DOCSLIB.ORG

A Differential Metabarcoding Approach to Describe Taxonomy Profiles Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Differential Metabarcoding Approach to Describe Taxonomy Profiles Of 1 SUPPLEMENTARY MATERIAL 2 3 A differential metabarcoding approach to describe taxonomy profiles 4 of Bacteria and Archaea in the Saltern of Margherita di Savoia (Italy) 5 6 Claudia Leoni1,a, Mariateresa Volpicella2,a,*, Bruno Fosso1,a, Caterina Manzari1, Elisabetta 7 Piancone2, Maria C.G. Dileo2, Erika Arcadi3, Michail Yakimov4, Graziano Pesole1,2 and Luigi R. 8 Ceci1,* 9 10 1Institute of Biomembranes, Bioenergetics and Molecular Biotechnologies, CNR, Via Amendola 11 122/O, 70126 Bari, Italy; 2Department of Biosciences, Biotechnologies and Biopharmaceutics, 12 University of Bari “Aldo Moro”, Via Orabona 4, 70126 Bari, Italy; 3Stazione Zoologica Anton 13 Dohrn, Via dei Mille 46, 98057 Milazzo (Messina), Italy; 4Institute for Biological Resources and 14 Marine Biotechnology, CNR, Spianata San Raineri, 86 - 98122 Messina, Italy. 15 16 a These Authors have contributed equally to this work. 17 18 *Correspondence: 19 Mariateresa Volpicella: [email protected] 20 Luigi R. Ceci: [email protected]. 21 22 23 List of material: 24 25 Table S1. List of primers. 26 Table S2. Cell counts (cells/ml) obtained from the different waters of the saltern of 27 MdS. 28 Table S3. Summary of pairwise Dunn tests. 29 Table S4. Pearson's product moment correlation coefficient (PC) between ASVs and 30 salinity. 31 Table S5. Relative abundances of bacterial and archaeal genera obtained by 32 metabarcoding analysis. 33 Table S6. Relative abundances of bacterial and archaeal genera obtained by 34 combination of metabarcoding and CARD-FISH data. 35 36 Figure S1. Detection of bacteria and archaea cells by CARD-FISH analysis. 37 Figure S2. Rarefaction curves of 16S rRNA ASVs for the assayed ponds of the MdS 38 saltern. 39 Figure S3. Heat maps of microbial amplicons similarity matrix of MdS ponds. 40 41 42 43 Table S1. List of primers for PCR and probes for CARD-FISH. 44 Name Sequence (5’-3’) Ref. Eub338 I GCTGCCTCCCGTAGGAGT 23,24 Eub338 II GCAGCCACCCGTAGGTGT 23,24 Eub338 III GCTGCCACCCGTAGGTGT 23,24 Arch915 GTGCTCCCCCGCCAATTCCT 25 B-V5* TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG/ATTAGATACCCYGGTAGTCC 28,29 A-V6* GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG/ACGAGCTGACGACARCCATG 28,29 Arch_349F* TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG/GYGCASCAGKCGMGAAW 30 Arch_806R* GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG/GGACTACVSGGGTATCTAAT 30 45 * The first part of the primer, before the slash, corresponds to the Nextera transposase sequence, 46 required by the Illumina protocol. 47 Symbols for degenerate nucleotides are according to the IUPAC nomenclature: Y: —C/T; R: —A/G; 48 S: —G/C; K: —G/T; M: —A/C; W—: A/T; V—: A/C/G. 49 50 Table S2. Cell counts (cells/ml) obtained from the different waters of the saltern of MdS. Ponds are indicated by conventional names, with 51 salinity reported as salt percentage (w/v). Three different counts were carried out for each pond. B/T, A/T and (B+A)/T are the relative abundances 52 of bacterial (B), archaeal (A) and living prokaryotic cells (B + A), respectively, compared to total cells (T) as counted by DAPI staining. B/ A/ DAPI Bacteria Archaea B/T A/T (B+A)/T DAPI Bacteria Archaea (B+A) (B+A) dev dev dev (%) (%) (%) (%) (%) Alma