The Role of Glycosylphosphatidylinositol Biosynthesis and Remodeling in Neural

Home , ALX3, CFC1, Contactin 1, DPM2, EHD2, FOLR2

and Craniofacial Development

A dissertation submitted to the

Graduate School of the University of Cincinnati

in partial fulfillment of the

requirements for the degree of

Doctor of Philosophy

in the Molecular and Developmental Biology Graduate Program

of the University of Cincinnati College of Medicine

Marshall Lukacs

B.A. Case Western Reserve University

June 2019

Committee Chair: Rolf Stottmann, Ph.D.

Abstract Glycosylation is the most abundant posttranslational modification though its role in development is highly understudied. One form of glycosylation involves the anchorage of nearly 150 proteins to the cell membrane by glycosylphosphatidylinositol (GPI). Over thirty genes are involved in the biosynthesis and remodeling of the GPI anchor. Mutations in these genes cause an array of genetic disorders called Inherited GPI Deficiencies

(IGDs) with broad clinical phenotypes including epilepsy, craniofacial defects, heart defects, and premature death. This thesis utilized several mouse genetic mouse models to test the requirement for GPI biosynthesis in neural and craniofacial development. We found that the Cleft Lip/Palate, Edema, and Exencephaly (Clpex) mutant mouse phenotype is caused by a hypomorphic mutation in the GPI remodeling gene Post-GPI

Attachment to Proteins 2 (Pgap2). We found Pgap2 is required for the survival of neural crest cells and the cranial neuroepithelium. We showed that trafficking of a GPI-anchored survival factor for these cells, Folate Receptor 1, requires Pgap2 for proper localization on the cell membrane. Supplementation with folinic acid to overcome the defective

FOLR1 trafficking partially rescued phenotypes in the Clpex mutant.

As we established the role of Pgap2 in neural and craniofacial development, we sought to determine the requirement for GPI biosynthesis in these tissues by using a more tailored genetic approach. Pgap2 is required for the one of the final steps in GPI biosynthesis but to completely abolish GPI biosynthesis, we utilized a conditional allele of Phosphatidylinositol Glycan Anchor Biosynthesis Class A, Piga, which is a component of the first committed step in GPI biosynthesis. Others have shown that deletion of Piga results in almost total absence of GPI biosynthesis. Thus we crossed the conditional Piga

2 allele to Wnt1-Cre, neural crest cell specific, and Nestin-Cre, central and peripheral nervous system specific, mice to generate tissue specific knockouts in the developing face and brain, respectively.

Knockout of Piga in neural crest cells resulted in craniofacial skeletal hypoplasia and cleft palate confirming the cell autonomous requirement for GPI biosynthesis in neural crest cells for their survival. Conditional ablation of Piga in the central and peripheral nervous system produced a number of interesting phenotypes. We found Piga, Nestin-Cre conditional knockout mice gained less weight than their wildtype littermates and died prematurely before weaning. These mice developed neurological decline, tremor, and an ataxic gait. Behavioral tests showed they are ataxic though they showed no defect in motor strength. Immunohistochemical analysis of the cerebellum showed a defect in

Purkinje cell dendritic branching in conditional knockouts. RNA-sequencing of the cerebellum identified a signature of Purkinje cell developmental delay and a strong signature of hypoxia. These data demonstrate that the cerebellum and motor coordination is uniquely sensitive to GPI deficiency. This thesis expands our understanding of the requirement for GPI biosynthesis in the development of the brain and face, the two organ systems most affected by GPI deficiency.

Acknowledgements

I would like to first thank my mother without whom this work would really not be possible.

My mother has supported me unfailingly in my endeavors and supported me in every way.

She always believed in my dreams and supported me unconditionally. Four sentences here is really incapable of expressing my gratitude to my mom, she’s an inspiration. I’d also like to thank my mentor, Rolf Stottmann, who had to tolerate my stubborn, critical personality. I’m sure it was a challenge to handle and he always let me pursue my own intellectual interests. Rolf is a very supportive mentor and was always looking out for new opportunities for me. My committee has been very supportive and pushed me to think critically about my data. I’d like to thank my friend Laura Schapiro who threw a party for me when I passed my qualifier even though none of my medical school friends knew what the qualifier meant. It was incredibly thoughtful and kind of her. I have to thank Sandra

Zoubovsky and our weekly therapy/hot sake sessions which helped me survive graduate school. I’d like to thank Tia Roberts who spent a summer with me and did an amazing job in the lab. Lastly, I’d like to thank my best friend Matt Sievers who dragged me out of the lab to escape and explore my queer side.

Table of Contents Title Page 1 Abstract 2 Acknowledgements 5 Table of Contents 6 Figures and Tables 8 Chapter 1. Introduction A. Summary 10 B. Congenital Disorders of Glycosylation 31 C. GPI Biosynthesis and Remodeling 36 D. Models of Inherited Glycosylphosphatidylinositol Deficiency 43 E. Craniofacial Development 48 F. Neural Development 54 G. Potential Mechanisms of Neurological Defects in CGD 63 H. Potential Mechanisms of Craniofacial Defects in CGD 68 I. References 72 Chapter 2. Glycosylphosphatidylinositol Biosynthesis and Remodeling are Required for Neural Crest Cell Survival A. Abstract 84 B. Introduction 85 C. Results 87 D. Discussion 114 E. Materials and Methods 119 F. Supplemental Figures 127 G. References 131 Chapter 3. CNS Glycosylphosphatidylinositol Deficiency Results in Delayed White Matter Development, Ataxia, and Premature Death in a Novel Mouse Model A. Introduction 137 B. Materials and Methods 140 C. Results 146

D. Discussion 162 E. Supplemental Figures 167 F. References 168 Chapter 4. Discussion A. Summary of Findings 172 B. Future Directions: Role of GPI biosynthesis in CNS development 175 C. Future Directions: The role of GPI biosynthesis in other organs 180 D. Future Directions: Determine the pathophysiology of Postnatal neurological defects in IGD 187 E. Future Directions: Therapy for IGD 188 F. Concluding Remarks 191 G. Acknowledgements 192 H. References 193

Figures and Tables 1. Chapter 1. Introduction Table 1. GPI anchored proteins and their knockout phenotypes 11 Table 2.GPI biosynthesis genes, knockout phenotypes, and their putative mechanisms 27 Figure 1. Congenital disorders of glycosylation by type 32 Figure 2. Biosynthesis and remodeling of glycophosphatidylinositol 35 Figure 3. Prevalence of clinical phenotypes in all IGD patients 38 Figure 4. Developmental timeline of facial prominence development 51 Figure 5. Developmental timeline of the secondary palate 54 Figure 6. Developmental timeline of neural tube closure 57 Figure 7. Cerebellum anatomy 60 Figure 8. Development of myelinating oligodendrocytes from 62 Oligodendrocyte precursors. 2. Chapter 2. Glycosylphosphatidylinositol Biosynthesis and Remodeling are Required for Neural Crest Cell Survival Figure 1. The Clpex mutant phenotype is caused by a hypomorphic Mutation in Pgap2 89 Table 1. Exome filtering of the Clpex mutant 90 Figure 2. Pgap2null allele fails to complement Pgap2Clpex allele 91 Figure 3. Pgap2 is dynamically expressed throughout embryogenesis 94 Figure 4. Pgap2 is required for proper anchoring of GPI-APs 97 Figure 5. Trafficking of FOLR1 to the cell membrane requires GPI biosynthesis and remodeling 99 Figure 6. Clpex cNCCs and neuroepithelium undergo apoptosis at E9.5 102 Figure 7. Folinic Acid treatment in utero partially rescues the cNCC apoptosis and cleft lip in Clpex mutants 104 Table 2. RNA Sequencing ToppGene Pathway Enrichment Analysis. 107

Table 3. Anterior/Posterior transcription factors differentially expressed in Clpex mutants compared to controls 108 Figure 8. Deletion of Piga in the Wnt1-Cre lineage leads to profound NCC GPI deficiency 110 Figure 9. Conditional knockout of Piga abolishes GPI biosynthesis in NCCs and leads to median cleft lip/palate and craniofacial hypoplasia 113 Table S1. Primers 127 Figure S1. Generation of CRISPR-edited cell lines 128 Figure S2. Clpex mutants are not defective at barrier formation 129 Figure S3. Anterior/Posterior patterning defects in Clpex mutants 129 Figure S4. Embryonic expression of GPI biosynthesis genes 130 3. Chapter 3. CNS Glycosylphosphatidylinositol Deficiency Results in Delayed White Matter Development, Ataxia, and Premature Death in a Novel Mouse Model Figure 1. Piga expression in the CNS 147 Figure 2. Deletion of Piga in the Nestin-Cre lineage results in CNS GPI deficiency 151 Figure 3. CNS GPI deficiency results in cerebellar hypoplasia, decreased weight gain, and decreased survival 153 Figure 4. CNS GPI deficiency results in hindlimb clasping, ataxia, and tremor 156 Figure 5. CNS GPI deficiency delays white matter development 158 Figure 6. CNS GPI deficiency impairs Purkinje cell arborization and alters the cerebellar transcriptome 161 Table S1. PCR Primers 167 Figure S1. Piga Mosaic cKO phenotype videos 168 4. Chapter 4. Discussion Figure 1. The requirement for GPI biosynthesis in diverse tissues during 186 development

Chapter 1. Introduction

Summary

The glycosylphosphatidylinositol (GPI) anchor is a posttranslational modification required for the cell surface expression of nearly 150 distinct proteins (Table 1) [2, 3]. These proteins have wide-ranging functions from immunity to development to cell structure and beyond (Table 1). Variants in the genes that synthesize and remodel the GPI anchor cause Inherited GPI Deficiencies (IGDs). Since the advent of next generation sequencing, causal variants in over half of the genes involved in the biosynthesis and remodeling of the GPI anchor have been identified in patients with a wide array of clinical phenotypes including craniofacial and neural defects and multiple animal models of GPI deficiency exist with multisystem phenotypes (Table 2) [5]. While we know a great deal about the molecular biology underlying the biosynthesis of the GPI anchor, we know relatively little about the mechanisms underlying the pathology observed in IGD patients and there is virtually no therapy to treat them. The aim of this work is to begin to determine the requirement for GPI biosynthesis and remodeling in craniofacial and neural tissues using several genetic mouse models of GPI deficiency.

Table 1. GPI Anchored proteins and their Knockout

Phenotypes

GPI-AP (Uniprot) KO Mouse Phenotype (MGI)[6]

CD24 B cell development impaired, RBCs aggregate

Prnp (Major Prion Resistance to Scrapie, discoordination

Protein)

Tdgf1 (Cripto) Rostral-Caudal axis specification defect, heart development

defect, dead immediately after gastrulation in Total KO, Tgf beta

pathway

Hyaluronidase-2 Osteoarthritis with bony outgrowths, cartilage developmental

(Hyal-2) defect

GPIHBP1 (GPI High TG, cholesterol due to defects in LPL mediated clearance of

HDL binding HDL protein 1)

CNTN2 (Contactin- Absent brain internal capsule, anterior commissure, striatum,

2) abnormal CC and VZ

Gas-1 abnormal eye development, abnormal cerebellar development,

syndactyly

Ache abnormal body temperature regulation/adipose development,

(Acetylcholinestera decreased muscle strength se)

GPC3 (Glypican 3) Embryonic lethal, body overgrowth, kidney cysts, heart defects

CD14 macrophage hyporesponsive to LPS/E.Coli

Efna5 NTD, anencephaly, cleft palate (due to failure of cranial neural

tube to close, not true CP), rostral neuropore closure defect,

abnormal neuronal migration

Thy-1 Long term potentiation is inhibited in dentate gyrus

VCAM Die by embryonic day 12.5 due to defective placenta and failure

of chorion/allantois fusion, and heart developmental anomalies.

Survivors are generally normal, but have high numbers of

circulating blood mononuclear leukocytes.

Art2b Decreased T cell apoptosis, decreased susceptibility to

autoimmune diabetes

FolR1 NTD, cleft palate

NCAM-1 Abnormal CNS glial morphology, neuron differentiation, spatial

learning, short circadian rhythm, reduced long term potentiation

Cfc1 crytpic Left-right laterality defect, asplenia, randomized embryo turning

and cardiac looping, and complex cardiac malformations bst2 (Bone Stromal Susceptibility to murine AIDS virus

Antigen 2)

Efna1 Heart defects

Sem7a Abnormal axon extension, abnormal olfactory tract

CA4 (Carbonic Embryonic lethality unspecified, hippocampal abnormalities

Anhydrase 4)

ALPL2 (alkaline Background-dependent differences in the timing of phosphatase 2) preimplantation cleavage and development, embryo survival,

gestational length and litter size. cdh13 (Cadherin Decreased retinal neovascularization and increased adiponectin heart 13) levels hfe2 (hemojeuvilin) Exhibit lack of hepcidin expression, severe iron overload and male

sterility, and systemic iron overload, a severe deficit in hepcidin

production, overexpression of ferroportin but normal male fertility

DPEP1 Phenotypically normal although defects have been noted in the

(Dipeptidase 1) conversion of leukotriene D4 to leukotriene E4

LPL (lipoprotein Cyanotic and die within 2 days of birth due to chylomicron lipase) engorgement of capillaries. Mutants show hypertriglyceridemia

and reduced fat stores. Heterozygotes show 1.5-2-fold elevated

triglyceride levels.

