose, D-fructose, D-mannose, L-rhamnose, dulcitol, inositol, D-mannitol, D-sorbitol, methyl-αD- glucopyranoside, N-acetylglucosamine, Amygdaline, Arbutine, salicine, D-celiobiose, D-maltose, D-lactose, D-melibiose, D- saccharose, D-trehalose, D-melezitose, D-raffinose, amidon, glycogen, xylitol, gentiobiose, D-turanose, D-lyxose, D-tagatose,D- fucose, L-fucose, D-arabitol and potassium gluconate. Negative reactions were observed for L-sorbose, methyl-αD-mannopyranoside, esculine, inulin, L-arabitol, potassium 2-ketogluconate and potassium 5-ketogluconate. For API ZYM, Mobilicoccus massiliensis SIT2 presented positive reaction only for Alpha-galactosidase (mélibiase) (Table 1).

Antibiotic susceptibility of our isolates was assessed using the disk diffusion method on Muller-Hinton agar plates supplemented with 5% blood (BD). The tested antibiotics were ceftriaxone, imipenem, vancomycin, rifampicin, gentamicin, ciprofloxacin, amoxicillin, doxycycline, ciprofloxacin, gentamicin, rifampicin, colistin, meropenem, trimethoprim-sulfamid, amoxicillin-clavulanic acid, fosfomycin and Metronidazol (SIRSCAN OXOID, FRANCE) (Table 2).

134 Matrix-assisted laser-desorption/ionization time-of-flight (MALDI- TOF) MS protein analysis was carried out as previously described6 using a Microflex spectrometer (Bruker Daltonics, Leipzig, Germany). The resulting score enabled the identification of tested species, or not: a score ≥ 2 with a validly published species enabled identification at the species level, a score ≥ 1.7 but < 2 enabled identification at the genus level, and a score < 1.7 did not enable any identification. No significant MALDI-TOF score was obtained for strain SIT2 against the Bruker database, suggesting that our isolate was not a member of a known species. Consequently, we added the spectrum from strain SIT2 to our database and the organism was selected for sequencing on the basis of its phylogenetic position and 16S rRNA similarity to members of the genus Dermatophilus (6).

Phylogenetic subtree highlighting the phylogenetic position of this bacteria relative to other species. Sequences are recovered thanks a nucleotide blast against the NCBI 16S rRNA Targeted Loci Project database. The bacterium was identified by sequence analysis of the 16S rRNA. Phylogenetic relationship with closely related species were determined by MEGA version 6. The evolutionary history was inferred by using the Maximum Likelihood method based on the JTT matrix-based model/ Strain SIT2 exhibited a 98% 16S rRNA sequence identity with Mobilicoccus Pelagius (NZ-BAFF00000000.1), the

135 phylogenetically-closest bacterial species with standing in nomenclature (Figure 1).

Genomic DNA of Mobilicoccus massiliensis was sequenced on the MiSeq Technology (Illumina Inc, San Diego, CA, USA) with the 2 applications: paired end and mate pair. The reads of the both applications were trimmed and the optimal assembly was obtained through the software Spades with 245 of coverage in 8 scaffolds which generated a genome size of 3.28Mb.The % GC was estimated at 29% (Tables 3 and 4).

Genome was annotated by Rapid Annotation using Subsytem Technology (RAST) bioserver (1). The resistome was analyzed with ARG-ANNOT (Antibiotic Resistance Gene-ANNOTation) database and BLASTp in Genbank (3). The functional annotation of protein sequences was performed using BLASTP against the GenBank and Clusters of Orthologous Groups (COG) databases3. The exhaustive bacteriocin database available in our laboratories (Bacteriocins of the URMITE database;http://drissifatima.wix.com/bacteriocins) was performed by collecting all currently available sequences from the databases and from NCBI. Protein sequences from this database allowed putative bacteriocins from human gut microbiota to be identified using BLASTp methodology (3). The genome of Mobilicoccus massiliensis SIT2 has been deposited in genbank with accession number CDGT01000000 and 16S rRNA accession number

136 LK985391. The genome is 3,842, 438 bp long with 70.47 % GC content. It is composed of 21 scaffolds (composed of 24 contigs). Of the 3,681 predicted genes, 3,362 were protein-coding genes, and 49 were RNAs (1 gene is 5S rRNA, 1 gene is 16S rRNA, 1 gene is 23S rRNA, 46 genes are TRNA genes). A total of 2,437 genes were assigned as putative function (by cogs or by NR blast). The remaining genes were annotated as hypothetical proteins (683 genes => 20.32%) (Figure 3).

The draft genome sequence of Mobilicoccus massiliensis is larger than those of Mobilicoccus Pelagius Aji5-31, Dermatophilus congolensis DSM 44180, Dermacoccus nishinomiyaensis, Arsenicicoccus sp. and Austwickia chelonae NBRC 105200 (3.54, 2.62, 3.03, 3.53 and 3.54 MB respectively) but smaller than those of Kineosphaera limosa NBRC 100340 (4.5 MB) (Table 5).

The G+C content of Mobilicoccus massiliensis is smaller than those of Mobilicoccus Pelagius Aji5-31 and Arsenicicoccus sp. (71.9 and 72.7% respectively), but larger than those of Dermatophilus congolensis DSM 44180, Kineosphaera limosa NBRC 100340, Dermacoccus nishinomiyaensis and Austwickia chelonae NBRC 105200 (59.4, 70.4, 69.1 and 66.1 % respectively). The gene content of Mobilicoccus massiliensis is larger than those of Mobilicoccus Pelagius Aji5-31, Dermatophilus congolensis DSM 4418, Kineosphaera limosa NBRC 100340, Dermacoccus nishinomiyaensis

137 Arsenicicoccus sp. and Austwickia chelonae NBRC 105200 (3090, 2340, 4375, 2745, 3271 and 3046 respectively) (Table 5).

The comparison of amino acid sequence homology of the predicted genes, as shown in Figure 4 by bidirectional BLAST hits taken from the RAST annotation (1), is a useful way to evaluate the protein similarity using BLAST between the NBRC 104925 and fully sequenced of SIT2.

Antimicrobial susceptibility testing demonstrate that the strain M. massiliensis SIT2 was susceptible to ceftriaxone, imipenem, vancomycin, rifampicin, gentamicin, ciprofloxacin, amoxicillin, doxycycline, ciprofloxacin, gentamicin, rifampicin and colistin but resistance to trimethoprim-sulfamethoxazole, fosfomycin and metronidazole. The analysis in silico of resistome reveals the presence of resistance gene showed in table 2.

The analysis of the genome has not demonstrated the presence of bacteriocin and non-reducing polyketide synthases (NRPKs). SIT2 is equipped with intact flagellar system of 41 CDS encoding six cytoplasmic signal transduction proteins, the products of the Che genes (cheA, cheB, cheR, cheW, cheY and cheZ),transmembrane proteins with receptor functions termed methyl-accepting chemotaxis proteins, or MCPs, flagellar assembly proteins (FliP, FliQ, FliR, flhA, flhB), chemotaxis protein (motA, motB), flagellar motor switch protein

138 (FliG, FliM, FliN, FliY), rod,hook and filament (FlgC, FlgG, FlgK, FlgL, fliD, fliC), regulation (RNA polymerase sigma factor for flagellar operon FliA).

On the basis of phenotypic, phylogenetic and genomic analyses (taxonogenomics), we propose that strain SIT2, represent novel specie of the genus Mobilicoccus for which the name Mobilicoccus massiliensis is proposed. The genome sequences are deposited in GenBank under accession numbers CDGT 01000000 and 16S LK985391 respectively.

