DOCSLIB.ORG

Homologs of Genes Expressed in Caenorhabditis Elegans Gabaergic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Homologs of Genes Expressed in Caenorhabditis Elegans Gabaergic Hammock et al. Neural Development 2010, 5:32 http://www.neuraldevelopment.com/content/5/1/32 RESEARCH ARTICLE Open Access Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain Elizabeth AD Hammock1,2*, Kathie L Eagleson3, Susan Barlow4,6, Laurie R Earls4,7, David M Miller III2,4,5, Pat Levitt3* Abstract Background: In an effort to identify genes that specify the mammalian forebrain, we used a comparative approach to identify mouse homologs of transcription factors expressed in developing Caenorhabditis elegans GABAergic neurons. A cell-specific microarray profiling study revealed a set of transcription factors that are highly expressed in embryonic C. elegans GABAergic neurons. Results: Bioinformatic analyses identified mouse protein homologs of these selected transcripts and their expression pattern was mapped in the mouse embryonic forebrain by in situ hybridization. A review of human homologs indicates several of these genes are potential candidates in neurodevelopmental disorders. Conclusions: Our comparative approach has revealed several novel candidates that may serve as future targets for studies of mammalian forebrain development. Background As with other cell types, the diversity of GABAergic Proper forebrain patterning and cell-fate specification neurons has its basis in different developmental origins, lay the foundation for complex behaviors. These neuro- with timing and location of birth playing key roles in developmental events in large part depend on a series of cell fate [1,6-8]. gene expression refinements (reviewed in [1]) that com- Despite the phenotypic variety of GABAergic neurons, mit cells to express certain phenotypic features that all use GABA as a neurotransmitter. In mammals, define circuit formation. Relatively subtle disturbances GABA is produced by one of two GABA-synthesizing in development may underlie the etiology of neurodeve- enzymes, glutamic acid decarboxylase (GAD)65 or lopmental disorders, especially when alternative cogni- GAD67. These closely related enzymes are orthologs of tive phenotypes do not have an apparent malformation the Caenorhabditis elegans protein UNC-25, which is at the gross anatomical level. In the forebrain, cells pro- found only in cells that produce GABA. Because UNC- ducing g-aminobutyric acid (GABAergic interneurons) 25/GAD and other components of the GABA synthetic have been implicated in neurodevelopmental disorders, pathway are highly conserved, it is likely that mamma- including autism and schizophrenia [2-4]. These neu- lian orthologs of some of the genes that specify rons are composed of a diverse class of cells providing a GABAergic cell fate in C. elegans embryogenesis may wide range of control of neural activity, and vary in neu- also control GABAergic fate specification during mam- roanatomical location, electrophysiological properties, malian embryogenesis. transcriptome/proteome and innervation patterns as We have explored this hypothesis in an effort to either local circuit or long-range projection neurons [5]. define new candidates for regulating forebrain GABAer- gic cell fate that may be highly conserved across evolu- tionarily distant taxa. This discovery-based approach * Correspondence: [email protected]; [email protected] 1 (Figure 1) complements existing analyses of the tran- Department of Pediatrics, Vanderbilt University School of Medicine, Nashville, TN 37232, USA scriptomes of subpopulations of mammalian GABAergic 3Zilkha Neurogenetic Institute, Keck School of Medicine, University of cells [9-13]. Thus, by using data from the transcription Southern California, Los Angeles, CA 90089, USA profiling of GABAergic cells in embryonic C. elegans,in Full list of author information is available at the end of the article © 2010 Hammock et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Hammock et al. Neural Development 2010, 5:32 Page 2 of 14 http://www.neuraldevelopment.com/content/5/1/32 Figure 1 Summary diagram of experimental approach. combination with bioinformatics analyses, we report isolates of the unc-25::GFP cells and from four replicates here transcripts with sequence homologs that may also of the reference samples. A comparison of the unc-25:: be involved in GABAergic fate specification in mam- GFP and reference data sets identified 673 transcripts mals. We focused our attention on transcripts with gene showing elevated expression (1.7×) in GABAergic neu- regulation ontologies. To probe the potential role of rons at a false discovery rate (FDR) ≤ 1% [14]). these conserved players in mammalian development, we mapped these gene products in the developing mouse Bioinformatics screen forebrain, with a selective focus on the telencephalon. Genes in the list of GABAergic enriched transcripts with As a proof of principle, this strategy identified several Gene Ontology (GO) terms related to DNA and tran- gene products already known to play a role in the speci- scription regulation were analyzed for potential homol- fication of forebrain GABAergic interneurons in mam- ogy to mouse transcripts. Because functional