DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 DMD FastThis article Forward. has not beenPublished copyedited on and March formatted. 23, The 2011 final version as doi:10.1124/dmd.111.038166 may differ from this version. DMD #38166
ABC transporter expression in human placenta as a function of pregnancy
condition
Cifford W. Mason1, Irina A. Buhimschi, Catalin S. Buhimschi, Yafeng Dong, Carl P. Weiner, and Peter W. Swaan
Department of Pharmaceutical Sciences, University of Maryland, Baltimore, Maryland, Downloaded from USA (CWM, PWS); Department of Obstetrics and Gynecology, University of Kansas
School of Medicine, Kansas City, Kansas, USA (YD, CPW); and Department of
Obstetrics and Gynecology, Yale University School of Medicine, New Haven, dmd.aspetjournals.org
Connecticut, USA (IAB, CSB)
at ASPET Journals on September 30, 2021
1
Copyright 2011 by the American Society for Pharmacology and Experimental Therapeutics. DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
a) Running Title: Transporter expression and pregnancy condition b) Corresponding Author:
Peter W. Swaan, Ph.D., Department of Pharmaceutical Sciences, University of
Maryland, 20 Penn Street, HSF2-621, Baltimore, MD 21201 USA
Tel: (410) 706-0103
Fax: (410) 706-5017
Email: [email protected] Downloaded from
c) Number of:
Text pages: 33 dmd.aspetjournals.org
Tables: 0
Figures: 4
References: 44 at ASPET Journals on September 30, 2021
Words in Abstract: 241
Words in Introduction: 461
Words in Discussion: 1,698
d) Abbreviations: PTB, preterm birth, PTL, preterm labor, PTLI, preterm labor with inflammation; PTLNI, preterm labor without inflammation; PTSPE, preterm no labor with indications for spontaneous preeclampsia; TNL, term no labor; TL, term labor; DEG, differentially expressed gene; FDR, false discovery rate; NS, no significant difference;
GA, gestational age; wk, weeks; IHC, immunohistochemistry; MDR, multidrug resistance protein; BCRP, breast cancer resistance protein; MRP, multidrug resistance- associated protein
2 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
ABSTRACT
Fetal drug exposure is determined by the type and concentration of placental transporters and their regulation is central to the development of new treatments and delivery strategies for pregnant women and their fetuses. We tested the expression of several clinically important transporters in the human placenta associated with various pregnancy conditions (i.e. labor, preeclampsia, and preterm labor-inflammation).
Placentas were obtained from 5 groups of women at the time of primary cesarean Downloaded from section: (i) term no labor (TNL); (ii) term labor (TL); (iii) preterm no labor (delivered for severe preeclampsia, PTSPE); (iv) preterm labor without inflammation (PTLNI); (v) dmd.aspetjournals.org preterm labor with inflammation (PTLI). Samples were analyzed by Western blot and immunohistochemistry to identify changes in protein expression. Relative mRNA expression was determined by quantitative real-time PCR. A functional genomic at ASPET Journals on September 30, 2021 approach was used to identify placental gene expression and elucidate molecular events that underlie the given condition. Placental expression of ABC transporters from laboring women and women with preeclampsia was unaltered. MDR1 and BCRP protein and mRNA expression increased in placentas of women with preterm labor- inflammation. Molecular pathways of genes up-regulated in PTLI samples included cytokine-cytokine receptor interactions and inflammatory response when compared to the PTLNI group. The mRNA expression of MDR1 and BCRP were correlated to that of interleukin-8, which also increased significantly in PTLI. These data suggest that the transfer of drugs across the placenta may be altered in preterm pregnancy conditions associated with inflammation through changes in MDR1 and BCRP.
3 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
INTRODUCTION
Drug treatment options during pregnancy and lactation are limited because few products have been tested for safety and efficacy in these two patient groups. The placenta is a partially protective barrier that limits fetal exposure to xenobiotics, which is attributed in part to the expression of transporter proteins on placental apical and basal membrane surfaces. Among the most abundant of the apically expressed xenobiotic transporters on the maternal side of the placenta are multidrug resistance protein Downloaded from
(MDR) 1 (P-glycoprotein; ABCB1), multidrug resistance-associated protein 2
(MRP2/ABCC2), and breast cancer resistance protein (BCRP/ABCG2), which handle dmd.aspetjournals.org the efflux of xenobiotics and metabolites out of the fetoplacental compartment (Jonker et al., 2000). The localization of MDR3 (ABCB4) and MRP1 (ABCC1) are less clear, but studies suggest that these transporters may be positioned on the basolateral membrane at ASPET Journals on September 30, 2021 of the placenta where they transport substrates from mother to fetus (Nagashige et al.,
2003; Evseenko et al., 2006). Additional transporters, including BCRP and MRP1, line the fetal capillaries, providing yet another barrier against xenobiotic entry (St-Pierre et al., 2000; Yeboah et al., 2006).
Expression of these clinically important transporters is dependent on gestational age. However, drug transporter expression and regulation in placenta of women with pregnancy pathology requires further definition. Preterm labor is the leading cause of perinatal morbidity and mortality. Preeclampsia and inflammation -which is often secondary to uterine infection- are well-recognized causes of preterm birth and, when diagnosed, frequently result in clinically indicated premature delivery. Treatment for the prevention of preterm birth has thus far been unsuccessful and the rate of premature
4 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
birth has increased over the years. We hypothesize that pregnancy conditions associated with preterm birth such as spontaneous preterm labor, preeclampsia, and preterm labor-inflammation, alter the expression of drug transporters in human placenta.
We applied immunohistochemistry, western blot, and quantitative real time PCR to determine the localization, and protein and mRNA expression of transporters in a series of human placentas obtained from clinically diagnosed pregnancy conditions. In addition, we applied functional genomic profiling, an effective approach toward obtaining Downloaded from mechanistic understanding of underlying disease through changes in gene expression
(Mason et al., 2006), to gain insight into the processes associated with abnormal labor. dmd.aspetjournals.org We postulate that these processes may mediate the observed changes in transporter expression.
The results from these studies provide evidence for altered expression of MDR1 at ASPET Journals on September 30, 2021 and BCRP during inflammation-associated spontaneous preterm labor. They also support the involvement of cytokine-mediated events as a means to explain the observed increase in MDR1 and BCRP expression. Overall, our data suggest that up- regulation of MDR1 and BCRP could alter drug transfer across the placenta. These results will help predict human fetal drug toxicity and drug delivery, and offer new insights into the regulation of placental drug transporters and the impact of various pregnancy conditions upon them.
5 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
METHODS
Study Design
Placenta were obtained under Institutional Review Board approval and after written consent from 5 groups of women at primary cesarean section performed at Yale
University: (i) term no labor (TNL); (ii) term labor (TL); (iii) preterm no labor delivered for severe preeclampsia (PTSPE; mean gestational age (GA), 30.3 weeks; range, 25.6 –
33.0 weeks); (iv) preterm labor unassociated with inflammation (PTLNI; mean GA, 30.5 Downloaded from weeks; range, 25.3 – 36.6 weeks, histological chorioamniotis, stage 0); (v) preterm labor with inflammation (PTLI; mean GA, 28.7 weeks; range, 28.0 – 33.3 weeks; histological dmd.aspetjournals.org chorioamniotis, stage III). Labor was defined by the presence of regular uterine contractions accompanied by progressive cervical dilation. The diagnosis of intra- amniotic inflammation was based on an amniotic fluid mass restricted score of 3 or 4 at ASPET Journals on September 30, 2021 plus >100 white blood cells/μL3 in the context of a positive amniotic fluid culture in a sample that was obtained by transabdominal amniocentesis (Buhimschi et al., 2005).
These tests provide the most accurate tools currently available to maximize the likelihood of sample homogeneity. The mass restricted score provides qualitative information regarding the presence or absence of intra-amniotic inflammation. Briefly, the score ranges from 0-4, depending on the presence (assigned a value of 1) or absence (assigned a value of 0) of each of 4 protein biomarkers (Buhimschi et al.,
2005). A score of 3-4 indicates inflammation, whereas a score of 0-2 excludes it. This biomarker pattern is predictive of preterm birth, histologic chorioamnionitis, and adverse neonatal outcome. A detailed description of the mass restricted method has been published previously (Buhimschi et al., 2005). Preeclampsia was defined according to
6 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
established criteria from the American College of Obstetricians and Gynecologists as a systolic blood pressure of 140 mmHg or a diastolic blood pressure of 90 mmHg and proteinuria of at least +1 on dipstick testing, each on two occasions 4–6 hours apart. In a 24-hr urine collection, proteinuria was defined as ≥300 mg of protein. Indications for cesarean delivery in the PTLNI group were related to spontaneous preterm labor. The indication for cesarean delivery in the TNL and TL group was related to breech presentation and an arrest of cervical dilation at ≥6 cm, respectively. Clinical data were Downloaded from retrieved from the medical records, and statistical analysis of patient demographics was performed using one-way analysis of variance (ANOVA), followed by Student-Newman- dmd.aspetjournals.org Keuls post hoc test for multiple comparisons.
RNA Isolation and Microarray Preparation
Total RNA isolation and gene profiling of placenta was performed in triplicate for at ASPET Journals on September 30, 2021 term and preterm samples using the Affymetrix GeneChip Human Genome U133 Plus
2.0™ microarray (Affymetrix, Santa Clara, CA) as described previously (Mason et al.,
2010).
Microarray Data Processing and Statistical Analysis
The quality of the microarray experiment was assessed as described by Chang and colleagues (Chang et al., 2007) using bioconductor packages for statistical analysis of microarray data. Multidimensional Scaling (MDS) analysis was performed with the signal estimates to assess sample variability. The quality assessment and MDS analyses identified and disqualified discordant sample chips. Signal data were obtained using the RMA algorithm. Differential gene expression between the individual pair-wise conditions was assessed by modified t-tests as described (Kedziorek et al., 2010). The
7 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
search for genes varying among the conditions was made by combining all the pair-wise comparisons above to construct an F-test, which is equivalent to a one-way ANOVA for each gene except that the residual mean squares have been moderated between genes
(Smyth, 2004). The P-values of the tests provide a way to rank genes in terms of the evidence for differential gene expression in order to obtain the most likely differentially expressed genes (DEG) between and among conditions. P-values (P ≤ 0.05) and a 1.5- fold threshold were used as a cutoff for gene inclusion in our analysis. Downloaded from
Microarray Data Analysis
DAVID (Huang da et al., 2009), an ontology-based webtool, was utilized to dmd.aspetjournals.org evaluate statistical measures of knowledge-based groups of genes from publications and public resources. The biological functions of the genes in the placental groups were examined in DAVID on the basis of information from the Gene Ontology (GO) terms, at ASPET Journals on September 30, 2021
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, and gene descriptions from various public databases. We distinguished genes that were up-regulated and down-regulated (differently expressed genes) and used DAVID to determine Gene
Ontology categories which were overrepresented (enriched) with differentially expressed genes. The false discovery rate (FDR) filter identified categories (biological processes, pathways, or molecular functions) that were changed by random chance.
The FDR was set at 10% and GO categories with FDR <10% were considered significantly enriched.
Quantitative Real Time PCR
Primer sequences for amplifications were chosen based on previously published cDNA sequences (Table 1). For normalization of the mRNA data, the endogenous
8 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
reference gene 18s rRNA was used. All primer sets were tested to ensure efficiency of amplification over a wide range of template concentrations. SYBR green (BioRad,
Hercules, CA) was used for amplicon detection. A melt curve was used after amplification to ensure all samples exhibited a single amplicon. Each sample was assayed in triplicate. The average Ct value (cycle threshold for target or endogenous reference gene amplification) was estimated using the software associated with the i- cycler real-time PCR detection system (BioRad, Hercules, CA). Relative changes in Downloaded from
- mRNA expression of the target genes were analyzed using delta-delta Ct method (2
ΔΔCt ) (Livak and Schmittgen, 2001). In this method, the average ΔCt was calculated by dmd.aspetjournals.org subtracting the average Ct value of the endogenous reference gene (18s rRNA) from the average Ct of the target gene for the condition and control placental groups. Fold changes in mRNA expression of target genes in placenta from the condition groups (TL, at ASPET Journals on September 30, 2021
PTSPE, PTLNI, PTLI) were expressed relative to that of the TNL placental control group.
To validate (biological and statistical) the microarray results, we performed qRT-
PCR on select genes that were differentially expressed and/or significantly different in comparisons of either PTLI versus PTLNI or PTLI versus TL.
Western blot analysis
Human placentas were processed according to methods previously described
(Novotna et al., 2004). Briefly, placentas were homogenized in buffer containing 250mM sucrose, 10mM Tris, 5mM EDTA and complete protease inhibitor cocktail (Roche,
Indianapolis, IN) supplemented with PMSF (1mM), pH 7.4. Crude membrane fractions were obtained through differential centrifugation. The homogenate was initially
9 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
centrifuged at 10,000 x g for 10 min at 4 °C. The resulting supernatant was then centrifuged at 36,000 x g for 70 min at 4 °C. Protein concentration was determined using Bradford (Bio-rad, Hercules, CA) assays according to the manufacturer’s protocol.
Membrane protein (50-75 µg) was subject to SDS-PAGE on precast Tris-HCl gels (Bio- rad, Hercules, CA). The separated proteins were transferred to PVDF membranes and blocked using 5% non-fat dry milk. Placental transporters were detected by incubating the membranes overnight at 4 °C with a 1:500 dilution of the monoclonal primary Downloaded from antibody for MDR1 (F4; Sigma, St. Louis, MO) and BCRP (BXP21; Chemicon,
Temecula, CA), a 1:500 dilution for MDR3 (clone P3 II-26; Chemicon, Temecula, CA), a dmd.aspetjournals.org 1:400 dilution for MRP1 (MRPr1; Alexis Biochemicals, San Diego, CA) and a 1:50 dilution for MRP2 (M2III-6; Chemicon, Temecula, CA). The membranes were immunoblotted using peroxidase-conjugated secondary antibody and detected using the at ASPET Journals on September 30, 2021
ECL detection systems (Amersham Biosciences, Piscataway, NJ). Equivalence of protein loading was confirmed by secondary immunoblotting with anti-β-actin antibody.
Immunohistochemical (IHC) Analysis
Immunohistochemical detection of MDR1 and BCRP was performed on frozen sections of placenta from each of the 5 groups of women (n=3 / group). Placental sections were blocked and incubated overnight at 4 oC with the MDR1 and BCRP monoclonal antibodies and dilutions used for western blots. Biotin-labeled secondary antibodies were visualized using peroxidase-conjugated streptavidin (Vectastain ABC kit, Vector Laboratories, USA) with diaminobenzidine (DAB; Sigma, St. Louis, MO) as the substrate. Slides were then counterstained with hematoxylin followed by dehydration in a graded series of ethanol dilutions, cleared by xylene substitute, and
10 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
mounted with DPX mountant (Sigma, St. Louis, MO). Control incubations were without primary antibody.
Statistical Analysis
Statistical analysis was done with Graphpad Prism version 4.0 (Graphpad
Software, Inc., San Diego, CA). Quantitative real-time PCR results were reported as fold change in mRNA expression of target genes (mean ± SEM) for each placental group Downloaded from relative to the mRNA expression found in the TNL control placental group. Mean fold changes in mRNA expression in all the groups were compared by one-way analysis of
variance (ANOVA) followed by post-hoc Student-Newman-Keuls multiple comparison dmd.aspetjournals.org test. Pearson coefficient analysis was used to determine the correlation between the fold changes in mRNA expression of the target genes. Statistical significance was set at p < 0.05. at ASPET Journals on September 30, 2021
RESULTS
Clinical characteristics of placental samples
There were no pathological changes in placentas from TNL, TL, and PTLNI groups based histological evaluation. The samples from PTLI group were associated with histological stage III chorioamnionitis (full-thickness inflammation of both chorion and amnion). This was complemented by inflammation of the amnion (range, grades 1-
3; mode, grade 3), inflammation of the chorion-decidua (range, grades 3-4; mode, grade
3) and funistis (range, grade 1-4; mode, grade 3). Histological grading was based on four grade system devised by Salafia and colleagues (Salafia et al., 1989). Pathological
11 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
abnormalities associated with placentas from PTSPE consisted of placental infarcts less than 3 cm, fibrin deposition, decidual vascular thrombosis, decidual hemorrhage, necrosis, and hyperplastic arteriosclerosis. Further, there were no statistically significant differences in gestational age or fetal birth weight among those women who delivered term (no labor versus labor) or preterm (preeclampsia, inflammation, labor, and no labor) or in maternal age (data not shown). Thus, the observed differences in the ABC transporters among the placental groups are likely the result of the pregnancy condition Downloaded from rather than any variation in maternal age, or variation in gestational age within term or preterm groups (i.e. PTLNI vs PTLI). dmd.aspetjournals.org
Expression and localization of placental drug transporters
Protein levels of MDR1, MDR3, MRP1, MRP2, and BCRP were determined from at ASPET Journals on September 30, 2021 immunoblot analyses. There was greater expression of MDR1 and BCRP observed in placenta of women who were preterm (Figure 1A and B) compared to term.