ACKNOWLEDGMENTS

We are very grateful to Linda Hadjadj for technical assistance.

Financial & competing interest disclosure:

This work was funded by the French Centre National de la Recherche Scientifique (CNRS) and Infectiopole Sud Foundation. There are no conflicts of interest to declare.

139

Figure Legends

Fig.1. Phylogenetic tree highlighting the position of Mobilicoccus massiliensis sp. nov. strain SIT2 (= CSUR P1162 = DSM 29078) relative to other type strains within the Dermatophilus genus.

Fig.2. Transmission electron microscopy of Mobilicoccus massiliensis strain SIT2 using a Morgani 268D.

Fig.3. Graphical circular map of the genome.

Fig.4. Proteomic comparison and “in silico” DNA-DNA hybridization between M. massiliensis SIT2 and M. pelagius NBRC 104925.

Fig.5. Distribution of functional classes of predicted genes of M. massiliensis and M. pelagius according to clusters of orthologous groups of proteins.

141 Tables Legends

Tab.1. Differential phenotypic characteristics between Mobilicoccus massiliensis sp. nov. Strain SIT2 and phylogenetically close members of other Dermatophilaceae species.

Tab.2. List of the genes associated with antibiotic resistant in Mobilicoccus massiliensis SIT2.

Tab. 3. Nucleotide content and gene count levels of the genome.

Tab. 4. Number of genes associated with the 25 general COG functional categories.

Tab.5. Genome features of Mobilicoccus SIT 2 genome comparaison to other Dermatophilaceae species.

142 76 Mobilicoccus pelagius strain Aji5-31 16S 90 Dermatophilus sp. CCUG 48971 partial 16S 47 Mobilicoccus sp. SIT2 partial 16S 21 Piscicoccus intestinalis strain Ngc37-23 16S Kineosphaera limosa strain NBRC 100340 16S Dermabacter sp. oral strain B46KS 16S Austwickia chelonae strain NBRC 105200 16S 75 100 Austwickia chelonae strain W16 16S Dermacoccus sp. BSi20643 16S 97 Dermacoccus sp. 103 16S 100 Dermacoccus sp. 22 16S ribosomal RNA

0.005

Figure1. Phylogenetic tree highlighting the position of Mobilicoccus massiliensis sp. nov. strain SIT2 (= CSUR P1162 = DSM 29078) relative to other type strains within the Dermatophilus genus. Sequences were aligned using CLUSTALW, and phylogenetic inferences were obtained using the maximum-likelihood method within the MEGA5.1. Numbers at the nodes are percentages of bootstrap values obtained by repeating 1,000 times the analysis to generate a majority consensus tree.

143 Figure 2. Transmission electron microscopy of Mobilicoccus massiliensis strain SIT2 using a Morgani 268D (Philips) at an operating voltage of 60kV. The scale bar represents 500 nm.

144 Figure 3. Graphical circular map of the genome. From outside to the center: Contigs (red / grey), COG category of genes on the forward strand (three circles), genes on forward strand (blue circle), genes on the reverse strand (red circle), COG category on the reverse strand (three circles), GC content.

145 Percent protein sequence identity between M. pelagius NBRC 104925 Mobilicoccus massiliensis SIT2

Figure 4. Proteomic comparison and “in silico” DNA-DNA hybridization between M. massiliensis SIT2 and M. pelagius NBRC 104925 (A) Color code referring to the percentage of similarity of protein sequence. It refer to the average of number of proteins with similarity ≥80% with the M. massiliensis SIT2 and M. pelagius NBRC 104925.

146 350

300

250

200

150

100

50 M. pelagius 0 M. massiliensis 1 47

Figure 5. Distribution of functional classes of predicted genes of M. massiliensis and M. pelagius according to clusters of orthologous groups of proteins. Table 1. Differential phenotypic characteristics between Mobilicoccus massiliensis sp. nov. Strain SIT2 and phylogenetically close members of other Dermatophilaceae species.

Properties Mobilicoccus Mobilicoccus pelagius Piscicoccus intesttinalis massiliensis Cell diameter 0.2-0.5 mm 0.7-1.2 μm 0.7-1 μm Oxygen requirement F/anaerobic F/anaerobic F/anaerobic Gram stain + + + Motility + + + G+C content (%) 70.5 71.6 71.5 Production of Alkaline phosphatase - + + Acid phosphatase - - + Catalase + + + Oxidase - - - α -glucosidase - + + β -glucosidase - - + α-galactosidase + - + 1

48 β-galactosidase - - + Leucine arylamidase - + + Pyrazinamidase - + + Utilization of Glycérol + - - Erythritol + - - D-arabinose + - - L-arabinose + - - D-ribose + - - D-xylose + + - L-xylose + + - D-adonitol + + - methyl-αD-mannopyranoside + + - D-galactose + - + D-glucose + - + D-fructose + - + D-mannose + - + L-rhamnose + + - dulcitol + + - inositol + - - D-mannitol + + - D-sorbitol + + - methyl-αD-glucopyranoside + + - N-acetylglucosamine + - - Amygdalin + + - Arbutin + + + salicin + + - D-celiobiose + + - D-maltose + - + D-lactose + + - D-melibiose + - - 149 D-saccharose + - -

D-trehalose + - + D-melezitose + - - D-raffinose + + + amidon + - - glycogen + - - xylitol + + - gentiobiose + + - D-turanose + - - D-lyxose + + - D-tagatose + - - D-fucose + + - L-fucose + + - D-arabitol + + - potassium gluconate + + - Habitat stool of a male Intestinal tract of a fish Intestinal tract of a fish +: positive result, -: negative result, na: data not available Table 2. List of the genes associated with antibiotic resistant in Mobilicoccus massiliensis SIT2

ORF Gene name GC% Size AA Function Best blast hit in Genbank % aa %aa identity

coverage

1719 MFS 70.6 513 MFS transporter M.pelagius 97 74 1 50 Table 3. Nucleotide content and gene count levels of the genome

Attribute Value % of totala Genome size (bp) 3842438 100 Coding region (bp) 3415931 88,90009 G+C content (bp) 2707407 70,4696 Total genes 3411 100 RNA genes 49 1,436529 Protein-coding genes 3362 100 Protein associated to function prediction 2359 70,16657 Protein associated to COGs 2099 62,43307 1

51 Protein with peptide signals 402 11,95717 Protein with transmembrane helices 738 21,95122

a The total is based on either the size of the genome in base pairs or the total number of protein coding genes in the annotated genome. Table 4. Number of genes associated with the 25 general COG functional categories

Code Value % agea Description J 154 4.580607 Translation

A 1 0.029744199 Rna processing and modification K 173 5.145746 Transcription

L 153 4.550863 Replication, recombination and repair

B 1 0.029744199 Chromatin structure and dynamics

D 23 0.6841166 Cell cycle control, mitosis and meiosis

Y 0 0 Nuclear structure

V 42 1.2492564 Defense mechanisms

T 85 2.528257 Signal transduction mechanisms

M 94 2.7959547 Cell wall/membrane biogenesis

N 25 0.743605 Cell motility

Z 0 0 Cytoskeleton W 0 0 Extracellular structures U 30 0.89232594 Intracellular trafficking and secretion