Dannata 2.70E+05 5.04E+04 1.46E+04 3.74E+04 5.80E+03 3.43E+03 18.7 5.4 22.5 24.1 (4.9%) 77.5 Polmone (5.2%) 3.11E+05 2.70E+05 3.51E+04 1.12E+04 1.48E+04 3.85E+03 86.8 11.3 88.5 11.5 98.1 Zero (8.4%) 2.09E+05 1.93E+05 1.31E+04 1.04E+04 7.39E+03 1.77E+03 92.3 6.3 93.6 6.4 98.6 Fine (13.1%) 3.10E+05 1.94E+05 1.08E+05 1.76E+04 2.05E+04 2.92E+03 62.6 34.8 64.2 35.8 97.4 Paradiso (14.5%) 5.06E+05 3.60E+05 1.26E+05 3.10E+04 7.93E+03 1.24E+04 71.1 24.9 74.1 25.9 96.0 Inizio (24.1%) 2.80E+05 1.07E+05 1.58E+05 1.04E+04 1.02E+04 1.36E+04 38.2 56.4 40.4 59.6 94.6 Armellina 3.42E+05 1.81E+05 1.38E+05 2.00E+04 2.09E+04 9.73E+03 52.9 40.4 56.7 43.3 93.3 (30.6%) Cappella (34.6%) 2.47E+05 1.24E+05 9.69E+04 1.20E+04 1.06E+04 1.04E+04 50.2 39.2 56.1 43.9 89.4 Imperatrice 1.84E+05 4.70E+04 9.60E+04 1.16E+04 5.32E+03 1.04E+04 25.5 52.2 32.9 67.1 77.7 (36.0%) 53 54 Table S3. Summary of pairwise Dunn tests. Pond names and salinities are listed in columns and 55 rows. The inferred adjusted p-values are shown. Significant p-values are in bold and starred (*≤ 0.05, 56 **≤ 0.01, ***≤0.001). 57 Bacteria: Pond Alma Fine Paradiso Inizio Armellina Cappella Imperatrice Polmone (Salinity Dannata (13.1%) (14.5%) (24.1%) (30.6%) (34.6%) (36.0%) (5.2%) %) (4.9%) Paradiso 0.4387 (14.5%) Inizio 0.1085 0.1400 (24.1%) Armellina 0.0448* 0.0614 0.3217 (30.6%) Cappella 0.0059** 0.0090** 0.0992 0.2053 (34.6%) Imperatrice 0.0118* 0.0175* 0.1518 0.2858 0.2858 (36.0%) Alma Dannata 0.2202 0.2685 0.3217 0.1773 0.0402* 0.0679 (4.9%) Polmone 0.2685 0.2202 0.0320* 0.0103* 0.0009*** 0.0020** 0.0825 (5.2%) Zero 0.3217 0.1400 0.1085 0.0103* 0.0027** 0.0002*** 0.0004*** 0.0320* (8.4%) 58 59 Archaea: Pond Fine Paradiso Inizio Armellina Cappella (Salinity (13.1%) (14.5%) (24.1%) (30.6%) (34.6%) %) Paradiso 0.2456 (14.5%) Inizio 0.0234* 0.0968 (24.1%) Armellina 0.0004*** 0.0037** 0.0843 (30.6%) Cappella 0.0109* 0.0541 0.3798 0.1422 (34.6%) Imperatrice 0.3798 0.0234* 0.0968 0.5000 0.0843 (36.0%) 60 61 Table S4. Pearson's product moment correlation coefficient (PC) between ASVs and salinity. 62 63 Bacteria: Pearson ASV P-value taxonomy Correlation aa1f4fd53f406a3613fcf5661e0b8035 0.97 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 99c793755e7c20d3416d3e113d63475e 0.96 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter da3ae34876ceb295b8846f57e0bf98fc 0.96 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter b7c04eaa669a35ed42a78381dfc78138 0.96 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 2c815d6b32f92298b7578702b0dd1510 0.96 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter be1f4e92c0ef762f0a1b05758e0a4bf9 0.95 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured 3a3161d5e80646e5938102d9d23acf5f 0.95 0.000 Chitinophagales d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured 34b2ada6eb11c95621549b76a674c1c1 0.94 0.000 Chitinophagales 2119951188cda0bdd84b64568e593a4a 0.94 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter c47adbe8321dce0f73d55e94e3e72780 0.93 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__Salinibacter_ruber d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured e5936cfb1715b6b9b7e14c4f953f94d3 0.92 0.000 Chitinophagales d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured b1189c366efdb76647929e59bc67f874 0.92 0.000 Chitinophagales d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured 57f64b6d2bae0c9eeed6063e20153acd 0.91 0.001 