Furthermore, their protein expression appeared highest in the placenta of women with inflammation (PTLI) compared to women in preterm labor unassociated with inflammation (PTLNI; Figure 1A and B). Other laboratories have shown that MDR1 expression is not dependent on the region of the sample, nor cesarean versus vaginal delivery (Camus et al., 2006; Sun et al., 2006). MRP1, MRP2, and MDR3 were present in all samples but their expression was variable and did not appear to be dramatically affected by pregnancy condition (Figure 1C, D, and E).
The proper cellular localization is essential for transporters to perform their transport function. IHC analysis verified that the observed changes were due to MDR1
12 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
and BCRP (Figure 2) protein expression at the membrane of the syncytiotrophoblast cells. BCRP was also localized to fetal blood vessel endothelial cells (Fig. 2).
In many instances, the regulation of these transporters occurs at transcription.
Given the range of gestational ages in each placental group (condition), we increased the number of placental samples (n = 6-10), following Western blot analysis and immunohistochemistry, used for semi-quantitative real-time PCR. We found significant increases in MDR1 and BCRP gene expression in the preterm placental samples Downloaded from associated with inflammation (PTLI) (Figure 3), which corresponds with their observed protein levels in this condition. There were no changes in MRP1 and MRP2 gene dmd.aspetjournals.org expression among the given conditions. MDR3 mRNA levels were significantly increased in the PTLI group and there were higher levels in PTSPE compared to TL and
TNL. at ASPET Journals on September 30, 2021
Functional characteristics of genes overexpressed in preterm labor inflammation (PTLI) a) PTLI compared to preterm labor no inflammation (PTLNI)
We identified 127 genes overexpressed (≥ 1.5; p ≤ 0.05) in PTLI compared to
PTLNI. The enrichment of these genes was categorized by GO (pathways, biological processes, and molecular functions). Pathway analysis using the KEGG database revealed only one significantly enriched pathway, cytokine-cytokine receptor interaction
(FDR 7.7). Significantly up-regulated genes were further categorized by biological processes and molecular functions. We identified seven biological processes that were significantly enriched: 1) response to wounding (FDR 0.6); 2) inflammatory response
(FDR 0.8); 3) regulation of cell motion (FDR 3.9); 4) regulation of cell proliferation (FDR
5.7); 5) defense response (FDR 6.4); 6) positive regulation of signal transduction (FDR
13 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
7.7); and 7) positive regulation of cell motion (FDR 8.0). There were three molecular functions significantly enriched: 1) growth factor binding (FDR 0.1); cytokine binding
(1.3); and 3) cytokine receptor activity (FDR 8.4). b) PTLI compared to term labor (TL)
One hundred and thirty seven genes were overexpressed (≥ 1.5; p ≤ 0.05) in
PTLI when compared to TL. We found only the focal adhesion pathway (FDR 9.9) to be Downloaded from significantly enriched. There were nine biological processes enriched: 1) female pregnancy (FDR 0.4); 2) tube development (FDR 3.3); 3) ossification (3.8); 4) positive
regulation of kinase activity (FDR 4.3); 5) bone development (FDR 5.1); 6) positive dmd.aspetjournals.org regulation of transferase activity (FDR 5.2); 7) wound healing (FDR 7.08); 8) regulation of locomotion (FDR 7.3); 9) anion transport (FDR 9.4) and two molecular functions enriched: 1) growth factor binding (FDR 1.95); and 2) actin binding (FDR 5.7). at ASPET Journals on September 30, 2021
Functional characteristics of genes underexpressed in preterm labor inflammation
(PTLI) a) PTLI compared to preterm labor no inflammation (PTLNI)
We identified 216 genes that were underexpressed (≥ 1.5; p ≤ 0.05) in PTLI compared to PTLNI. There was only one significantly enriched pathway, ECM-receptor interaction (FDR 1.7). Ten biological processes were found to be significantly enriched:
1) unsaturated fatty acid metabolic process (FDR 0.6); 2) fatty acid metabolic process
(FDR 1.1); 3) branching morphogenesis of a tube (FDR 1.8); 4) morphogenesis of a branching structure (FDR 3.2); 5) icosanoid metabolic process (FDR 3.9); 6) tube morphogenesis (FDR 6.8); 7) negative regulation of binding (FDR 8.7); 8) lipid
14 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
biosynthesis process (FDR 8.9); 9) positive regulation of cell adhesion (FDR 9.2); and
10) icosanoid biosynthesis process (FDR 9.4). There were six molecular functions significantly enriched: 1) lipid binding (FDR 0.4); 2) coenzyme binding (FDR 1.8); 3) cofactor binding (FDR 3.6); 4) actin binding (FDR 6.7); 5) peroxidase activity (FDR 8.1); and 6) oxidoreductase activity, acting on peroxide as acceptor (FDR 8.1). b) PTLI compared to term labor (TL) Downloaded from There were 140 genes underexpressed (≥ 1.5; p ≤ 0.05) in PTLI compared to TL.
There were no pathways or biological processes that were significantly enriched (FDR <
10%). Lipid binding (FDR 1.8) was the only molecular function that was significantly dmd.aspetjournals.org enriched.
Biological validation of microarray gene expression at ASPET Journals on September 30, 2021 To verify the microarray results, highly differentially expressed genes including beta-1 adrenergic receptor (ADRB1), eosinophil major basic protein- also referred to as proteoglycan 2 (MBP or PRG2), stanniocalcin 1 (STC1), and hydroxysteroid (11-beta) dehydrogenase 2 (HSD11β2) were selected and analyzed by qRT-PCR. We confirmed changes in expression (direction and magnitude) of these genes between PTLI and
PTLNI (Supplemental Table 2), and PTLI and TL (Supplemental Table 3). Overall, the direction of change in gene expression by qRT-PCR was consistent with the microarray analysis of these four genes. Additional genes encoding human chorionic gonadotropin beta polypeptide (β-hCG), retinoid x receptor alpha (RXRα), and GATA binding protein
2 (GATA2) were used to confirm statistical significance of microarray genes.
Changes in the mRNA expression of pro-inflammatory cytokines in various placental
15 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
conditions
Previous reports have indicated inverse correlations between MDR1 and pro- inflammatory cytokines. However, neither TNF-α nor IL-6 mRNA expression was altered, and fold changes in IL-8 mRNA expression was significantly increased (12.1- fold, p < 0.001) in PTLI compared to TNL (Figure 4). IL-8 mRNA expression in PTLI was greater than in other conditions including PTSPE where the fold change in IL-8 mRNA Downloaded from expression (6.3, p < 0.05) compared to TNL was greater than that of TL but not PTL with and without inflammation (Figure 4). The fold changes in mRNA expression of IL-8
were correlated with that of MDR1 (Pearson r = 0.50, p < 0.05, respectively) and BCRP dmd.aspetjournals.org
(Pearson r = 0.65, p < 0.00) among the placental groups.
at ASPET Journals on September 30, 2021 DISCUSSION
Expression patterns of placental ABC transporters vary with gestational age and medical condition during pregnancy. The general consensus is that MDR1 and BCRP expression decline (Gil et al., 2005; Mathias et al., 2005; Meyer zu Schwabedissen et al., 2006; Sun et al., 2006), whereas MRP2 and MDR3 levels increase with gestational age towards term (Patel et al., 2003; Meyer zu Schwabedissen et al., 2005). This may reflect a physiological adaptation to the changing requirements for fetal protection, especially in the preterm period. However, several discrepancies have been observed, particularly in humans. For example, Mathias and colleagues reported that BCRP expression in human placenta does not significantly change with gestational age
(Mathias et al., 2005), whereas Yeboah and co-workers showed that placental BCRP protein levels increased toward term while mRNA expression remained unchanged
16 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
(Yeboah et al., 2006). The placental samples used here encompass two very distinct gestational time points: a preterm pregnancy period (28-31 weeks) and a term pregnancy period (38-41 weeks. Because this is not a continuous time course analysis, we cannot infer gestational regulation of the inspected transporters. However, we do observe relatively higher protein expression of MDR1 and BCRP in placental samples from preterm women compared to term (Fig. 1A, B).
There were no apparent changes in expression levels of the ABC transporters in Downloaded from response to labor (term or preterm), which is consistent with prior reports where expression levels of BCRP in human reproductive tissues (fetal membranes and dmd.aspetjournals.org attached deciduas) (Yeboah et al., 2008) and MDR1 in human placenta (Sun et al.,
2006) were not altered by labor at term. Our data further supports that MDR1 and
BCRP expression does not change with preterm labor. Changes in MRP1, MRP2, and at ASPET Journals on September 30, 2021
MDR3 protein expression were less apparent in crude membrane fractions of placental tissue. These preparations differ from isolated syncytiotrophoblasts in purity, and may explain potential differences with other results; specifically in the extent of BCRP and
MRP1 protein expression, which are also localized to the fetal capillary endothelial cells.
However, immunohistochemistry revealed that the cellular localization of MDR1 and
BCRP was not altered in the placental groups. Further, mRNA expression appears to parallel that of protein expression. We suspect that the observed differences in protein expression are due to the specific pregnancy condition rather than variation in experimental design.
Preterm birth is the leading cause of perinatal morbidity and mortality. A large proportion of preterm births are associated with preeclampsia and inflammation- often
17 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
secondary to infection. It is increasingly clear that inflammation (outside of that associated with pregnancy) affects the expression of drug transporters (Petrovic et al.,
2007). We found that both MDR1 and BCRP (protein and mRNA expression) are highest in placentas from women with inflammation (Figures 1A, B and 3A, B). Given their high WBC count, it is probable that inflammation (i.e. stage III chorioamnionitis) is a response to uterine infection. These data represent the first evidence of direct infection-mediated transporter regulation. Downloaded from
Our findings differ with prior literature noting transporter down-regulation during inflammation caused by inflammatory cytokines such as TNF-α, IL-6 and endotoxin (i.e. dmd.aspetjournals.org LPS) in rats (Sukhai et al., 2001; Chen et al., 2005; Wang et al., 2005) and human primary placental cells (Evseenko et al., 2007). We offer several possible explanations for these differences: the impact of LPS-induced inflammation on drug transporters has at ASPET Journals on September 30, 2021 yet to be evaluated at different gestational stages, and previous reports have indicated that preterm placentas respond differently to LPS compared to those at term, specifically in their patterns of cytokine release (Holcberg et al., 2007). More importantly, common clinical infections of the reproductive compartments are associated with microorganisms that lack LPS, such as Ureaplasma sp., Mycoplasma hominis, and Group B Streptococcus. It is evident that different pathogens or pathogen components elicit diverse patterns of gene expression and cytokine release (Flad et al.,
1993; Ueyama et al., 2005). For example, IL-8 was significantly elevated in amniotic fluid and umbilical cord blood in cases of intrauterine Ureaplasma infection, which was not observed with other pathogens (Witt et al., 2005). Taken together, stimulation of alternative cytokines or inflammatory mediators could have contrasting affects on ABC
18 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
transporters. Thus, observed differences in transporter regulation among various experimental models are not surprising. This is evident in cases of patients with inflammation from rheumatoid arthritis where an increase, rather than decrease, in
MDR1 expression is observed (Llorente et al., 2000). It is clear that the impact of inflammation on drug transporters in the human placenta is still in a nascent stage. The development of models that more closely mimic that of the human pathological pregnancy condition will expound differences in transporter regulation; this includes the Downloaded from need to evaluate various inflammatory pathogens and or stimuli during pregnancy.
Hence, we adopted a functional genomic approach to identify potential dmd.aspetjournals.org mechanisms driving changes in gene expression during preterm labor associated with inflammation (PTLI). We hypothesized that underlying inflammatory events may account for the observed MDR1 and BCRP regulation. Because the PTLI group is defined, in at ASPET Journals on September 30, 2021 part, by labor, it was logical to compare this placental group to those also associated with labor, specifically PTLNI and TL. In general, functional pathways and biological processes associated with pregnancy and development were found to be enriched
(overrepresented) with genes overexpressed in PTLI compared to TL. Interestingly, these events appeared to be similar in comparisons of genes up-regulated in PTLNI compared to TL (Supplemental Data Section). When we compared PTLI to PTLNI we found that genes were up regulated in processes associated with inflammation and cellular regulation, in particular the cytokine-cytokine receptor interaction pathway as were molecular functions related to cytokine activity. These results provide biological relevance for the given PTLI condition and further suggest that proinflammatory cytokines may be involved in the pathways regulating MDR1 and BCRP. Thus, we
19 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
evaluated the correlation between expression of well-recognized proinflammatory cytokines, IL-6, IL-8, and TNF-α, and MDR1 and BCRP.
IL-8 is a potent chemotactic and activates neutrophils, potentiating host defense mechanism against inflammation. It is thought to be constitutively produced by the human placenta (Shimoya et al., 1992) independent of preterm vs. term delivery
(Keelan et al., 1999). IL-8 is increased in placental tissue during chorioamnionitis
(Lockwood et al., 2006) as well as in amniotic fluid and cord blood from women with Downloaded from intrauterine infection. We found a significant fold increase in IL-8 mRNA expression in placenta of inflammation-associated pregnancy (PTLI), while there were no differences dmd.aspetjournals.org in placentas from preterm vs. term pregnancy as demonstrated in comparisons between
PTLNI versus TL and TNL (Fig. 4). These results are consistent with the literature. Fold changes in IL-8 mRNA expression were correlated with that of MDR1 and BCRP. Based at ASPET Journals on September 30, 2021 on the aforementioned association between IL-8 and inflammation-infection, these data support altered expression of MDR1 and BCRP in placentas of women with preterm labor-inflammation. Interestingly, there were no changes in mRNA expression of other pro-inflammatory cytokines, TNF-α and IL-6. However, changes in these cytokines may be more apparent in the amniotic fluid or the maternal or fetal serum.
We observed elevated placental mRNA expression of IL-8 in women diagnosed with preterm preeclampsia (PTSPE) compared to term (TNL and TL). These results are consistent with reports of increased IL-8 production in trophoblasts cells (Bowen et al.,
2005) and elevated IL-8 levels in maternal and umbilical cord serum as well as amniotic fluid of preeclamptic women (Nakabayashi et al., 1998; Laskowska et al., 2007). In contrast, Wang and co-workers found a decrease in placental IL-8 production in
20 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
preeclampsia (Wang et al., 1999). Additional experiments may be required to determine the association of preeclampsia and cytokine-specific production.
In these studies, we did not detect significant changes in protein or mRNA expression of the multidrug associated proteins, MRP1 and MRP2. LPS and pro- inflammatory cytokines have been shown to down-regulate MRP2 expression in the liver of rodents (Teng and Piquette-Miller, 2008), however, there is currently no data to support inflammatory-induced changes in MRP2 and MRP1 expression in humans and Downloaded from in placental tissue. Although it has generally been considered a liver-specific transporter, MDR3 expression in human term and preterm placenta has been described dmd.aspetjournals.org (Patel et al., 2003); however, its physiologic function in syncytiotrophoblasts remains speculative. We observed that MDR3 protein levels were not altered to the same extent as its mRNA expression. Others have also indicated discrepancies in MDR3 protein and at ASPET Journals on September 30, 2021 mRNA expression in trophoblasts, which may be attributed, in part, to translational regulation (Evseenko et al., 2006).
In the present study, we found that MDR1 and BCRP are significantly regulated in human placenta. Prior studies have observed that MDR1 and BCRP are co-regulated in various tissue barriers to enhance tissue protection from xenobiotics. For example, de
Vries and colleagues showed that these two transporters act in concert to limit the penetration of topotecan at the blood-brain barrier (de Vries et al., 2007). Like the blood- brain barrier, the placenta protects against harmful toxic substances and restricts the entry of therapeutic agents. Therefore, changes in placental expression of these transporters could have a profound impact on drug efficacy or toxicity. We further demonstrated that both MDR1 and BCRP expression increase in association with
21 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
underlying inflammation. Upregulation of MDR1 and BCRP in placenta during preterm inflammation and/or labor could significantly impair therapeutic intervention. For example, MDR1 and BCRP transport a variety of drugs including drugs necessary for fetal therapy. BCRP/Bcrp1 significantly limits the fetal level of nitrofurantoin, an antibiotic commonly used to treat urinary tract infections during pregnancy (Zhang et al.,
2007) while MDR1/Mdr1a/b transports antibiotics such as azithromycin, erythromycin, clarithromycin, levofloxacin, and rifampin (Thuerauf and Fromm, 2006). These are Downloaded from agents currently used to prevent materno-fetal infections. MDR1 may also limit the transplacental transfer of Protease Inhibitors (PI) such as nelfnavir, ritonavir, saquinavir, dmd.aspetjournals.org lopinavir which are used in HIV-infected women to prevent transmission to the fetus.