O 79 2.3497918 Posttanslational modification, protein turnover,chaperones

C 147 4.3723974 Energy production and conversion

G 191 5.6811423 Carbohydrate transport and metabolism

E 275 8.179655 Amino acid transport and metabolism

F 60 1.7846519 Nucleotide transport and metabolism

H 114 3.3908389 Coenzyme transport and metabolism

I 106 3.1528852 Lipid transport and metabolism

P 159 4.729328 Inorganic ion transport and metabolism

Q 68 2.0226057 Secondary metabolites biosynthesis, transport and catabolism

R 302 8.982749 General function prediction only S 155 4.610351 Function unknown - 1263 37.566925 Not in COGs a The total is based on the total number of protein coding genes in the annotated genome

152 Table 5. Genome features of Mobilicoccus SIT 2 genome comparaison to other Dermatophilaceae species

Strain Accession list Size GC % Gene Protein (Mb) Mobilicoccus NZ_CDGT00000000.1 3.84 70.5 3,377 3,182 SIT 2 Mobilicoccus NZ_BAFE00000000.1 3.54 71.9 3,090 2,895 pelagius Dermatophilus NZ_AUCS00000000.1 2.62 59.4 2,340 2,204 congolensis Kineosphaera NZ_BAHD00000000.1 4.85 70.4 4,375 4,033 limosa Dermacoccus NZ_CP008889.1 3.03 69.1 2,745 2,619 nishinomiyaensis Arsenicicoccus NZ_CP012070.1 3.53 72.7 3,271 3,052 sp. Austwickia NZ_BAGZ00000000.1 3.54 66.1 3,046 2,903 chelonae

153

Reference List

1. Aziz, R. K., D. Bartels, A. A. Best, M. DeJongh, T. Disz, R. A. Edwards, K. Formsma, S. Gerdes, E. M. Glass, M. Kubal, F. Meyer, G. J. Olsen, R. Olson, A. L. Osterman, R. A. Overbeek, L. K. McNeil, D. Paarmann, T. Paczian, B. Parrello, G. D. Pusch, C. Reich, R. Stevens, O. Vassieva, V. Vonstein, A. Wilke, and O. Zagnitko. 2008. The RAST Server: rapid annotations using subsystems technology. BMC.Genomics 9:75. doi:1471-2164-9-75 [pii];10.1186/1471-2164-9-75 [doi]. 2. Dubourg, G., J. C. Lagier, C. Robert, F. Armougom, P. Hugon, S. Metidji, N. Dione, N. P. Dangui, A. Pfleiderer, J. Abrahao, D. Musso, L. Papazian, P. Brouqui, F. Bibi, M. Yasir, B. Vialettes, and D. Raoult. 2014. Culturomics and pyrosequencing evidence of the reduction in gut microbiota diversity in patients with broad- spectrum antibiotics. Int.J.Antimicrob.Agents 44:117-124. doi:S0924-8579(14)00169-1 [pii];10.1016/j.ijantimicag.2014.04.020 [doi]. 3. Gupta, S. K., B. R. Padmanabhan, S. M. Diene, R. Lopez-Rojas, M. Kempf, L. Landraud, and J. M. Rolain. 2014. ARG-ANNOT, a new bioinformatic tool to discover antibiotic resistance genes in bacterial genomes. Antimicrob.Agents Chemother. 58:212-220. doi:AAC.01310-13 [pii];10.1128/AAC.01310-13 [doi]. 4. Hamada, M., T. Iino, T. Iwami, S. Harayama, T. Tamura, and K. Suzuki. 2010. Mobilicoccus pelagius gen. nov., sp. nov. and Piscicoccus intestinalis gen. nov., sp. nov., two new members of the family Dermatophilaceae, and reclassification of Dermatophilus chelonae (Masters et al. 1995) as Austwickia chelonae gen. nov., comb. nov. J.Gen.Appl.Microbiol. 56:427-436. doi:JST.JSTAGE/jgam/56.427 [pii]. 5. Kokcha, S., A. K. Mishra, J. C. Lagier, M. Million, Q. Leroy, D. Raoult, and P. E. Fournier. 2012. Non contiguous-finished genome sequence and description of Bacillus timonensis sp. nov. Stand.Genomic.Sci. 6:346-355. doi:10.4056/sigs.2776064 [doi];sigs.2776064 [pii].

155 6. Lagier, J. C., F. Armougom, M. Million, P. Hugon, I. Pagnier, C. Robert, F. Bittar, G. Fournous, G. Gimenez, M. Maraninchi, J. F. Trape, E. V. Koonin, S. B. La, and D. Raoult. 2012. Microbial culturomics: paradigm shift in the human gut microbiome study. Clin.Microbiol.Infect. 18:1185-1193. doi:10.1111/1469- 0691.12023 [doi];S1198-743X(14)60804-1 [pii]. 7. Lagier, J. C., K. K. El, T. T. Nguyen, F. Armougom, D. Raoult, and P. E. Fournier. 2012. Non-contiguous finished genome sequence and description of Anaerococcus senegalensis sp. nov. Stand.Genomic.Sci. 6:116-125. doi:10.4056/sigs.2415480 [doi];sigs.2415480 [pii]. 8. Mishra, A. K., J. C. Lagier, C. Robert, D. Raoult, and P. E. Fournier. 2012. Non-contiguous finished genome sequence and description of Clostridium senegalense sp. nov. Stand.Genomic.Sci. 6:386-395. doi:10.4056/sigs.2766062 [doi];sigs.2766062 [pii]. 9. Ramasamy, D., A. K. Mishra, J. C. Lagier, R. Padhmanabhan, M. Rossi, E. Sentausa, D. Raoult, and P. E. Fournier. 2014. A polyphasic strategy incorporating genomic data for the taxonomic description of novel bacterial species. Int.J.Syst.Evol.Microbiol. 64:384-391. doi:ijs.0.057091-0 [pii];10.1099/ijs.0.057091-0 [doi]. 10. Stackebrandt, E., W. Frederiksen, G. M. Garrity, P. A. Grimont, P. Kampfer, M. C. Maiden, X. Nesme, R. Rossello-Mora, J. Swings, H. G. Truper, L. Vauterin, A. C. Ward, and W. B. Whitman. 2002. Report of the ad hoc committee for the re- evaluation of the species definition in bacteriology. Int.J.Syst.Evol.Microbiol. 52:1043-1047. doi:10.1099/00207713- 52-3-1043 [doi]. 11. Tindall, B. J., R. Rossello-Mora, H. J. Busse, W. Ludwig, and P. Kampfer. 2010. Notes on the characterization of prokaryote strains for taxonomic purposes. Int.J.Syst.Evol.Microbiol. 60:249-266. doi:ijs.0.016949-0 [pii];10.1099/ijs.0.016949-0 [doi].

156 Article 7:

Genome sequence and description of Paenibacillus ihuae strain GD6 sp. nov. isolated from the stool of a 62-year-old man, France

Charbel Al-Bayssari, Gregory Dubourg, Teresa Cimmino,

Liliane Okdah, Najla Mathlouthi, Thi Tien Nguyen,

Claudia Andrieu, Jaishriram Rathored, Pierre-Edouard Fournier,

Didier Raoult and Jean Marc Rolain*

Submitted in New Microbes and New Infections (NMNI) Impact factor: 2.6

157

Genome sequence and description of Paenibacillus ihuae strain GD6 sp. nov. isolated from the stool of a 62-year-old man, France.