Chitinophagales ac3da6eb5e5938d0b631004834859280 0.88 0.002 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter 23c128e062a85e3f9edad481d971abb5 0.86 0.003 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter c2962efec2da9314edd38d7167b6aaea 0.86 0.003 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 0d88996a0249a67e3208cb890f339219 0.81 0.009 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter 2cd0e6986ba98bb71bc7cc679fd6e2c6 0.80 0.010 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 49ef03099317acbf97e22e34a253fcb2 0.79 0.011 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 3092c2440ff9a90461054bf40642f489 0.79 0.011 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter d__Bacteria;p__Proteobacteria;c__Gammaproteobacteria;o__Nitrococcales;f__Nitrococcaceae;g__uncultured Nitrococcaceae;s__uncultured 00a224b16122e353591ac23cc72d6e7d 0.78 0.013 Nitrococcaceae eaed4b8971f40866bd1f31e062f579f9 0.77 0.016 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter 038e1e6407a6fbf106d92d05eb71621d 0.74 0.022 d__Bacteria;p__Proteobacteria;c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__Sediminimonas;s__uncultured Sediminimonas d__Bacteria;p__Desulfobacterota;c__Desulfuromonadia;o__Bradymonadales;f__Bradymonadaceae;g__Bradymonadaceae;s__uncultured 0869c07ab138130212f6a46f19029879 0.74 0.024 Bradymonadaceae d__Bacteria;p__Desulfobacterota;c__Desulfuromonadia;o__Bradymonadales;f__Bradymonadaceae;g__Bradymonadaceae;s__uncultured d4d4a7b2415a45986d9a4418acbff493 0.73 0.025 Bradymonadaceae d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured fc3010d03af677da6c45d7ca8c5f6d1e
Load more

Recommended publications
  • Genome Sequence and Description of Haloferax Massiliense Sp. Nov., a New Halophilic Archaeon Isolated from the Human Gut
    Extremophiles (2018) 22:485–498 https://doi.org/10.1007/s00792-018-1011-1 ORIGINAL PAPER Genome sequence and description of Haloferax massiliense sp. nov., a new halophilic archaeon isolated from the human gut Saber Khelaifa1 · Aurelia Caputo1 · Claudia Andrieu1 · Frederique Cadoret1 · Nicholas Armstrong1 · Caroline Michelle1 · Jean‑Christophe Lagier1 · Felix Djossou2 · Pierre‑Edouard Fournier1 · Didier Raoult1,3 Received: 14 November 2017 / Accepted: 5 February 2018 / Published online: 12 February 2018 © The Author(s) 2018. This article is an open access publication Abstract By applying the culturomics concept and using culture conditions containing a high salt concentration, we herein isolated the frst known halophilic archaeon colonizing the human gut. Here we described its phenotypic and biochemical characteriza- tion as well as its genome annotation. Strain Arc-HrT (= CSUR P0974 = CECT 9307) was mesophile and grew optimally at 37 °C and pH 7. Strain Arc-HrT was also extremely halophilic with an optimal growth observed at 15% NaCl. It showed gram-negative cocci, was strictly aerobic, non-motile and non-spore-forming, and exhibited catalase and oxidase activities. The 4,015,175 bp long genome exhibits a G + C% content of 65.36% and contains 3911 protein-coding and 64 predicted RNA genes. PCR-amplifed 16S rRNA gene of strain Arc-HrT yielded a 99.2% sequence similarity with Haloferax prahovense, the phylogenetically closest validly published species in the Haloferax genus. The DDH was of 50.70 ± 5.2% with H. prahovense, 53.70 ± 2.69% with H. volcanii, 50.90 ± 2.64% with H. alexandrinus, 52.90 ± 2.67% with H.