Currently, perinatal drug therapy in an inflamed and/or infected maternal-fetal milieu is secondary to clinical premature fetal delivery. Future studies will need to demonstrate at ASPET Journals on September 30, 2021 that the placental MDR1 and BCRP expression during preterm inflammatory conditions directly correlates with drug exposure and outcome.There are a variety of placental transporters that localize to the maternal interface of the placenta, the fetal membrane surface, or both. Additional studies should focus on other important placental transporter proteins and their regulation under the various pregnancy conditions.
22 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
Authorship Contributions
Participated in research design: Mason, Swaan, Weiner
Conducted experiments: Mason, Dong
Contributed clinical samples: Buhismschi, IA & Buhimschi, CS
Performed data analysis: Mason, Swaan
Wrote or contributed to the writing of the manuscript: Mason, Swaan, Weiner Downloaded from
dmd.aspetjournals.org at ASPET Journals on September 30, 2021
23 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
REFERENCES
Bowen RS, Gu Y, Zhang Y, Lewis DF and Wang Y (2005) Hypoxia promotes
interleukin-6 and -8 but reduces interleukin-10 production by placental
trophoblast cells from preeclamptic pregnancies. J Soc Gynecol Investig 12:428-
432.
Buhimschi IA, Christner R and Buhimschi CS (2005) Proteomic biomarker analysis of Downloaded from
amniotic fluid for identification of intra-amniotic inflammation. Bjog 112:173-181.
Camus M, Delomenie C, Didier N, Faye A, Gil S, Dauge MC, Mabondzo A and Farinotti dmd.aspetjournals.org R (2006) Increased expression of MDR1 mRNAs and P-glycoprotein in placentas
from HIV-1 infected women. Placenta 27:699-706.
Chang TC, Wentzel EA, Kent OA, Ramachandran K, Mullendore M, Lee KH, Feldmann at ASPET Journals on September 30, 2021
G, Yamakuchi M, Ferlito M, Lowenstein CJ, Arking DE, Beer MA, Maitra A and
Mendell JT (2007) Transactivation of miR-34a by p53 broadly influences gene
expression and promotes apoptosis. Mol Cell 26:745-752.
Chen YH, Wang JP, Wang H, Sun MF, Wei LZ, Wei W and Xu DX (2005)
Lipopolysaccharide treatment downregulates the expression of the pregnane X
receptor, cyp3a11 and mdr1a genes in mouse placenta. Toxicology 211:242-
252. de Vries NA, Zhao J, Kroon E, Buckle T, Beijnen JH and van Tellingen O (2007) P-
glycoprotein and breast cancer resistance protein: two dominant transporters
working together in limiting the brain penetration of topotecan. Clin Cancer Res
13:6440-6449.
24 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
Evseenko DA, Paxton JW and Keelan JA (2006) ABC drug transporter expression and
functional activity in trophoblast-like cell lines and differentiating primary
trophoblast. Am J Physiol Regul Integr Comp Physiol 290:R1357-1365.
Evseenko DA, Paxton JW and Keelan JA (2007) Independent regulation of apical and
basolateral drug transporter expression and function in placental trophoblasts by
cytokines, steroids, and growth factors. Drug Metab Dispos 35:595-601.
Flad HD, Loppnow H, Rietschel ET and Ulmer AJ (1993) Agonists and antagonists for Downloaded from
lipopolysaccharide-induced cytokines. Immunobiology 187:303-316.
Gil S, Saura R, Forestier F and Farinotti R (2005) P-glycoprotein expression of the dmd.aspetjournals.org human placenta during pregnancy. Placenta 26:268-270.
Holcberg G, Amash A, Sapir O, Sheiner E, Levy S and Huleihel M (2007) Perfusion with
lipopolysaccharide differently affects the secretion of tumor necrosis factor-alpha at ASPET Journals on September 30, 2021
and interleukin-6 by term and preterm human placenta. J Reprod Immunol 74:15-
23.
Huang da W, Sherman BT and Lempicki RA (2009) Systematic and integrative analysis
of large gene lists using DAVID bioinformatics resources. Nat Protoc 4:44-57.
Jonker JW, Smit JW, Brinkhuis RF, Maliepaard M, Beijnen JH, Schellens JH and
Schinkel AH (2000) Role of breast cancer resistance protein in the bioavailability
and fetal penetration of topotecan. J Natl Cancer Inst 92:1651-1656.
Kedziorek DA, Muja N, Walczak P, Ruiz-Cabello J, Gilad AA, Jie CC and Bulte JW
(2010) Gene expression profiling reveals early cellular responses to intracellular
magnetic labeling with superparamagnetic iron oxide nanoparticles. Magn Reson
Med 63:1031-1043.
25 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
Keelan JA, Marvin KW, Sato TA, Coleman M, McCowan LM and Mitchell MD (1999)
Cytokine abundance in placental tissues: evidence of inflammatory activation in
gestational membranes with term and preterm parturition. Am J Obstet Gynecol
181:1530-1536.
Laskowska M, Laskowska K, Leszczynska-Gorzelak B and Oleszczuk J (2007)
Comparative analysis of the maternal and umbilical interleukin-8 levels in normal
pregnancies and in pregnancies complicated by preeclampsia with intrauterine Downloaded from
normal growth and intrauterine growth retardation. J Matern Fetal Neonatal Med
20:527-532. dmd.aspetjournals.org Livak KJ and Schmittgen TD (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods
25:402-408. at ASPET Journals on September 30, 2021
Llorente L, Richaud-Patin Y, Diaz-Borjon A, Alvarado de la Barrera C, Jakez-Ocampo J,
de la Fuente H, Gonzalez-Amaro R and Diaz-Jouanen E (2000) Multidrug
resistance-1 (MDR-1) in rheumatic autoimmune disorders. Part I: Increased P-
glycoprotein activity in lymphocytes from rheumatoid arthritis patients might
influence disease outcome. Joint Bone Spine 67:30-39.
Lockwood CJ, Arcuri F, Toti P, Felice CD, Krikun G, Guller S, Buchwalder LF and
Schatz F (2006) Tumor necrosis factor-alpha and interleukin-1beta regulate
interleukin-8 expression in third trimester decidual cells: implications for the
genesis of chorioamnionitis. Am J Pathol 169:1294-1302.
Mason CW, Hassan HE, Kim KP, Cao J, Eddington ND, Newman AH and Voulalas PJ
(2010) Characterization of the transport, metabolism, and pharmacokinetics of
26 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
the dopamine D3 receptor-selective fluorenyl- and 2-pyridylphenyl amides
developed for treatment of psychostimulant abuse. J Pharmacol Exp Ther
333:854-864.
Mason CW, Swaan PW and Weiner CP (2006) Identification of interactive gene
networks: a novel approach in gene array profiling of myometrial events during
guinea pig pregnancy. Am J Obstet Gynecol 194:1513-1523.
Mathias AA, Hitti J and Unadkat JD (2005) P-glycoprotein and breast cancer resistance Downloaded from
protein expression in human placentae of various gestational ages. Am J Physiol
Regul Integr Comp Physiol 289:R963-969. dmd.aspetjournals.org Meyer zu Schwabedissen HE, Grube M, Dreisbach A, Jedlitschky G, Meissner K,
Linnemann K, Fusch C, Ritter CA, Volker U and Kroemer HK (2006) Epidermal
growth factor-mediated activation of the map kinase cascade results in altered at ASPET Journals on September 30, 2021
expression and function of ABCG2 (BCRP). Drug Metab Dispos 34:524-533.
Meyer zu Schwabedissen HE, Jedlitschky G, Gratz M, Haenisch S, Linnemann K,
Fusch C, Cascorbi I and Kroemer HK (2005) Variable expression of MRP2
(ABCC2) in human placenta: influence of gestational age and cellular
differentiation. Drug Metab Dispos 33:896-904.
Nagashige M, Ushigome F, Koyabu N, Hirata K, Kawabuchi M, Hirakawa T, Satoh S,
Tsukimori K, Nakano H, Uchiumi T, Kuwano M, Ohtani H and Sawada Y (2003)
Basal membrane localization of MRP1 in human placental trophoblast. Placenta
24:951-958.
Nakabayashi M, Sakura M, Takeda Y and Sato K (1998) Elevated IL-6 in midtrimester
amniotic fluid is involved with the onset of preeclampsia. Am J Reprod Immunol
27 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
39:329-334.
Novotna M, Libra A, Kopecky M, Pavek P, Fendrich Z, Semecky V and Staud F (2004)
P-glycoprotein expression and distribution in the rat placenta during pregnancy.
Reprod Toxicol 18:785-792.
Patel P, Weerasekera N, Hitchins M, Boyd CA, Johnston DG and Williamson C (2003)
Semi quantitative expression analysis of MDR3, FIC1, BSEP, OATP-A, OATP-
C,OATP-D, OATP-E and NTCP gene transcripts in 1st and 3rd trimester human Downloaded from
placenta. Placenta 24:39-44.
Petrovic V, Teng S and Piquette-Miller M (2007) Regulation of drug transporters during dmd.aspetjournals.org infection and inflammation. Mol Interv 7:99-111.
Salafia CM, Weigl C and Silberman L (1989) The prevalence and distribution of acute
placental inflammation in uncomplicated term pregnancies. Obstet Gynecol at ASPET Journals on September 30, 2021
73:383-389.
Shimoya K, Matsuzaki N, Taniguchi T, Kameda T, Koyama M, Neki R, Saji F and
Tanizawa O (1992) Human placenta constitutively produces interleukin-8 during
pregnancy and enhances its production in intrauterine infection. Biol Reprod
47:220-226.
Smyth GK (2004) Linear models and empirical bayes methods for assessing differential
expression in microarray experiments. Stat Appl Genet Mol Biol 3:Article3.
St-Pierre MV, Serrano MA, Macias RI, Dubs U, Hoechli M, Lauper U, Meier PJ and
Marin JJ (2000) Expression of members of the multidrug resistance protein family
in human term placenta. Am J Physiol Regul Integr Comp Physiol 279:R1495-
1503.
28 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
Sukhai M, Yong A, Pak A and Piquette-Miller M (2001) Decreased expression of P-
glycoprotein in interleukin-1beta and interleukin-6 treated rat hepatocytes.
Inflamm Res 50:362-370.
Sun M, Kingdom J, Baczyk D, Lye SJ, Matthews SG and Gibb W (2006) Expression of
the multidrug resistance P-glycoprotein, (ABCB1 glycoprotein) in the human
placenta decreases with advancing gestation. Placenta 27:602-609.
Teng S and Piquette-Miller M (2008) Regulation of transporters by nuclear hormone Downloaded from
receptors: implications during inflammation. Mol Pharm 5:67-76.
Thuerauf N and Fromm MF (2006) The role of the transporter P-glycoprotein for dmd.aspetjournals.org disposition and effects of centrally acting drugs and for the pathogenesis of CNS
diseases. Eur Arch Psychiatry Clin Neurosci 256:281-286.
Ueyama J, Nadai M, Kanazawa H, Iwase M, Nakayama H, Hashimoto K, Yokoi T, Baba at ASPET Journals on September 30, 2021
K, Takagi K, Takagi K and Hasegawa T (2005) Endotoxin from various gram-
negative bacteria has differential effects on function of hepatic cytochrome P450
and drug transporters. Eur J Pharmacol 510:127-134.
Wang JH, Scollard DA, Teng S, Reilly RM and Piquette-Miller M (2005) Detection of P-
glycoprotein activity in endotoxemic rats by 99mTc-sestamibi imaging. J Nucl
Med 46:1537-1545.
Wang Y, Baier J, Adair CD, Lewis DF, Krueger S, Kruger T, Gurski M and Brown E
(1999) Interleukin-8 stimulates placental prostacyclin production in preeclampsia.
Am J Reprod Immunol 42:375-380.
Witt A, Berger A, Gruber CJ, Petricevic L, Apfalter P and Husslein P (2005) IL-8
concentrations in maternal serum, amniotic fluid and cord blood in relation to
29 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
different pathogens within the amniotic cavity. J Perinat Med 33:22-26.
Yeboah D, Kalabis GM, Sun M, Ou RC, Matthews SG and Gibb W (2008) Expression
and localisation of breast cancer resistance protein (BCRP) in human fetal
membranes and decidua and the influence of labour at term. Reprod Fertil Dev
20:328-334.
Yeboah D, Sun M, Kingdom J, Baczyk D, Lye SJ, Matthews SG and Gibb W (2006)
Expression of breast cancer resistance protein (BCRP/ABCG2) in human Downloaded from
placenta throughout gestation and at term before and after labor. Can J Physiol
Pharmacol 84:1251-1258. dmd.aspetjournals.org Zhang Y, Wang H, Unadkat JD and Mao Q (2007) Breast cancer resistance protein 1
limits fetal distribution of nitrofurantoin in the pregnant mouse. Drug Metab
Dispos 35:2154-2158. at ASPET Journals on September 30, 2021
30 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
FOOTNOTES PAGE a) Unnumbered footnote
This work was supported in part by grants from the Public Health Service, Centers for
Disease Control [U01 DP000187] and National Institutes of Health [R01 HL049041 and
R01 DK61425].
c) Send reprint requests to: Downloaded from
Peter W. Swaan, Ph.D., Department of Pharmaceutical Sciences, University of
Maryland, 20 Penn Street, HSF2-621, Baltimore, MD 21201 USA; E-mail: dmd.aspetjournals.org [email protected] d) 1Current Address: Department of Obstetrics and Gynecology, University of Kansas
School of Medicine, Kansas City, Kansas, USA at ASPET Journals on September 30, 2021
31 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
FIGURE LEGENDS
Figure 1. Immunoblot analysis of protein expression of MDR1, BCRP, MRP2, MRP1, and MDR3 in human placenta from women after primary c-section during term no labor
(TNL), term labor (TL), preterm spontaneous preeclampsia (PTSPE), preterm labor without inflammation (PTLNI), and preterm labor with inflammation (PTLI).
Figure 2. Immunohistochemical localization of MDR1 and BCRP in human placenta. Downloaded from
Results show MDR1 and BCRP localization to the membrane of the syncytiotrophoblast cells (arrows) in all tissue conditions (n=3 per tissue group). BCRP was also localized to dmd.aspetjournals.org the fetal blood vessel endothelial cells (arrowheads). The MDR1 and BCRP controls are indicative of immunostaining without primary antibody. Images are 40x magnification.
Scale bars: (in Control), 120 µm. at ASPET Journals on September 30, 2021
Figure 3. Relative changes in the gene expression of ABC transporters was determined by real time PCR in human placenta (n = 6-10) from women of various pregnancy conditions. The mean fold change in ABC transporter genes, normalized to the endogenous reference gene, 18s rRNA, and relative to the expression of the TNL
ΔΔ control was calculated in each sample by the 2- Ct method. Differences between all possible pairs of group means were determined by one-way ANOVA followed by
Student-Newman-Keuls multiple comparison post-hoc test. Data are represented as mean ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001, NS, no significant difference.
There were no differences in the mean fold changes of MRP1 and MRP2. Relative mRNA expression in PTLI was significantly higher for MDR1 (p < 0.01), BCRP (p <
32 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. DMD #38166
0.001), and MDR3 (p < 0.05), by 6.4-fold, 3.7-fold, and 12.7-fold, respectively, than that in the TNL placental group.
Figure 4. Relative changes in mRNA expression of proinflammatory cytokines. [A] mRNA levels of IL-6, TNF-α, and IL-8 were analyzed by quantitative real time PCR. The mean fold change in ABC transporter genes, normalized to the endogenous reference gene, 18s rRNA, and relative to the expression of the TNL control was calculated in Downloaded from
ΔΔ each sample by the 2- Ct method. Differences between all possible pairs of group means were determined by one-way ANOVA followed by Student-Newman-Keuls dmd.aspetjournals.org multiple comparison post-hoc test. Data shown are the mean ± SEM from 6-10 independent placenta from each of the 5 groups. *, p < 0.05; **, p < 0.01; ***, p < 0.001;
NS, no significant difference. There were no differences in the mean fold changes of at ASPET Journals on September 30, 2021
TNF-α and IL-6. Relative mRNA expression in PTSPE and PTLI was significantly higher for IL-8 by 6.3-fold (p < 0.05) and 12.1-fold (p < 0.001), respectively, than that in the
TNL placental group. [B] Fold changes in mRNA expression of IL-8 transcripts were correlated with MDR1 and BCRP in the human placentas of varying pregnancy conditions. Correlation analysis was performed using Pearson correlation.