Rtn4r Decreased exploration in new environment, impaired

coordination, and improved recovery and rubrospinal axon

regeneration following spinal cord injury.

5' Nucelotidase Increased circulating alkaline phosphatase and impaired

tubuloglomerular feedback regulation, and increased vascular

permeability especially under hypoxic conditions

RAE1b (Retinoic N/A acid early- inducible protein 1- beta)

Glypican1 Reduced brain size with mild cerebellar patterning defects, but are

otherwise viable and fertile

Izumo1r (Folr4) Female infertility

Uromodulin Renal dysfunction and increased susceptibility to bladder infection

Pantetheinase Develop normally and so no abnormalities in the maturation of

lymphoid organs. However, membrane bound pantetheinase is

absent in livers and kidneys resulting in an absence of cysteamine

in these organs.

Vtcn1 Stronger Th1 responses upon parasitic infection by L. major

including reduced footpad swelling and lower parasite burden

compared to controls. Responses to other Th1-driven immune

responses are normal.

RGMB and RGMA Exhibit lethality at 2 to 3 weeks after birth. RGMA -/- has NTD (cell

polarity defect). RGMs are BMP co-receptors

Cntn1 Growth retardation, progressive ataxia and death prior to

weaning. A targeted null mutation, but not a spontaneous

mutation, causes a small cerebellum with abnormalities of the

molecular layer and abnormal Purkinje cell axon morphology. cd48 Slight increase in CD4+CD8- thymocytes and impaired T cell

proliferation in response to mitogens, anti-CD3 antibodies, and

alloantigens. netrin G1 Survive into adulthood with no major alterations in gross brain

cytoarchitecture or axonal projection.

Dpep3 Not described

UPAR Chronic inflammation, macrophage dysfunction, and reduced

angiogenesis. Homozygotes for another null allele show

neutrophil dysfunction, increased anxiety, loss of GABAergic

neurons, myoclonus, and susceptibility to bacterial infection and

PTZ -induced seizures.

MMP19 Diet-induced obesity due to adipocyte hypertrophy and display

decreased incidence of chemically-induced fibrosarcomas while

another knock-out mutant shows a reduced inflammatory reaction

to contact hypersensitivity and abnormal T cell differentiation.

Cntn4 Aberrant projection of olfactory axons to multiple glomeruli in the

olfactory bulb.

Itln1 (Intelectin-1a) Has no notable phenotype in any parameter tested.

SPRN (shadow Normal survival but abnormal body weight. prion protein)

Enpp6 Reproductive phenotype unspecified

Cntfra (Ciliary Homozygous mutant animals exhibit a significant reduction in the

Neurotrophic factor number of motor neurons. Neonatal mutants fail to suckle and die alpha) within 24 hours after birth.

Dpep2 Not described

(Dipeptidase 2)

Plet1 (placenta Not described expressed transcript)

NTNG2 (Netrin Mice homozygous for a null allele exhibit an absence of startle

G2) reflex and abnormal ABR amplitude.

Msln(Mesothelin) No phenotype

EFNA2 (Ephrin A2) Homozygous null mice exhibit increased neural progenitor cell

proliferation and abnormalities in sensory projections to the

superior colliculus

RECK Homozygous mutation of this gene results in lethality around

E10.5-E11.5, defects in collagen fibrils, basal lamina and vascular

development.

GFRA1-4 (Glial Homozygous mutants have dry eyes, poor postweaning growth

Cell derived associated with impaired parasympathetic cholinergic innervation

Neurotrophic of lacrimal and salivary glands and of small intestine, reduced skin factor) thickness and accelerated hair follicle regression. Hirschsprung

disease.

Appl2 (placental Differences in the timing of preimplantation cleavage and alkaline development, embryo survival, gestational length and litter size. phosphatase)

Tecta (tectorin sensorineural deafness alpha)

MMP17 Subtle renal developmental defects, hypodipsia, and elevated

urine osmolarity.

HyallP Normally fertile, but in vitro their sperm are slower at clearing cells

from the cumulus mass

Bst1 Delayed peritoneal B-1 cell development and a rise in

CD38low/- B-lineage cells in bone marrow and spleen

CNTN6 (contactin Impaired coordination without any obvious morphological of

6) physiological abnormalities in the brain.

CD109 Display epidermal hyperplasia and thickening, sebaceous gland

hyperplasia and transient impairment of hair growth.

Raet1c (RA early Not described transcript gamma)

IAP (Intestinal No gross abnormalities in appearance, behavior or fertility. They

Alkaline do display accelerated lipid absorption on a high fat diet leading

Phosphatase) to elevated plasma triglycerides and increased weight gain

GFRA4 (Glial cell Null mutations are mice were viable, fertile, showed no overt line derived anatomical defects. Thyroid tissue calcitonin content was reduced

18 neurotrophic in null homozygotes and rate of bone formation was enhanced factor) when in 129/B6 hybrid background strain

Ly6e Die as embryos as a result of heart defects

OMG Exhibit improved recovery from spinal cord injuries

(oligodendrocyte myelin glycoprotein)

MMP25 Not described

CD59a (MAC Abnormal complement pathway, abnormal response to injury, complex) altered susceptibility to viral infection, and abnormal CD4+ T cell

morphology and physiology

CD59b (MAC Mutation develop a severe hemolytic anemia and progressive complex) male infertility

Negr1 (Neuronal Homozygous for a knock-out or ENU-induced allele exhibit growth regulator 1) reduced body weight

EFNA3 (Ephrin 3) Exhibit disorganized and elongated dendritic spine of CA1

pyramidal neuron and reduced hippocampal-dependent learning.

Lynx1 (neurotoxin Increased sensitivity to nicotine, neurodegeneration, brain

1) vacuoles and improved cue-conditioned learning.

GFRA1 (glial cell Lack kidneys and enteric neurons resulting in neonatal lethality line derived neurotrophic factor family receptor alpha 1)

Art1 (ADP Cardiovascular, growth/size/body, hematopoietic, liver/biliary, ribosyltransferase mortality/aging, muscle

Raet1a (Retinoic N/A acid early transcript 1, alpha)

NCAM2 A gene trap insertion into an intron of this gene results in no

obvious phenotype.

DAF1 (Decay Show increased susceptibility to injury following ethanol accelerating factor) exposure, to experimental autoimmune myasthenia gravis and to

acute nephrotoxic nephritis. Another allele results in an abnormal

complement cascade leading to increased C3 deposition.

Prss21 (protease Impairs fertilization of epididymal sperm only in an in vitro

Serine 21) experiment. Mice homozygous for another knock-out allele exhibit

defective sperm maturation during passage through the

epididymis and decreased sperm fertilization capability

Neuritin Reduction in body length and body weight, delayed axonal,

dendritic, and synaptic development, reduced dendritic spine

maintenance leading to gradual spine loss, and impaired

associative and spatial learning.

Ly6a (lymphocyte Strain-dependent prenatal lethality, altered proliferative response antigen 6a) by T lymphocytes, hematopoietic stem cell and progenitor

defects, and age-related osteoporosis. Heterozygotes for a

knock-in allele develop a myeloproliferative disorder and skin

pathology at high penetrance.

Folr2 Viable, fertile and physically normal

Mfi2 Viable and fertile, exhibit no physical defects, and develop

(Melanotransferrin) normally with no detectable alterations in iron metabolism. prnd Display male infertility.

(doppelganger)

Mdga1 (MAM Abnormal neuronal migration during corticogenesis that is domain containing resolved by P7 glycosylphosphatid ylinositol anchor 1)

GFRa3 (glial cell Ptosis and poor development of the sympathetic chain ganglia line derived and associated nerves. neurotrophic factor

21 family receptor alpha 3)

CPM Growth/size/body, reproductive

(Carboxypeptidase

Tectorin Beta Enlarged tectorial membrane with a disrupted striated-sheet

matrix, absence of the marginal band, and low-frequency hearing

loss. However, basilar-membrane and neural tuning are both

enhanced in high-frequency cochlear regions, with little loss in

sensitivity.

Raet1d (retinoic Not described (abnormal growth/reproduction in screen) acid early transcript delta)

F Not described

Prss41 (testis Not described serine protease 1)

Treh (Trehalase) Fail to exhibit a rapid increase in blood glucose levels following

oral trehalose administration

CNTN5 (Contactin Viable, fertile, and less susceptible to audiogenic seizures

Prss30 (serine Not described protease 30)

Tex101 (Testis Knockout allele of this marker are infertile due to the failure of

Expressed gene sperm to migrate into the oviduct

101)

Intelectin-1b Targeted null allele indicates this mutation has no notable

phenotype in any parameter tested

Otoa (otoancorin) Hearing loss, detachment of the tectorial membrane from the

spiral limbus, abnormal tectorial membrane morphology, absence

of Hensen's stripe and increased cochlear nerve compound

action potential threshold.

Nrn1l (Neutrin-like Homozygous for a gene trap allele indicates this mutation has no protein) notable phenotype in any parameter tested

Art4 Not described

Rtn4rl2 (reticulon 4 No phenotype receptor-like 2_

Gpc4 (Glypican 4) Anemia

CNTN3 (Contactin No phenotype

Ly6d (lymphocyte Not described antigen 6 complex, locus D)

CD160(nk cell Increased tumor growth, decreased interferon receptor) ly6g6d Not described

(lymphocyte antigen 6 complex, locus G6D)

RAE1E NK/T cell phenotype

Lypd3 Decreased Ca, Na, TG, Alk phos, preweaning lethality

Ly6I Not described

Mdga2 (MAM Exhibit varying degrees of abnormalities in the skull, paw, and tail domain containing glycosylphosphatid ylinositol anchor 2)

GP2 Display no obvious abnormalities in pancreas morphology and

function, development, growth, weight, behavior, life span, or

fertility.

NTM (neurotrimin) Not described

GPC6 (glypican 6) Not described

CD52 Viable with no gross abnormalities and no defects in sperm

development or function

LSAMP Hyperresponsive to novel environments. Mice homozygous for

another knock-out allele exhibit reduced barbering, whisker

trimming, anxiety, dominance, and aggression.

GPC2(glypican 2) Knock-out allele are phenotypically normal.

Ly6H Not described

Spaca4 (sperm Not described acrosome associated 4_

GPC5 Abnormal hair morphology, sebaceous glands, ribs, and

decreased phosphate

Lypd2 Not described

Ly6K Reproductive phenotype unspecified psca (prostate Viable and fertile and show no significant differences in stem cell antigen) spontaneous or radiation-induced primary epithelial tumor

formation relative to wild-type littermates.

Ly6g Not described

Ly6c1 Not described

Lypd5 Not described

LPD6b Not described

Lypd8 Not described

Ly6f Not described

Lypd1 Increased fear and anxiety behaviors with increased

spontaneous excitatory postsynaptic current following nicotine

treatment.

Ly6c2 not described

CD177 not described

Lypd4 not described

Total

27/129 not described

102/129 have some phenotypic analysis

Table 2. GPI Biosynthesis Genes, Knockout Phenotypes, and their Putative Mechanisms. Gene Mutant Defect Mechanism Reference Implicated PMID PIGA Development of trophoblast/mesendoderm BMP decreased due 18397754 to defective CRIPTO anchoring Neuronal differentiation defect BMP decreased, 28441409 lysis due to complement Infertility eggshell permeability 22298425 Long bone growth defect Delayed maturation 19762422 of Piga ko chondrocytes Hemolytic anemia susceptibility to 16990386 complement Cleft lip/NTD Unknown 10092065 Cleft palate, neonatal seizures, contractures, central Unknown 22305531 nervous system (CNS) structural malformations, and other anomalies. Aggressive B cell lymphomas in somatic clones that Unknown 19302917 lose Piga Ichthyosis/ epidermal horny layer was tightly packed barrier defect/skin 9207103 and thickened differentiation Cysts in epithelial tissues Maintaining the 25807459 integrity of the epithelial tissues, allowing them to withstand the pressure and stresses of morphogenesis. PIGC Global developmental delay, severe ID and drug- Unknown 27694521 responsive seizure disorder. PIGH Arthrogryposis in cattle Unknown 25895751 PIGP Early-onset refractory seizures, hypotonia, and Unknown 28334793 profound global developmental delay PIGQ Complex seizure types and developmental delay Unknown 24463883 PIGY Dysmorphism, seizures, severe developmental delay, Unknown 26293662 cataracts and early death DPM2 Profound developmental delay, intractable epilepsy, Unknown 23109149 progressive microcephaly, severe hypotonia with elevated blood creatine kinase levels, and early fatal outcome.