    [Show full text]
  • Haloferax Massiliensis Sp. Nov., the First Human-Associated Halophilic
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector NEW SPECIES Haloferax massiliensis sp. nov., the first human-associated halophilic archaea S. Khelaifia1,2 and D. Raoult1,2 1) Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergentes, CNRS (UMR 7278), IRD (198), INSERM (U1095), AMU (UM63) and 2) Institut Hospitalo-Universitaire Méditerranée-Infection, Faculté de médecine, Aix-Marseille Université, Marseille, France Abstract We report the main characteristics of Haloferax massiliensis strain Arc-HrT (= CSUR P974) isolated from stool specimen of a 22-year-old Amazonian obese female patient. © 2016 The Authors. Published by Elsevier Ltd on behalf of European Society of Clinical Microbiology and Infectious Diseases. Keywords: Culturomics, genomics, Haloferax massiliensis, taxonogenomics, taxonomy Original Submission: 6 May 2016; Revised Submission: 9 May 2016; Accepted: 10 May 2016 Article published online: 14 May 2016 low speed. The pure culture of this halophilic archaea grew Corresponding author: S. Khelaifia, URMITE, CNRS (UMR 7278), aerobically after 7-day incubation at 37°C. Strain Arc-Hr ex- IRD (198), INSERM (U1095), AMU (UM63), Faculté de Médecine, Aix-Marseille Université, 27 Boulevard Jean Moulin, 13385 Marseille hibits positive catalase and oxidase activities. The growing col- Cedex 5, France onies on the halophilic medium were red, opaque and 0.5 to fi E-mail: khelai [email protected] 1 mm in diameter. Cells were Gram-negative cocci, nonmotile and non–spore forming with a diameter of 0.9 μm. The 16S rRNA gene was sequenced using the primers as previously described [4] using a 3130-XL sequencer (Applied Biosciences, In December 2013, we successfully isolated the strain Arc-Hr Saint Aubin, France).
    [Show full text]
  • The Role of Stress Proteins in Haloarchaea and Their Adaptive Response to Environmental Shifts
    biomolecules Review The Role of Stress Proteins in Haloarchaea and Their Adaptive Response to Environmental Shifts Laura Matarredona ,Mónica Camacho, Basilio Zafrilla , María-José Bonete and Julia Esclapez * Agrochemistry and Biochemistry Department, Biochemistry and Molecular Biology Area, Faculty of Science, University of Alicante, Ap 99, 03080 Alicante, Spain; [email protected] (L.M.); [email protected] (M.C.); [email protected] (B.Z.); [email protected] (M.-J.B.) * Correspondence: [email protected]; Tel.: +34-965-903-880 Received: 31 July 2020; Accepted: 24 September 2020; Published: 29 September 2020 Abstract: Over the years, in order to survive in their natural environment, microbial communities have acquired adaptations to nonoptimal growth conditions. These shifts are usually related to stress conditions such as low/high solar radiation, extreme temperatures, oxidative stress, pH variations, changes in salinity, or a high concentration of heavy metals. In addition, climate change is resulting in these stress conditions becoming more significant due to the frequency and intensity of extreme weather events. The most relevant damaging effect of these stressors is protein denaturation. To cope with this effect, organisms have developed different mechanisms, wherein the stress genes play an important role in deciding which of them survive. Each organism has different responses that involve the activation of many genes and molecules as well as downregulation of other genes and pathways. Focused on salinity stress, the archaeal domain encompasses the most significant extremophiles living in high-salinity environments. To have the capacity to withstand this high salinity without losing protein structure and function, the microorganisms have distinct adaptations.