33 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from dmd.aspetjournals.org at ASPET Journals on September 30, 2021 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from dmd.aspetjournals.org at ASPET Journals on September 30, 2021 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from dmd.aspetjournals.org at ASPET Journals on September 30, 2021 DMD Fast Forward. Published on March 23, 2011 as DOI: 10.1124/dmd.111.038166 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from dmd.aspetjournals.org at ASPET Journals on September 30, 2021 ABC transporter expression in human placenta as a function of pregnancy condition Cifford W. Mason1, Irina A. Buhimschi, Catalin S. Buhimschi, Yafeng Dong, Carl P. Weiner, and Peter W. Swaan DRUG METABOLISM AND DISPOSITION
ID Gene.Title Gene.Symbol FoldΔ p-value 205387_s_at chorionic gonadotropin, beta polypeptide /// chorionic goCGB /// CGB5 /// 4.9 0.03 210997_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 3.3 0.01 224589_at X (inactive)‐specific transcript XIST 3.2 0.34 233011_at Annexin A1 ANXA1 3.2 0.09 224590_at X (inactive)‐specific transcript XIST 3.2 0.33 230746_s_at Stanniocalcin 1 STC1 3.0 0.06 209189_at v‐fos FBJ murine osteosarcoma viral oncogene homolog FOS 2.9 0.01 214471_x_at luteinizing hormone beta polypeptide LHB 2.9 0.03 209875_s_at secreted phosphoprotein 1 (osteopontin, bone sialoproteSPP1 2.8 0.02 221900_at collagen, type VIII, alpha 2 COL8A2 2.8 0.00 205547_s_at transgelin TAGLN 2.8 0.01 207558_s_at paired‐like homeodomain 2 PITX2 2.8 0.00 210755_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 2.8 0.01 1568765_at serpin peptidase inhibitor, clade E (nexin, plasminogen acSERPINE1 2.7 0.00 1555724_s_at transgelin TAGLN 2.7 0.01 235210_s_at RPE‐spondin RPESP 2.7 0.10 204748_at prostaglandin‐endoperoxide synthase 2 (prostaglandin G/PTGS2 2.7 0.07 210145_at phospholipase A2, group IVA (cytosolic, calcium‐dependePLA2G4A 2.7 0.14 224588_at X (inactive)‐specific transcript XIST 2.7 0.47 226707_at nicotinate phosphoribosyltransferase domain containing NAPRT1 2.7 0.03 221728_x_at X (inactive)‐specific transcript XIST 2.6 0.39 204955_at sushi‐repeat‐containing protein, X‐linked SRPX 2.6 0.00 236220_at Transcribed locus ‐‐‐ 2.5 0.06 202311_s_at collagen, type I, alpha 1 COL1A1 2.5 0.03 219197_s_at signal peptide, CUB domain, EGF‐like 2 SCUBE2 2.5 0.03 227671_at X (inactive)‐specific transcript XIST 2.5 0.53 228635_at protocadherin 10 PCDH10 2.5 0.00 214218_s_at X (inactive)‐specific transcript XIST 2.4 0.42 227404_s_at Early growth response 1 EGR1 2.4 0.06 210764_s_at cysteine‐rich, angiogenic inducer, 61 CYR61 2.4 0.01 209101_at connective tissue growth factor CTGF 2.4 0.04 207173_x_at cadherin 11, type 2, OB‐cadherin (osteoblast) CDH11 2.4 0.01 221898_at podoplanin PDPN 2.4 0.00 201058_s_at myosin, light chain 9, regulatory MYL9 2.4 0.01 201289_at cysteine‐rich, angiogenic inducer, 61 CYR61 2.4 0.02 203868_s_at vascular cell adhesion molecule 1 VCAM1 2.4 0.12 222484_s_at chemokine (C‐X‐C motif) ligand 14 CXCL14 2.3 0.22 209993_at ATP‐binding cassette, sub‐family B (MDR/TAP), member 1ABCB1 2.3 0.11 226811_at family with sequence similarity 46, member C FAM46C 2.3 0.08 205648_at wingless‐type MMTV integration site family member 2 WNT2 2.3 0.00 202768_at FBJ murine osteosarcoma viral oncogene homolog B FOSB 2.3 0.03 228245_s_at ovostatin 2 /// similar to cDNA sequence BC048546 LOC728715 /// O 2.3 0.16 212489_at collagen, type V, alpha 1 COL5A1 2.3 0.03 212488_at collagen, type V, alpha 1 COL5A1 2.3 0.01 207995_s_at C‐type lectin domain family 4, member M CLEC4M 2.2 0.03 222939_s_at solute carrier family 16, member 10 (aromatic amino acidSLC16A10 2.2 0.08 201310_s_at chromosome 5 open reading frame 13 C5orf13 2.2 0.05 209994_s_at ATP‐binding cassette, sub‐family B (MDR/TAP), member 1ABCB1 /// ABCB4 2.2 0.09 204597_x_at stanniocalcin 1 STC1 2.2 0.08 218162_at olfactomedin‐like 3 OLFML3 2.2 0.12 203088_at fibulin 5 FBLN5 2.2 0.00 214146_s_at pro‐platelet basic protein (chemokine (C‐X‐C motif) ligandPPBP 2.2 0.04 213068_at dermatopontin DPT 2.2 0.06 219915_s_at solute carrier family 16, member 10 (aromatic amino acidSLC16A10 2.2 0.09 210881_s_at insulin‐like growth factor 2 (somatomedin A) /// insulin‐ i IGF2 /// INS‐IGF2 2.1 0.00 205066_s_at ectonucleotide pyrophosphatase/phosphodiesterase 1 ENPP1 2.1 0.13 239742_at Tubby like protein 4 TULP4 2.1 0.02 223669_at hemogen HEMGN 2.1 0.09 205769_at solute carrier family 27 (fatty acid transporter), member 2SLC27A2 2.1 0.05 236179_at Transcribed locus ‐‐‐ 2.1 0.04 218002_s_at chemokine (C‐X‐C motif) ligand 14 CXCL14 2.1 0.28 213948_x_at cell adhesion molecule 3 CADM3 2.1 0.05 201309_x_at chromosome 5 open reading frame 13 C5orf13 2.1 0.05 211821_x_at glycophorin A (MNS blood group) GYPA 2.1 0.08 202310_s_at collagen, type I, alpha 1 COL1A1 2.1 0.04 229302_at transmembrane protein 178 TMEM178 2.1 0.02 213994_s_at spondin 1, extracellular matrix protein SPON1 2.1 0.20 1568574_x_at Secreted phosphoprotein 1 (osteopontin, bone sialoproteSPP1 2.1 0.06 200974_at actin, alpha 2, smooth muscle, aorta ACTA2 2.1 0.02 226360_at zinc and ring finger 3 ZNRF3 2.0 0.10 212915_at PDZ domain containing RING finger 3 PDZRN3 2.0 0.04 235209_at RPE‐spondin RPESP 2.0 0.12 214188_at Hexamethylene bis‐acetamide inducible 1 HEXIM1 2.0 0.06 202274_at actin, gamma 2, smooth muscle, enteric ACTG2 2.0 0.11 205768_s_at solute carrier family 27 (fatty acid transporter), member 2SLC27A2 2.0 0.10 201291_s_at topoisomerase (DNA) II alpha 170kDa TOP2A 2.0 0.13 201694_s_at early growth response 1 EGR1 2.0 0.04 205321_at eukaryotic translation initiation factor 2, subunit 3 gamm EIF2S3 2.0 0.16 213139_at snail homolog 2 (Drosophila) SNAI2 2.0 0.08 206726_at prostaglandin D2 synthase, hematopoietic PGDS 2.0 0.01 204471_at growth associated protein 43 GAP43 2.0 0.04 205421_at solute carrier family 22 (extraneuronal monoamine trans SLC22A3 2.0 0.23 228766_at CD36 molecule (thrombospondin receptor) CD36 2.0 0.06 226658_at podoplanin PDPN 2.0 0.00 226834_at Transcribed locus ‐‐‐ 1.9 0.05 204879_at podoplanin PDPN 1.9 0.00 229704_at Androgen‐induced proliferation inhibitor PDS5B 1.9 0.13 212224_at aldehyde dehydrogenase 1 family, member A1 ALDH1A1 1.9 0.12 1558397_at CDNA FLJ34100 fis, clone FCBBF3007597 ‐‐‐ 1.9 0.00 238617_at CDNA FLJ38181 fis, clone FCBBF1000125 ‐‐‐ 1.9 0.05 203980_at fatty acid binding protein 4, adipocyte FABP4 1.9 0.23 209031_at cell adhesion molecule 1 CADM1 1.9 0.09 206102_at GINS complex subunit 1 (Psf1 homolog) GINS1 1.9 0.06 203325_s_at collagen, type V, alpha 1 COL5A1 1.9 0.06 226769_at fin bud initiation factor FIBIN 1.9 0.03 214456_x_at serum amyloid A1 SAA1 1.9 0.07 205984_at corticotropin releasing hormone binding protein CRHBP 1.9 0.39 205382_s_at complement factor D (adipsin) CFD 1.9 0.02 233223_at CDNA FLJ20843 fis, clone ADKA01954 ‐‐‐ 1.9 0.01 210481_s_at C‐type lectin domain family 4, member M CLEC4M 1.9 0.02 204061_at protein kinase, X‐linked PRKX 1.9 0.03 207166_at guanine nucleotide binding protein (G protein), gamma trGNGT1 1.9 0.32 209897_s_at slit homolog 2 (Drosophila) SLIT2 1.9 0.02 203649_s_at phospholipase A2, group IIA (platelets, synovial fluid) PLA2G2A 1.9 0.29 209094_at dimethylarginine dimethylaminohydrolase 1 DDAH1 1.9 0.10 227194_at family with sequence similarity 3, member B FAM3B 1.9 0.04 207172_s_at cadherin 11, type 2, OB‐cadherin (osteoblast) CDH11 1.9 0.02 220595_at PDZ domain containing RING finger 4 PDZRN4 1.9 0.02 213067_at myosin, heavy chain 10, non‐muscle MYH10 1.9 0.06 204083_s_at tropomyosin 2 (beta) TPM2 1.9 0.08 203304_at BMP and activin membrane‐bound inhibitor homolog (XeBAMBI 1.9 0.00 218585_s_at denticleless homolog (Drosophila) DTL 1.9 0.07 1566140_at homeodomain‐only protein HOP 1.9 0.00 204719_at ATP‐binding cassette, sub‐family A (ABC1), member 8 ABCA8 1.9 0.32 204114_at nidogen 2 (osteonidogen) NID2 1.8 0.04 230130_at Slit homolog 2 (Drosophila) SLIT2 1.8 0.05 200953_s_at cyclin D2 CCND2 1.8 0.04 214433_s_at selenium binding protein 1 SELENBP1 1.8 0.05 225895_at synaptopodin 2 SYNPO2 1.8 0.17 226225_at mutated in colorectal cancers MCC 1.8 0.07 224169_at neuropeptide FF receptor 2 NPFFR2 1.8 0.23 213001_at angiopoietin‐like 2 ANGPTL2 1.8 0.00 202410_x_at insulin‐like growth factor 2 (somatomedin A) /// insulin‐ i IGF2 /// INS‐IGF2 1.8 0.00 206488_s_at CD36 molecule (thrombospondin receptor) CD36 1.8 0.03 210002_at GATA binding protein 6 GATA6 1.8 0.10 229088_at ‐‐‐ ‐‐‐ 1.8 0.08 205563_at KiSS‐1 metastasis‐suppressor KISS1 1.8 0.01 223484_at chromosome 15 open reading frame 48 C15orf48 1.8 0.32 235094_at CDNA FLJ39413 fis, clone PLACE6015729 ‐‐‐ 1.8 0.01 236121_at olfactory receptor, family 51, subfamily E, member 2 OR51E2 1.8 0.04 228875_at chromosome 6 open reading frame 189 C6orf189 1.8 0.07 205919_at hemoglobin, epsilon 1 HBE1 1.8 0.05 233887_at G protein‐coupled receptor 126 GPR126 1.8 0.03 236577_at Transcribed locus ‐‐‐ 1.8 0.02 209436_at spondin 1, extracellular matrix protein SPON1 1.8 0.16 231169_at Taxilin alpha TXLNA 1.8 0.02 209406_at BCL2‐associated athanogene 2 BAG2 1.8 0.03 203881_s_at dystrophin (muscular dystrophy, Duchenne and Becker tyDMD 1.8 0.07 203570_at lysyl oxidase‐like 1 LOXL1 1.8 0.05 201890_at ribonucleotide reductase M2 polypeptide RRM2 1.8 0.15 1554997_a_at prostaglandin‐endoperoxide synthase 2 (prostaglandin G/PTGS2 1.8 0.04 219837_s_at cytokine‐like 1 CYTL1 1.8 0.13 223670_s_at hemogen HEMGN 1.8 0.07 201466_s_at jun oncogene JUN 1.8 0.11 225681_at collagen triple helix repeat containing 1 CTHRC1 1.8 0.07 208607_s_at serum amyloid A1 /// serum amyloid A2 SAA1 /// SAA2 1.8 0.03 223475_at cysteine‐rich secretory protein LCCL domain containing 1 CRISPLD1 1.8 0.35 213106_at ‐‐‐ ‐‐‐ 1.8 0.09 228850_s_at ‐‐‐ ‐‐‐ 1.8 0.05 235979_at complement component 7 C7 1.8 0.22 238021_s_at hCG1815491 hCG_1815491 1.8 0.15 238780_s_at MRNA; cDNA DKFZp779F2345 (from clone DKFZp779F234‐‐‐ 1.7 0.01 209156_s_at collagen, type VI, alpha 2 COL6A2 1.7 0.02 237586_at ‐‐‐ ‐‐‐ 1.7 0.01 213150_at homeobox A10 HOXA10 1.7 0.09 214397_at methyl‐CpG binding domain protein 2 MBD2 1.7 0.17 228653_at sterile alpha motif domain containing 5 SAMD5 1.7 0.01 222877_at CDNA: FLJ21027 fis, clone CAE07110 ‐‐‐ 1.7 0.05 215483_at A kinase (PRKA) anchor protein (yotiao) 9 AKAP9 1.7 0.20 229124_at prokineticin 1 PROK1 1.7 0.27 237622_at Transcribed locus ‐‐‐ 1.7 0.11 1559156_at MRNA; cDNA DKFZp686B1142 (from clone DKFZp686B11 ‐‐‐ 1.7 0.07 212686_at protein phosphatase 1H (PP2C domain containing) PPM1H 1.7 0.24 229623_at Hypothetical LOC441027 FLJ12993 1.7 0.17 219908_at dickkopf homolog 2 (Xenopus laevis) DKK2 1.7 0.03 227915_at ankyrin repeat and SOCS box‐containing 2 ASB2 1.7 0.02 209496_at retinoic acid receptor responder (tazarotene induced) 2 RARRES2 1.7 0.09 205280_at glycine receptor, beta GLRB 1.7 0.01 226464_at chromosome 3 open reading frame 58 C3orf58 1.7 0.02 226145_s_at Fraser syndrome 1 FRAS1 1.7 0.13 237491_at ‐‐‐ ‐‐‐ 1.7 0.08 213093_at protein kinase C, alpha PRKCA 1.7 0.01 213004_at angiopoietin‐like 2 ANGPTL2 1.7 0.00 215646_s_at versican VCAN 1.7 0.06 229007_at hypothetical protein LOC283788 LOC283788 1.7 0.01 202350_s_at matrilin 2 MATN2 1.7 0.14 213746_s_at filamin A, alpha (actin binding protein 280) FLNA 1.7 0.00 219434_at triggering receptor expressed on myeloid cells 1 TREM1 1.7 0.29 205430_at bone morphogenetic protein 5 BMP5 1.7 0.12 229026_at CDC42 small effector 2 CDC42SE2 1.7 0.31 229449_at CDNA FLJ36553 fis, clone TRACH2008478 ‐‐‐ 1.7 0.04 1553275_s_at ‐‐‐ ‐‐‐ 1.7 0.02 210998_s_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 1.7 0.03 214247_s_at dickkopf homolog 3 (Xenopus laevis) DKK3 1.7 0.13 204036_at endothelial differentiation, lysophosphatidic acid G‐proteEDG2 1.7 0.11 205693_at troponin T type 3 (skeletal, fast) TNNT3 1.7 0.01 202196_s_at dickkopf homolog 3 (Xenopus laevis) DKK3 1.7 0.05 238778_at membrane protein, palmitoylated 7 (MAGUK p55 subfamMPP7 1.7 0.25 204624_at ATPase, Cu++ transporting, beta polypeptide ATP7B 1.7 0.04 233857_s_at ankyrin repeat and SOCS box‐containing 2 ASB2 1.7 0.16 206157_at pentraxin‐related gene, rapidly induced by IL‐1 beta PTX3 1.7 0.64 224061_at indolethylamine N‐methyltransferase INMT 1.7 0.11 201801_s_at solute carrier family 29 (nucleoside transporters), membeSLC29A1 1.7 0.03 229225_at neuropilin 2 NRP2 1.7 0.03 208998_at uncoupling protein 2 (mitochondrial, proton carrier) UCP2 1.7 0.05 213747_at ‐‐‐ ‐‐‐ 1.7 0.06 1557688_at MRNA; cDNA DKFZp666E118 (from clone DKFZp666E118)‐‐‐ 1.7 0.01 201867_s_at