Congenital muscular dystrophy associated with Cell death 27291147 hypoglycosylation of alpha-dystroglycan (α-DG) in skeletal muscle. PIGL CHIME disease Unknown 28371479 PIGW Seizures Unknown 27626616 PIGM Propensity to venous thrombosis and seizures, Promoter mutations 19168132 treatable with transcription booster treatable with transcription enhancement PIGX Breast cancer cell proliferation through suppression Transcriptional 27572108 of EHD2 and ZIC1 control Pigv Cysts Linkage between 25807459 plasma membrane and actin skeleton is impaired Left diaphragmatic hernia (DH)/polyhydramnios, Unknown 28817240 hypoplastic mandible, mild enlargement of the fetal bladder, hydronephrosis, and rocker bottom foot deformities. HPMRS including multiple congenital malformation Unknown 24129430 syndrome with a high frequency of Hirschsprung disease, vesicoureteral, and renal anomalies as well as anorectal malformations. Pign AML progression Genomic instability 28187452 Protein retention in ER in worms 27980068 Hyperkinesia and dystonia Unknown 27891564 Frynn syndrome: diaphragmatic defects, a Unknown 27300081 characteristic facial appearance, distal digital hypoplasia, multiple congenital abnormalities, severe intellectual disability and developmental delay PIGN prevents protein aggregation in the ER retention of GPI- 27980068 endoplasmic reticulum independently of its function in APs the GPI synthesis.

Holoprosencephaly/forebrain truncation BMP defect due to 23213481 loss of Cripto Pigb N/A N/A Pigf NTD N/A 23519034 Pigo Global developmental delay, dystrophy, axial Unknown 28900819 hypotonia, epileptic encephalopathy dominated by intractable complex partial seizures that were resistant to various anti-epileptic treatments. Dysmorphic features comprised low set ears, hypertelorism, upslanting palpebral fissures, a broad nasal bridge, and blue sclera with elongated

eyelashes. Brain MRI in both children showed a corpus callosum hypoplasia t Dysmorphism, psychomotor disability, epilepsy and Unknown 28545593 hyperphosphatasemia Epileptic encephalopathy. Unknown 24417746 Facial dysmorphism, seizures, brachytelephalangy, Unknown 22683086 and persistent elevated serum alkaline phosphatase Pigg Cerebellar hypoplasia, cerebellar ataxia, early-onset Unknown 28581210 seizures, and minor facial dysmorphology Intellectual disability, hypotonia, and early-onset Unknown 26996948 seizures. Pigk Touch-insensitive zebrafish mutant, macho (maco), Reduced sodium 26133798 previously shown to have reduced sodium current current (INa) amplitude and lack of action potential firing in sensory amplitudes in neurons sensory neurons. Gpaa1 Amplification and overexpression of GPIT subunits in Unknown 18028549 bladder and breast cancer with oncogenic function. Gene amplification in hepatocellular carcinoma Unknown 16642471 Pigs n/a n/a Pigt Intractable seizures accompanied by epileptic apnea Unknown 28728837 Hypotonia, severe global developmental delay, and Unknown 25943031 intractable seizures along with endocrine, ophthalmologic, skeletal, hearing, and cardiac anomalies Pigu Zebrafish insensitive to touch Decreased 20392743 expression of sodium channels Pgap1 Current apnea especially during sleep that persisted unknown 27206732 at least until age 2 years. Sequential cerebral MRI at age one and two year(s) respectively revealed frontal accentuated brain atrophy and significantly delayed myelination. Autosomal-recessive forms of intellectual disability GPI-APs resistant to 24784135 (ARID). cleavage by PI-PLC Headless BMP defect due to 23213481 CRIPTO Headless Unknown 17711852 Oto mutant with truncated forebrain Wnt sequestered in 19593386 ER Pgap5 N/A N/A Pgap3 Profound developmental delay, severe ID, no speech, Unknown 24439110 psychomotor delay, and postnatal microcephaly. Pgap2 Psychomotor retardation, low birth parameters, and Unknown 26879448 chest deformities already existing in neonatal period. The disease course was slowly progressive with

29 severe hypotonia, chronic fever, and respiration insufficiency at the age of 6. The second girl showed profound psychomotor retardation, marked hypotonia, and high birth weight (97 centile). Dysmorphia was mild or absent in both girls. Seizures, muscular hypotonia, and intellectual Unknown 23561847 disability.

Congenital Disorders of Glycosylation

Nearly half of all proteins are modified by the posttranslational addition of carbohydrates in a process called glycosylation. The cell dedicates almost 2% of the coding genome to glycosylation, more than half of all proteins are glycosylated in some way, and glycosylation occurs in essentially every cell [4, 7]. There are multiple forms of glycosylation including N-linked/O-linked glycosylation of proteins, glycosaminoglycans, glycolipids, and glycophosphatidylinositol anchors. Mutations in the vast array of genes that are involved in glycosylation are termed congenital disorders of glycosylation (CDG)

(Fig. 1). The function of glycosylation is diverse, including the protection of proteins from extracellular proteases, quality control of nascent protein folding, altering receptor-ligand interactions, altering cell-cell adhesion, and altering the subcellular localization of proteins

[8]. Since the advent of next generation sequencing, over one hundred CDGs have been identified [4].

N-linked Glycosylation Related CDGs

More than half of all CDGs reside in the N-linked glycosylation pathway which involves the addition of oligosaccharides to the nitrogen atom of the amide group of asparagine

(Fig. 1). N-linked glycosylation is the most abundant form of glycosylation. PMM2-CDG, a subset of N-linked CDGs, is the most common CDG, with more than 900 cases, caused by mutations in Phosphomannomutase 2 (PMM2) [OMIM:212065]. PMM2 converts mannose-6-phosphate to mannose-1-phosphate (M1P). M1P is combined with guanosine diphosphate (GDP) to form GDP-mannose. GDP-mannose is a major substrate for multiple glycosylation pathways. PMM2-CDG patients display phenotypes common to the vast majority of CDGs including developmental delay, hypotonia,

31 hyporeflexia, seizures, craniofacial defects, hypogonadism, cerebellar hypoplasia/atrophy, truncal ataxia, growth retardation, coagulation defects, abnormal fat distribution, eye abnormalities, demyelination, cardiovascular defects, hepatic dysfunction, coagulopathy and variety of less frequent phenotypes [9]. Recently, development of a mouse model of PMM2-CDG by knock-in of the two most common variants generated a mouse model that recapitulates the majority of phenotypes observed in patients including structural defects in the cardiovascular, hepatic, and renal systems and decreased body weight due to low circulating IGF levels [10]. The widespread defects observed in CDGs reflect the diverse functions of glycosylation in development.

Treatment for CDG is largely symptomatic and very few specific therapies based on the underlying molecular defect are available.

O-Fucose Glycolipid 3% 2% O-GalNac GPI anchor 3% 13%

Dystroglycan 11% N-linked 55%

Glycosaminoglycan 13%

Figure 1. Congenital Disorders of Glycosylation by Type. Adapted from [4].

Glycosaminoglycan Related CDGs

13% of CDGs are caused by defects in glycosaminoglycan (GAG) biosynthesis .GAGs are unbranched heteropolymers made of disaccharide units and are added to protein scaffolds to form proteoglycans. Chondroitin sulfate, heparan sulfate, keratin sulfate, and hyaluronic acid are some examples of highly abundant GAGs. GAGs are highly anionic, absorb water, and are found as lubricants in connective tissue and joints. GAG-related

CDGs are unique in that patients present with joint laxity/dislocations, malformed long bones, and/or subepithelial connective tissue defects including the skin and sclera [11].

Dystroglycanopathies

11%of CDGs relate to the many genes involved in the O-glycosylation of α-dystroglycan, a large peripheral membrane protein and part of the dystrophin-associated glycoproteins.

Dystrophin forms a large molecular complex that links the extracellular matrix to the actin cytoskeleton and dystrophin requires α-dystroglycan on the cell surface to maintain the integrity of myocyte membranes [12, 13]. Mutations in α-dystroglycan cause a form of muscular dystrophy [OMIM #616538], a devastating disease that results in severe muscle cell damage as α-dystogycan is critical for the structural integrity of myocytes [13-15].

Dystroglycan is heavily O-glycosylated (addition of oligosaccharides to the oxygen atom of the hydroxyl group of serine and threonine residues) and this glycosylation is necessary for α-dystroglycan to associate properly with extracellular components such as laminin

[16]. Many genes are involved in O-linked glycosylation of α-dystroglycan including

Fukutin, POMT1/2, and LARGE [17]. Mutations in any of these genes results in defective

α-dystroglycan glycosylation, muscular dystrophy and distinctive eye and brain

33 phenotypes, including Walker-Warburg syndrome, which point to a role for α-dystroglycan in neural development [18-20].

Inherited GPI Deficiency (IGD)

Inherited GPI Deficiencies account for 13% of CDGs. Of the many forms of glycosylation, we chose to focus our research on the defects in the GPI biosynthesis pathway as these are far understudied compared to N-linked, GAG-related, or dystroglycanopathy CDGs.

The glycosylphosphatidylinositol (GPI) anchor is a posttranslational modification required for the cell surface expression of nearly 150 distinct proteins (Table 1) [2]. GPI-anchored proteins are trafficked to lipid rafts and participate in a wide array of biological activities including cell signaling, receptor/ligand interactions, and cell adhesion [2]. Since the advent of next generation sequencing, causal variants in over half of the proteins involved in the biosynthesis and remodeling of the GPI anchor have been identified in patients with a wide array of clinical phenotypes including craniofacial and neural defects [5]. These mutations are generally autosomal recessive, hypormorphic missense variants with the exception of PIGA-CDG which is X-linked and has only been identified in male patients.

While we know a great deal about the molecular biology underlying the biosynthesis of the GPI anchor, we know relatively little about the mechanisms underlying the pathology observed in IGD patients and there is virtually no therapy to treat them.

N-acetylglucosaminyltransferase GPI Transamidase

PIGA PIGL PIGW PIGM PIGV PIGN PIGB PIGF PIGF PIGK PIGC PIGX PIGO PIGG GPAA1 PIGH PIGS PIGP PIGT

PIGQ PIGU

PIGY ER

Lumen DPM2

PGAP1 PGAP5 PGAP3 PGAP2 =Mannose =N-acetylglucosamine =Glucosamine

=Phosphate =Ethanolamine phosphate

Golgi =GPI-anchored protein

=Phosphatidylinositol

Figure 2. Biosynthesis and Remodeling of Glycophosphatidylinositol. Adapted from [2]. Genes addressed experimentally in this dissertation are highlighted in red. PM=Plasma Membrane. Genes for which there are patient mutations and/or animal mutations are italicized.

GPI Biosynthesis and Remodeling

Biosynthesis and remodeling of the GPI anchor involves over 30 proteins (Fig. 2) [2]. The anchor involves a lipid portion that resides in the outer leaflet of the plasma membrane and the C-terminus of the anchored protein is attached by a carbohydrate rich linker. The process is initiated by a series of Phosphatidylinositol Glycan class (PIG) proteins in the endoplasmic reticulum. The biosynthesis begins with the formation of N- acetylglucosaminyl phosphatidylinositol (GlcNac-PI) from phosphatidylinositol and N- acetylglucosamine. This first step in committed GPI biosynthesis is carried out by a large molecular complex called the N-acetylglucosaminyltransferase which includes

Phosphatidylinositol Glycan Class A (PIGA) which is the best studied of the GPI biosynthesis genes (Fig. 2). Once the immature anchor is formed in the ER, it is transferred en bloc to nascent proteins carrying the GPI signal sequence via GPI transamidase (PIGK, GPAA1, PIGS, PIGT, and PIGU complex). The GPI anchor itself will be attached to the C-terminal aspect of nascent proteins at the so-called ω site 20 aa from the C-terminus. The GPI signal sequence contains a C-terminal stretch of hydrophobic amino acids (15-20aa) separated from the GPI attachment site (ω) by a short stretch of hydrophilic amino acids (1-2aa). Once the GPI anchor is added to the nascent protein, it is transferred to the Golgi apparatus where the lipid portion of the anchor is remodeled by a series of Post-GPI Attachment to Protein (PGAP) proteins. This process involves the removal of portions of the lipid anchor and the addition of stearic acid in the final step by PGAP2 (Fig. 2). Once remodeled, the mature GPI-anchored protein (GPI-

AP) is trafficked to the plasma membrane where the hydrophobic portion of the anchor resides in the outer leaflet of the plasma membrane and associates with lipid rafts. From

36 the membrane, GPI-APs can be shed by phospholipases, bind to ligands, or serve as receptors and internalize when bound to ligand.