    [Show full text]
  • Variations in the Two Last Steps of the Purine Biosynthetic Pathway in Prokaryotes
    GBE Different Ways of Doing the Same: Variations in the Two Last Steps of the Purine Biosynthetic Pathway in Prokaryotes Dennifier Costa Brandao~ Cruz1, Lenon Lima Santana1, Alexandre Siqueira Guedes2, Jorge Teodoro de Souza3,*, and Phellippe Arthur Santos Marbach1,* 1CCAAB, Biological Sciences, Recoˆ ncavo da Bahia Federal University, Cruz das Almas, Bahia, Brazil 2Agronomy School, Federal University of Goias, Goiania,^ Goias, Brazil 3 Department of Phytopathology, Federal University of Lavras, Minas Gerais, Brazil Downloaded from https://academic.oup.com/gbe/article/11/4/1235/5345563 by guest on 27 September 2021 *Corresponding authors: E-mails: [email protected]fla.br; [email protected]. Accepted: February 16, 2019 Abstract The last two steps of the purine biosynthetic pathway may be catalyzed by different enzymes in prokaryotes. The genes that encode these enzymes include homologs of purH, purP, purO and those encoding the AICARFT and IMPCH domains of PurH, here named purV and purJ, respectively. In Bacteria, these reactions are mainly catalyzed by the domains AICARFT and IMPCH of PurH. In Archaea, these reactions may be carried out by PurH and also by PurP and PurO, both considered signatures of this domain and analogous to the AICARFT and IMPCH domains of PurH, respectively. These genes were searched for in 1,403 completely sequenced prokaryotic genomes publicly available. Our analyses revealed taxonomic patterns for the distribution of these genes and anticorrelations in their occurrence. The analyses of bacterial genomes revealed the existence of genes coding for PurV, PurJ, and PurO, which may no longer be considered signatures of the domain Archaea. Although highly divergent, the PurOs of Archaea and Bacteria show a high level of conservation in the amino acids of the active sites of the protein, allowing us to infer that these enzymes are analogs.
    [Show full text]
  • (DSM 3754 T ) and the Laboratory Strains R1 and NRC-1 Friedhelm Pfeiffer, Gerald Losensky, Anita Marchfelder, Bianca Habermann, Mike Dyall-Smith
    Whole-genome comparison between the type strain of Halobacterium salinarum (DSM 3754 T ) and the laboratory strains R1 and NRC-1 Friedhelm Pfeiffer, Gerald Losensky, Anita Marchfelder, Bianca Habermann, Mike Dyall-smith To cite this version: Friedhelm Pfeiffer, Gerald Losensky, Anita Marchfelder, Bianca Habermann, Mike Dyall-smith. Whole-genome comparison between the type strain of Halobacterium salinarum (DSM 3754 T ) and the laboratory strains R1 and NRC-1. MicrobiologyOpen, Wiley, 2019, 1, 10.1002/mbo3.974. hal- 02392940 HAL Id: hal-02392940 https://hal-amu.archives-ouvertes.fr/hal-02392940 Submitted on 4 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial| 4.0 International License Received: 17 July 2019 | Revised: 8 November 2019 | Accepted: 9 November 2019 DOI: 10.1002/mbo3.974 ORIGINAL ARTICLE Whole-genome comparison between the type strain of Halobacterium salinarum (DSM 3754T) and the laboratory strains R1 and NRC-1 Friedhelm Pfeiffer1 | Gerald Losensky2 | Anita Marchfelder3 | Bianca Habermann1,4 | Mike Dyall-Smith1,5 1Computational Biology Group, Max-Planck- Institute of Biochemistry, Martinsried, Abstract Germany Halobacterium salinarum is an extremely halophilic archaeon that is widely distributed 2 Microbiology and Archaea, Department of in hypersaline environments and was originally isolated as a spoilage organism of Biology, Technische Universität Darmstadt, T Darmstadt, Germany salted fish and hides.