Charbel Al-Bayssari1, Gregory Dubourg1, Teresa Cimmino1, Liliane Okdah1, Najla Mathlouthi1, Thi Tien Nguyen1, Claudia Andrieu1, Jaishriram Rathored1, Pierre-Edouard Fournier1, Didier Raoult 1and Jean Marc Rolain1*

Affiliations: 1 Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergentes, UM 63, CNRS 7278, IRD 198, Inserm U1095, Institut Hospitalo-Universitaire Méditerranée-Infection, Faculté de médecine, Aix-Marseille Université, 27 Boulevard Jean Moulin, 13385 Marseille cedex 05, France

* Corresponding author:

Tel.: +33 4 91 32 43 75;

Fax: +33 4 91 38 77 72

E-mail address: [email protected]

Abstract: 100 words

Text: 1668 words

Figures: 3

Tables: 4

References: 13

Key words: Paenibacillus ihuae, culturomics, taxonogenomics

159

Abstract

Paenibacillus ihuae strain GD6 (= CSUR P892 = DSMZ 45751T) is the new type strain collected from the stool of a 69-year-old French man admitted in intensive care unit and receiving a 10-day course of imipenem at the time of the stool collection. This is a gram-positive, facultative anaerobic, rod-shaped bacterium. We describe here the features of this organism, together with the complete genome sequence and annotation. The genome size is 6,719,043 bp with 49.6 % GC content and contains 6211 protein-coding and 65 sRNA genes including four 5S rRNA genes, one 16S rRNA gene and one 23S rRNA gene.

Key words: Paenibacillus ihuae, culturomics, taxonogenomics

Abbreviations

CSUR: collection de souches de l’unité des Rickettsies

DSM: Deutsche Sammlung von Mikroorganismen

MALDI -TOF MS: Matrix-assisted laser-desorption/ionization time- of-flight mass spectrometry

URMITE: Unité de Recherche sur les Maladies Tropicales et Emergentes

NRPS: non ribosomial peptide synthetase

PKS: polyketide synthase 161

Introduction

Paenibacillus is a genus of facultative anaerobic, endospore-forming gram-positive bacteria, originally included within the genus Bacillus and then reclassified as a separate genus in 1993 [1]. Since this classification, additional transfer to the genus Paenibacillus and proposal for novel strains to be designated as Paenibacillus species have increased. Bacteria belonging to this genus are commonly found in the environment such as soil, water, rhizospher, vegetable matter, forage and insect larvae, but few species have been linked to infections in humans [2,3]. These bacteria have rarely been considered to be pathogenic for humans; however it has been shown to produce a wide range of peptide antibiotics [4].

Paenibacillus ihuae strain GD6 was isolated from the stool of a 69- year-old man admitted in intensive care unit and receiving a 10-day course of imipenem at the time of the stool collection, as part of a culturomics study aiming to isolate all bacterial species present in the human gut [5].

Herein we present a summary of the classification and set of features for Paenibacillus ihuae sp. nov. strain GD6 (= CSUR P892 = DSMZ 45751T) together with the description of the complete genomic sequencing and annotation. These characteristics support the creation of this Paenibacillus ihuae species.

163 Organism information

Classification and features

A stool sample was collected from a 69-year-old man living in France. The study was approved by the ethics committee of the Institut Fédératif de Recherche IFR48, Faculty of Medicine, Marseille, France, under agreement 09-002.

The faecal specimen was preserved at -80 °C after collection. Strain GD6 was isolated on Columbia agar supplemented with 5% sheep’s blood (bioMérieux, Marcy-l’Étoile, France) in aerobic condition at 37°C. Strain GD6 exhibited a 97.4% 16S rRNA sequence identity with Paenibacillus typhae strain xj7 5 (NR_109462.1), the phylogenetically closest bacterial species withstanding in nomenclature (Figure 1). Its 16S rRNA sequence was deposited in GenBank under accession number JX424768. As recommended by Stackebrandt and Ebers [6], This value was lower than the 98.7% 16S rRNA gene sequence threshold to delineate a new species without carrying out DNA-DNA hybridization, thus a new species was created. The spectrum of the strain GD6 was added to our MALDI- TOF MS database.

164 Growth conditions and identification

The stool sample was diluted in phosphate-buffered saline (PBS) (Life Technologies Corporation, UK). 100 µl of obtained inoculum was incubated for 24 to 48 hours on 5% sheep blood-enriched Columbia agar (Biomérieux) at 37°C. Growth was tested under aerobic and anaerobic conditions using AnaeroGenTM Compact (BioMerieux). Gram staining and electron microscopy were performed with a TechnaiG2 Cryo (FEI Company, Limeil-Brevannes, France) at an operating voltage of 200 keV (Figure 2). Cells were grown on 5% sheep’s blood agar for 24 hours. A bacterial suspension was prefixed in 5% (v/v) glutaraldehyde in phosphate buffer (Thermo Fisher Scientific Life Sciences, Waltham, MA, USA) for at least 1 hour at room temperature, washed in the same buffer and stained with 1% (w/v) ammonium molybdate 1%. Oxidase (Becton, Dickinson and Company, Le Pont de Claix, France) and catalase assays (BioMerieux) were performed separately. Biochemical tests were performed using an APIZYM strip (BioMerieux) and an API50CH strip (BioMerieux). In vitro susceptibility to antibiotics was determined using the disc diffusion method (i2a, Montpellier, France) on Muller-Hinton agar with 5% blood.

165 Extended Features Descriptions Colonies obtained were isolated on 5% sheep blood-enriched Columbia agar, and identified using MALDI-TOF. MALDI-TOF identification, measurement and analysis were performed as previously described [7], using a Microflex spectrometer (Bruker). No significant MALDI-TOF MS score was obtained for strain GD6 against the Bruker database, suggesting that our isolate was not a member of a known species. We added the spectrum from strain GD6 to our database.

Genome sequence and assembly

Genomic DNA of strain GD6 was sequenced using MiSeq Technology (Illumina, San Diego, CA, USA) with the mate-pair strategy. The assembly was performed using the gsAssembler from Roche with 90% identity and 40bp as overlap. It leads to 11 scaffolds and 564 large contigs (>1500bp) generating a genome size of 6.71 Mb.

Genome annotation and comparison

Genome was annotated by Rapid Annotation using Subsytem Technology (RAST) bioserver [8]. The predicted bacterial protein sequences were searched against the GenBank database and the Clusters of Orthologous Groups (COGs) databases using BLASTP (E value 1e-03, coverage 0.7 and identity percentage 30%). The tRNAScanSE tool [9] was used to find tRNA genes, whereas

166 ribosomal RNAs were found by using RNAmmer [10]. The resistome was analyzed with ARG-ANNOT (Antibiotic Resistance Gene- ANNOTation) database [11]. The exhaustive bacteriocin database available in our laboratories (Bacteriocins of the URMITE database; http://drissifatima.wix.com/bacteriocins) was performed by collecting all currently available sequences from the databases and from NCBI. Protein sequences from this database allowed putative bacteriocins from human gut microbiota to be identified using BLASTp methodology [12].

The presence of polyketide synthases and nonribosomal peptide- synthetase (PKS/NRPS) was analyzed by discriminating genes with large size using a database realized in our laboratory, predicted proteins were compared against non-redundant GenBank database using blastp and finally examined using antiSMASH. PHAST (PHAge search Tool) was used to identify phage sequences [13]. Phylogenetic relationships with closely related species were determined by MEGA6. The evolutionary history was concluded by using the maximum likelihood method based on the JTT matrix-based model. We compared the genome sequence of Paenibacillus ihuae strain GD6 with those of Paenibacillus graminis strain RSA19 (NZ_ASSG00000000.1), Paenibacillus polymyxa strain DSM 365 (NZ_JMIQ00000000.1) and Paenibacillus massiliensis strain DSM 16942 (NZ_ARIL00000000.1).