transducin (beta)‐like 1X‐linked TBL1X 1.7 0.04 201135_at enoyl Coenzyme A hydratase, short chain, 1, mitochondriECHS1 1.7 0.00 214109_at LPS‐responsive vesicle trafficking, beach and anchor cont LRBA 1.7 0.07 209555_s_at CD36 molecule (thrombospondin receptor) CD36 1.7 0.25 203335_at phytanoyl‐CoA 2‐hydroxylase PHYH 1.7 0.07 205132_at actin, alpha, cardiac muscle 1 ACTC1 1.7 0.03 201599_at ornithine aminotransferase (gyrate atrophy) OAT 1.7 0.02 237945_at Maternally expressed (in Callipyge) 8 MEG8 1.7 0.09 202286_s_at tumor‐associated calcium signal transducer 2 TACSTD2 1.7 0.16 219791_s_at putative protein product of Nbla00301 NBLA00301 1.7 0.02 203628_at insulin‐like growth factor 1 receptor IGF1R 1.7 0.22 219778_at zinc finger protein, multitype 2 ZFPM2 1.7 0.05 213338_at transmembrane protein 158 TMEM158 1.7 0.05 242625_at radical S‐adenosyl methionine domain containing 2 RSAD2 1.7 0.08 232058_at CDNA FLJ13694 fis, clone PLACE2000115 ‐‐‐ 1.7 0.00 206390_x_at platelet factor 4 (chemokine (C‐X‐C motif) ligand 4) PF4 1.7 0.02 203908_at solute carrier family 4, sodium bicarbonate cotransporterSLC4A4 1.7 0.24 222816_s_at zinc finger, CCHC domain containing 2 ZCCHC2 1.6 0.06 227558_at chromobox homolog 4 (Pc class homolog, Drosophila) CBX4 1.6 0.04 208950_s_at aldehyde dehydrogenase 7 family, member A1 ALDH7A1 1.6 0.08 205523_at hyaluronan and proteoglycan link protein 1 HAPLN1 1.6 0.36 212372_at myosin, heavy chain 10, non‐muscle MYH10 1.6 0.05 206724_at chromobox homolog 4 (Pc class homolog, Drosophila) CBX4 1.6 0.00 238005_s_at Transcribed locus ‐‐‐ 1.6 0.01 228955_at Transcribed locus ‐‐‐ 1.6 0.01 212091_s_at collagen, type VI, alpha 1 COL6A1 1.6 0.01 201438_at collagen, type VI, alpha 3 COL6A3 1.6 0.03 207030_s_at cysteine and glycine‐rich protein 2 CSRP2 1.6 0.16 242467_at Transcribed locus ‐‐‐ 1.6 0.20 227560_at sideroflexin 2 SFXN2 1.6 0.00 227764_at LY6/PLAUR domain containing 6 LYPD6 1.6 0.10 201464_x_at jun oncogene JUN 1.6 0.10 206918_s_at copine I CPNE1 1.6 0.08 228332_s_at chromosome 11 open reading frame 31 C11orf31 1.6 0.00 203562_at fasciculation and elongation protein zeta 1 (zygin I) FEZ1 1.6 0.01 222162_s_at ADAM metallopeptidase with thrombospondin type 1 moADAMTS1 1.6 0.06 242009_at Transcribed locus ‐‐‐ 1.6 0.19 205471_s_at dachshund homolog 1 (Drosophila) DACH1 1.6 0.04 202238_s_at nicotinamide N‐methyltransferase NNMT 1.6 0.14 225491_at solute carrier family 1 (glial high affinity glutamate transpSLC1A2 1.6 0.06 226611_s_at proline rich 6 PRR6 1.6 0.00 201930_at minichromosome maintenance complex component 6 MCM6 1.6 0.12 206698_at X‐linked Kx blood group (McLeod syndrome) XK 1.6 0.12 227055_at methyltransferase like 7B METTL7B 1.6 0.06 218824_at hypothetical protein FLJ10781 FLJ10781 1.6 0.01 219935_at ADAM metallopeptidase with thrombospondin type 1 moADAMTS5 1.6 0.29 208433_s_at low density lipoprotein receptor‐related protein 8, apolipLRP8 1.6 0.01 223380_s_at LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 1.6 0.02 222529_at solute carrier family 25, member 37 SLC25A37 1.6 0.13 226431_at amyotrophic lateral sclerosis 2 (juvenile) chromosome regALS2CR13 1.6 0.05 201506_at transforming growth factor, beta‐induced, 68kDa TGFBI 1.6 0.15 202237_at nicotinamide N‐methyltransferase NNMT 1.6 0.24 203180_at aldehyde dehydrogenase 1 family, member A3 ALDH1A3 1.6 0.00 223092_at ankylosis, progressive homolog (mouse) ANKH 1.6 0.03 238418_at solute carrier family 35, member B4 SLC35B4 1.6 0.05 201852_x_at collagen, type III, alpha 1 (Ehlers‐Danlos syndrome type IVCOL3A1 1.6 0.06 219181_at lipase, endothelial LIPG 1.6 0.07 202712_s_at creatine kinase, mitochondrial 1B /// creatine kinase, mit CKMT1A /// CKM 1.6 0.01 242626_at sterile alpha motif domain containing 5 SAMD5 1.6 0.01 202502_at acyl‐Coenzyme A dehydrogenase, C‐4 to C‐12 straight chaACADM 1.6 0.11 200859_x_at filamin A, alpha (actin binding protein 280) FLNA 1.6 0.01 205431_s_at bone morphogenetic protein 5 BMP5 1.6 0.04 241885_at Transcribed locus ‐‐‐ 1.6 0.03 225667_s_at ‐‐‐ ‐‐‐ 1.6 0.15 209032_s_at cell adhesion molecule 1 CADM1 1.6 0.13 243140_at Actin, alpha 2, smooth muscle, aorta ACTA2 1.6 0.16 223895_s_at epsin 3 EPN3 1.6 0.01 218025_s_at peroxisomal D3,D2‐enoyl‐CoA isomerase PECI 1.6 0.03 204288_s_at sorbin and SH3 domain containing 2 SORBS2 1.6 0.09 214452_at branched chain aminotransferase 1, cytosolic BCAT1 1.6 0.04 230788_at glucosaminyl (N‐acetyl) transferase 2, I‐branching enzymeGCNT2 1.6 0.06 201525_at apolipoprotein D APOD 1.6 0.42 221731_x_at versican VCAN 1.6 0.07 213993_at spondin 1, extracellular matrix protein SPON1 1.6 0.14 202007_at nidogen 1 NID1 1.6 0.10 204026_s_at ZW10 interactor ZWINT 1.6 0.16 207076_s_at argininosuccinate synthetase 1 ASS1 1.6 0.10 209711_at solute carrier family 35 (UDP‐glucuronic acid/UDP‐N‐acetSLC35D1 1.6 0.02 237159_x_at adaptor‐related protein complex 1, sigma 3 subunit AP1S3 1.6 0.06 227480_at sushi domain containing 2 SUSD2 1.6 0.01 213880_at leucine‐rich repeat‐containing G protein‐coupled receptoLGR5 1.6 0.25 204713_s_at coagulation factor V (proaccelerin, labile factor) F5 1.6 0.09 221909_at transmembrane protein 118 TMEM118 1.6 0.21 229327_s_at Transcribed locus ‐‐‐ 1.6 0.34 222486_s_at ADAM metallopeptidase with thrombospondin type 1 moADAMTS1 1.6 0.08 206470_at plexin C1 PLXNC1 1.6 0.11 211560_s_at aminolevulinate, delta‐, synthase 2 (sideroblastic/hypochALAS2 1.6 0.28 213438_at neurofascin homolog (chicken) NFASC 1.6 0.26 210933_s_at fascin homolog 1, actin‐bundling protein (StrongylocentroFSCN1 1.6 0.02 205097_at solute carrier family 26 (sulfate transporter), member 2 SLC26A2 1.6 0.16 225881_at solute carrier family 35, member B4 SLC35B4 1.6 0.08 224975_at nuclear factor I/A NFIA 1.6 0.02 228750_at Transcribed locus ‐‐‐ 1.6 0.30 207249_s_at solute carrier family 28 (sodium‐coupled nucleoside transSLC28A2 1.6 0.13 220306_at family with sequence similarity 46, member C FAM46C 1.6 0.14 225894_at synaptopodin 2 SYNPO2 1.6 0.14 214039_s_at lysosomal associated protein transmembrane 4 beta LAPTM4B 1.6 0.03 221942_s_at guanylate cyclase 1, soluble, alpha 3 GUCY1A3 1.6 0.01 203821_at heparin‐binding EGF‐like growth factor HBEGF 1.6 0.04 227056_at KIAA0141 KIAA0141 1.6 0.00 204363_at coagulation factor III (thromboplastin, tissue factor) F3 1.6 0.16 229119_s_at zinc finger, SWIM‐type containing 7 ZSWIM7 1.6 0.21 204952_at LY6/PLAUR domain containing 3 LYPD3 1.6 0.04 214752_x_at filamin A, alpha (actin binding protein 280) FLNA 1.6 0.01 226311_at CDNA clone IMAGE:30924414 ‐‐‐ 1.6 0.28 227917_at MRNA; cDNA DKFZp434N2116 (from clone DKFZp434N21‐‐‐ 1.6 0.06 236383_at Transcribed locus ‐‐‐ 1.6 0.22 225566_at neuropilin 2 NRP2 1.6 0.03 218948_at glutaminyl‐tRNA synthase (glutamine‐hydrolyzing)‐like 1 QRSL1 1.6 0.00 230030_at heparan sulfate 6‐O‐sulfotransferase 2 HS6ST2 1.6 0.28 206172_at interleukin 13 receptor, alpha 2 IL13RA2 1.6 0.48 202222_s_at desmin DES 1.6 0.02 202404_s_at collagen, type I, alpha 2 COL1A2 1.6 0.19 237310_at Transcribed locus ‐‐‐ 1.6 0.00 208610_s_at serine/arginine repetitive matrix 2 SRRM2 1.6 0.02 205967_at histone cluster 1, H4c HIST1H4C 1.6 0.03 213797_at radical S‐adenosyl methionine domain containing 2 RSAD2 1.6 0.12 220037_s_at lymphatic vessel endothelial hyaluronan receptor 1 LYVE1 1.6 0.26 205968_at potassium voltage‐gated channel, delayed‐rectifier, subfaKCNS3 1.6 0.03 227419_x_at placenta‐specific 9 PLAC9 1.6 0.02 201242_s_at ATPase, Na+/K+ transporting, beta 1 polypeptide ATP1B1 1.6 0.31 204931_at transcription factor 21 TCF21 1.6 0.05 225502_at dedicator of cytokinesis 8 DOCK8 1.6 0.09 218051_s_at 5'‐nucleotidase domain containing 2 NT5DC2 1.6 0.03 213248_at similar to heterogeneous nuclear ribonucleoprotein A/B LOC730101 1.6 0.18 210220_at frizzled homolog 2 (Drosophila) FZD2 1.6 0.01 241789_at CDNA FLJ36544 fis, clone TRACH2006378 ‐‐‐ 1.5 0.15 225155_at small nucleolar RNA host gene (non‐protein coding) 5 SNHG5 1.5 0.33 221245_s_at frizzled homolog 5 (Drosophila) FZD5 1.5 0.04 214157_at GNAS complex locus GNAS 1.5 0.00 211571_s_at versican VCAN 1.5 0.12 230233_at Transcribed locus ‐‐‐ 1.5 0.08 209505_at Nuclear receptor subfamily 2, group F, member 1 NR2F1 1.5 0.26 244753_at Transcribed locus ‐‐‐ 1.5 0.01 223093_at ankylosis, progressive homolog (mouse) ANKH 1.5 0.04 224482_s_at RAB11 family interacting protein 4 (class II) RAB11FIP4 1.5 0.01 208847_s_at alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 1.5 0.03 211138_s_at kynurenine 3‐monooxygenase (kynurenine 3‐hydroxylaseKMO 1.5 0.06 205048_s_at phosphoserine phosphatase PSPH 1.5 0.45 229353_s_at nuclear casein kinase and cyclin‐dependent kinase substr NUCKS1 1.5 0.04 221210_s_at N‐acetylneuraminate pyruvate lyase (dihydrodipicolinate NPL 1.5 0.04 208644_at poly (ADP‐ribose) polymerase family, member 1 PARP1 1.5 0.03 217735_s_at eukaryotic translation initiation factor 2‐alpha kinase 1 EIF2AK1 1.5 0.01 211576_s_at solute carrier family 19 (folate transporter), member 1 SLC19A1 1.5 0.08 218795_at acid phosphatase 6, lysophosphatidic ACP6 1.5 0.03 203695_s_at deafness, autosomal dominant 5 DFNA5 1.5 0.15 239653_at Transcribed locus ‐‐‐ 1.5 0.00 213428_s_at collagen, type VI, alpha 1 COL6A1 1.5 0.05 212281_s_at transmembrane protein 97 TMEM97 1.5 0.20 204159_at cyclin‐dependent kinase inhibitor 2C (p18, inhibits CDK4) CDKN2C 1.5 0.09 213757_at Eukaryotic translation initiation factor 5A EIF5A 1.5 0.03 202431_s_at v‐myc myelocytomatosis viral oncogene homolog (avian) MYC 1.5 0.15 206858_s_at homeobox C6 HOXC6 1.5 0.05 224690_at chromosome 20 open reading frame 108 C20orf108 1.5 0.03 210139_s_at peripheral myelin protein 22 PMP22 1.5 0.06 221882_s_at transmembrane protein 8 (five membrane‐spanning domTMEM8 1.5 0.12 60474_at chromosome 20 open reading frame 42 C20orf42 1.5 0.09 209037_s_at EH‐domain containing 1 EHD1 1.5 0.02 237400_at ATP synthase, H+ transporting, mitochondrial F0 complexATP5S 1.5 0.07 228082_at adipocyte‐specific adhesion molecule ASAM 1.5 0.03 226085_at CDNA clone IMAGE:4842353 ‐‐‐ 1.5 0.14 1556499_s_at collagen, type I, alpha 1 COL1A1 1.5 0.07 238865_at similar to poly(A) binding protein, cytoplasmic 4 (inducibl LOC132430 1.5 0.02 229896_at CDNA clone IMAGE:6106200 ‐‐‐ 1.5 0.14 227481_at CNKSR family member 3 CNKSR3 1.5 0.19 52651_at collagen, type VIII, alpha 2 COL8A2 1.5 0.01 202314_at cytochrome P450, family 51, subfamily A, polypeptide 1 CYP51A1 1.5 0.02 214439_x_at bridging integrator 1 BIN1 1.5 0.00 202082_s_at SEC14‐like 1 (S. cerevisiae) SEC14L1 1.5 0.06 243951_at ATP‐binding cassette, sub‐family B (MDR/TAP), member 1ABCB1 1.5 0.05 203758_at cathepsin O CTSO 1.5 0.01 205306_x_at kynurenine 3‐monooxygenase (kynurenine 3‐hydroxylaseKMO 1.5 0.07 218009_s_at protein regulator of cytokinesis 1 PRC1 1.5 0.15 242881_x_at Clone HLS_IMAGE_626842 mRNA sequence ‐‐‐ 1.5 0.33 209610_s_at solute carrier family 1 (glutamate/neutral amino acid tranSLC1A4 1.5 0.13 209591_s_at bone morphogenetic protein 7 (osteogenic protein 1) BMP7 1.5 0.11 209904_at troponin C type 1 (slow) TNNC1 1.5 0.03 231577_s_at guanylate binding protein 1, interferon‐inducible, 67kDa GBP1 1.5 0.46 229529_at transcription factor 21 TCF21 1.5 0.00 225720_at synaptopodin 2 SYNPO2 1.5 0.25 236984_at chromosome 4 open reading frame 26 C4orf26 1.5 0.13 209230_s_at nuclear protein 1 NUPR1 1.5 0.19 207519_at solute carrier family 6 (neurotransmitter transporter, seroSLC6A4 1.5 0.08 204534_at vitronectin VTN 1.5 0.08 211161_s_at collagen, type III, alpha 1 (Ehlers‐Danlos syndrome type IVCOL3A1 1.5 0.10 202931_x_at bridging integrator 1 BIN1 1.5 0.01 235761_at CDNA FLJ36553 fis, clone TRACH2008478 ‐‐‐ 1.5 0.08 236548_at GIPC PDZ domain containing family, member 2 GIPC2 1.5 0.00 208121_s_at protein tyrosine phosphatase, receptor type, O PTPRO 1.5 0.08 210717_at PRO1412 ‐‐‐ 1.5 0.02 214209_s_at ATP‐binding cassette, sub‐family B (MDR/TAP), member 9ABCB9 1.5 0.00 221530_s_at basic helix‐loop‐helix domain containing, class B, 3 BHLHB3 1.5 0.02 206471_s_at plexin C1 PLXNC1 1.5 0.14 210266_s_at tripartite motif‐containing 33 TRIM33 1.5 0.02 222696_at axin 2 (conductin, axil) AXIN2 1.5 0.06 210027_s_at APEX nuclease (multifunctional DNA repair enzyme) 1 APEX1 1.5 0.02 222614_at RWD domain containing 2B RWDD2B 1.5 0.12 227300_at transmembrane protein 119 TMEM119 1.5 0.03 217109_at mucin 4, cell surface associated MUC4 1.5 0.11 209651_at transforming growth factor beta 1 induced transcript 1 TGFB1I1 1.5 0.06 221729_at collagen, type V, alpha 2 COL5A2 1.5 0.11 239183_at angiopoietin‐like 1 ANGPTL1 1.5 0.31 227498_at CDNA FLJ11723 