    [Show full text]
  • Seasonal Dynamics of Extremely Halophilic Microbial Communities in Three Argentinian Downloaded From
    FEMS Microbiology Ecology Advance Access published September 7, 2016 A manuscript submitted to FEMS Microbiology Ecology Seasonal dynamics of extremely halophilic microbial communities in three Argentinian Downloaded from salterns http://femsec.oxfordjournals.org/ Leonardo Di Meglioa, Fernando Santosb, María Gomarizb, Cristina Almansac, Cristina Lópezb, Josefa Antónb and Débora Nercessiana*. a. Instituto de Investigaciones Biológicas, Facultad de Ciencias Exactas y Naturales, UNMDP – CONICET, Funes 3250 4º nivel, 7600 Mar del Plata, Argentina. by guest on September 11, 2016 b. Departamento de Fisiología, Genética y Microbiología, Facultad de Ciencias, Universidad de Alicante, 03690 San Vicente del Raspeig, España. c. Servicios Técnicos de Investigación (SSTTI), Unidad de Microscopía, Universidad de Alicante, Alicante, 03690 San Vicente del Raspeig, España *Correspondence to: Débora Nercessian E-mail: [email protected] Phone: (54) 223-4753030 Fax: (54) 223-4724143 Keywords: Halophilic microorganisms; haloviruses; microbial dynamics; prokaryotic diversity; hypersaline environments; environmental parameters. Downloaded from Running title: Microbial dynamics in three Argentinian salterns http://femsec.oxfordjournals.org/ Abstract A seasonal sampling was carried out in three Argentinian salterns: Salitral Negro (SN), Colorada Grande (CG) and Guatraché (G), aimed to analyze abiotic parameters and microbial diversity and dynamics. Microbial assemblages were correlated to environmental factors by statistical analyses. Principal- Component-Analysis
    [Show full text]
  • Nutrient Supplementation Experiments with Saltern Microbial Communities Implicate Utilization Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.20.212662; this version posted January 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Nutrient supplementation experiments with saltern microbial communities implicate utilization of 2 DNA as a source of phosphorus 3 4 Running Title: DNA as a microbial community’s phosphorus source 5 6 Zhengshuang Hua1, Matthew Ouellette2,$, Andrea M. Makkay2, R. Thane Papke2,*, Olga Zhaxybayeva1,3* 7 8 1 Department of Biological Sciences, Dartmouth College, Hanover, NH, USA 9 2 Department of Molecular and Cell Biology, University of Connecticut, Storrs, CT, USA 10 3 Department of Computer Science, Dartmouth College, Hanover, NH, USA 11 12 $ Current affiliation: The Forsyth Institute, Cambridge, Massachusetts, USA and Department of Oral 13 Medicine, Infection and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts, USA 14 15 *Corresponding authors: 16 O.Z., [email protected]; 17 R.T.P., [email protected]. 18 19 Keywords: extracellular DNA, dissolved DNA, hypersaline, haloarchaea, Halobacteria, DNA uptake, 20 community diversity 21 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.20.212662; this version posted January 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.
    [Show full text]
  • Nutrient Supplementation Experiments on Saltern Microbial Communities Support Utilization Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.20.212662; this version posted July 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Nutrient supplementation experiments on saltern microbial communities support utilization of 2 DNA as a source of phosphorus 3 4 Running Title: DNA as a microbial community’s phosphorus source 5 6 Zhengshuang Hua1, Matthew Ouellette2,$, Andrea M. Makkay2, R. Thane Papke2,*, Olga Zhaxybayeva1,3* 7 8 1 Department of Biological Sciences, Dartmouth College, Hanover, NH, USA 9 2 Department of Molecular and Cell Biology, University of Connecticut, Storrs, CT, USA 10 3 Department of Computer Science, Dartmouth College, Hanover, NH, USA 11 12 $ Current affiliation: The Forsyth Institute, Cambridge, Massachusetts, USA and Department of Oral 13 Medicine, Infection and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts, USA 14 15 *Corresponding authors: 16 O.Z., [email protected]; 17 R.T.P., [email protected]. 18 19 Keywords: extracellular DNA, dissolved DNA, hypersaline, haloarchaea, Halobacteria, DNA uptake, 20 community diversity 21 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.20.212662; this version posted July 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.