IGD phenotypes

A recent review of IGD patients summarized the clinical findings in all known patients (202 patients, 18 different GPI biosynthesis genes) (Fig.3) [5]. The overwhelming majority of patients develop debilitating neural and craniofacial phenotypes including developmental delay, epilepsy, cleft lip/palate, and dysmorphic features regardless of which GPI biosynthesis gene was mutated. The majority of these patients experience premature death but there is great variability in the severity of the disease. However, a wide variety of clinical findings were observed at lower penetrance in IGD patients. We will briefly summarize these clinical phenotypes.

Developmental Delay/Intellectual Disability (DD/ID)

The most common phenotype among IGD patients was developmental delay and intellectual disability (99%). Over 700 genes have been associated with intellectual disability affecting very diverse processes from regulation of transcription/translation to neuronal migration to synaptogenesis [21]. Of note, patients with IGD are remarkable for profound motor delay including delayed walking and delayed motor milestones in addition to intellectual disability.

IGD phenotypes 100% 90% 80% 70% 60% 50% 40%

Prevalence 30% 20% 10% 0%

Phenotypes Figure 3. Prevalence of clinical phenotypes in all IGD patients. Adapted from [5].

Seizures/Epilepsy

The second most common phenotype was seizure/ epilepsy including severe intractable

epilepsy (80%). In some patients, epilepsy was so severe that patients developed

epileptic encephalopathy with characteristic hypsarrhythmia on EEG. Of note, several

patients responded to Vitamin B6 supplementation whereas other conventional therapies

failed [22]. The possible mechanism of action for Vitamin B6 supplementation efficacy in

IGD will be discussed later in possible mechanisms of IGD phenotypes.

Craniofacial defects

Third most common finding in IGD is dysmorphic features or craniofacial defects (75%).

These phenotypes include “coarse features”, cleft lip/palate, high arched palate, tented upper lip, malformations of the cranial bones, and low-set ears.

Structural Brain Anomalies

Half of IGD patients show some structural brain anomaly on Magnetic Resonance

Imaging including delayed white matter development and/or atrophy, thin corpus callosum, cerebellar hypoplasia and/or atrophy, and cerebral atrophy. Hypo/hyper- intensities on MRI indicative of white matter defects were common, especially in the subcortical structures including the midbrain and pons. The terms cerebellar “hypoplasia” and “atrophy” are used interchangeably and/or together in the literature so it remains unclear whether it is a developmental or degenerative process in IGD patients. Similarly, white matter defects are not definitely classified as developmental or degenerative. Dandy

Walker malformation and vermis hypoplasia have also been reported. Autopsy of a PIGA deficient patient showed decreased myelination and small cerebellum [23].

Ventriculomegaly, micro/macrocephaly have also been reported with decreased penetrance [5, 24].

Ophthalmological defects

Ophthalmological defects in IGD appear to be poorly defined. Reports generally cite

“visual impairment” including blindness but no clear description of the phenotype has been well defined to our knowledge. We show that Pgap2 is expressed in the ganglion

39 cell layer of the retina in mice in the Pgap2 Results section of this dissertation. The function of Pgap2 expression in this domain is completely unknown.

Gastrointestinal Anomalies

Several IGD patients presented with Hirschsprung disease, a failure of neuronal innervation of the distal colon. This aganglionic segment of the distal colon must be removed surgically to allow for normal GI function and prevent the formation of toxic megacolon [25]. This is interesting as the enteric nervous system is derived from trunk neural crest cells, similar to the cranial neural crest cells that give rise to the craniofacial complex. The shared Hirschsprung and craniofacial defects in IGD patients may be caused by a more basic defect in neural crest cell development. Patients also display incomplete penetrance of Gastroesophageal Reflux Disease (GERD), anal atresia, and poor feeding [26-31].

Cardiac Anomalies

Cardiac defects observed in IGD patients are highly variable. Cardiac defects have been reported in PIGW, PIGA, PIGV, PIGN, PIGO, PIGG, PIGT, GPAA1, PGAP3, and PGAP2 patients to varying degrees. Reports of patent ductus arteriosus, increased atrial load, ventricular septal defects, atrial septal defect, long QT, restrictive cardiomyopathy, and/or myocardial hypertrophy have been made. Notably, several patients have died of cardiac arrest though the causes of cardiac arrest are diffuse and may be related to multisystem disease [5, 32-34].

Genitourinary Anomalies

GU defects in IGD are broad with vesicouteral reflux, duplicated collecting duct system, nephrocalcinosis, hydronephrosis, and dysplatic kidney, [5].

Skeletal Anomalies

A wide array of skeletal anomalies has been reported in IGD. These include delayed bone age, osteoporosis, brachytelephalangy, scoliosis, and hip dysplasia. Notably, hyperphosphatasia has been reported in many patients (subsets of IGDs were called

“hyperphosphatasia and mental retardation syndromes”) and this hyperphosphatasia is thought to be related to the decreased bone mineralization and bone growth in these patients. . Alkaline Phosphatase (ALP) is GPI-anchored and it has been suggested that

GPI deficiency leads to shedding of ALP and overactivation of the phosphatase. This overactivation may lead to aberrant cleave of phosphate from proteins and general hyperphosphatasia. Recently, the characterization of hyperphosphatasia has come into dispute as it does not appear to be the most common finding in IGD patients.

Ataxia

Cerebellar ataxia has been reported in a variety of IGD patients [33, 35-37]. These include patients with mutations in PGAP3, GPAA1, PIGG, and PIGS but the prevalence of this phenotype is difficult to assess as many IGD patients never survive to walking stages or their motor development is so delayed that they can never walk independently. The severe neurological decline in these patients precludes a rigorous analysis of ataxia phenotypes. Cerebellar structural defects are more common including

41 atrophy/hypoplasia, Dandy-Walker malformation, and gliosis and Purkinje cell loss has been noted in autopsy from PIGA deficient patients [38].

Diagnosing IGD

Most CDGs are diagnosed by isoelectric focusing of transferrin, a heavily N-glycosylated protein that is abundant in blood. Isoelectric focusing can distinguish the mature heavily glycosylated transferrin from CDG patient samples with less glycosylated forms of transferrin [39]. GPI biosynthesis is not required for transferrin glycosylation so historically clinicians have diagnosed IGD by clinical presentation and the presence of hyperphosphatasia. However, hyperphosphatasia has not been found to be common among all IGD patients [5]. The current best diagnostic method for IGD is cell surfacing staining of patient blood with Fluorescent Aerolysin (FLAER), a bacterial toxin conjugated to fluorescein which directly binds the GPI anchor on the cell surface and can be easily quantified by flow cytometry. FLAER staining has been shown to be effective at distinguishing patient from control samples in hematologic GPI deficiencies (PNH) and has been used in the literature to diagnose germline IGD as well [40].

Treating CGDs

Though most CDGs lack specific therapies, there are several notable exceptions. Seven of the known CDGs have been treated by oral supplementation with the corresponding deficient monosaccharaide and/or small molecules. In Mannose Phosphate Isomerase

(MPI)-CDG, a deficiency in the supply of mannose-6-phosphate, a widely used early glycosylation precursor, results in decreased N-glycosylation. It was found that oral mannose could be endocytosed by patient cells, restore normal levels of glycosylation,

42 and completely reverse the severe protein-losing enteropathy, coagulation defects, and growth defects seen in these patients [41]. In CAD-CDG, a deficiency in the biosynthesis of uridine results in global glycosylation defects as uridine diphosphate (UDP) is a carrier for multiple glycosylation substrates. Oral uridine supplementation in two patients with

CAD-CDG completely reversed their severe seizure course, improved their cognitive and motor development, and normalized their metabolic parameters [42]. Four other CDGs

(PGM1-CDG, SLC35A2-CDG, SLC39A8-CDG, and TMEM165-CDG) with defects in galactose processing have been treated with oral galactose and/or manganese which alleviated some aspects of the disease [43-46]. Of note, patients with deficiencies of the

GPI anchor display severe seizures and vitamin B6 supplementation was able to treat these seizures in a few patients [22]. The possible mechanism behind the mechanism of action of Vitamin B6 in IGD is discussed in “Potential Mechanisms of Neurological Defects in CGD” below. Interestingly, a patient with a mutation in the promoter for PIGM was treated with sodium phenyl butyrate, a histone deacetylase inhibitor that activates transcription, and experienced an improvement in her motor development and decreased her seizure frequency [47]. Thus CDGs have been shown to be treatable with increased knowledge of the pathophysiology.

Mouse Models of IGD

In the 1980s, it was discovered that treatment of mouse embryos with phospholipase C

(PLC), an enzyme that cleaves GPI-APs from the cell surface, causes neural tube defects

[48]. At that time, it was thought that critical cell adhesion molecules including N-CAM were cleaved from the neuroepithelium with PLC treatment resulting in the NTD. This was the first evidence that GPI is functionally important for neural development in mice.

Subsequently, genetic approaches to understand GPI biosynthesis lead to the creation of a germline null allele of Piga, the first enzyme in the GPI biosynthesis pathway, and mouse embryos lacking all GPI biosynthesis [49]. As Piga is located on the X chromosome in mouse and human, hemizygous total knockout males and mosaic knockout female embryos were generated. The investigators were unable to recover any total knockout hemizygous males leading them to the conclusion that GPI biosynthesis is critical in early development. However, they were able to identify mosaic female embryos at E18.5 with cleft lip/palate and cranial neural tube defects. They argued these mosaic females have residual Piga function due to random X inactivation and this remaining function was sufficient to allow the females to survive longer than male total hemizygous knockouts. This genetic evidence confirmed the critical role for GPI biosynthesis in neural development and pointed to novel roles in craniofacial development and early embryogenesis. Subsequent mouse mutants including the Pigf mutant with NTD developed by DMDD have further confirmed the role of GPI biosynthesis in neural tube closure [50]. The exact mechanism behind NTD in GPI mutants remains unknown. To date, no IGD patients with NTD have been identified but patients with severe enough mutations in GPI biosynthesis genes may be stillborn and unlikely to have been sequenced. Genomic sequencing of stillborn infants is not common clinical practice.

More recent studies using hypomorphic mouse mutants of two GPI biosynthesis genes,

Pign and Pgap1, shed light on the role of GPI biosynthesis in early embryogenesis.

Mckean et. al. identified the gonzo and beaker mutants with truncated anterior structures and near complete headlessness [51]. The loss of anterior structures in these mutants lead the authors to hypothesize there was an early defect in specification of the

44 anterior/posterior (A/P) axis. A/P axis determination requires GPI-anchored Cripto/TgfB signaling which allows for the migration of the anterior visceral endoderm and specification of the head [52]. In Cripto knockout mutants, the entire embryo is posteriorized because the anterior visceral endoderm fails to migrate anteriorly and establish the anterior pole. Mckean et. al. argued the GPI-anchoring of Cripto is critical for its function and the gonzo and beaker mutants with GPI biosynthesis deficiencies lack functional Cripto. The newly identified GPI gene Pgap6 confirmed the role of GPI biosynthesis in anterior/posterior axis formation as the Pgap6 knockout mouse showed a defect in AVE migration and anterior pole formation [53]. The early defect in A/P patterning and embryonic lethality has made it difficult to study germline mutants of the

GPI biosynthesis pathway.

Several conditional knockout approaches have highlighted the requirement for GPI biosynthesis is several distinct tissues. Most models have used conditional alleles of Piga, the first enzyme involved in GPI biosynthesis, and deletion of Piga by use of conditional

Cre recombinase can abolish GPI biosynthesis in a given tissue [54]. The first publication to use this approach deleted Piga in the developing epidermis using the Keratin-5 -Cre recombinase. The conditional knockout mutants developed ichthyosis and defects in the stratum corneum of the epidermis [54]. A second study used a conditional Piga allele and the HoxB6-Cre to abolish GPI biosynthesis in the limb bud. These conditional knockout mutants developed short, wide limbs and may have a defect in convergent extension during long bone development [55]. Finally, to model the most common GPI-related disorder, investigators have knocked out Piga in the hematopoietic lineage. Somatic mutations in PIGA in the bone marrow result in paroxysmal nocturnal hemoglobinuria, a

45 hemolytic anemia caused by the lack of GPI-anchored negative regulators of complement on red blood cells, CD55 and CD59 [56]. Conditional knockout of Piga in the Gata1, erythrocytes and megakaryocytes lineage, resulted in hemolytic anemia in mice [57].

Thus conditional knockouts of Piga have been very valuable for determining the unique requirements for GPI biosynthesis in different tissues during development.