fis, clone HEMBA1005314 ‐‐‐ 1.5 0.10 201118_at phosphogluconate dehydrogenase PGD 1.5 0.02 34210_at CD52 molecule CD52 1.5 0.43 225297_at coiled‐coil domain containing 5 (spindle associated) CCDC5 1.5 0.03 239014_at Cell division cycle and apoptosis regulator 1 CCAR1 1.5 0.15 202403_s_at collagen, type I, alpha 2 COL1A2 1.5 0.18 211208_s_at calcium/calmodulin‐dependent serine protein kinase (MACASK 1.5 0.06 242447_at hypothetical gene supported by AK091454 LOC285382 1.5 0.20 1552767_a_at heparan sulfate 6‐O‐sulfotransferase 2 HS6ST2 1.5 0.25 228707_at claudin 23 CLDN23 1.5 0.04 205307_s_at kynurenine 3‐monooxygenase (kynurenine 3‐hydroxylaseKMO 1.5 0.21 204239_s_at neuronatin NNAT 1.5 0.11 203131_at platelet‐derived growth factor receptor, alpha polypeptidPDGFRA 1.5 0.35 203803_at prenylcysteine oxidase 1 PCYOX1 1.5 0.14 216627_s_at UDP‐Gal:betaGlcNAc beta 1,4‐ galactosyltransferase, polyB4GALT1 1.5 0.39 229768_at olfactory receptor, family 51, subfamily E, member 1 OR51E1 1.5 0.19 224677_x_at chromosome 11 open reading frame 31 C11orf31 1.5 0.00 233824_at CDNA: FLJ21428 fis, clone COL04203 ‐‐‐ 1.5 0.01 211820_x_at glycophorin A (MNS blood group) GYPA 1.5 0.17 205353_s_at phosphatidylethanolamine binding protein 1 PEBP1 1.5 0.01 213393_at Clone 23908 mRNA sequence ‐‐‐ 1.5 0.02 209422_at PHD finger protein 20 PHF20 1.5 0.07 205746_s_at ADAM metallopeptidase domain 17 (tumor necrosis factoADAM17 1.5 0.21 222424_s_at nuclear casein kinase and cyclin‐dependent kinase substr NUCKS1 1.5 0.05 227918_s_at zyg‐11 homolog B (C. elegans) ZYG11B 1.5 0.02 213519_s_at laminin, alpha 2 (merosin, congenital muscular dystrophyLAMA2 1.5 0.05 205932_s_at msh homeobox 1 MSX1 1.5 0.01 208096_s_at collagen, type XXI, alpha 1 COL21A1 1.5 0.17 209679_s_at small trans‐membrane and glycosylated protein LOC57228 1.5 0.11 226749_at mitochondrial ribosomal protein S9 MRPS9 1.5 0.03 239348_at ‐‐‐ ‐‐‐ 1.5 0.01 212865_s_at collagen, type XIV, alpha 1 (undulin) COL14A1 1.5 0.32 216147_at MRNA; cDNA DKFZp761L23121 (from clone DKFZp761L23‐‐‐ 1.5 0.06 222750_s_at steroid 5 alpha‐reductase 2‐like SRD5A2L 1.5 0.03 227478_at hypothetical protein LOC284262 LOC284262 1.5 0.14 204455_at dystonin DST 1.5 0.44 205924_at RAB3B, member RAS oncogene family RAB3B 1.5 0.02 240271_at Transcribed locus ‐‐‐ 1.5 0.04 207855_s_at chloride channel CLIC‐like 1 CLCC1 1.5 0.14 201528_at replication protein A1, 70kDa RPA1 1.5 0.03 212012_at peroxidasin homolog (Drosophila) PXDN 1.5 0.08 1552309_a_at nexilin (F actin binding protein) NEXN 1.5 0.24 227279_at transcription elongation factor A (SII)‐like 3 TCEAL3 1.5 0.05 209960_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 1.5 0.16 222680_s_at denticleless homolog (Drosophila) DTL 1.5 0.12 214407_x_at glycophorin B (MNS blood group) GYPB 1.5 0.08 220146_at toll‐like receptor 7 TLR7 1.5 0.14 211126_s_at cysteine and glycine‐rich protein 2 CSRP2 1.5 0.12 229656_s_at similar to echinoderm microtubule associated protein likeFLJ42562 1.5 0.09 202472_at mannose phosphate isomerase MPI 1.5 0.02 225687_at family with sequence similarity 83, member D FAM83D 1.5 0.16 225380_at hypothetical protein BC007901 LOC91461 1.5 0.01 216396_s_at etoposide induced 2.4 mRNA EI24 1.5 0.06 214632_at neuropilin 2 NRP2 1.5 0.02 209961_s_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 1.5 0.16 244802_at glutamate dehydrogenase 1 GLUD1 1.5 0.22 242281_at ‐‐‐ ‐‐‐ 1.5 0.01 227013_at LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 1.5 0.04 202345_s_at fatty acid binding protein 5 (psoriasis‐associated) /// simi FABP5 /// LOC72 1.5 0.08 219493_at SHC SH2‐domain binding protein 1 SHCBP1 1.5 0.13 238478_at basonuclin 2 BNC2 1.5 0.00 218755_at kinesin family member 20A KIF20A 1.5 0.21 210201_x_at bridging integrator 1 BIN1 1.5 0.00 223272_s_at chromosome 1 open reading frame 57 C1orf57 1.5 0.03 240314_at Full length insert cDNA clone ZE12G01 ‐‐‐ 1.5 0.13 209291_at inhibitor of DNA binding 4, dominant negative helix‐loop‐ID4 1.5 0.28 209286_at CDC42 effector protein (Rho GTPase binding) 3 CDC42EP3 1.5 0.13 38241_at butyrophilin, subfamily 3, member A3 BTN3A3 1.5 0.21 207620_s_at calcium/calmodulin‐dependent serine protein kinase (MACASK 1.5 0.13 208962_s_at fatty acid desaturase 1 FADS1 1.5 0.11 205282_at low density lipoprotein receptor‐related protein 8, apolipLRP8 1.5 0.04 215313_x_at major histocompatibility complex, class I, A HLA‐A 1.5 0.13 202589_at thymidylate synthetase TYMS 1.5 0.24 207761_s_at methyltransferase like 7A METTL7A 1.5 0.07 235368_at ADAM metallopeptidase with thrombospondin type 1 moADAMTS5 1.5 0.33 234987_at Full‐length cDNA clone CS0DI067YM20 of Placenta Cot 25‐‐‐ 1.5 0.12 211042_x_at melanoma cell adhesion molecule MCAM 1.5 0.08 212148_at pre‐B‐cell leukemia homeobox 1 PBX1 1.5 0.06 1564027_a_at family with sequence similarity 139, member A FAM139A 1.5 0.10 1555630_a_at RAB34, member RAS oncogene family RAB34 1.5 0.01 201013_s_at phosphoribosylaminoimidazole carboxylase, phosphoriboPAICS 1.5 0.08 228237_at pappalysin 2 PAPPA2 1.5 0.47 229518_at family with sequence similarity 46, member B FAM46B 1.5 0.18 236386_at Suppressor of zeste 12 homolog pseudogene SUZ12P 1.5 0.23 235005_at DIS3 mitotic control homolog (S. cerevisiae)‐like DIS3L 1.5 0.00 217820_s_at enabled homolog (Drosophila) ENAH 1.5 0.16 207459_x_at glycophorin B (MNS blood group) GYPB 1.5 0.11 244777_at DCP2 decapping enzyme homolog (S. cerevisiae) DCP2 1.5 0.17 218552_at enoyl Coenzyme A hydratase domain containing 2 ECHDC2 1.5 0.03 204857_at MAD1 mitotic arrest deficient‐like 1 (yeast) MAD1L1 1.5 0.00 201292_at topoisomerase (DNA) II alpha 170kDa TOP2A 1.5 0.33 202107_s_at minichromosome maintenance complex component 2 MCM2 1.5 0.06 238451_at membrane protein, palmitoylated 7 (MAGUK p55 subfamMPP7 1.5 0.15 241425_at Nucleoporin like 1 NUPL1 1.5 0.07 204620_s_at versican VCAN 1.5 0.11 236123_at Suppression of tumorigenicity 7 like ST7L 1.5 0.03 204595_s_at stanniocalcin 1 STC1 1.5 0.07 213241_at plexin C1 PLXNC1 1.5 0.20 225728_at sorbin and SH3 domain containing 2 SORBS2 1.5 0.24 242890_at CDNA FLJ34225 fis, clone FCBBF3023372 ‐‐‐ 1.5 0.07 228273_at Transcribed locus ‐‐‐ 1.5 0.27 231045_x_at chromosome 11 open reading frame 31 C11orf31 1.5 0.00 223276_at MSTP150 MST150 1.5 0.16 242856_at CDNA FLJ10247 fis, clone HEMBB1000705 ‐‐‐ 1.5 0.12 219143_s_at ribonuclease P/MRP 25kDa subunit RPP25 1.5 0.00 222026_at RNA binding motif (RNP1, RRM) protein 3 RBM3 1.5 0.00 208319_s_at RNA binding motif (RNP1, RRM) protein 3 RBM3 1.5 0.01 201268_at non‐metastatic cells 2, protein (NM23B) expressed in /// NME1‐NME2 /// 1.5 0.06 221004_s_at integral membrane protein 2C ITM2C 1.5 0.06 222714_s_at lactamase, beta 2 LACTB2 1.5 0.07 239286_at Transcribed locus ‐‐‐ 1.5 0.03 205436_s_at H2A histone family, member X H2AFX 1.5 0.05 226736_at churchill domain containing 1 CHURC1 1.5 0.25 203510_at met proto‐oncogene (hepatocyte growth factor receptor MET 1.5 0.18 200951_s_at cyclin D2 CCND2 1.5 0.05 219672_at erythroid associated factor ERAF 1.5 0.09 1554012_at R‐spondin 2 homolog (Xenopus laevis) RSPO2 1.5 0.02 206999_at interleukin 12 receptor, beta 2 IL12RB2 1.5 0.06 238066_at retinol binding protein 7, cellular RBP7 1.5 0.06 1560013_at pyridoxal‐dependent decarboxylase domain containing 1 PDXDC1 1.5 0.12 203625_x_at S‐phase kinase‐associated protein 2 (p45) SKP2 1.5 0.11 214761_at zinc finger protein 423 ZNF423 1.5 0.02 200931_s_at vinculin VCL 1.5 0.10 203946_s_at arginase, type II ARG2 1.5 0.12 220176_at nucleotide binding protein‐like NUBPL 1.5 0.01 1553179_at ADAM metallopeptidase with thrombospondin type 1 moADAMTS19 1.5 0.18 223062_s_at phosphoserine aminotransferase 1 PSAT1 1.5 0.17 242245_at CDNA FLJ90705 fis, clone PLACE1007591 ‐‐‐ 1.5 0.26 209590_at bone morphogenetic protein 7 (osteogenic protein 1) BMP7 1.5 0.17 203775_at solute carrier family 25, member 13 (citrin) SLC25A13 1.5 0.10 207574_s_at growth arrest and DNA‐damage‐inducible, beta GADD45B 1.5 0.02 1556329_a_at CDNA clone IMAGE:5301690 ‐‐‐ 1.5 0.24 202904_s_at LSM5 homolog, U6 small nuclear RNA associated (S. cerevLSM5 1.5 0.07 208228_s_at fibroblast growth factor receptor 2 (bacteria‐expressed k FGFR2 1.5 0.14 211596_s_at leucine‐rich repeats and immunoglobulin‐like domains 1 LRIG1 1.5 0.06 225016_at adenomatosis polyposis coli down‐regulated 1 APCDD1 1.5 0.26 39729_at peroxiredoxin 2 PRDX2 1.5 0.07 230722_at basonuclin 2 BNC2 1.5 0.00 209368_at epoxide hydrolase 2, cytoplasmic EPHX2 1.5 0.03 1568658_at hypothetical gene supported by AK075484; BC014578 LOC339804 1.5 0.07 226492_at sema domain, transmembrane domain (TM), and cytopla SEMA6D 1.5 0.06 209535_s_at ‐‐‐ ‐‐‐ 1.5 0.09 52255_s_at collagen, type V, alpha 3 COL5A3 1.5 0.04 1554899_s_at Fc fragment of IgE, high affinity I, receptor for; gamma poFCER1G 1.5 0.33 219059_s_at lymphatic vessel endothelial hyaluronan receptor 1 LYVE1 1.5 0.24 204254_s_at vitamin D (1,25‐ dihydroxyvitamin D3) receptor VDR 1.5 0.03 209846_s_at butyrophilin, subfamily 3, member A2 BTN3A2 1.5 0.22 213006_at CCAAT/enhancer binding protein (C/EBP), delta CEBPD 1.5 0.15 239842_x_at Transcribed locus ‐‐‐ 1.5 0.05 230708_at Prickle homolog 1 (Drosophila) PRICKLE1 1.5 0.05 216237_s_at minichromosome maintenance complex component 5 MCM5 1.5 0.02 203755_at BUB1 budding uninhibited by benzimidazoles 1 homolog BUB1B 1.5 0.17 205006_s_at N‐myristoyltransferase 2 NMT2 1.5 0.14 204279_at proteasome (prosome, macropain) subunit, beta type, 9 (PSMB9 1.5 0.40 209030_s_at cell adhesion molecule 1 CADM1 1.5 0.14 1553746_a_at chromosome 12 open reading frame 64 C12orf64 1.5 0.11 209869_at adrenergic, alpha‐2A‐, receptor ADRA2A 1.5 0.04 203764_at discs, large homolog 7 (Drosophila) DLG7 1.5 0.17 232843_s_at dedicator of cytokinesis 8 DOCK8 1.5 0.16 201753_s_at adducin 3 (gamma) ADD3 1.5 0.07 214710_s_at cyclin B1 CCNB1 1.5 0.28 233882_s_at sema domain, transmembrane domain (TM), and cytopla SEMA6D 1.5 0.04 203639_s_at fibroblast growth factor receptor 2 (bacteria‐expressed k FGFR2 1.5 0.07 213069_at HEG homolog 1 (zebrafish) HEG1 1.5 0.14 204341_at tripartite motif‐containing 16 /// tripartite motif‐containi TRIM16 /// TRIM 1.5 0.02 241762_at F‐box protein 32 FBXO32 1.5 0.05 37512_at hydroxysteroid (17‐beta) dehydrogenase 6 homolog (mouHSD17B6 1.5 0.27 1559277_at hypothetical protein FLJ35700 FLJ35700 1.5 0.49 213705_at CDNA FLJ30007 fis, clone 3NB692000012 ‐‐‐ 1.5 0.09 238169_at Transcribed locus ‐‐‐ 1.5 0.13 212822_at HEG homolog 1 (zebrafish) HEG1 1.5 0.03 241938_at Quaking homolog, KH domain RNA binding (mouse) QKI 1.5 0.08 203153_at interferon‐induced protein with tetratricopeptide repeatsIFIT1 1.5 0.10 220440_at lectin, galactoside‐binding, soluble, 13 (galectin 13) LGALS13 1.5 0.18 203626_s_at S‐phase kinase‐associated protein 2 (p45) SKP2 1.5 0.05 212067_s_at complement component 1, r subcomponent C1R 1.5 0.24 226771_at ATPase, Class I, type 8B, member 2 ATP8B2 1.5 0.05 212185_x_at metallothionein 2A MT2A 1.5 0.08 228570_at BTB (POZ) domain containing 11 BTBD11 1.5 0.07 225978_at family with sequence similarity 80, member B FAM80B 1.5 0.09 228141_at Similar to RIKEN cDNA 2310016C16 LOC493869 1.5 0.04 203276_at lamin B1 LMNB1 1.5 0.11 234331_s_at ‐‐‐ ‐‐‐ 1.5 0.16 217430_x_at collagen, type I, alpha 1 COL1A1 1.5 0.01 205319_at prostate stem cell antigen PSCA 1.5 0.50 201896_s_at proline/serine‐rich coiled‐coil 1 PSRC1 1.5 0.08 1553542_at coiled‐coil domain containing 125 CCDC125 1.5 0.01 217294_s_at enolase 1, (alpha) ENO1 1.5 0.05 205933_at SET binding protein 1 SETBP1 1.5 0.07 238022_at hCG1815491 hCG_1815491 1.5 0.03 235834_at Caldesmon 1 CALD1 1.5 0.07 216064_s_at aspartylglucosaminidase AGA 1.5 0.06 203508_at tumor necrosis factor receptor superfamily, member 1B TNFRSF1B 1.5 0.07 213712_at elongation of very long chain fatty acids (FEN1/Elo2, SUR4ELOVL2 1.5 0.12 210839_s_at ectonucleotide pyrophosphatase/phosphodiesterase 2 (aENPP2 1.5 0.12 241891_at Transcribed locus ‐‐‐ 1.5 0.20 1554830_a_at STEAP family member 3 STEAP3 1.5 0.02 213194_at roundabout, axon guidance receptor, homolog 1 (Drosop ROBO1 1.5 0.07 ABC transporter expression in human placenta as a function of pregnancy condition Cifford W. Mason1, Irina A. Buhimschi, Catalin S. Buhimschi, Yafeng Dong, Carl P. DRUG METABOLISM AND DISPOSITION
Tissue: Placenta Experimental: Preterm Labor Inflammation Control: Preterm Labor No Inflammation Threshold: 1.5 Fold Filter: p-value ≤ 0.05
Category Term Count Genes FDR KEGG_PATHWAY ECM-receptor interaction 7 228766_AT, 52255_S 1.73