167 Results

Phenotypic properties

Paenibacillus ihuae growth was obtained either on aerobic and anaerobic conditions on 5% sheep’s blood–Columbia agar at 37°C. Gram staining showed elongated-shaped Gram positive bacilli. The motility test was positive. Cells grown in trypticase soy broth (TSB) medium have flagellum, as observed using an electron microscopy (Figure 2). Strain GD6 exhibits positive catalase and negative oxidase activity. Acid production was observed for the following carbohydrates with API 50 CH strip (bioMérieux): glycerol, erythritol, D-arabinose, L-arabinose, D-xylose, methyl-βD-xylopyranoside, D- galactose, D-glucose, D-fructose, D-mannose, L-rhamnose, inositol, D-mannitol, methyl-αD-glucopyranoside, N-acetylglucosamine, amygdalin, arbutin, esculin, salicin, D-cellobiose, D-maltose, D- lactose, D—melibiose, D-saccharsoe, D-trehalose, inulin, D-D- melexitose, D-rafinose, starch, glycogene, gentiobiose, D-turanose, D- fucose, L-fucose, L-arabitol, potassium 5-cetogluconate. Differential phenotype characteristics between P. ihuae and other species are shown in table 1. By using API ZYM, positive reactions were observed for: Ivertase (test 1), chitinase and invertase (test2). Paenibacillus ihuae strain GD6 was resistant to oxacillin and metronidazole but was susceptible to cephalosporins (cefotaxime, ceftriaxone, and cefoxitin), carbapenems (imipenem, ertapenem),

168 vancomycin, teicoplanin, lincomycin, gentamycin, amikacin, trimethoprim–sulfamethoxazole, rifampicin and fosfomycin.

Genome properties

The genome of Paenibacillus ihuae strain GD6 is 6,719,043 bp long with 49.6 % GC content. It is composed of 13 scaffolds (CTED00000000.1) composed of 600contigs (LN831198- LN831210).The phylogenetic tree highlights the position based on 16S rDNA of Paenibacillus ihuae strain GD6 (Figure 1) which exhibited 97.4% sequence identity with Paenibacillus typhae strain xj7 (NR_109462.1). A total of 6211 protein-coding genes are annotated; 65 were RNAs (including four 5S, one 16S and one 23S). A total of 4839 genes were assigned as putative function while 445 were assigned as unknown function. The properties of the genome and the comparison with other genomes are summarized in Table 2 and Table 3 respectively. The distribution of genes into COGs functional categories is presented in Table 4. It contains two phages, one questionable and one incomplete, 41.5 and 39.2 kb in size with 50.4% and 44.59 GC content, respectively.

169 Specific features

The analysis of the resistome shows the absence of resistance genes. In silico analysis for polyketide synthase (PKS) and non-ribosomal peptide synthetase (NRPS) revealed the presence of a NRPS organized as a highly modular mode in a massive multi-domain enzyme organized with upstream enzyme clustering of condensation (C), adenylation (A), thiolation (T) or peptidyl carrier. The non-ribosomial polyketide synthase (NRPKs) had a size of 3369 bp and a GC content of 48%. This cluster showed 88% of similarity with the non- ribosomial polyketide synthase of Paenibacillus sp. FSL R5-0912 (Figure 3).

Genome comparison

Here we compared the genome of Paenibacillus ihuae strain GD6 with those of Paenibacillus graminis RSA19, Paenibacillus polymyxa DSM 365 and Paenibacillus massiliensis DSM 16942. The draft genome of Paenibacillus ihuae strain GD6 is bigger in size than those of P. polymyxa DSM 365 and P. massiliensis DSM 16942 (6.71 vs.5.78 and 6.39 Mb, respectively) but smaller than that of P. graminis (6.71 vs. 6.98 Mb). The G+C content of Paenibacillus ihuae strain GD6 is smaller than that of P. graminis RSA19 (49.6% vs. 50.30%) but largest than those of P. polymyxa DSM 365 and P. massiliensis DSM 16942 (49.6% vs. 45.5% and 48.5%).

170 Conclusions

On the basis of phenotypic, phylogenetic and genomic analyses, we propose the creation of Paenibacillus ihuae strain GD6 sp. nov. The strain was isolated from the stool sample of a 69-year-old French man admitted in intensive care unit and receiving a 10-day course of imipenem at the time of the stool collection.

171 Description of Paenibacillus ihuae strain GD6 sp. nov

Paenibacillus ihuae strain GD6 (= CSUR P892 = DSMZ 45751T) is the new type strain collected from the stool sample of a 69-year-old French man admitted in intensive care unit and receiving a 10-day course of imipenem at the time of the stool collection during a culturomics study aiming to isolate all bacterial species present in the human gut. Paenibacillus ihuae is a gram-positive, facultative anaerobic, rod-shaped bacterium that exhibits positive catalase and negative oxidase activity. Growth was obtained under aerobic and anaerobic conditions on 5% sheep’s blood–Columbia agar at 37°C. Using API ZYM and API 50CH, positive reactions were observed for ivertase (test 1), chitinase and invertase (test2), glycerol, erythritol, D- arabinose, L-arabinose, D-xylose, methyl-βD-xylopyranoside, D- galactose, D-glucose, D-fructose, D-mannose, L-rhamnose, inositol, D-mannitol, methyl-αD-glucopyranoside, N-acetylglucosamine, amygdalin, arbutin, esculin, salicin, D-cellobiose, D-maltose, D- lactose, D—melibiose, D-saccharsoe, D-trehalose, inulin, D-D- melexitose, D-rafinose, starch, glycogene, gentiobiose, D-turanose, D- fucose, L-fucose, L-arabitol, potassium 5-cetogluconate. Cells of P. ihuae strain GD6 were resistant to oxacillin and metronidazole but susceptible to other antibiotics. The analysis of the genome showed the absence of antibiotic resistance genes but the presence of a non- ribosomal polyketide synthase (NRPS).

172 Genome sequence accession number

The genome of Paenibacillus ihuae strain GD6 has been submitted to the EBI database under bioproject ID PRJEB549 with GenBank accession number CTED01000000 and 16S RNA accession number JX424768.

Acknowledgements

We thank Miss L. Hadjadj for technical assistance. This project was funded by the French

Centre National de la Recherche Scientifique (CNRS) and Infectiopole Sud Fundation.

Conflict of Interest

None declared.

173 Figures Legends

Figure 1: Phylogenetic tree highlighting position of Paenibacillus ihuae strain GD6 relative to other type strains within Paenibacillus genus. Sequences were aligned using MUSCLE, and phylogenetic inferences were obtained using maximum-likelihood method within MEGA6. Numbers at nodes are percentages of bootstrap values obtained by repeating analysis to generate majority consensus tree 1000 times.

Figure 2: Transmission electron microscopy of Paenibacillus ihuae strain GD6 using a TechnaiG2 Cryo (FEI Company, Limeil- Brevannes, France) at an operating voltage of 200 keV. Scale bar = 500 nm.

Figure 3: Phylogenetic of cluster representative of non-ribosomal peptide synthase Paenibacillus ihuae strain GD6; Comparison of non-ribosomal peptide-synthetase (NRPS) of Paenibacillus sp. GD6 with closer cluster in other species. Percentages of identity are indicated for homologs found in the cluster of (WP 054942807.1) non-ribosomal peptide synthetase of Paenibacillus sp. GD6 and closer cluster in other species.