Zebrafish Models of IGD

Two models of touch insensitivity in zebrafish have been identified with mutations in two

GPI biosynthesis genes, PigK and PigU. These mutants display an inability to recognize mechanosensory stimulation through embryonic sensory neurons called Rohon-Beard neurons. In both mutants, the authors argue defects in GPI biosynthesis adversely affected the apical sorting of sodium channels to the cell membrane although the channel proteins themselves are not GPI-anchored. The defects in sodium channel localization result in a failure of the Rohon-Beard cells to sense stimuli and signal [58, 59]. This work showed that GPI biosynthesis may be necessary for the sorting of many proteins on the cell surface, not just the subset of GPI-APs. This may be because GPI anchors associate with lipid rafts in microdomains on the cell surface which are critical for the arrangement of proteins on the cell membrane. Thus defects in GPI biosynthesis may be far reaching beyond affecting candidate GPI-APs. This finding is further supported by recent work in

Drosophila.

Drosophila Models of IGD

In a forward screen for Drosophila mutants with mistrafficking of rhodopsin in the fly photoreceptor, groups have identified GPI deficient mutants [60]. Similar to what was

46 seen in touch-insensitive zebrafish mutants, GPI biosynthesis is somehow necessary for the apical sorting of certain proteins such as fly photoreceptors. In GPI deficient flies, rhodopsin and a variety of other proteins are mislocalized and the photoreceptor degenerates.

The unique advantage of the Gal4-UAS system in drosophila allows for the easy and efficient conditional knockdown of virtually any gene in virtually any tissue in development.

Recent studies by Clement Chow from the University of Utah have shown that pan- neuronal knockdown of Piga in flies leads to decreased motor coordination, increased time spent asleep, neurodegeneration, and early death. Further studies using knockdown in glial cells only showed a bang sensitive phenotype, a seizure phenotype in flies

(Clement Chow, personal communication). These exciting new data show the conserved role in GPI biosynthesis in flies and humans and may serve as models for testing novel therapies. There is still need for a mammalian model as the fly lacks homologous structures to those affected in IGD patients including a true cerebellum and multilayered myelin sheaths found in white matter in mammals.

Rational for Studying Craniofacial and Neural Development

While a wide array of phenotypes are observed in IGD patients (including renal, genitourinary, gastrointestinal, ophthalmologic, cardiac, and skeletal) the clear burden of the disease across the IGD patients are the neural and craniofacial phenotypes. Animal models complement the patient findings with neural and craniofacial defects. Given the overrepresentation of these phenotypes in IGD patients, we chose to focus on these two

47 systems to understand the unique requirement for GPI biosynthesis and remodeling in these tissues. To investigate these systems we used a germline hypomorph in GPI biosynthesis generated by N-ethyl-N-nitrosurea mutagenesis, and we complemented this work with conditional GPI biosynthesis deficiency models of the craniofacial and neural tissues. In order to explain the defects we observed in our models, we must first outline the basic development of the craniofacial and neural tissues.

Craniofacial Development

Neural Crest Cell Induction and Formation of the Facial Prominences

The development of the craniofacial complex begins with the formation and migration of a unique, transient subset of cells called neural crest cells (NCCs). NCCs form a variety of tissues including the craniofacial bones and cartilage, enteric nervous system, autonomic ganglia, cranial nerves, and melanocytes [61]. It was originally shown that

NCCs are multipotent by fluorescent dextran labeling of individual trunk NCCs as they emigrate from the neural tube and determining that their progeny could become sensory neurons, glia, adrenal medulla cells, and melanocytes [62]. Regionalization of the crest results in cranial, cardiac, trunk, and vagal/sacral subpopulations. Cranial NCCs (cNCCs) can differentiate into muscle, cartilage, bone, and connective tissue whereas trunk NCCs cannot. This difference is largely due to the expression of Hox genes in the trunk which prevent differentiation into the skeletal components. If Hox expression is inhibited in trunk

NCCs they can form bony elements showing that indeed Hox expression alone is sufficient to block trunk NCC differentiation into skeleton [63].

At approximately embryonic day E8.5 in mouse, neural crest cells originate at the boundary of the neural and non-neural ectoderm under the direction of bone morphogenetic protein (BMP) antagonists Noggin and Chordin, Fibroblast Growth

Factors (Fgfs), and Wnt [61]. These specified epithelial cells undergo an epithelial to mesenchymal transition initiated by the master transcription factors Snail1 and Slug, and change their cell surface cadherins to allow them to invade the mesenchyme [64]. NCCs then migrate in defined streams following chemotactic gradients of Fgf8 and Fgf2 to populate the pharyngeal arches according to this timed migration [65]. cNCCs from the midbrain and rhombomeres 1 and 2 constitute the first stream of migration and populate pharyngeal arch 1 which will give rise to the mandible and maxilla as well as the incus and malleus bones of the middle ear [66]. This first stream of migratory NCCs does not mix with later streams that will populate the other pharyngeal arches due to chemorepellants such as ephrins and semaphorins. If Ephrin receptors are blocked, the different migratory streams that will populate the pharyngeal arches will mix abnormally

[67]. Once they migrate to the branchial arches and frontonasal process, they proliferate extensively under the influence of sources of mitogens including Sonic Hedgehog (SHH) and Wnts. Neural crest cells made genetically incompetent to respond to Shh or Wnt1 signaling undergo significant apoptosis leading to global craniofacial hypoplasia [68, 69].

Proliferation of NCCs in these areas produces five facial prominences that will give rise to the face; the frontonasal, maxillary, mandibular, medial and lateral nasal prominences

(Fig. 4). Interestingly, the frontonasal prominence cNCCs secrete Noggin and Gremlin to inhibit BMP signaling in the anterior neural ridge, an ectodermal signaling center, which

49 is critical for the outgrowth of the forebrain by secreting Fgf8. If these cNCCs are removed,

BMP inhibition does not occur in the anterior neural ridge and this prevents the secretion of Fgf8. The underlying forebrain requires Fgf8 for outgrowth and thus removal of the cNCCs in this region not only affects face development but severely impairs forebrain development [70]. This work has led to the hypothesis that the “face predicts the brain” suggesting that the interplay between these two tissues is so significant that defects in craniofacial development likely lead to defects in brain development as well.

Formation of the Upper lip and Mechanisms of Cleft Lip

The facial prominences grow and at approximately E12.5 in mouse, the medial and lateral nasal prominences will fuse with the maxillary prominence to form the upper lip, primary palate, and alae of the nose. If this process fails to occur, cleft lip will result. Lip fusion is complicated and involves periderm removal and the influence of multiple signaling pathways. The periderm is an embryonic membrane the coats all epithelial surfaces and prevents intra-epithelial adhesions. The periderm surrounding the maxillary and medial/lateral prominences must be removed by restricted apoptosis at the site of fusion

[71].

The site of lip fusion expresses many signaling molecules including Bmp4, Fgf8, and

Wnts [72]. Msx1/2 are critical for the activation of BMP4 and outgrowth of the facial prominences. Msx1/2 double knockout mice develop bilateral cleft lip which is rescuable by a BMP4 transgene indicating that BMP4 is the downstream effector of these genes

[73]. Inactivation of Fgf8 in the facial ectoderm causes midfacial cleft lip due to apoptosis of the underlying NCCs [74]. Both Wnt3 and Wnt9b have been shown to be critical for lip development as mutants develop cleft lip. A TOPGAL reporter transgene showed clear

50 activation of canonical Wnt signaling in the epithelia of medial/lateral nasal processes and the maxillary process prior to fusion [75, 76]. Furthermore environmental agents can affect the incidence of cleft lip, including folate which has been shown to decrease the incidence of clefting in a variety of models possibly by increasing NCC proliferation and preventing apoptosis [77-79]. Folic acid is required for maintenance of the one-carbon donor pool mediated by S-adenosylmethionine and folic acid is required for the biosynthesis of the nucleotide thymidine. Of note, Folate Receptor 1, one of the major receptors for folate, is GPI anchored.

E9.5 E10.5

Nt Nt

FNP LNP MNP Mx

Mn Mx

Figure 4. Developmental Timeline of Facial prominences.FNP= frontonasal prominence, LNP=lateral nasal process, MNP=medial nasal process, Mn=mandibular prominence, Mx=maxillary prominence.

Formation of the Secondary Palate and Mechanisms of Cleft Palate

After the upper lip has fused, the palatal shelves begin to form and will give rise to the secondary palate. At E12.5 in mouse, paired swellings of the maxillary prominence grow downward along the sides of the developing tongue (Fig.5A). These swellings give rise to the paired palatal shelves and their growth is critically dependent on Shh expression from the oral epithelium. Shh initiates a BMP/FGF feed forward loop that is required for palatal shelf growth and patterning [80]. Genetic inactivation of the Shh receptor

Smoothened in the palatal mesenchyme using Osr2-Cre results in underdeveloped palatal shelves that do not proliferate normally [81]. It has been shown that Shh regulates the expression of cell cycle regulators including Cyclin D1/2 in palatal mesenchyme cells to encourage their proliferation [81]. Within the palatal mesenchyme, coordination of multiple signaling pathways seems to be orchestrated by Pax9. Pax9 maintains the activation of Msx1 and BMP4 in the palate and activates a Fgf/Shh feedforward loop that encourages palatal growth [82]. Defects in components in this pathway including Osr2,

Pax9, Fgf10, and Msx1 can all lead to cleft palate [83-86].

The palatal shelves continue to grow downward until E14.5 in mouse when the tongue is displaced downward and the palatal shelves reorient themselves and begin to grow toward each other (Fig. 5B). The elevation of the palatal shelves requires the biosynthesis of extracellular matrix components including the highly negatively charge GAGs.

Interestingly, the Golgb1 mutant mouse, with defects in biosynthesis of several glycosylation products including glycosaminoglycan, can form the palatal shelves but fail to elevate the shelves to the horizontal position resulting in cleft palate. It was proposed that accumulation of GAGs, particularly hyluronan, are necessary in the ECM to allow for

52 increased water content in the palatal shelves to allow them to expand. In the Golgb1 mutants, the cell density in the palatal shelves is significantly increased and the shelves lack this GAG/water accumulation observed in WT embryos[87]. A detailed analysis of the ECM components in the shelves has not been performed but the Golgb1 mutant highlights the critical, understudied role that glycosylation plays in craniofacial development.

In mouse mutants that lack periderm, an embryonic epidermal layer that coats the entire embryo and acts as molecular “Teflon”, aberrant intraepithelial adhesions can occur between the tongue and palatal shelves resulting in cleft palate. This phenomenon occurs in the Irf6 knockout mouse which fails to maintain the periderm and displays barrier defects [88]. This phenomenon also occurs in Jag2-/- mice in which Notch1 is not activated normally, periderm does not differentiate normally and aberrant inter-epithelial adhesions arise leading to cleft palate [89]. By E15.5, the shelves have met in the midline and the epithelial seam between the shelves is removed by convergence and extrusion (Fig.5C-

D). The fusion of the palatal shelves requires Tgfβ3 which is expressed at the epithelial seem and allows for the breakdown of periderm and its extrusion from the fusing shelves

[90, 91]. Interestingly, the breakdown of the seam also requires Snail as Snail1+/-, Snail2-

/- compound mutants develop cleft palate in which the palatal shelve meet in the midline but cannot fuse [92].

E13.5 E15.0

A C PS PS T T

E14.5 E15.5 B D PS P

T T

Figure 5. Developmental timeline of the secondary palate. PS= palatal shelf, P=palate, T=-tongue. Adapted from [1] ]. Black line in C represents the epithelial seam.

Neural Development

Neural Tube Closure

Neural development in mice begins with the formation of the neural plate, a flat sheet of neural ectoderm that will eventually give rise to the entire CNS (Fig. 6A). At E7.5-E8.5 in mouse, the neural plate begins to bend at the midline and extend along the rostro-caudal axis in a process called convergent extension. This process is driven by non-canonical

Wnt signaling and the effector Planar Cell Polarity (PCP) pathway [93]. Mutants of the

PCP pathway including Vangl2 and Celsr1 fail to undergo convergent extension and the

54 entire neural tube fails to close at all [93, 94]. This defect is the most severe form of neural tube defect (NTD) called craniorachischisis.