homology mals. Additionally, our approach identified several is conserved at the protein level, we generated a list of previously unexplored gene products that serve as pro- C. elegans proteins from the list of corresponding tran- mising candidates for future investigation of forebrain scripts and then used BLASTP [16] analysis available at patterning. WormBase [17] from June 2005 to November 2008 (wormbase releases WS144 to WS196) to identify the Materials and methods closest matching mouse protein sequence homologs. We C. elegans transcription profiling then used this list of mouse protein homologs to gener- A microarray profiling of C. elegans cells (MAPCeL) ate the corresponding catalogue of mouse transcripts for strategy was used to obtain a transcriptome profile of C. in situ hybridization analysis. We did not distinguish elegans GABAergic neurons [14,15]. A complete among potential splice variants and/or protein isoforms description of the methods used for this study and the for a given single gene locus. To further rank potential GABAergic neuron expression profile will be reported candidates, we performed BLASTP in the reverse direc- elsewhere (S Barlow, L Earls, J Watson, C Spencer, K tion; after generating the list of mouse protein sequence Watkins, D Miller, manuscript in preparation). Briefly, homologs, those proteins were used to identify the best the unc-25::GFP marker was used to label C. elegans sequence homologs in the C. elegans proteome. GABAergic neurons. unc-25::GFP-expressing embryos were dissociated with chitinase and cultured for 24 Mouse care and use hours and viable unc-25::GFP labeled cells were isolated Timed pregnant C57Bl6j mice were bred in-house from by fluorescence activated cell sorting (FACS). Total founders originating from Jackson Labs under protocols RNA was purified from both the sorted unc-25::GFP approved by the Institutional Animal Care and Use positive cells and from the reference sample of all Committee of Vanderbilt University. Mice were main- embryonic cells. The RNAs were amplified and hybri- tained on a 12:12 light-dark cycle and were permitted dized to the Affymetrix C. elegans array. Average signal food and water ad libitum. Noon on the day following a intensities were calculated from three independent time-delimited overnight pairing was considered Hammock et al. Neural Development 2010, 5:32 Page 3 of 14 http://www.neuraldevelopment.com/content/5/1/32 embryonic day 0.5 (E0.5). Pregnant females were readily with VectaMount (Vector Laboratories, Burlingame, CA, identifiable at E14.5 and were deeply anesthetized with USA). isofluorane vapors followed by rapid decapitation in order to harvest embryos. Expression patterns of genes Light microscopy at this fetal age were analyzed because it is a mid-point Microscopy was performed using an Axioplan II micro- in the age-range for cortical GABAergic neuron produc- scope (Zeiss, Jena, Germany), and micrographs were tion and migration in the mouse forebrain [8]. Thus, we acquired with a Zeiss AxioCam HRc camera (Zeiss) in hypothesized that expression patterns related to Axiovision 4.1 software (Zeiss). Low-magnification GABAergic neuron specification and differentiation images were collected and linearly adjusted for bright- likely would be apparent at this age. ness and contrast using Adobe Photoshop (version 7.0, Adobe, San Jose, CA, USA). No other image alterations Riboprobe labeling other than resizing were performed. All figures were I.M.A.G.E. clones were obtained from ATCC (Manassas, prepared digitally in PowerPoint 2007 (Microsoft, Red- VA, USA) and Open Biosystems (Huntsville, AL, USA) mond, WA, USA). for the mouse transcripts (Additional file 1). The iden- tity of each I.M.A.G.E. clone was confirmed by sequen- Results cing at the Vanderbilt DNA Sequencing Facility. When Genes expressed in C. elegans GABAergic neurons necessary, due to cDNA size or the plasmid vector, we C. elegans embryonic GABAergic neurons were profiled subcloned the I.M.A.G.E. clone into a separate vector by the MAPCeL approach in which unc-25::GFP labeled (Additional file 2). These subclones were also sequenced cells were isolated by
Load more

Recommended publications
  • Wo 2010/075007 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 1 July 2010 (01.07.2010) WO 2010/075007 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/68 (2006.01) G06F 19/00 (2006.01) kind of national protection available): AE, AG, AL, AM, C12N 15/12 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) International Application Number: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US2009/067757 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 11 December 2009 ( 11.12.2009) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (25) Filing Language: English SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, (26) Publication Language: English TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 12/3 16,877 16 December 2008 (16.12.2008) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, (71) Applicant (for all designated States except US): DODDS, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, W., Jean [US/US]; 938 Stanford Street, Santa Monica, TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, CA 90403 (US).