174 Tables’ legends

Table 1: Differential characteristics of Paenibacillus ihuae strain GD6 and phylogenetically close members of other Paenibacillus species.

Table 2: Genome features of Paenibacillus ihuae strain GD6.

Table 3: Genomic comparison of Paenibacillus ihuae strain GD6 with other Paenibacillus species.

Table 4: Distribution of genes into COGs functional categories.

175 Figure 1: Phylogenetic tree highlighting position of Paenibacillus ihuae strain GD6 relative to other type strains within Paenibacillus genus. Sequences were aligned using MUSCLE, and phylogenetic inferences were obtained using maximum-likelihood method within MEGA6. Numbers at nodes are percentages of bootstrap values obtained by repeating analysis to generate majority consensus tree 1000 times.

176 Figure 2: Transmission electron microscopy of Paenibacillus ihuae

strain GD6 using a TechnaiG2 Cryo (FEI Company, Limeil-

Brevannes, France) at an operating voltage of 200 keV.

Scale bar = 500 nm.

177 Figure 3: Phylogenetic of cluster representative of non-ribosomal peptide synthase Paenibacillus ihuae strain GD6; Comparison of non- ribosomal peptide-synthetase (NRPS) of Paenibacillus sp. GD6 with closer cluster in other species. Percentages of identity are indicated for homologs found in the cluster of (WP 054942807.1) non-ribosomal peptide synthetase of Paenibacillus sp. GD6 and closer cluster in other species.

178 Table 1: Differential characteristics of Paenibacillus ihuae strain GD6 and phylogenetically close members of other Paenibacillus species.

+, positive result; −, negative result; NA, data not available. Test P. ihuae GD6 P. graminis P. polymyxa P. massiliensis Glycerol + + + - D-Arabinose + NA - - L-Arabinose + + + NA D-Xylose + + + + D-Ribose - - + - D-Trehalose + + + NA D-Galactose + + NA NA Starch + NA + - D-Glucose + + + -

1 D-Lactose + + + NA 79 D-Mannose + NA + - L-Rhamnose + - - - D-Mannitol + + + + Inulin + + - + D-Rafinose + NA + + D-Turanose + NA + - D-Melezitose + + - + Methyl α-D-gluopyranoside + + + + Methyl α-D-mannopyranoside - - + NA Table 2: Genome features of Paenibacillus ihuae strain GD6.

Attribute Value

Size (bp) 6719043

G+C content (bp) 49.6

RNAs gene 65

5S rRNA 4

16S rRNA 1

23S rRNA 1

Protein coding gene 6211

Genes with unknown function 445

Genes assigned to COGs 5284

Genes associated to PKS or NRPS 1

Genes associated to toxin/antitoxin 0

Genes associated to resistome 0

180 Table 3: Genomic comparison of Paenibacillus ihuae strain

GD6 with other Paenibacillus species.

Species strain Size (Mb) GC% Gene content

Paenibacillus ihuae GD6 6.71 49.6 6211 Paenibacillus graminis RSA19 6.98 50.30 6379 Paenibacillus polymyxa DSM 365 5.78 45.5 5031 Paenibacillus massiliensis DSM 16942 6.39 48.5 5461

181 Table 4: Distribution of genes into COGs functional categories.

Code Value % of Total Description A 2 0.032 RNA processing and modification B 1 0.016 Chromatin structure and dynamics C 204 3.28 Energy production and conversion D 50 0.8 Cell cycle control, cell division, chromosome partitioning E 364 5.9 Amino acid transport and metabolism F 129 2.07 Nucleotide transport and metabolism G 591 9.51 Carbohydrate transport and metabolism H 193 3.1 Coenzyme transport and metabolism I 108 1.73 Lipid transport and metabolism J 222 3.6 Translation, ribosomal structure and biogenesis K 578 9.306 Transcription L 195 3.13 Replication, recombination and repair M 263 4.23 Cell wall/membrane/envelope biogenesis N 97 1.56 Cell motility O 136 2.2 Posttranslational modification, protein turnover, chaperones P 290 4.67 Inorganic ion transport and metabolism Q 91 1.46 Secondary metabolites biosynthesis, transport and catabolism R 641 10.32 General function prediction only S 445 7.16 Function unknown T 484 7.8 Signal transduction mechanisms U 65 1.04 Intracellular trafficking, secretion, and vesicular transport V 134 2.15 Defense mechanisms W 0 0 Extracellular structures X 0 0 Nuclear structure Z 1 0.016 Cytoskeleton - 927 14.92 Not in COG

182 References

1. Ash C, Priest FG, Collins MD. Molecular identification of rRNA group 3 bacilli (Ash, Farrow, Wallbanks and Collins) using a PCR probe test. Proposal for the creation of a new genus Paenibacillus. Antonie Van Leeuwenhoek. 64(3-4), 253–60.

2. Pinho-Gomes A-C, Nasir A, Mosca R, Mirza S, Kadir I. Intraoperative diagnosis of mitral valve endocarditis secondary to Paenibacillus provencensis. Ann. R. Coll. Surg. Engl. , e1–e2 (2016).

3. Ouyang J, Pei Z, Lutwick L, et al. Case report: Paenibacillus thiaminolyticus: a new cause of human infection, inducing bacteremia in a patient on hemodialysis. Ann. Clin. Lab. Sci. 38(4), 393–400 (2008).

4. Li J, Beatty PK, Shah S, Jensen SE. Use of PCR-targeted mutagenesis to disrupt production of fusaricidin-type antifungal antibiotics in Paenibacillus polymyxa. Appl. Environ. Microbiol. 73(11), 3480–9 (2007).

5. Lagier J-C, Armougom F, Million M, et al. Microbial culturomics: paradigm shift in the human gut microbiome study. Clin. Microbiol. Infect. 18(12), 1185–1193 (2012).

6. Stackebrandt E EJ. Taxonomic parameters revisited: tarnished gold standards. Microbiol. today. (33), 152–5 (2006).

7. Seng P, Rolain JM, Fournier PE, La SB, Drancourt M, Raoult D. MALDI-TOF-mass spectrometry applications in clinical microbiology. Future.Microbiol. 5(1746-0921 (Electronic)), 1733–-1754 (2010).

183 8. Aziz RK, Bartels D, Best AA, et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 9, 75 (2008).

9. Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25(5), 955–64 (1997).

10. Lagesen K, Hallin P, Rødland EA, Staerfeldt H-H, Rognes T, Ussery DW. RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res. 35(9), 3100–8 (2007).

11. Gupta SK, Padmanabhan BR, Diene SM, et al. ARG-ANNOT, a new bioinformatic tool to discover antibiotic resistance genes in bacterial genomes. Antimicrob.Agents Chemother. 58(1), 212–20 (2014).

12. Drissi F, Buffet S, Raoult D, Merhej V. Common occurrence of antibacterial agents in human intestinal microbiota. Front. Microbiol. 6, 441 (2015).

13. Zhou Y, Liang Y, Lynch KH, Dennis JJ, Wishart DS. PHAST: a fast phage search tool.

Nucleic Acids Res. 39(Web Server issue), W347–52 (2011).