As convergent extension proceeds, a median hinge point (MHP) forms in the midline and paired dorsolateral hinge points (DLHPs) form at the cranial levels of the (Fig. 6B-C). The

MHP is induced by the underlying notochord. However, the MHP does not appear to be necessary for neural tube closure as mutants lacking the MHP still undergo neural tube closure, including the Shh and Foxa2 mutants [95, 96]. DLHPs form lateral to the MHP and the cells of the neuroepithelium undergo a wedge-shape conformation to allow the flat neural plate to begin to bend into a tube structure. DLHPs are absolutely critical for neural tube closure as multiple mutants that fail to form DLHPs develop neural tube defects including the Zic2 mutant and SHH gain-of-function mutants [97]. DLHPs appear to form at the boundary between antagonistic dorsal BMP signaling and ventral Shh signaling. The neural tube is arranged in an opposing morphogen gradient with high BMP dorsally and Shh ventrally. If either Shh or BMP soaked beads are placed at the DLHPs, the DLHPs will fail to form [98]. Indeed, many genetic mutants with enhanced Shh pathway activity develop cranial NTDs including ciliopathy mutants and Gli3 mutants [99,

100]. These data argue the DLHPs require a low BMP/low Shh environment for the morphological wedge shape conformation to develop. The constriction of the DLHPs requires active actin cytoskeleton remodeling and mutants of cytoskeletal components also develop NTDs [101, 102].

Once the neural folds bend, they must meet in the midline and fuse to form a continuous closed neural tube. This process requires subcellular protrusions from one fold to the other which have been observed recently by live imaging [103]. It is well established that

Eph/Ephrin receptors are involved in the closure once the neural folds meet and E- cadherin under the control of Grhl2 is also required for this final closure step to occur

[104]. Overgrowth of the epithelium can also cause the folds to fail to meet in the midline

, as in the case of Phactr4 mutants with an overgrown neuroepthileium [105].

Folate deficiency has been linked to NTD and folate supplementation in the western diet has dropped the incidence of NTD dramatically [106, 107]. However, the mechanism by which folate mediates the effect is unknown. These is some evidence folate regulates neuroepithelial proliferation/apoptosis and there is some evidence the Shh signaling domain is expanded in folate receptor 1 knockout mouse, which is an established mechanism of NTD [108-111].

E8.0 NNE NC B

MHP

E8.5

C DLHP

E9.0

E9.5

Figure 6. Developmental timeline of neural tube closure. DLHP= dorsolateral hinge point, MHP= median hinge point, NC= notochord, NE= neural ectoderm, NNE= non-neural ectoderm, NT=neural tube.

Cerebellar Development

Cerebellar atrophy/hypoplasia is a common finding among all CDG patients [112]. The cerebellum is critical for motor coordination as the cerebellum integrates information from the cortex, basal ganglia, spinal cord, vestibular nuclei, and red nucleus and projects back to the cortex to coordinate motor control. The cerebellum develops from the junction between the midbrain and hindbrain at E8.5 in the mouse embryo designated the isthmus.

This site defined by the expression of Fgf8 which is the master organizer of early cerebellum development [113, 114]. The forebrain/midbrain is patterned by Otx2 and the hindbrain is patterned by Gbx2, and these two master transcription factors mutually repress each other. The isthmus lies at the junction where these two domains meet and experiences relatively low expression of both of these transcription factors [115]. At this stage, the primordial cerebellum is divided into the ventricular zone which lies next to the fourth ventricle and will give rise to the GABAergic neurons of the cerebellum and the rhombic lip which will give rise to the glutamatergic neurons including the granule cells.

The Purkinje cells (PCs), the major output of the cerebellum, extend their axons to the deep cerebellar nuclei which form a circuit with the cerebral cortex. Purkinje cells have an extensive dendritic tree situated in the molecular layer which synapses with thousands of granule cell axons and one climbing fiber (Fig. 7). This complex dendritic tree is critical for Purkinje cells to coordinate signals from many brain regions. PCs develop early around E10.5-E13.5 in ventricular zone and migrate into the cerebellar anlage proper on radial glia that express relin, an extracellular matrix protein. Their survival and proliferation require nerve growth factor, acetylcholine, RORα and neurotrophins. At E17.5, PCs secrete Shh which activates the extensive proliferation of granule cell precursors in the

58 external granule layer derived from the rhombic lip [116]. This massive proliferation proceeds postnatally until about P10in the mouse. During this process, granule cells will migrate past PCs along Bergman glia to their mature location forming the internal granule layer deep to the single cell PC layer [117]. If the granule cells fail to migrate past the

PCs, they can become a proliferative focus in the molecular layer and a source of medulloblastoma [118]. Granule cell situated in the internal granule layer then extend axons to the developing PC dendrites in the molecular layer and provide glutamatergic inputs to the PCs (Fig. 7).

At P0, PCs extend a single simple outgrowth into the molecular layer which will elaborate to form the extensive dendritic tree. The dendritic tree will be mature at approximately

P28 in mouse. At maturity, the dendritic tree will have 150,000-200,000 synapses with granule cell axons arrayed in parallel fibers and 1 synapse with a climbing fiber from the inferior olivary nucleus of the medulla oblongata. The process of arborization is complex and requires hormonal input from thyroid hormone, progesterone, and estrogen. Defects in the synthesis of any of these hormones severely impair dendritic development [119-

121]. PCs also express Wnt3 after their contact with granule cell axons and this contact is critical for dendrite morphogenesis [122]. If granule cells are depleted, either by X-ray irradiation or genetically such as in weaver mutants carrying a damaging mutation in the potassium inward rectifying channel Kcnj6, the dendritic tree does not elaborate normally and mice develop ataxia, a severe incoordination of their limbs [123].

PFs

PC s GC C s Deep F Cerebellar MF Nuclei

Cortex, reticular Olivary formation, vestibular nucleus nuclei

Figure 7. Cerebellum anatomy. Generated with BioRender.com. C=Climbing fiber, GC= granule cell, MF=mossy fiber, PC= purkinje cell, PF=parallel fibers

White Matter Development

Central myelination, like cerebellar development, is largely a postnatal phenomenon.

Myelination is the process of ensheathing axons in the lipid bilayer of oligodendrocyte membrane. Myelin is required to insulate axons and increase the speed of propagation of axon potentials along the axon. Delayed white matter maturation has been reported in a great number of not only IGD patients but CDG patients in general [112]. Mouse models of delayed myelination, such as the jimpy (Proteolipid protein mutant), and shiverer

(Myelin Basic Protein mutant) mutant mice, develop tremor, seizures, decreased body weight and typically die around the fourth week of life when myelination is complete in wildtype mice [124, 125].

Myelination begins with the generation of oligodendrocyte precursor cells (OPCs) in the ventral ventricular zone of the developing mouse forebrain at E12.5. These cells are strongly positive for Pdgfra and will migrate extensively from the ventral forebrain to myelinate the axon tracts of the CNS. OPCs will give rise to mature myelinating oligodendrocytes (OLs) (Fig. 8). OLs are marked by high expression of the master transcription factors Sox10 and Olig2 which drive the mature OL program and activate the transcription of the major myelin components including myelin basic protein (MBP), myelin oligodendrocyte glycoprotein (MOG), and proteolipid protein (PLP) [126, 127]. The unique proteolipid composition of the myelin membrane in OLs allows for ensheathement of axon tracts such as the corpus callosum and corticospinal tracts among others.

A variety of extracellular matrix proteins and GPI-APs have been indicated in white matter development and GPI-APs are enriched in mature myelin [128]. These include the GPI-

AP contactin family of proteins which are expressed by developing OPCs and are

61 required for their maturation into OLs [129, 130]. Contactin 1 knockout mice have severely delayed central myelination, display severe growth delay, ataxia, and die around day P21 consistent with other models of central hypomyelination [129, 130]. The GPI-AP NCAM and its partner F3 have also been found in GPI-rich rafts in myelinating oligodendrocytes and they may be critical for oligodendrocytes to recognize axons and initiate myelination

[128]. Thus, GPI-APs in oligodendrocytes and/or axons may be critical mediators of myelination.

OPC OL

Contactin-1

Figure 8. Development of myelinating oligodendrocytes from oligodendrocyte precursors. Generated with BioRender.com. OL= myelinating oligodendrocyte, OPC= oligodendrocyte precursor cell.

Potential Mechanisms of Neurological Defects in CGD

Common mechanisms in CDG neurological defects

The commonalties of intellectual disability, seizure, hypotonia and cerebellar atrophy/hypoplasia in many CDGs point to some general requirement for glycosylation in neurons. It is known that gated ion channels that transport sodium in the CNS are highly

N-linked glycosylated, contributing up to 50% of their molecular weight [131]. The specific candidate gated ion channels that are underglycosylated due to N-linked glycosylation defects remain to be identified but underglycosylation of sodium channels in general may lead to defects in neuron axon potential maintenance and communication. Furthermore, the acetylcholine receptor is heavily glycosylated and defects in Acetylcholine Receptor glycosylation can result in decreased receptor expression at the neuromuscular junction and congenital myasthenia syndrome [132, 133]. Indeed a fly model of PMM2 knockdown, the most commonly mutated gene in CGD, lead to gross structural defects in the NMJ, early lethality, and uncoordinated movements likely because the heavily glycosylated NMJ synapse was defective [134]. Similar ataxic phenotypes have been observed in other models of CDG including the Cog7 KD mutant flies demonstrating that motor coordination critically requires normal glycosylation [135].

Seizures are incredibly common across CDGs and it appears glycosylation plays multiple roles in neuronal transmission. The ECM of the brain is high in hyaluronan, a GAG, and local decreases in GAG can cause seizures in mice [136]. Neuronal migration disorders perturb neuronal migrations and commonly cause seizures. It is well documented that defects in glycosylated proteins, particularly α-dystroglycan, cause defects in neuronal migration and possible foci for seizure development [137].

Glycosylation in cerebellar defects

Several glycosylation mutants have been investigated with severe cerebellar defects.

Tmem30a is required for phosphatidylserine and phosphatidylethanolamine flippase activity and Tmem30a knockout mice display severe PC degeneration and ataxia [138].

In a recent elegant study, genetic blockade of N-glycosylation by cerebellar specific inactivation of Srd5a3, an initiating enzyme of N-glycosylation, resulted in axon outgrowth defects in granule cells, ectopic granule cells trapped in the molecular layer, and severe ataxia [139]. The authors showed a variety of cell adhesion molecules including NCAM and L1CAM were hypoglycosylated in their model and may be responsible for these morphological defects. Autopsy of PMM2-CDG patients, the most common N-linked

CDG, showed specific defects in the cerebellum including loss of PCs, dendritic outgrowth defects in the surviving PCs, and granule cell depletion [140]. Multiple forms of glycosylation are clearly involved in multiple steps of cerebellum development.

Unfolded protein response

An alternative hypothesis concerns the role of glycosylation in the unfolded protein response. Disruptions in glycosylation can lead to misfolding of proteins or trapping in the

ER and Golgi. If enough misfolded proteins accumulate, they trigger an exquisite molecular alarm called the unfolded protein response (UPR). The ER sensor IRE1 detects the accumulation of misfolded proteins, splices out an intron in the mRNA of a transcription factor XBP1, leading to XBP1 translation and activation of its target genes.

XBP1 directs the transcription of chaperones, foldases, and autophagy machinery to manage the protein misfolding crisis. If the ER cannon reduce the load of misfolded aggregates, XBP1 will initiate cellular apoptosis [141]. Several groups have suggested

64 that defects in multiple glycosylation genes lead to activation of the UPR in neurons and subsequent neuronal apoptosis. This may be a common mechanism of neurological dysfunction seen in CDGs. In support of this hypothesis, one group has shown that granule cells, the major input to Purkinje cells of the cerebellum, are uniquely sensitive to

UPR-mediated apoptosis and this may account for the cerebellar phenotypes observed in CDG patients [142].

Accumulation of toxic intermediates

A common finding in biosynthetic pathway blockages is the accumulation of upstream intermediates at the site of pathway blockade. Some work argues the accumulation of intermediates can be toxic to the cell and might be driving the pathology observed in biosynthetic mutants. For example, in PMM2 morphant zebrafish, accumulation of the upstream intermediate Mannose-6-P caused the aberrant cleavage of other glycosylation intermediates. Depleting the synthesis of M6P in PMM2 morphants partially rescued the neurological and craniofacial phenotype [143]. Thus, toxic intermediates may play a role in the pathophysiology of CDG.

GPI-APs are involved in patterning, neuronal adhesion, white matter development, and synaptogenesis

The GPI anchor is a unique case among other forms of glycosylation in the CNS. Many critical neural proteins are anchored by GPI including Neural Cell Adhesion Molecule 1

(NCAM1), the Nogo Receptor (NgR), and the contactin family of proteins. NCAM plays many critical roles in neural development including the outgrowth and fasciculation of neurites in neurons [144]. NCAM is also classically required for neuronal cell adhesion

65 and some have speculated that IGD leads to defects in this critical process of neuroepithelial adhesion leading to neural tube defects [145, 146]. Another GPI-AP, NgR regulates neuronal plasticity, axon regeneration, and interacts directly with oligodendrocyte myelin glycoprotein [147, 148].