Category Term Count Genes FDR BIOLOGICAL PROCESS unsaturated fatty acid metabolic process 6 226658_AT, 226068_ 0.58 BIOLOGICAL PROCESS fatty acid metabolic process 10 204573_AT, 206726_ 1.05 BIOLOGICAL PROCESS branching morphogenesis of a tube 6 210764_S_AT, 23951 1.77 BIOLOGICAL PROCESS morphogenesis of a branching structure 6 210764_S_AT, 23951 3.15 BIOLOGICAL PROCESS icosanoid metabolic process 5 226658_AT, 226068_ 3.88 BIOLOGICAL PROCESS tube morphogenesis 7 226658_AT, 221898_ 6.82 BIOLOGICAL PROCESS negative regulation of binding 5 242705_X_AT, 20893 8.65 BIOLOGICAL PROCESS lipid biosynthetic process 11 226492_AT, 206726_ 8.85 BIOLOGICAL PROCESS positive regulation of cell adhesion 5 214456_X_AT, 20860 9.16 BIOLOGICAL PROCESS icosanoid biosynthetic process 4 226068_AT, 206726_ 9.44
Category Term Count Genes FDR MOLECULAR FUNCTION lipid binding 16 216321_S_AT, 20242 0.36 MOLECULAR FUNCTION coenzyme binding 9 202428_X_AT, 21842 1.79 MOLECULAR FUNCTION cofactor binding 10 202428_X_AT, 21842 3.60 MOLECULAR FUNCTION actin binding 11 210933_S_AT, 23509 6.74 MOLECULAR FUNCTION peroxidase activity 4 1554997_A_AT, 2047 8.11 MOLECULAR FUNCTION oxidoreductase activity, acting on peroxide as acceptor 4 1554997_A_AT, 2047 8.11 ABC transporter expression in human placenta as a function of pregnancy condition Cifford W. Mason1, Irina A. Buhimschi, Catalin S. Buhimschi, Yafeng Dong, Carl P. Weiner, and Peter W. Swaan DRUG METABOLISM AND DISPOSITION ID Gene.Title Gene.Symbol FoldΔ p-value 230746_s_at Stanniocalcin 1 STC1 4.0 0.02 223484_at chromosome 15 open reading frame 48 C15orf48 3.6 0.05 210755_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 2.8 0.00 225895_at synaptopodin 2 SYNPO2 2.7 0.03 212942_s_at KIAA1199 KIAA1199 2.7 0.05 214471_x_at luteinizing hormone beta polypeptide LHB 2.6 0.04 229896_at CDNA clone IMAGE:6106200 --- 2.6 0.00 37512_at hydroxysteroid (17-beta) dehydrogenase 6 homolog (mousHSD17B6 2.6 0.01 226769_at fin bud initiation factor FIBIN 2.6 0.00 204597_x_at stanniocalcin 1 STC1 2.6 0.04 210997_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 2.5 0.03 205700_at hydroxysteroid (17-beta) dehydrogenase 6 homolog (mousHSD17B6 2.4 0.02 1558397_at CDNA FLJ34100 fis, clone FCBBF3007597 --- 2.2 0.00 205547_s_at transgelin TAGLN 2.2 0.04 1568765_at serpin peptidase inhibitor, clade E (nexin, plasminogen act SERPINE1 2.2 0.00 207558_s_at paired-like homeodomain 2 PITX2 2.2 0.00 236984_at chromosome 4 open reading frame 26 C4orf26 2.2 0.01 202934_at hexokinase 2 HK2 2.2 0.05 206595_at cystatin E/M CST6 2.1 0.01 207995_s_at C-type lectin domain family 4, member M CLEC4M 2.1 0.03 222816_s_at zinc finger, CCHC domain containing 2 ZCCHC2 2.1 0.01 212962_at synapse defective 1, Rho GTPase, homolog 1 (C. elegans SYDE1 2.1 0.05 1555724_s_at transgelin TAGLN 2.1 0.04 209125_at keratin 6A /// keratin 6C KRT6A /// KRT6C 2.1 0.01 200974_at actin, alpha 2, smooth muscle, aorta ACTA2 2.1 0.02 209189_at v-fos FBJ murine osteosarcoma viral oncogene homolog FOS 2.1 0.05 242625_at radical S-adenosyl methionine domain containing 2 RSAD2 2.1 0.02 210287_s_at fms-related tyrosine kinase 1 (vascular endothelial growth fFLT1 2.1 0.04 228850_s_at ------2.1 0.01 243140_at Actin, alpha 2, smooth muscle, aorta ACTA2 2.1 0.04 213747_at ------2.0 0.01 230130_at Slit homolog 2 (Drosophila) SLIT2 2.0 0.03 231169_at Taxilin alpha TXLNA 2.0 0.01 221900_at collagen, type VIII, alpha 2 COL8A2 2.0 0.01 210481_s_at C-type lectin domain family 4, member M CLEC4M 2.0 0.01 210064_s_at uroplakin 1B UPK1B 2.0 0.03 203770_s_at steroid sulfatase (microsomal), isozyme S STS 2.0 0.03 212915_at PDZ domain containing RING finger 3 PDZRN3 2.0 0.04 219232_s_at egl nine homolog 3 (C. elegans) EGLN3 2.0 0.01 203650_at protein C receptor, endothelial (EPCR) PROCR 2.0 0.00 210998_s_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 2.0 0.01 240314_at Full length insert cDNA clone ZE12G01 --- 2.0 0.02 214182_at ADP-ribosylation factor 6 ARF6 1.9 0.04 243993_at ------1.9 0.02 239365_at Full-length cDNA clone CS0DI027YJ20 of Placenta Cot 25 --- 1.9 0.02 203769_s_at steroid sulfatase (microsomal), isozyme S STS 1.9 0.02 209897_s_at slit homolog 2 (Drosophila) SLIT2 1.9 0.02 231067_s_at Transcribed locus --- 1.9 0.01 205919_at hemoglobin, epsilon 1 HBE1 1.9 0.03 225894_at synaptopodin 2 SYNPO2 1.9 0.05 203592_s_at follistatin-like 3 (secreted glycoprotein) FSTL3 1.9 0.04 231152_at Hypothetical protein FLJ20309 FLJ20309 1.9 0.05 214701_s_at fibronectin 1 FN1 1.9 0.02 205543_at heat shock 70kDa protein 4-like HSPA4L 1.9 0.01 210065_s_at uroplakin 1B UPK1B 1.9 0.04 201058_s_at myosin, light chain 9, regulatory MYL9 1.9 0.03 213797_at radical S-adenosyl methionine domain containing 2 RSAD2 1.9 0.03 204368_at solute carrier organic anion transporter family, member 2A SLCO2A1 1.9 0.01 228582_x_at Transcribed locus --- 1.9 0.05 203768_s_at steroid sulfatase (microsomal), isozyme S STS 1.9 0.01 202068_s_at low density lipoprotein receptor (familial hypercholesterolemLDLR 1.9 0.00 203153_at interferon-induced protein with tetratricopeptide repeats 1 IFIT1 1.9 0.01 1554012_at R-spondin 2 homolog (Xenopus laevis) RSPO2 1.8 0.00 205282_at low density lipoprotein receptor-related protein 8, apolipoprLRP8 1.8 0.00 243847_at Transcribed locus --- 1.8 0.05 204254_s_at vitamin D (1,25- dihydroxyvitamin D3) receptor VDR 1.8 0.00 201185_at HtrA serine peptidase 1 HTRA1 1.8 0.05 228707_at claudin 23 CLDN23 1.8 0.01 242856_at CDNA FLJ10247 fis, clone HEMBB1000705 --- 1.8 0.03 200832_s_at stearoyl-CoA desaturase (delta-9-desaturase) SCD 1.8 0.00 209961_s_at hepatocyte growth factor (hepapoietin A; scatter factor) HGF 1.8 0.05 210986_s_at tropomyosin 1 (alpha) TPM1 1.8 0.04 229943_at tripartite motif-containing 13 TRIM13 1.8 0.03 222853_at fibronectin leucine rich transmembrane protein 3 FLRT3 1.7 0.02 228635_at protocadherin 10 PCDH10 1.7 0.05 231101_at Transcribed locus --- 1.7 0.01 204952_at LY6/PLAUR domain containing 3 LYPD3 1.7 0.02 220595_at PDZ domain containing RING finger 4 PDZRN4 1.7 0.03 227480_at sushi domain containing 2 SUSD2 1.7 0.00 209406_at BCL2-associated athanogene 2 BAG2 1.7 0.05 204955_at sushi-repeat-containing protein, X-linked SRPX 1.7 0.02 1556194_a_at CDNA FLJ33585 fis, clone BRAMY2012163 --- 1.7 0.05 216396_s_at etoposide induced 2.4 mRNA EI24 1.7 0.02 202314_at cytochrome P450, family 51, subfamily A, polypeptide 1 CYP51A1 1.7 0.01 205648_at wingless-type MMTV integration site family member 2 WNT2 1.7 0.04 224009_x_at dehydrogenase/reductase (SDR family) member 9 DHRS9 1.7 0.03 217550_at activating transcription factor 6 ATF6 1.7 0.00 203951_at calponin 1, basic, smooth muscle CNN1 1.7 0.01 208614_s_at filamin B, beta (actin binding protein 278) FLNB 1.7 0.00 211138_s_at kynurenine 3-monooxygenase (kynurenine 3-hydroxylase) KMO 1.7 0.03 203637_s_at midline 1 (Opitz/BBB syndrome) MID1 1.7 0.00 203767_s_at steroid sulfatase (microsomal), isozyme S STS 1.7 0.04 1566140_at homeodomain-only protein HOP 1.7 0.01 206249_at mitogen-activated protein kinase kinase kinase 13 MAP3K13 1.7 0.00 228955_at Transcribed locus --- 1.7 0.01 225491_at solute carrier family 1 (glial high affinity glutamate transpor SLC1A2 1.7 0.05 205306_x_at kynurenine 3-monooxygenase (kynurenine 3-hydroxylase) KMO 1.6 0.04 203990_s_at ubiquitously transcribed tetratricopeptide repeat, X chromo UTX 1.6 0.03 209682_at Cas-Br-M (murine) ecotropic retroviral transforming sequenCBLB 1.6 0.01 210881_s_at insulin-like growth factor 2 (somatomedin A) /// insulin- insuIGF2 /// INS-IGF 1.6 0.00 203304_at BMP and activin membrane-bound inhibitor homolog (XenoBAMBI 1.6 0.02 208613_s_at filamin B, beta (actin binding protein 278) FLNB 1.6 0.00 208433_s_at low density lipoprotein receptor-related protein 8, apolipoprLRP8 1.6 0.01 229465_s_at Transcribed locus, moderately similar to XP_001102724.1 --- 1.6 0.02 207172_s_at cadherin 11, type 2, OB-cadherin (osteoblast) CDH11 1.6 0.05 213004_at angiopoietin-like 2 ANGPTL2 1.6 0.01 211000_s_at interleukin 6 signal transducer (gp130, oncostatin M receptIL6ST 1.6 0.05 211103_at myosin VIIA MYO7A 1.6 0.01 237732_at ------1.6 0.05 224252_s_at FXYD domain containing ion transport regulator 5 FXYD5 1.6 0.01 207978_s_at nuclear receptor subfamily 4, group A, member 3 NR4A3 1.6 0.00 222451_s_at zinc finger, DHHC-type containing 9 ZDHHC9 1.6 0.03 204864_s_at interleukin 6 signal transducer (gp130, oncostatin M receptIL6ST 1.6 0.04 209747_at transforming growth factor, beta 3 TGFB3 1.6 0.02 209535_s_at ------1.6 0.05 201995_at exostoses (multiple) 1 EXT1 1.6 0.01 222847_s_at egl nine homolog 3 (C. elegans) EGLN3 1.6 0.01 239227_at ------1.6 0.01 235150_at MRNA; cDNA DKFZp313B1017 (from clone DKFZp313B10--- 1.6 0.03 226621_at ------1.6 0.02 214452_at branched chain aminotransferase 1, cytosolic BCAT1 1.6 0.04 205431_s_at bone morphogenetic protein 5 BMP5 1.6 0.05 205729_at oncostatin M receptor OSMR 1.6 0.05 1552947_x_at zinc finger protein 114 ZNF114 1.6 0.02 223952_x_at dehydrogenase/reductase (SDR family) member 9 DHRS9 1.6 0.03 218084_x_at FXYD domain containing ion transport regulator 5 FXYD5 1.6 0.02 222288_at Transcribed locus, moderately similar to XP_517655.1 sim--- 1.6 0.02 1557918_s_at solute carrier family 16, member 1 (monocarboxylic acid traSLC16A1 1.6 0.03 243917_at chloride intracellular channel 5 CLIC5 1.6 0.00 213317_at chloride intracellular channel 5 CLIC5 1.6 0.02 218454_at hypothetical protein FLJ22662 FLJ22662 1.6 0.00 210665_at tissue factor pathway inhibitor (lipoprotein-associated coagTFPI 1.5 0.05 203974_at haloacid dehalogenase-like hydrolase domain containing 1HDHD1A 1.5 0.04 233219_at CDNA FLJ13365 fis, clone PLACE1000332 --- 1.5 0.03 213001_at angiopoietin-like 2 ANGPTL2 1.5 0.01 239901_at Transcribed locus --- 1.5 0.04 202195_s_at transmembrane emp24 protein transport domain containingTMED5 1.5 0.02 213746_s_at filamin A, alpha (actin binding protein 280) FLNA 1.5 0.01 218772_x_at transmembrane protein 38B TMEM38B 1.5 0.01 228706_s_at claudin 23 CLDN23 1.5 0.05 223275_at protein arginine methyltransferase 6 PRMT6 1.5 0.05 210126_at pregnancy specific beta-1-glycoprotein 9 PSG9 1.5 0.02 238419_at pleckstrin homology-like domain, family B, member 2 PHLDB2 1.5 0.03 218729_at latexin LXN 1.5 0.01 227870_at neighbor of Punc E11 NOPE 1.5 0.00 204636_at collagen, type XVII, alpha 1 COL17A1 1.5 0.05 204686_at insulin receptor substrate 1 IRS1 1.5 0.03 218948_at glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 QRSL1 1.5 0.00 214580_x_at keratin 6A /// keratin 6B /// keratin 6C KRT6A /// KRT6B 1.5 0.00 239286_at Transcribed locus --- 1.5 0.02 1556055_at Clone 23574 mRNA sequence --- 1.5 0.04 228702_at hypothetical protein FLJ43663 FLJ43663 1.5 0.05 213446_s_at IQ motif containing GTPase activating protein 1 IQGAP1 1.5 0.03 232525_at CDNA: FLJ21429 fis, clone COL04205 --- 1.5 0.03 211083_s_at mitogen-activated protein kinase kinase kinase 13 MAP3K13 1.5 0.01 230100_x_at p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeasPAK1 1.5 0.02 227419_x_at placenta-specific 9 PLAC9 1.5 0.03 235684_s_at sestrin 3 SESN3 1.5 0.00 228156_at Homo sapiens, clone IMAGE:4346533, mRNA --- 1.5 0.05 219648_at melanoregulin MREG 1.5 0.03 36552_at hypothetical protein DKFZP586P012 1.5 0.05 219191_s_at bridging integrator 2 BIN2 1.5 0.02 233260_at CDNA FLJ13528 fis, clone PLACE1006143 --- 1.5 0.04 207543_s_at procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline P4HA1 1.5 0.02 201411_s_at pleckstrin homology domain containing, family B (evectins)PLEKHB2 1.5 0.00 1554593_s_at solute carrier family 1 (high affinity aspartate/glutamate tranSLC1A6 1.5 0.01 220029_at elongation of very long chain fatty acids (FEN1/Elo2, SUR4ELOVL2 1.5 0.01 209967_s_at cAMP responsive element modulator CREM 1.5 0.01 203636_at midline 1 (Opitz/BBB syndrome) MID1 1.5 0.01 217294_s_at enolase 1, (alpha) ENO1 1.5 0.05 214539_at serpin peptidase inhibitor, clade B (ovalbumin), member 10SERPINB10 1.5 0.00 228234_at toll-like receptor adaptor molecule 2 TICAM2 1.5 0.02 220949_s_at chromosome 7 open reading frame 49 C7orf49 1.5 0.00 235539_at Nuclear mitotic apparatus protein 1 NUMA1 1.5 0.04 200859_x_at filamin A, alpha (actin binding protein 280) FLNA 1.5 0.02 240271_at Transcribed locus --- 1.5 0.05 1557100_s_at HECT domain containing 1 HECTD1 1.5 0.03 216504_s_at solute carrier family 39 (zinc transporter), member 8 SLC39A8 1.5 0.04 SUPPLEMENTAL DATA
The expression of ABC transporter proteins in human placenta as a function of
pregnancy condition
C.W. Mason, I.A. Buhimschi, C.S. Buhimschi , Y. Dong, C.P. Weiner, P.W. Swaan Drug Metabolism and Disposition