184 CONCLUSION ET PERSPECTIVES

Au terme de ce travail, nous avons confirmé que la résistance aux antibiotiques est devenue une préoccupation universelle et constitue un problème majeur de santé publique. En effet, ces dernières années, nous avons assisté à une augmentation mondiale fulgurante de la résistance aux antibiotiques, en particulier chez les bactéries à Gram négatif. Parmi ces antibiotiques, la résistance aux β- lactamines et plus particulièrement aux carbapénèmes est d’incidence croissante. Face à cette situation inquiétante, la problématique essentielle reste de trouver les solutions à proposer pour contrecarrer cette diffusion rapide de la résistance. De ce fait, la lutte contre ces BMR peut se faire par la prévention qui nécessite obligatoirement une connaissance approfondie et avérée de la situation globale de leur dissémination à travers le monde afin de comprendre leurs mécanismes de transmission et de trouver les déterminants de la résistance pour pouvoir par la suite mettre en place des outils de détection et de surveillance efficaces.

Notre travail de Thèse de Doctorat ayant été réalisé dans un environnement méditerranéen, entre la France et la Tunisie, nous avons rédigé une revue de littérature reprenant toutes les publications qui ont été rapportées dans tous les pays méditerranéens concernant la résistance des bacilles à Gram négatif aux carbapénèmes. Dans cette

185 revue, nous avons présenté un aperçu sur les mécanismes enzymatiques de la résistance aux carbapénèmes chez les bacilles à Gram négatif, particulièrement les entérobactéries, les bactéries du genre Pseudomonas et Acinetobacter, tout en accordant une attention particulière sur l'épidémiologie moléculaire des gènes de résistance à ces antibiotiques décrits jusqu'ici dans le bassin méditerranéen incluant 11 pays Européens (l’Albanie, la Bosnie, l’Herzégovine, la Croatie, l’Espagne, la France, la Grèce, l’Italie, Malte, Montenegro, Monaco et la Slovénie), 5 pays Asiatiques (Chypres, Israël, le Liban, la Syrie et la Turquie) et 5 pays Africains (l’Algérie, l’Egypte, la Libye, le Maroc et la Tunisie).

Par ailleurs, au cours de cette thèse, nous nous sommes intéressés à la caractérisation des mécanismes de la résistance aux β- lactamines chez des bacilles à Gram négatif fermentants (E. coli et K. pneumoniae) et non fermentants (A. baumannii et P. aeruginosa) isolés de patients hospitalisés dans des hôpitaux tunisiens et libyens. Les résultats de notre étude ont permis de fournir des données sur l’épidémiologie moléculaire de ces souches en Tunisie et en Libye. Ce type d'étude d’actualité et d'incidence croissante s’intègre parmi les nombreuses études de surveillance mondiale et représente un des éléments épidémiologiques essentiels qui peut être incorporé dans un programme plus global de lutte contre la dissémination des bactéries multi-résistantes.

186 Les résultats de cette étude, concernant les BGN-F, ont révélé un taux élevé (66.6%) d’entérobactéries (43 E. coli et 15 K. pneumoniae) qui produisent des BLSE. La recherche moléculaire du support génétique a montré une diversité génétique de ces BLSE et ce chez les souches tunisiennes et libyennes: le type CTX-M a été détecté chez 72.30% des isolats, le type TEM chez 47.69% des souches et

27.69% des isolats hébergeaient le gène blaSHV. Cette étude confirme de ce fait la propagation internationale du gène blaCTX-M-15. Par ailleurs, notre étude est la première à rapporter la détection de différents variants communs entre les isolats tunisiens et la libyens (CTX-M-15, TEM-1, SHV-1, SHV-2, SHV-11, SHV-12 et SHV-28) ainsi que l’émergence de nouveaux variants décrits pour la première fois (SHV-26, SHV-38, SHV-132 et SHV-187). Quant à la résistance à l’imipénème, nous avons détecté l’émergence de 10 souches de K. pneumoniae, isolées de patients hospitalisés dans les hôpitaux tunisiens et libyens, productrices de l’enzyme OXA-48 rendant ainsi les options du traitement des infections causées par ce germe plus restreintes. En outre, en utilisant la technique de MLST pour rechercher la relation clonale entre les souches KpBLSE, nous avons pu identifier 15 différents clones ou séquences types (ST) dont 12 ST déjà connues (ST20, ST17, ST29, ST 100, ST101, ST111, ST414, ST969, ST1065, ST1112, ST1322 et ST1657) et 3 nouvelles ST décrites pour la première fois dans cette étude (ST1949, ST1950 et ST1951).

187 D’autre part, concernant les BGN-NF, nos résultats rapportent pour la première fois en Libye des souches de P. aeruginosa qui produisent la carbapénèmase VIM-2. De plus, toutes ces souches présentent des mutations au niveau des séquences de leur gène oprD ce qui confirme leur résistance vis à vis de l’imipénème. L’analyse MLST réalisée pour toutes les souches de P. aeruginosa résistantes à l’imipénème a révélé que celles-ci appartiennent à 13 différents types de ST, dont 8 types de ST déjà connus (ST227, ST235, ST593, ST660, ST662, ST699, ST911 et ST1582) et 5 nouvelles séquences type (ST1924, ST1925, ST1926, ST1927 et ST1928). La ST majoritaire dans notre étude est la ST911 suivie de la ST235.

Par ailleurs, concernant les souches d’A. baumannii résistantes à l’imipénème, après l’analyse moléculaire des déterminants de cette résistance, les résultats de notre étude ont montré la production des oxacillinases OXA-23, OXA-24, OXA-58 et OXA-48 et de la métallo- β-lactamase NDM-1. Il faut signaler que notre étude est la première étude qui décrit la NDM-1 en Libye. Le génotypage des souches d’A. baumannii a été également déterminé par la méthode MLST. Les résultats montrent une diversité clonale des souches isolées au niveau des hôpitaux tunisiens et libyens. En effet, de multiples STs ont été décrites pour la première fois en Tunisie (ST1, ST2, ST164, ST310, ST570, ST602, ST623 et ST636) et en Libye (ST1, ST2, ST20, ST81, ST85, ST164, ST588, ST589, ST590, ST591, ST592, ST593, ST594,

188 ST595, ST596, ST597, ST598, ST599, ST600, ST601 et ST602). La ST majoritaire dans notre étude est la ST2 qui a été déjà rapportée dans plusieurs pays du bassin méditerranéen.

Finalement, cette étude est la première étude qui s’est intéressée à l’émergence et à la dissémination des BLSE et des carbapénèmases chez les BGN en Libye ce qui nous a permis de parfaire et d’enrichir nos connaissances sur la situation de la résistance aux β-lactamines chez les BGN dans le bassin méditerranéen. Les résultats obtenus indiquent une émergence rapide des bactéries productrices de β-lactamases en Libye et en Tunisie soulignant la nécessité d'une surveillance continue des BMR au sein des hôpitaux tunisiens et libyens en particulier dans les unités de soins intensifs qui sont le plus souvent associés à un taux élevé de mortalité.

Des mesures de contrôle devraient être envisagées rapidement afin d’instaurer un système de veille nationale dans les deux pays pour pouvoir superviser l'émergence et la propagation des gènes codant surtout pour les carbapénèmases. Il est donc impératif de mettre en place un système de contrôle de l’application stricte des mesures d’hygiène (surtout l’hygiène des mains des soignants, des patients et de leur environnement hospitalier), d’équiper les laboratoires par des outils permettant l’identification certaine des bactéries et la détection rapide de la résistance aux antibiotiques et de développer des nouvelles techniques plus efficaces pour investiguer la résistance aux

189 antibiotiques chez les BMR dans un but ultime de pouvoir arrêter leur dissémination.