Other neural GPI-APs include prion protein, neurregulins, netrin, and T-cadherin. Prion protein is a well-known protein famous for forming misfolded aggregates and accumulating in the CNS with devastating neurodegenerative effects. Neuroligins are important regulators of synapse formation. Netrin is critical for axon outgrowth and GPCs are critical in excitatory synapse outgrowth [149]. Thus many GPI-APs are involved in the maturation of synaptogenesis and thus it is no surprise that defects in GPI biosynthesis could lead to diffuse clinical presentations such as intellectual disability and developmental delay.

TNAP and the putative mechanism of action for Vitamin B6 in IGD related epilepsy

Several groups have focused on the role of GPI anchored Tissue nonspecific alkaline phosphatase (TNAP). TNAP is necessary for the dephosphorylation of pyridoxal phosphate (the active form of vitamin B6) which is required for it to cross the cell membrane. Once inside neuronal cells, pyridoxal phosphate is re-phosphorylated and used in the synthesis of δ-amino-butyric acid (GABA), a major inhibitory neurotransmitter.

TNAP deficient mice develop spontaneous seizures due to the resulting deficiency in

GABA and this phenotype can be rescued by exogenous Vitamin B6 administration [150,

151]. In patients with defective GPI biosynthesis, TNAP functioning may be defective and the resulting decrease in Vitamin B6 availability may decrease GABA synthesis and lead to seizures. Indeed Vitamin B6 supplementation has shown to be effective at treating

66 seizures in some IGD patients [22]. However, no group has definitely shown that TNAP function is defective in IGD and that IGD patients have low GABA levels.

A potential role for complement in neuronal cell death

While IGDs are poorly understood, somatic mutations in Piga in the adult bone marrow cause a well-studied disorder caused Paroxysmal Nocturnal Hemoglobinuria (PNH). Loss of PIGA and thus GPI biosynthesis in red blood cell clones in PNH results in the failure of membrane anchoring of two critical negative regulators of complement, CD55 and CD59.

RBCs lacking these two GPI-APs cannot inhibit the formation of the complement membrane attack complex as they circulate in the blood. Activated complement leads to

RBC lysis and episodic hemolytic anemia, frequently at night, leading to the name of PNH for the disorder [152]. Brodsky’s group at Johns Hopkins has made induced pluripotent stem cells from patients with germline PIGA mutations and directed them toward the neuron cell fate. They showed that these GPI deficient neurons are susceptible to complement in the same way RBCs are susceptible in PNH [153]. This work leads credence to the hypothesis that neural defects in IGD could be due to defective inhibition of complement on neurons. Indeed, complement has been shown to be active in the CNS, especially in the process of synapse elimination and remodeling [154]. Could there be a role for complement-mediated neuronal damage in IGD? More work is required in vivo to determine whether this is the case.

A clear need for animal models

Despite the roles of many GPI-APs in neural development, very few models of IGD exist because germline null mutations for GPI biosynthesis genes frequently result in early

67 embryonic lethality. Without reliable models of investigating neural manifestations of IGD, one can only speculate as to which of these GPI-APs contribute to the disease pathogenesis in IGD. We hope to correct this absence with the work presented in this dissertation.

Potential Mechanisms of Craniofacial defects in CDG

Dysmorphic features and craniofacial defects are a common finding across most CDGs.

Few studies have addressed the role of glycosylation in craniofacial development but several studies have been informative. Twisted Gastrulation, a secreted glycoprotein that binds BMP, is a major regulator of this signaling pathway in craniofacial development and defects in Twisted Gastrulation cause severe craniofacial defects in mice and Xenopus

[155, 156]. Recently, it was found that N-glycosylation of two sites on Twisted Gastrulation are absolutely necessary for binding BMP and defects in glycosylation significantly impaired its ability to repress BMP target gene activation [157]. Tmem165 mutant zebrafish with defects in N-glycosylation also show craniofacial defects with delays in osteoblast differentiation and chondrocyte maturation [158, 159]. Thus glycosylation plays multiple roles in craniofacial development.

To our knowledge, no study to date has directly tested the role of GPI biosynthesis specifically in craniofacial development. While several studies have focused on the role of GPI biosynthesis in neural development and early A/P patterning in the embryo, the role of GPI in the neural crest has been mostly ignored. However, craniofacial defects are common in IGD and multiple neural crest-related proteins are GPI anchored.

Eph/Ephrins

Eph/EphrinA5 signaling is critical for neural crest cell migration and defects in eph/ephrin signaling are known to cause craniofacial defects including cranial neural tube defects.

Eph/Ephrin signaling in neural crest cells directs neural crest migration by directing repulsive interactions [160]. Ephrin A5 is GPI-anchored and it’s possible that GPI biosynthesis defects could result in defects in Eph/Ephrin signaling.

Folate Receptor 1

Folate is a survival factor for neural crest cells and the major receptor for folate, FOLR1, is GPI-Anchored [108-111]. The role of folic acid in neural crest cells remains controversial as folic acid is required for pyrimidine biosynthesis and the generation of the one carbon donor S-adenosylmethionine which is the major donor in methylation reactions. These two very essential functions are likely both contributing to the requirement for folate in rapidly dividing neural crest cells.

GDNF Family Receptor A/B (GFRA/B)

Glial-derived Neurotrophic factor (GDNF) is secreted by the gut mesenchyme and signals to trunk neural crest cells migrating into the gut. GDNF binds its receptor Ret in conjunction with GPI-anchored co-receptors GFRA/B expressed on migrating neural crest cells [161].GDNF is required for the proliferation, migration, survival and differentiation of NCCs in the gut. Mice deficient for GDNF develop aganglionosis of the gut and renal defects [162]. GDNF signaling through Ret requires GFRa and conditional knockout of GFRa in post migratory neural crest cells causes apoptosis of ENS neurons

[163]. Thus survival of NCC derivatives requires GPI-anchored GFRa1. Indeed, several

IGD patients develop Hirschsprung’s disease due to aganglionosis of the distal colon [5].

Few groups have focused on the role of GDNF in cranial NCCs but expression patterns of GDNF in chick suggest it plays a role in cranial NCCs in the arches [164]. GFRa’s role in cNCCs remains to be determined but it may play a role in IGD related craniofacial defects (Rafi Kopan, unsolicited personal communication).

Glypicans

Glypicans are a family of six GPI-anchored heparan sulfate proteoglycans that are known modulators of multiple signaling pathways including Shh, Wnt, and Fgf, which are critical survival factors for neural crest cells [165]. Glypican 3 knockout mice resemble gain-of- function Shh mutants with overgrowth and mispatterning of the neural tube suggesting glypican 3 is a negative regulator of Shh [166]. While the requirement for GPI anchoring of glypicans remains largely unknown, it has been proposed that membrane anchoring of the glypicans limits their range of actions on morphogen and defects in their anchoring may extend or decrease their range of action. Thus, multiple signaling pathways could be affected by altering the distribution of the morphogen-modulating HSPGs.

Complement and NCC development

Recent work from Roberto Mayor’s group has shown that complement is required in

NCCs for normal development. C3a, the major complement protein, is a chemoattractant for NCCs in Xenopus larva and C3a receptor morphants display severe defects in NCC migration [167, 168]. As discussed in “Mouse Models of IGD”, the two major negative regulators or complement, CD55 and CD59, are GPI anchored and GPI deficiency in the bone marrow leads to extensive complement mediated lysis of red blood cells. Though it

70 remains to be determined whether NCCs express CD55/Cd59 developmentally, it remains possible that NCCs may be sensitive to complement-mediated lysis in the absence of these GPI-anchored complement inhibitors.

References

1. Bush, J.O. and R.L. Jiang, Palatogenesis: morphogenetic and molecular mechanisms of secondary palate development. Development, 2012. 139(2): p. 231-243. 2. Kinoshita, T., Biosynthesis and deficiencies of glycosylphosphatidylinositol. Proc Jpn Acad Ser B Phys Biol Sci, 2014. 90(4): p. 130-43. 3. Kinoshita, T., Glycosylphosphatidylinositol (GPI) Anchors: Biochemistry and Cell Biology: Introduction to a Thematic Review Series. Journal of Lipid Research, 2016. 57(1): p. 4-5. 4. Ng, B.G. and H.H. Freeze, Perspectives on Glycosylation and Its Congenital Disorders. Trends in Genetics, 2018. 34(6): p. 466-476. 5. Bellai-Dussault, K., et al., Clinical variability in inherited glycosylphosphatidylinositol deficiency disorders. Clinical Genetics, 2019. 95(1): p. 112-121. 6. Eppig, J.T., Mouse Genome Informatics (MGI) Resource: Genetic, Genomic, and Biological Knowledgebase for the Laboratory Mouse. Ilar Journal, 2017. 58(1): p. 17-41. 7. Apweiler, R., H. Hermjakob, and N. Sharon, On the frequency of protein glycosylation, as deduced from analysis of the SWISS-PROT database. Biochimica Et Biophysica Acta-General Subjects, 1999. 1473(1): p. 4-8. 8. Varki, A., Biological Roles of Oligosaccharides - All of the Theories Are Correct. Glycobiology, 1993. 3(2): p. 97-130. 9. Sparks, S.E. and D.M. Krasnewich, PMM2-CDG (CDG-Ia), in GeneReviews((R)), M.P. Adam, et al., Editors. 1993: Seattle (WA). 10. Chan, B., et al., A mouse model of a human congenital disorder of glycosylation caused by loss of PMM2. Human Molecular Genetics, 2016. 25(11): p. 2182-2193. 11. Sasarman, F., et al., Biosynthesis of glycosaminoglycans: associated disorders and biochemical tests. Journal of Inherited Metabolic Disease, 2016. 39(2): p. 173- 188. 12. Campbell, K.P. and S.D. Kahl, Association of Dystrophin and an Integral Membrane Glycoprotein. Nature, 1989. 338(6212): p. 259-262. 13. Montanaro, F., M. Lindenbaum, and S. Carbonetto, alpha-dystroglycan is a laminin receptor involved in extracellular matrix assembly on myotubes and muscle cell viability. Journal of Cell Biology, 1999. 145(6): p. 1325-1340. 14. Ibraghimovbeskrovnaya, O., et al., Primary Structure of Dystrophin-Associated Glycoproteins Linking Dystrophin to the Extracellular-Matrix. Nature, 1992. 355(6362): p. 696-702. 15. Matsumura, K., et al., Deficiency of Dystrophin-Associated Proteins in Duchenne Muscular-Dystrophy Patients Lacking Cooh-Terminal Domains of Dystrophin. Journal of Clinical Investigation, 1993. 92(2): p. 866-871. 16. Michele, D.E., et al., Post-translational disruption of dystroglycan-ligand interactions in congenital muscular dystrophies. Nature, 2002. 418(6896): p. 417- 422. 17. Martin, P.T., The dystroglycanopathies: the new disorders of O-linked glycosylation. Semin Pediatr Neurol, 2005. 12(3): p. 152-8.

18. Beltran-Valero, D., et al., Mutations in the O-mannosyltransferase gene POMT1 give rise to the severe neuronal migration disorder Walker-Warburg syndrome. American Journal of Human Genetics, 2002. 71(4): p. 165-165. 19. Toda, T., et al., Genetic Identity of Fukuyama-Type Congenital Muscular- Dystrophy and Walker-Warburg Syndrome. Annals of Neurology, 1995. 37(1): p. 99-101. 20. Longman, C., et al., Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Human Molecular Genetics, 2003. 12(21): p. 2853-2861. 21. Vissers, L.E.L.M., C. Gilissen, and J.A. Veltman, Genetic studies in intellectual disability and related disorders. Nature Reviews Genetics, 2016. 17(1): p. 9-18. 22. Kuki, I., et al., Vitamin B-6-Responsive Epilepsy Due to Inherited Gpi Deficiency. Neurology, 2013. 81(16): p. 1467-1469. 23. Johnston, J.J., et al., The Phenotype of a Germline Mutation in PIGA: The Gene Somatically Mutated in Paroxysmal Nocturnal Hemoglobinuria. American Journal of Human Genetics, 2012. 90(2): p. 295-300. 24. Tarailo-Graovac, M., et al., The genotypic and phenotypic spectrum of PIGA deficiency. Orphanet Journal of Rare Diseases, 2015. 10. 25. Green, H.L., D. Rizzolo, and M. Austin, Surgical management for Hirschsprung disease: A review for primary care providers. Jaapa-Journal of the American Academy of Physician Assistants, 2016. 29(4): p. 24-29. 26. Horn, D., et al., Hyperphosphatasia-Mental Retardation Syndrome Due to PIGV Mutations: Expanded Clinical Spectrum. American Journal of Medical Genetics Part A, 2011. 155a(8): p. 1917-1922. 27. Krawitz, P.M., et al., Identity-by-descent filtering of exome sequence data identifies PIGV mutations in hyperphosphatasia mental retardation syndrome. Nature Genetics, 2010. 42(10): p. 827-829. 28. Krawitz, P.M., et al., PGAP2 Mutations, Affecting the GPI-Anchor-Synthesis Pathway, Cause Hyperphosphatasia with Mental Retardation Syndrome. American Journal of Human Genetics, 2013. 92(4): p. 584-589. 29. Hansen, L., et al., Hypomorphic Mutations in PGAP2, Encoding a GPI-Anchor- Remodeling Protein, Cause Autosomal-Recessive Intellectual Disability. American Journal of Human Genetics, 2013. 92(4): p. 575-583. 30. Nakamura, K., et al., PIGO mutations in intractable epilepsy and severe developmental delay with mild elevation of alkaline phosphatase levels. Epilepsia, 2014. 55(2): p. E13-E17. 31. Krawitz, P.M., et al., Mutations in PIGO, a Member of the GPI-Anchor-Synthesis Pathway, Cause Hyperphosphatasia with Mental Retardation. American Journal of Human Genetics, 2012. 91(1): p. 146-151. 32. Ng, B.G., et al., Mutations in the Glycosylphosphatidylinositol Gene PIGL Cause CHIME Syndrome. American Journal of Human Genetics, 2012. 90(4): p. 685-688. 33. Makrythanasis, P., et al., Pathogenic Variants in PIGG Cause Intellectual Disability with Seizures and Hypotonia. American Journal of Human Genetics, 2016. 98(4): p. 615-626.