A. Biological Validation of Microarray Gene Expression Data Functional genomics is a tool used to expand and characterize molecular pathways that potentially define a given condition. Presently, a functional genomic approach was taken to identify potential mechanisms driving changes in gene expression during preterm labor associated with inflammation (PTLI). We hypothesized that underlying inflammatory events may account for the observed MDR1 and BCRP regulation. Because the PTLI group is defined, in part, by labor, it was logical to compare this placental group to those also associated with labor, specifically PTLNI and TL. We first verified the microarray gene expression by analyzing a set of selected genes that had large changes in gene expression on the array. These genes have been previously associated with pregnancy. The eosinophil major basic protein (MBP; aka proteoglycan 2, PRG2) is a potent toxin for parasites (Butterworth et al., 1979; Wassom and Gleich, 1979; Duffus et al., 1980; Kierszenbaum et al., 1981; Hamann et al., 1990), bacteria (Lehrer et al., 1989), and certain mammalian cells (Gleich et al., 1979). There is also evidence that it possesses proinflammatory properties (O'Donnell et al., 1983; Zheutlin et al., 1984; Moy et al., 1990; Rohrbach et al., 1990; Weiler et al., 1992). Previous studies indicate that plasma levels of MBP are increased in pregnant women, even more so in those who experienced spontaneous onset of labor. During pregnancy the majority is synthesized in placenta as the level of its mRNA is more than 200-fold higher in placenta than in other tissues (Overgaard et al., 1999). We verified by qRT-PCR our array findings (Supplemental Tables 2 and 3) that the levels of MBP are increased in placenta from the PTLI group. The beta-adrenergic receptors (β-ARs) are members of the G-protein coupled receptor superfamily. Studies have indicated that β1-ARs are rather abundant in the placenta. Of the nearly 32,000 genes on the microarray, ADRB1- the gene encoding the β1-AR was highly decreased in PTLI compared to PTLNI and TL as measured by microarray and qRT-PCR (Supplemental Tables 2 and 3). Stanniocalcin 1 (STC1) is a hormone that regulates calcium and phosphate homeostasis. Its expression appears to be highest in the ovaries and enhanced during pregnancy and lactation. STC1 has been described in multiple species. In sheep, STC1 mRNA and protein is up-regulated in the uterine glands after day 16 of pregnancy probably regulating growth and differentiation of the fetus and placenta (Song et al., 2006). Our gene expression data (microarray and qRT-PCR) shows that STC1 mRNA levels are increased in PTLI compared to TL. Hydroxysteroid (11-beta) dehydrogenase 2 (11β-HSD2) is a placental enzyme that converts maternal cortisol to cortisone and is partly responsible for maintaining the lower levels
1 of glucocorticoids (GC) in the fetus than in the mother. Human placental 11β-HSD2 is regulated by steroids and cytokines, and is down-regulated with infection (Challis and Connor, 2009). We confirmed decreased gene expression of 11β-HSD2 in PTLI in our microarray finding by qRT-PCR. Additional genes encoding human chorionic gonadotropin beta polypeptide (β-hCG), retinoid x receptor alpha (RXRα), and GATA binding protein 2 (GATA2) were used for statistical confirmation of the microarray findings.
B. Identification of Gene Ontology processes In general, functional pathways and biological processes associated with pregnancy and development were found to be enriched with genes overexpressed in PTLI compared to TL. Interestingly, these events appeared to be similar in comparisons of genes up regulated in PTLNI compared to TL (Supplemental Data_PTLNI-TL; MS Excel File format). For example, the focal adhesion pathway and molecular function of growth factor binding were most significantly enriched with genes up regulated in PTLI and PTLNI compared to TL. Moreover, biological processes associated with development (i.e. ossification, bone development) were enriched in both comparisons. When we compared PTLI to PTLNI we found that genes were up regulated in processes associated with inflammation (i.e. response to wounding, inflammatory response, defense response) and cellular regulation (i.e. regulation of ell motion, regulation of cell proliferation). In addition, the cytokine-cytokine receptor interaction pathway was significantly enriched as were molecular functions related to cytokine activity (i.e. cytokine binding, cytokine receptor activity). These results provide biological relevance for the given PTLI condition and further suggest that proinflammatory cytokines may be involved in the pathways regulating MDR1 and BCRP.
2 Supplemental Table 1. PCR primers used for quantitative real-time PCR
Gene 5’ Primer 3’ Primer Reference
(Albermann et MDR1 CCCATCATTGCAATAGCAGG TGTTCAAACTTCTGCTCCTGA al., 2005) (Pattyn et al., BCRP GCCGTGGAACTCTTTGTGGTAG ACAGCCAAGATGCAATGGTTGT 2003) (Yanai et al., MDR3 TGGCCCTGGTTGGAAGTAGTG AGAAGGATCTTGGGGTTGCGAA 2003) (Yeh et al., MRP1 TCTACCTCCTGTGGCTGAATCTG CCGATTGTCTTTGCTCTTCATG 2003) (Ballestero et MRP2 GGCAGTGAAGAAGAAGACGATGA ATTGGACCTAGAACTGCGGCT al., 2006) IL-6 CCAGTACCCCCAGGAGAAGAT CGTTCTGAAGAGGTGAGTGGC Abe, 2005 (Partridge et IL-8 TGCCAAGGAGTGCTAAAG CTCCACAACCCTCTGCAC al., 2007) (Duman et al., TNF-α GAGCACTGAAAGCATGATCC CGAGAAGATGATCTGACTGCC 2007) (Dunne et al., PRG2 TGGATTGGAGGCAGGATCA TGCCGTCAACCCACTGAAA 2006) (Cao et al., ADRB1 CCTCGTCCGTAGTCTCCTTC GCAGCTGTCGATCTTCTTCA 2010) (Law et al., STC1 CACACCCACGAGCTGACTTC TCTCCCTGGTTATGCACTCTCA 2008) 11β- CTGGCTGCTTCAAGACAGAGT AGGCAGGTAGTAGTGGATGAA HSD2 β-hCG TGTGCATCACCGTCAACACC AGCGCACATCGCGGTAGTT (Daoud et al., 2006) RXRα CGACCCTGTCACCAACATTTGC GAGCAGCTCATTCCAGCCTGCC (Mangelsdorf et al., 1990) GATA2 GCACCTGTTGTGCAAATTGT GCCCCTTTCTTGCTCTTCTT (Rodrigues et al., 2005) 18s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG
3 Supplemental Table 2. Comparison of qRT-PCR and microarray analysis of selected genes: PTLI versus PTLNI
qRT-PCR Microarray
Fold Direction of Fold Direction of Gene P-value P-value Change Change Change Change
ADRB1 0.21 -9.1 decrease 0.00 -2.6 decrease
PRG2 0.06 11.9 increase 0.06 2.8 increase
STC1 0.26 2.3 increase 0.61 1.3 increase
11β-HSD2 0.01 -3.1 decrease 0.02 -1.5 decrease
Supplemental Table 3. Comparison of qRT-PCR and microarray analysis of selected genes: PTLI versus TL
qRT-PCR Microarray
Fold Direction of Fold Direction of Gene P-value P-value Change Change Change Change
ADRB1 0.18 -3.8 decrease 0.00 -4.6 decrease
PRG2 0.16 -1.8 decrease 0.92 -1.1 decrease
STC1 0.03 2.6 increase 0.02 4.0 increase
11β-HSD2 0.01 -2.4 decrease 0.03 -1.5 decrease hCGβ <0.01 4.4 increase 0.05 3.9 increase
RXRα 0.04 -2.0 decrease 0.05 -1.1 decrease
GATA2 <0.01 -3.3 decrease 0.02 -1.3 decrease
4 REFERENCES
Albermann N, Schmitz-Winnenthal FH, Z'Graggen K, Volk C, Hoffmann MM, Haefeli WE and Weiss J (2005) Expression of the drug transporters MDR1/ABCB1, MRP1/ABCC1, MRP2/ABCC2, BCRP/ABCG2, and PXR in peripheral blood mononuclear cells and their relationship with the expression in intestine and liver. Biochem Pharmacol 70:949-958. Ballestero MR, Monte MJ, Briz O, Jimenez F, Gonzalez-San Martin F and Marin JJ (2006) Expression of transporters potentially involved in the targeting of cytostatic bile acid derivatives to colon cancer and polyps. Biochem Pharmacol 72:729-738. Butterworth AE, Wassom DL, Gleich GJ, Loegering DA and David JR (1979) Damage to schistosomula of Schistosoma mansoni induced directly by eosinophil major basic protein. J Immunol 122:221- 229. Cao DX, Wu GH, Yang ZA, Zhang B, Jiang Y, Han YS, He GD, Zhuang QL, Wang YF, Huang ZL and Xi QL (2010) Role of beta1-adrenoceptor in increased lipolysis in cancer cachexia. Cancer Sci 101:1639-1645. Challis JR and Connor K (2009) Glucocorticoids, 11beta-hydroxysteroid dehydrogenase: mother, fetus, or both? Endocrinology 150:1073-1074. Daoud G, Rassart E, Masse A and Lafond J (2006) Src family kinases play multiple roles in differentiation of trophoblasts from human term placenta. J Physiol 571:537-553. Duffus WP, Thorne K and Oliver R (1980) Killing of juvenile Fasciola hepatica by purified bovine eosinophil proteins. Clin Exp Immunol 40:336-344. Duman DG, Ozdemir F, Birben E, Keskin O, Eksioglu-Demiralp E, Celikel C, Kalayci O and Kalayci C (2007) Effects of pentoxifylline on TNF-alpha production by peripheral blood mononuclear cells in patients with nonalcoholic steatohepatitis. Dig Dis Sci 52:2520-2524. Dunne J, Cullmann C, Ritter M, Soria NM, Drescher B, Debernardi S, Skoulakis S, Hartmann O, Krause M, Krauter J, Neubauer A, Young BD and Heidenreich O (2006) siRNA-mediated AML1/MTG8 depletion affects differentiation and proliferation-associated gene expression in t(8;21)-positive cell lines and primary AML blasts. Oncogene 25:6067-6078. Gleich GJ, Frigas E, Loegering DA, Wassom DL and Steinmuller D (1979) Cytotoxic properties of the eosinophil major basic protein. J Immunol 123:2925-2927. Hamann KJ, Gleich GJ, Checkel JL, Loegering DA, McCall JW and Barker RL (1990) In vitro killing of microfilariae of Brugia pahangi and Brugia malayi by eosinophil granule proteins. J Immunol 144:3166-3173. Kierszenbaum F, Ackerman SJ and Gleich GJ (1981) Destruction of bloodstream forms of Trypanosoma cruzi by eosinophil granule major basic protein. Am J Trop Med Hyg 30:775-779. Law AY, Lai KP, Lui WC, Wan HT and Wong CK (2008) Histone deacetylase inhibitor-induced cellular apoptosis involves stanniocalcin-1 activation. Exp Cell Res 314:2975-2984. Lehrer RI, Szklarek D, Barton A, Ganz T, Hamann KJ and Gleich GJ (1989) Antibacterial properties of eosinophil major basic protein and eosinophil cationic protein. J Immunol 142:4428-4434. Mangelsdorf DJ, Ong ES, Dyck JA and Evans RM (1990) Nuclear receptor that identifies a novel retinoic acid response pathway. Nature 345:224-229. Moy JN, Gleich GJ and Thomas LL (1990) Noncytotoxic activation of neutrophils by eosinophil granule major basic protein. Effect on superoxide anion generation and lysosomal enzyme release. J Immunol 145:2626-2632. O'Donnell MC, Ackerman SJ, Gleich GJ and Thomas LL (1983) Activation of basophil and mast cell histamine release by eosinophil granule major basic protein. J Exp Med 157:1981-1991. Overgaard MT, Oxvig C, Christiansen M, Lawrence JB, Conover CA, Gleich GJ, Sottrup-Jensen L and Haaning J (1999) Messenger ribonucleic acid levels of pregnancy-associated plasma protein-A and the proform of eosinophil major basic protein: expression in human reproductive and nonreproductive tissues. Biol Reprod 61:1083-1089. Partridge J, Carlsen H, Enesa K, Chaudhury H, Zakkar M, Luong L, Kinderlerer A, Johns M, Blomhoff
5 R, Mason JC, Haskard DO and Evans PC (2007) Laminar shear stress acts as a switch to regulate divergent functions of NF-kappaB in endothelial cells. Faseb J 21:3553-3561. Pattyn F, Speleman F, De Paepe A and Vandesompele J (2003) RTPrimerDB: the real-time PCR primer and probe database. Nucleic Acids Res 31:122-123. Rodrigues NP, Janzen V, Forkert R, Dombkowski DM, Boyd AS, Orkin SH, Enver T, Vyas P and Scadden DT (2005) Haploinsufficiency of GATA-2 perturbs adult hematopoietic stem-cell homeostasis. Blood 106:477-484. Rohrbach MS, Wheatley CL, Slifman NR and Gleich GJ (1990) Activation of platelets by eosinophil granule proteins. J Exp Med 172:1271-1274. Song G, Bazer FW, Wagner GF and Spencer TE (2006) Stanniocalcin (STC) in the endometrial glands of the ovine uterus: regulation by progesterone and placental hormones. Biol Reprod 74:913- 922. Wassom DL and Gleich GJ (1979) Damage to Trichinella spiralis newborn larvae by eosinophil major basic protein. Am J Trop Med Hyg 28:860-863. Weiler JM, Edens RE and Gleich GJ (1992) Eosinophil granule cationic proteins regulate complement. I. Activity on the alternative pathway. J Immunol 149:643-648. Yanai Y, Micallef MJ, Yamamoto S, Yamamoto K, Yamauchi H, Ikegami H and Kurimoto M (2003) Expression profiling of tumor necrosis factor alpha-induced apoptosis-associated genes in human solid tumor cell lines. Anticancer Res 23:2339-2348. Yeh PY, Chuang SE, Yeh KH, Song YC and Cheng AL (2003) Involvement of nuclear transcription factor-kappa B in low-dose doxorubicin-induced drug resistance of cervical carcinoma cells. Biochem Pharmacol 66:25-33. Zheutlin LM, Ackerman SJ, Gleich GJ and Thomas LL (1984) Stimulation of basophil and rat mast cell histamine release by eosinophil granule-derived cationic proteins. J Immunol 133:2180-2185.
6