Suite au développement des nouveaux outils de séquençage à haut débit et d’analyse bioinformatique, de nombreuses études, ayant utilisé l’approche du séquençage du génome pour étudier la résistance aux antibiotiques, ont permis de mettre en évidence les véhicules des gènes de résistance à plusieurs familles d’antibiotiques. Les études récentes démontrant des sources anciennes et/ou environnementales des gènes de résistance aux antibiotiques, devraient nous encourager à rechercher de nouveaux gènes de résistance à partir des métagénomes du sol, de l’eau, de l’environnement et des animaux qui représentent sans doute de très importants réservoirs de gènes de résistance jamais explorés jusqu’ici.

190 REMERCIEMENTS

A prime abord, j’adresse mes vifs remerciements, ma gratitude infinie et l’expression de mon profond respect à mon encadreur français Monsieur Jean-Marc ROLAIN. Votre vision et votre passion ont su nourrir mon intérêt scientifique. Merci de m'avoir montré à me surpasser en recherchant toujours l’excellence. Mon admiration envers vos accomplissements est absolue et j’ai grandement apprécié apprendre de vous. Un grand merci de m’avoir offert cette opportunité.

Mes remerciements s’adressent également à mon encadreur tunisien Monsieur Chedly CHOUCHANI pour sa disponibilité, sa compréhension, sa bonne humeur et ses qualités humaines que chacun dans sa profession se plaît à lui reconnaître. Je suis reconnaissante de l’énergie et du temps que vous avez voué à mon encadrement. Que ce travail, bien modeste, marquerait combien je vous suis obligée.

Il m’est particulièrement agréable de remercier Madame Marie KEMPF, Maître de Conférences à l’Université d’Angers, pour m’avoir infiniment honoré en acceptant de rapporter ce travail.

191

Je remercie vivement Monsieur Taoufik GHRAIRI, Maître de Conférences à l’Université Tunis el Manar, d’avoir accepté d’être rapporteur de cette thèse et de juger ce travail.

J’exprime ma très grande considération à Monsieur Philippe COLSON, Professeur à l’Université d’Aix-Marseille, d’avoir accepté d’examiner et d’évaluer ce travail.

Je suis très sensible à l’honneur que me fait Madame Imane ZOUARI, Professeur à l’Université de Tunis el Manar, pour m’avoir infiniment honoré en acceptant de présider le jury de cette thèse.

La richesse de l'équipe de l’URMITE repose sur la diversité de ses membres et la complémentarité des connaissances. Je tiens à remercier tous les étudiants: Charbel, merci de ton enthousiasme contagieux je n’oublierai jamais tout ce que tu as fait pour moi, Sofiane de ton positivisme, Liliane de ton écoute, Teresa de ta bonne humeur, Lucie de ta sympathie, Abiola de ta générosité, Elisa de ton amabilité. Les liens d'amitiés qui nous unissent sauront toujours franchir les frontières qui nous séparent. Merci Camille, Adele, Salma, Win, Stéphanie, Sophie, Cédric, Sherley, Thibaud, Alice, Vincent, Kodjovi, Rita, Joanne, Poonam et Sushim. J’ai fait de si belles rencontres et je me sens tellement enrichie que je recommencerai sans hésiter.

193

Je tiens à adresser un merci particulier à la technicienne Linda, pour son aide précieuse et son assistance morale.

Je ne terminerai pas sans remercier Madame Valérie FILOSA pour son amabilité, sa compréhension et sa sympathie. Qu’elle trouve ici le témoignage de ma profonde gratitude.

Finalement, j’adresse mes remerciements à toutes les personnes qui ont contribué de près ou de loin à la réussite de ce travail et que j’aurais malencontreusement oubliées. Qu’elles trouvent ici mes excuses les plus sincères.

195

DEDICACE

A mes très chers parents Hedia et Samir qui m’ont tout donné sans rien en retour, qui m’ont éclairé le chemin de la vie par leur grand amour, leur dévouement exemplaire et par les énormes sacrifices qu’ils m’ont consentis durant mes études. Que ce modeste travail soit le témoignage sincère et affectueux de ma profonde reconnaissance et de mon amour infini.

A ma sœur Salma pour son affection, son soutien et ses encouragements. Je lui exprime ma gratitude et mon dévouement.

A la mémoire de ma grand-mère bien aimée « Mama Halima » que Dieu repose son âme en paix.

A tous ceux que j'aime...

197

RESUME L’augmentation et la dissémination de la résistance aux β-lactamines chez les bacilles à Gram négatif, particulièrement les Entérobactéries, les bactéries du genre Pseudomonas et Acinetobacter, représentent un problème majeur de santé publique. Les infections nosocomiales causées par ces bactéries multi-résistantes (BMR) ont conduit à une augmentation de la mortalité, de la morbidité et du coût de traitement. L’utilisation abusive et non contrôlée de ces antibiotiques a grandement contribué à la large diffusion de cette résistance. Ainsi, face à cette préoccupation mondiale et suite à de nombreuses recommandations, plusieurs études épidémiologiques et moléculaires ont été rapportées afin de contrôler et de surveiller la diffusion et la dissémination des BMR. Contrairement à de nombreuses régions dans le monde, il existe peu d’informations concernant la caractérisation moléculaire des gènes de résistance aux β-lactamines des bacilles à Gram négatif isolés en Tunisie et surtout en Libye. C’est dans cette optique que ce projet de Thèse de Doctorat s’articule avec comme objectifs: (i) mettre en évidence la prévalence des bacilles à Gram négatifs multi-résistants isolés aux niveaux des hôpitaux tunisiens et libyens (ii) identifier le support génétique de la résistance aux β-lactamines de ces souches cliniques (iii) étudier la diversité clonale des souches multi-résistantes par typage moléculaire (iiii) étudier l’épidémiologie moléculaire de ces BMR dans ces pays afin de maîtriser le processus décisionnel du traitement et l’identification rapide des épidémies en mettant en œuvre les mesures de contrôle appropriées de la propagation des infections et surtout en développant de nouveaux outils et logiciels de diagnostic et de surveillance des BMR au sein des établissement de santé de ces pays méditerranéens. Mots clés: bacilles Gram-négatif, bassin méditerranéen, isolats cliniques multi-résistants aux β-lactamines, études moléculaires des mécanismes de résistance aux β-lactamines, études épidémiologiques. SUMMARY The increase and spread of β-lactam resistance in gram negative bacteria especially Enterobacteriaceae, Pseudomonas and Acinetobacter (E.P.A) species have become a major concern worldwide. The hospital-acquired infections caused by MDR bacteria have led to an increase in mortality, morbidity and cost of treatment. The frequent misuse of antibiotic drug has greatly contributed to worldwide dissemination of antibiotics resistance. Front of this worldwide concern, and various recommendations, several epidemiological and molecular studies have been reported in order to control the spread and the dissemination of these MDR. Unlike many parts of the world, there is little information concerning the molecular characterization of the β-lactam resistance genes of Gram-negative bacilli isolated in Tunisia and especially in Libya. Therefore, it is in this context that the project of this thesis was conducted with essential objectives: (i) highlight the prevalence of multi-resistant Gram negative bacilli isolated in Tunisian and Libyan hospitals (ii) identify the genetic support of resistance to β-lactams of these clinical strains (iii) study the clonal diversity of the multi- resistant strains by molecular typing (iii) study the molecular epidemiology of these BMRs in these countries in order to control the decision-making process of the treatment and the rapid identification of epidemics by implementing appropriate control measures for the spread of infections and especially developing new tools and software for the diagnosis and monitoring of potential MDR bacteria in Mediterranean countries. Keywords: Gram-negative bacilli, mediterranean basin, clinical isolates multi-resistant to β- lactams, molecular studies of the mechanisms of β-lactam resistance, epidemiological studies.