    [Show full text]
  • Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Androgen Receptor Binding Sites Identified by a GREF GATA Model
    doi:10.1016/j.jmb.2005.09.009 J. Mol. Biol. (2005) 353, 763–771 COMMUNICATION Androgen Receptor Binding Sites Identified by a GREF_GATA Model Katsuaki Masuda1, Thomas Werner2, Shilpi Maheshwari1 Matthias Frisch2, Soyon Oh1, Gyorgy Petrovics1, Klaus May2 Vasantha Srikantan1, Shiv Srivastava1 and Albert Dobi1* 1Center for Prostate Disease Changes in transcriptional regulation can be permissive for tumor Research, Department of progression by allowing for selective growth advantage of tumor cells. Surgery, Uniformed Services Tumor suppressors can effectively inhibit this process. The PMEPA1 gene, a University, Rockville, MD potent inhibitor of prostate cancer cell growth is an androgen-regulated 20852, USA gene. We addressed the question of whether or not androgen receptor can directly bind to specific PMEPA1 promoter upstream sequences. To test this 2Genomatix Software GmbH hypothesis we extended in silico prediction of androgen receptor binding D-80339 Munich, Germany sites by a modeling approach and verified the actual binding by in vivo chromatin immunoprecipitation assay. Promoter upstream sequences of highly androgen-inducible genes were examined from microarray data of prostate cancer cells for transcription factor binding sites (TFBSs). Results were analyzed to formulate a model for the description of specific androgen receptor binding site context in these sequences. In silico analysis and subsequent experimental verification of the selected sequences suggested that a model that combined a GREF and a GATA TFBS was sufficient for predicting a class of functional androgen receptor binding sites. The GREF matrix family represents androgen receptor, glucocorticoid receptor and progesterone receptor binding sites and the GATA matrix family represents GATA binding protein 1–6 binding sites.
    [Show full text]
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
    [Show full text]
  • Homeobox Transcription Factor Prox1 in Sympathetic Ganglia of Vertebrate Embryos: Correlation with Human Stage 4S Neuroblastoma
    0031-3998/10/6802-0112 Vol. 68, No. 2, 2010 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2010 International Pediatric Research Foundation, Inc. Homeobox Transcription Factor Prox1 in Sympathetic Ganglia of Vertebrate Embryos: Correlation With Human Stage 4s Neuroblastoma JU¨ RGEN BECKER, BAIGANG WANG, HELENA PAVLAKOVIC, KERSTIN BUTTLER, AND JO¨ RG WILTING Department of Anatomy and Cell Biology, University Medicine Goettingen, 37075 Goettingen, Germany ABSTRACT: Previously, we observed expression of the homeobox progression of tumors derived from these tissues has not been transcription factor Prox1 in neuroectodermal embryonic tissues. investigated. We have studied Prox1 expression in the sym- Besides essential functions during embryonic development, Prox1 pathetic nervous system of avian and murine embryos, and in has been implicated in both progression and suppression of malig- childhood tumors derived from this tissue: neuroblastoma nancies. Here, we show that Prox1 is expressed in embryonic sym- (NB). We show that Prox1 is expressed in sympathetic neu- pathetic trunk ganglia of avian and murine embryos. Prox1 protein is rons during early stages of development at similar levels as in localized in the nucleus of neurofilament-positive sympathetic neu- rons. Sympathetic progenitors represent the cell of origin of neuro- lymphatic endothelial cells (LECs), but at greatly reduced blastoma (NB), the most frequent solid extracranial malignancy of levels in human NB cell lines. Studies of primary NB of all children. NB may progress to life-threatening stage 4, or regress stages (stages 1–4s) show significantly higher amounts of spontaneously in the special stage 4s. By qRT-PCR, we show that Prox1 mRNA in stage 4s.
    [Show full text]
  • 2020 Program Book
    PROGRAM BOOK Note that TAGC was cancelled and held online with a different schedule and program. This document serves as a record of the original program designed for the in-person meeting. April 22–26, 2020 Gaylord National Resort & Convention Center Metro Washington, DC TABLE OF CONTENTS About the GSA ........................................................................................................................................................ 3 Conference Organizers ...........................................................................................................................................4 General Information ...............................................................................................................................................7 Mobile App ....................................................................................................................................................7 Registration, Badges, and Pre-ordered T-shirts .............................................................................................7 Oral Presenters: Speaker Ready Room - Camellia 4.......................................................................................7 Poster Sessions and Exhibits - Prince George’s Exhibition Hall ......................................................................7 GSA Central - Booth 520 ................................................................................................................................8 Internet Access ..............................................................................................................................................8
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Cell-Specific Alterations in Pitx1 Regulatory Landscape Activation Caused 2 by the Loss of a Single Enhancer
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434611; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Cell-specific alterations in Pitx1 regulatory landscape activation caused 2 by the loss of a single enhancer 3 4 5 Raquel Rouco1,2*, Olimpia Bompadre1,2*, Antonella Rauseo1,2, Olivier Fazio3, Fabrizio Thorel3, 6 Rodrigue Peraldi1,2, Guillaume Andrey1,2 7 8 9 1Department of Genetic Medicine and Development, Faculty of Medicine, University of 10 Geneva, Geneva, Switzerland 11 2Institute of Genetics and Genomics in Geneva (iGE3), University of Geneva, Geneva, 12 Switzerland 13 3 Transgenesis Core Facility, Faculty of Medicine, University of Geneva, Geneva, Switzerland 14 15 *Authors contributed equally 16 Correspondence: [email protected] 17 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434611; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 18 Abstract 19 20 Most developmental genes rely on multiple transcriptional enhancers for their accurate expression 21 during embryogenesis. Because enhancers may have partially redundant activities, the loss of one 22 of them often leads to a partial loss of gene expression and concurrent moderate phenotypic 23 outcome, if any.
    [Show full text]