
1 SUPPLEMENTARY MATERIAL 2 3 A differential metabarcoding approach to describe taxonomy profiles 4 of Bacteria and Archaea in the Saltern of Margherita di Savoia (Italy) 5 6 Claudia Leoni1,a, Mariateresa Volpicella2,a,*, Bruno Fosso1,a, Caterina Manzari1, Elisabetta 7 Piancone2, Maria C.G. Dileo2, Erika Arcadi3, Michail Yakimov4, Graziano Pesole1,2 and Luigi R. 8 Ceci1,* 9 10 1Institute of Biomembranes, Bioenergetics and Molecular Biotechnologies, CNR, Via Amendola 11 122/O, 70126 Bari, Italy; 2Department of Biosciences, Biotechnologies and Biopharmaceutics, 12 University of Bari “Aldo Moro”, Via Orabona 4, 70126 Bari, Italy; 3Stazione Zoologica Anton 13 Dohrn, Via dei Mille 46, 98057 Milazzo (Messina), Italy; 4Institute for Biological Resources and 14 Marine Biotechnology, CNR, Spianata San Raineri, 86 - 98122 Messina, Italy. 15 16 a These Authors have contributed equally to this work. 17 18 *Correspondence: 19 Mariateresa Volpicella: [email protected] 20 Luigi R. Ceci: [email protected]. 21 22 23 List of material: 24 25 Table S1. List of primers. 26 Table S2. Cell counts (cells/ml) obtained from the different waters of the saltern of 27 MdS. 28 Table S3. Summary of pairwise Dunn tests. 29 Table S4. Pearson's product moment correlation coefficient (PC) between ASVs and 30 salinity. 31 Table S5. Relative abundances of bacterial and archaeal genera obtained by 32 metabarcoding analysis. 33 Table S6. Relative abundances of bacterial and archaeal genera obtained by 34 combination of metabarcoding and CARD-FISH data. 35 36 Figure S1. Detection of bacteria and archaea cells by CARD-FISH analysis. 37 Figure S2. Rarefaction curves of 16S rRNA ASVs for the assayed ponds of the MdS 38 saltern. 39 Figure S3. Heat maps of microbial amplicons similarity matrix of MdS ponds. 40 41 42 43 Table S1. List of primers for PCR and probes for CARD-FISH. 44 Name Sequence (5’-3’) Ref. Eub338 I GCTGCCTCCCGTAGGAGT 23,24 Eub338 II GCAGCCACCCGTAGGTGT 23,24 Eub338 III GCTGCCACCCGTAGGTGT 23,24 Arch915 GTGCTCCCCCGCCAATTCCT 25 B-V5* TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG/ATTAGATACCCYGGTAGTCC 28,29 A-V6* GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG/ACGAGCTGACGACARCCATG 28,29 Arch_349F* TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG/GYGCASCAGKCGMGAAW 30 Arch_806R* GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG/GGACTACVSGGGTATCTAAT 30 45 * The first part of the primer, before the slash, corresponds to the Nextera transposase sequence, 46 required by the Illumina protocol. 47 Symbols for degenerate nucleotides are according to the IUPAC nomenclature: Y: —C/T; R: —A/G; 48 S: —G/C; K: —G/T; M: —A/C; W—: A/T; V—: A/C/G. 49 50 Table S2. Cell counts (cells/ml) obtained from the different waters of the saltern of MdS. Ponds are indicated by conventional names, with 51 salinity reported as salt percentage (w/v). Three different counts were carried out for each pond. B/T, A/T and (B+A)/T are the relative abundances 52 of bacterial (B), archaeal (A) and living prokaryotic cells (B + A), respectively, compared to total cells (T) as counted by DAPI staining. B/ A/ DAPI Bacteria Archaea B/T A/T (B+A)/T DAPI Bacteria Archaea (B+A) (B+A) dev dev dev (%) (%) (%) (%) (%) Alma Dannata 2.70E+05 5.04E+04 1.46E+04 3.74E+04 5.80E+03 3.43E+03 18.7 5.4 22.5 24.1 (4.9%) 77.5 Polmone (5.2%) 3.11E+05 2.70E+05 3.51E+04 1.12E+04 1.48E+04 3.85E+03 86.8 11.3 88.5 11.5 98.1 Zero (8.4%) 2.09E+05 1.93E+05 1.31E+04 1.04E+04 7.39E+03 1.77E+03 92.3 6.3 93.6 6.4 98.6 Fine (13.1%) 3.10E+05 1.94E+05 1.08E+05 1.76E+04 2.05E+04 2.92E+03 62.6 34.8 64.2 35.8 97.4 Paradiso (14.5%) 5.06E+05 3.60E+05 1.26E+05 3.10E+04 7.93E+03 1.24E+04 71.1 24.9 74.1 25.9 96.0 Inizio (24.1%) 2.80E+05 1.07E+05 1.58E+05 1.04E+04 1.02E+04 1.36E+04 38.2 56.4 40.4 59.6 94.6 Armellina 3.42E+05 1.81E+05 1.38E+05 2.00E+04 2.09E+04 9.73E+03 52.9 40.4 56.7 43.3 93.3 (30.6%) Cappella (34.6%) 2.47E+05 1.24E+05 9.69E+04 1.20E+04 1.06E+04 1.04E+04 50.2 39.2 56.1 43.9 89.4 Imperatrice 1.84E+05 4.70E+04 9.60E+04 1.16E+04 5.32E+03 1.04E+04 25.5 52.2 32.9 67.1 77.7 (36.0%) 53 54 Table S3. Summary of pairwise Dunn tests. Pond names and salinities are listed in columns and 55 rows. The inferred adjusted p-values are shown. Significant p-values are in bold and starred (*≤ 0.05, 56 **≤ 0.01, ***≤0.001). 