    [Show full text]
  • The Microbiology of Table Salts
    The microbiology of table salts Seana P. Thompson Cooperative Institute for Research in Environmental Sciences and Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, Colorado, USA Honors Thesis Committee: Noah Fierera, Abby Hickcoxb, Ravinder Singhc, Alison Vigersd a Department of Ecology and Evolutionary Biology, Cooperative Institute for Research in Environmental Sciences, University of Colorado, Boulder, Colorado, USA b Arts and Sciences Honors Program, University of Colorado, Boulder, Colorado, USA c Department of Molecular, Cellular, Developmental Biology, University of Colorado, Boulder, Colorado, USA d Thesis Advisor. Department of Molecular, Cellular, Developmental Biology, Department of Psychology and Neuroscience, University of Colorado, Boulder, Colorado, USA Defense Date: April 3rd, 2020 Abstract The dominant bacteria and archaea on table salts from around the world were identified and how these halophilic families varied as a function of salt chemical makeup was investigated. Through this study, the dominant taxa found on table salts were reported to be: Haloferacaceae, Pseudomonadaceae, Halomicrobiaceae, Halobacteriaceae, Nanohaloarchaeaceae, Rhodothermaceae, Burkholderiaceae, and Rhizobiaceae Marinobacteraceae, Alteromonadaceae, Rhodobacteraceae, Micrococcaceae, Moracellaceae, Staphylococcaceae, Oligoflexaceae, Halomonadaceae, and Flavobacteriaceae. The relative abundance of these microorganisms across samples was variable and related to the chemical composition of the table salts,
    [Show full text]
  • Tracing Protein Evolutionary Trajectory Homology Inference with Specific Molecular Constraints
    Tracing protein evolutionary trajectory Homology inference with specific molecular constraints Jarosław Surkont Dissertation presented to obtain the Ph.D degree in Bioinformatics Instituto de Tecnologia Química e Biológica António Xavier | Universidade Nova de Lisboa Research work coordinated by: Oeiras April, 2016 Cover: A cartoon representation of the Rab11b and cGMP-dependent protein kinase II leucine zipper complex (A. S. Reger et al. (2014). Crystal Structure of the cGMP-dependent Protein Kinase II Leucine Zipper and Rab11b Protein Complex Reveals Molecular Details of G-kinase-specific Interactions. Journal of Biological Chemistry 289.37, 25393–25403). Tracing protein evolutionary trajectory Homology inference with specific molecular constraints Jarosław Surkont, Computational Genomics Laboratory, Instituto Gulbenkian de Ciência Declaration: This dissertation is a result of my own research carried out between June 2012 and March 2016 in the laboratory of Dr. José B. Pereira Leal, Ins- tituto Gulbenkian de Ciência in Oeiras, Portugal, within the PhD Programme in Integrative Biomedical Sciences (edition 2011-2012). Declaração: Esta dissertação é o resultado do meu próprio trabalho desenvolvido entre Julho 2012 e Março 2016 no laboratório do Doutor José B. Pereira Leal, Instituto Gulbenkian de Ciência em Oeiras, Portugal, no âmbito do Programa de Doutoramento em Integrative Biomedical Sciences (edição 2011-2012). Financial support: This dissertation had the financial support from Fundação para a Ciência e a Tecnologia and European Social Found, through grant SFRH/ BD/51880/2012 awarded to Jarosław Surkont, and Fundação Calouste Gulben- kian. Apoio financeiro: Esta dissertação teve o apoio financeiro da Fundação para a Ciência e a Tecnologia e do Fundo Social Europeu no âmbito do Quadro Comu- nitário de apoio através da bolsa de doutoramento SFRH/BD/51880/2012 e da Fundação Calouste Gulbenkian.