57 Bacteria: Pond Alma Fine Paradiso Inizio Armellina Cappella Imperatrice Polmone (Salinity Dannata (13.1%) (14.5%) (24.1%) (30.6%) (34.6%) (36.0%) (5.2%) %) (4.9%) Paradiso 0.4387 (14.5%) Inizio 0.1085 0.1400 (24.1%) Armellina 0.0448* 0.0614 0.3217 (30.6%) Cappella 0.0059** 0.0090** 0.0992 0.2053 (34.6%) Imperatrice 0.0118* 0.0175* 0.1518 0.2858 0.2858 (36.0%) Alma Dannata 0.2202 0.2685 0.3217 0.1773 0.0402* 0.0679 (4.9%) Polmone 0.2685 0.2202 0.0320* 0.0103* 0.0009*** 0.0020** 0.0825 (5.2%) Zero 0.3217 0.1400 0.1085 0.0103* 0.0027** 0.0002*** 0.0004*** 0.0320* (8.4%) 58 59 Archaea: Pond Fine Paradiso Inizio Armellina Cappella (Salinity (13.1%) (14.5%) (24.1%) (30.6%) (34.6%) %) Paradiso 0.2456 (14.5%) Inizio 0.0234* 0.0968 (24.1%) Armellina 0.0004*** 0.0037** 0.0843 (30.6%) Cappella 0.0109* 0.0541 0.3798 0.1422 (34.6%) Imperatrice 0.3798 0.0234* 0.0968 0.5000 0.0843 (36.0%) 60 61 Table S4. Pearson's product moment correlation coefficient (PC) between ASVs and salinity. 62 63 Bacteria: Pearson ASV P-value taxonomy Correlation aa1f4fd53f406a3613fcf5661e0b8035 0.97 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 99c793755e7c20d3416d3e113d63475e 0.96 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter da3ae34876ceb295b8846f57e0bf98fc 0.96 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter b7c04eaa669a35ed42a78381dfc78138 0.96 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 2c815d6b32f92298b7578702b0dd1510 0.96 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter be1f4e92c0ef762f0a1b05758e0a4bf9 0.95 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured 3a3161d5e80646e5938102d9d23acf5f 0.95 0.000 Chitinophagales d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured 34b2ada6eb11c95621549b76a674c1c1 0.94 0.000 Chitinophagales 2119951188cda0bdd84b64568e593a4a 0.94 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter c47adbe8321dce0f73d55e94e3e72780 0.93 0.000 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__Salinibacter_ruber d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured e5936cfb1715b6b9b7e14c4f953f94d3 0.92 0.000 Chitinophagales d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured b1189c366efdb76647929e59bc67f874 0.92 0.000 Chitinophagales d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured 57f64b6d2bae0c9eeed6063e20153acd 0.91 0.001 Chitinophagales ac3da6eb5e5938d0b631004834859280 0.88 0.002 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter 23c128e062a85e3f9edad481d971abb5 0.86 0.003 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter c2962efec2da9314edd38d7167b6aaea 0.86 0.003 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 0d88996a0249a67e3208cb890f339219 0.81 0.009 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter 2cd0e6986ba98bb71bc7cc679fd6e2c6 0.80 0.010 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 49ef03099317acbf97e22e34a253fcb2 0.79 0.011 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter 3092c2440ff9a90461054bf40642f489 0.79 0.011 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter d__Bacteria;p__Proteobacteria;c__Gammaproteobacteria;o__Nitrococcales;f__Nitrococcaceae;g__uncultured Nitrococcaceae;s__uncultured 00a224b16122e353591ac23cc72d6e7d 0.78 0.013 Nitrococcaceae eaed4b8971f40866bd1f31e062f579f9 0.77 0.016 d__Bacteria;p__Bacteroidota;c__Rhodothermia;o__Rhodothermales;f__Rhodothermaceae;g__Salinibacter;s__uncultured Salinibacter 038e1e6407a6fbf106d92d05eb71621d 0.74 0.022 d__Bacteria;p__Proteobacteria;c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__Sediminimonas;s__uncultured Sediminimonas d__Bacteria;p__Desulfobacterota;c__Desulfuromonadia;o__Bradymonadales;f__Bradymonadaceae;g__Bradymonadaceae;s__uncultured 0869c07ab138130212f6a46f19029879 0.74 0.024 Bradymonadaceae d__Bacteria;p__Desulfobacterota;c__Desulfuromonadia;o__Bradymonadales;f__Bradymonadaceae;g__Bradymonadaceae;s__uncultured d4d4a7b2415a45986d9a4418acbff493 0.73 0.025 Bradymonadaceae d__Bacteria;p__Bacteroidota;c__Bacteroidia;o__Chitinophagales;f__uncultured Chitinophagales;g__uncultured Chitinophagales;s__uncultured fc3010d03af677da6c45d7ca8c5f6d1e
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages17 Page
-
File Size-