    [Show full text]
  • Supplementary Material For: Undinarchaeota Illuminate The
    Supplementary Material for: Undinarchaeota illuminate the evolution of DPANN archaea Nina Dombrowski1, Tom A. Williams2, Benjamin J. Woodcroft3, Jiarui Sun3, Jun-Hoe Lee4, Bui Quang MinH5, CHristian Rinke5, Anja Spang1,5,# 1NIOZ, Royal NetHerlands Institute for Sea ResearcH, Department of Marine Microbiology and BiogeocHemistry, and UtrecHt University, P.O. Box 59, NL-1790 AB Den Burg, THe NetHerlands 2 ScHool of Biological Sciences, University of Bristol, Bristol, BS8 1TQ, UK 3Australian Centre for Ecogenomics, ScHool of CHemistry and Molecular Biosciences, THe University of Queensland, QLD 4072, Australia 4Department of Cell- and Molecular Biology, Science for Life Laboratory, Uppsala University, SE-75123, Uppsala, Sweden 5ResearcH ScHool of Computer Science and ResearcH ScHool of Biology, Australian National University, ACT 2601, Australia #corresponding autHor. Postal address: Landsdiep 4, 1797 SZ 't Horntje (Texel). Email address: [email protected]. PHone number: +31 (0)222 369 526 Table of Contents Table of Contents 2 General 3 Evaluating CHeckM completeness estimates 3 Screening for contaminants 3 Phylogenetic analyses 4 Informational processing and repair systems 7 Replication and cell division 7 Transcription 7 Translation 8 DNA-repair and modification 9 Stress tolerance 9 Metabolic features 10 Central carbon and energy metabolism 10 Anabolism 13 Purine and pyrimidine biosyntHesis 13 Amino acid degradation and biosyntHesis 14 Lipid biosyntHesis 15 Vitamin and cofactor biosyntHesis 16 Host-symbiont interactions 16 Genes potentially
    [Show full text]
  • Prokaryotic Communities in the Thalassohaline Tuz Lake, Deep Zone, and Kayacik, Kaldirim and Yavsan Salterns (Turkey) Assessed by 16S Rrna Amplicon Sequencing
    microorganisms Article Prokaryotic Communities in the Thalassohaline Tuz Lake, Deep Zone, and Kayacik, Kaldirim and Yavsan Salterns (Turkey) Assessed by 16S rRNA Amplicon Sequencing Can Akpolat 1 , Ana Beatriz Fernández 2 , Pinar Caglayan 1 , Baris Calli 3 , Meral Birbir 1,* and Antonio Ventosa 4,* 1 Department of Biology, Faculty of Arts and Sciences, Marmara University, 34722 Istanbul, Turkey; [email protected] (C.A.); [email protected] (P.C.) 2 Institute for Multidisciplinary Research in Applied Biology-IMAB, Universidad Publica de Navarra, Multilva, 31006 Navarra, Spain; [email protected] 3 Department of Environmental Engineering, Faculty of Engineering, Marmara University, 34722 Istanbul, Turkey; [email protected] 4 Department of Microbiology and Parasitology, Faculty of Pharmacy, University of Sevilla, 41004 Sevilla, Spain * Correspondence: [email protected] (M.B.); [email protected] (A.V.); Tel.: +90-216-777-3200 (M.B.); +34-954-556-765 (A.V.) Abstract: Prokaryotic communities and physico-chemical characteristics of 30 brine samples from the thalassohaline Tuz Lake (Salt Lake), Deep Zone, Kayacik, Kaldirim, and Yavsan salterns (Turkey) were analyzed using 16S rRNA amplicon sequencing and standard methods, respectively. Archaea (98.41% of reads) was found to dominate in these habitats in contrast to the domain Bacteria (1.38% of reads). Representatives of the phylum Euryarchaeota were detected as the most predominant, while 59.48% Citation: Akpolat, C.; Fernández, and 1.32% of reads, respectively, were assigned to 18 archaeal genera, 19 bacterial genera, 10 archaeal A.B.; Caglayan, P.; Calli, B.; Birbir, M.; genera, and one bacterial genus that were determined to be present, with more than 1% sequences in Ventosa, A.
    [Show full text]