34. Wurm, D., et al., Early fatal course in siblings with CDG-Ia (caused by two novel mutations in the PMM2 gene): clinical, molecular and autopsy findings. European Journal of Pediatrics, 2007. 166(4): p. 377-378. 35. Knaus, A., et al., Rare Noncoding Mutations Extend the Mutational Spectrum in the PGAP3 Subtype of Hyperphosphatasia with Mental Retardation Syndrome. Human Mutation, 2016. 37(8): p. 737-744. 36. Nguyen, T.T.M., et al., Mutations in GPAA1, Encoding a GPI Transamidase Complex Protein, Cause Developmental Delay, Epilepsy, Cerebellar Atrophy, and Osteopenia. American Journal of Human Genetics, 2017. 101(5): p. 856-865. 37. Nguyen, T.T.M., et al., Mutations in PIGS, Encoding a GPI Transamidase, Cause a Neurological Syndrome Ranging from Fetal Akinesia to Epileptic Encephalopathy. American Journal of Human Genetics, 2018. 103(4): p. 602-611. 38. Swoboda, K.J., et al., A Novel Germline PIGA Mutation in Ferro-Cerebro- Cutaneous Syndrome: A Neurodegenerative X-Linked Epileptic Encephalopathy With Systemic Iron-Overload. American Journal of Medical Genetics Part A, 2014. 164(1): p. 17-28. 39. Babovic-Vuksanovic, D. and J.F. O'Brien, Laboratory diagnosis of congenital disorders of glycosylation type I by analysis of transferrin glycoforms. Molecular Diagnosis & Therapy, 2007. 11(5): p. 303-311. 40. Sutherland, D.R., et al., Diagnosing PNH with FLAER and multiparameter flow cytometry. Cytometry Part B-Clinical Cytometry, 2007. 72b(3): p. 167-177. 41. Harms, H.K., et al., Oral mannose therapy persistently corrects the severe clinical symptoms and biochemical abnormalities of phosphomannose isomerase deficiency. Acta Paediatrica, 2002. 91(10): p. 1065-1072. 42. Koch, J., et al., CAD mutations and uridine-responsive epileptic encephalopathy. Brain, 2017. 140: p. 279-286. 43. Wong, S.Y.W., et al., Oral D-galactose supplementation in PGM1-CDG. Genetics in Medicine, 2017. 19(11): p. 1226-1235. 44. Dorre, K., et al., A new case of UDP-galactose transporter deficiency (SLC35A2- CDG): molecular basis, clinical phenotype, and therapeutic approach. Journal of Inherited Metabolic Disease, 2015. 38(5): p. 931-940. 45. Park, J.H., et al., SLC39A8 deficiency: biochemical correction and major clinical improvement by manganese therapy. Genetics in Medicine, 2018. 20(2): p. 259- 268. 46. Morelle, W., et al., Galactose Supplementation in Patients With TMEM165-CDG Rescues the Glycosylation Defects. Journal of Clinical Endocrinology & Metabolism, 2017. 102(4): p. 1375-1386. 47. Almeida, A.M., et al., Brief report: Targeted therapy for inherited GPI deficiency. New England Journal of Medicine, 2007. 356(16): p. 1641-1647. 48. O'Shea, K.S. and M.H. Kaufman, Phospholipase C-induced neural tube defects in the mouse embryo. Experientia, 1980. 36(10): p. 1217-9. 49. Nozaki, M., et al., Developmental abnormalities of glycosylphosphatidylinositol- anchor-deficient embryos revealed by Cre/loxP system. Lab Invest, 1999. 79(3): p. 293-9.

50. Wilson, R., et al., Deciphering the mechanisms of developmental disorders: phenotype analysis of embryos from mutant mouse lines. Nucleic Acids Research, 2016. 44(D1): p. D855-D861. 51. McKean, D.M. and L. Niswander, Defects in GPI biosynthesis perturb Cripto signaling during forebrain development in two new mouse models of holoprosencephaly. Biol Open, 2012. 1(9): p. 874-83. 52. Ding, J.X., et al., Cripto is required for correct orientation of the anterior-posterior axis in the mouse embryo. Nature, 1998. 395(6703): p. 702-707. 53. Lee, G.H., et al., A GPI processing phospholipase A2, PGAP6, modulates Nodal signaling in embryos by shedding CRIPTO. Journal of Cell Biology, 2016. 215(5): p. 705-718. 54. Tarutani, M., et al., Tissue-specific knockout of the mouse Pig-a gene reveals important roles for GPI-anchored proteins in skin development. Proceedings of the National Academy of Sciences of the United States of America, 1997. 94(14): p. 7400-7405. 55. Ahrens, M.J., et al., Convergent extension movements in growth plate chondrocytes require gpi-anchored cell surface proteins. Development, 2009. 136(20): p. 3463-3474. 56. Kinoshita, T., Molecular genetics, biochemistry, and biology of PNH. Rinsho Ketsueki, 2017. 58(4): p. 353-362. 57. Jasinski, M., et al., GATA1-CRE mediates Piga gene in activation in the erythroid/megakaryocytic lineage and leads to circulating RBC's with a partial deficiency of GPI-linked proteins (PNH type II cells). Blood, 2000. 96(11): p. 526a- 526a. 58. Carmean, V., et al., pigk Mutation underlies macho behavior and affects Rohon- Beard cell excitability. Journal of Neurophysiology, 2015. 114(2): p. 1146-1157. 59. Nakano, Y., et al., Biogenesis of GPI-anchored proteins is essential for surface expression of sodium channels in zebrafish Rohon-Beard neurons to respond to mechanosensory stimulation. Development, 2010. 137(10): p. 1689-98. 60. Satoh, T., et al., GPI biosynthesis is essential for rhodopsin sorting at the trans- Golgi network in Drosophila photoreceptors. Development, 2013. 140(2): p. 385- 394. 61. Cordero, D.R., et al., Cranial Neural Crest Cells on the Move: Their Roles in Craniofacial Development. American Journal of Medical Genetics Part A, 2011. 155a(2): p. 270-279. 62. Bronner-Fraser, M. and S.E. Fraser, Cell lineage analysis reveals multipotency of some avian neural crest cells. Nature, 1988. 335(6186): p. 161-4. 63. Abzhanov, A., et al., Dissimilar regulation of cell differentiation in mesencephalic (cranial) and sacral (trunk) neural crest cells in vitro. Development, 2003. 130(19): p. 4567-4579. 64. Duband, J.L., A. Dady, and V. Fleury, Resolving Time and Space Constraints During Neural Crest Formation and Delamination. Neural Crest and Placodes, 2015. 111: p. 27-67. 65. Kubota, Y. and K. Ito, Chemotactic migration of mesencephalic neural crest cells in the mouse. Developmental Dynamics, 2000. 217(2): p. 170-179.

66. Le Douarin, N. and C. Kalcheim, The neural crest. 2nd ed. Developmental and cell biology series. 1999, Cambridge, UK ; New York, NY, USA: Cambridge University Press. xxiii, 445 p. 67. Helbling, P.M., C.T. Tran, and A.W. Brandli, Requirement for EphA receptor signaling in the segregation of Xenopus third and fourth arch neural crest cells. Mechanisms of Development, 1998. 78(1-2): p. 63-79. 68. Jeong, J.H., et al., Hedgehog signaling in the neural crest cells regulates the patterning and growth of facial primordia. Genes & Development, 2004. 18(8): p. 937-951. 69. Brault, V., et al., Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development, 2001. 128(8): p. 1253-1264. 70. Le Douarin, N.M., J.M. Brito, and S. Creuzet, Role of the neural crest in face and brain development. Brain Res Rev, 2007. 55(2): p. 237-47. 71. Sun, D., S. Baur, and E.D. Hay, Epithelial-mesenchymal transformation is the mechanism for fusion of the craniofacial primordia involved in morphogenesis of the chicken lip. Dev Biol, 2000. 228(2): p. 337-49. 72. Jiang, R.L., J.O. Bush, and A.C. Lidral, Development of the upper lip: Morphogenetic and molecular mechanisms. Developmental Dynamics, 2006. 235(5): p. 1152-1166. 73. Ishii, M., et al., Combined deficiencies of Msx1 and Msx2 cause impaired patterning and survival of the cranial neural crest. Development, 2005. 132(22): p. 4937-50. 74. Trumpp, A., et al., Cre-mediated gene inactivation demonstrates that FGF8 is required for cell survival and patterning of the first branchial arch. Genes & Development, 1999. 13(23): p. 3136-3148. 75. Lan, Y., et al., Expression of Wnt9b and activation of canonical Wnt signaling during midfacial morphogenesis in mice. Developmental Dynamics, 2006. 235(5): p. 1448-1454. 76. Juriloff, D.M., M.J. Harris, and C.J. Brown, Unravelling the complex genetics of cleft lip in the mouse model. Mammalian Genome, 2001. 12(6): p. 426-435. 77. Kelly, D., T. O'Dowd, and U. Reulbach, Use of folic acid supplements and risk of cleft lip and palate in infants: a population-based cohort study. British Journal of General Practice, 2012. 62(600). 78. Lopez-Gordillo, Y., et al., Maternal folic acid supplementation reduces the severity of cleft palate in Tgf-beta(3) null mutant mice. Pediatric Research, 2019. 85(4): p. 566-573. 79. Wahl, S.E., et al., The role of folate metabolism in orofacial development and clefting. Developmental Biology, 2015. 405(1): p. 108-122. 80. Xu, J.Y., et al., A Shh-Foxf-Fgf18-Shh Molecular Circuit Regulating Palate Development. Plos Genetics, 2016. 12(1). 81. Lan, Y. and R. Jiang, Sonic hedgehog signaling regulates reciprocal epithelial- mesenchymal interactions controlling palatal outgrowth. Development, 2009. 136(8): p. 1387-1396. 82. Lan, Y., J.Y. Xu, and R.L. Jiang, Cellular and Molecular Mechanisms of Palatogenesis. Craniofacial Development, 2015. 115: p. 59-84.

83. Lan, Y., et al., Odd-skipped related 2 (Osr2) encodes a key intrinsic regulator of secondary palate growth and morphogenesis. Development, 2004. 131(13): p. 3207-3216. 84. Peters, H., et al., Pax9-deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes & Development, 1998. 12(17): p. 2735-2747. 85. Alappat, S.R., et al., The cellular and molecular etiology of the cleft secondary palate in Fgf10 mutant mice. Developmental Biology, 2005. 277(1): p. 102-113. 86. Satokata, I. and R. Maas, Msx1 Deficient Mice Exhibit Cleft-Palate and Abnormalities of Craniofacial and Tooth Development. Nature Genetics, 1994. 6(4): p. 348-356. 87. Lan, Y., et al., Golgb1 regulates protein glycosylation and is crucial for mammalian palate development. Development, 2016. 143(13): p. 2344-2355. 88. Ingraham, C.R., et al., Abnormal skin, limb and craniofacial morphogenesis in mice deficient for interferon regulatory factor 6 (Irf6). Nature Genetics, 2006. 38(11): p. 1335-1340. 89. Casey, L.M., et al., Jag2-Notch1 signaling regulates oral epithelial differentiation and palate development. Developmental Dynamics, 2006. 235(7): p. 1830-1844. 90. Yang, L.T. and V. Kaartinen, Tgfb1 expressed in the Tgfb3 locus partially rescues the cleft palate phenotype of Tgfb3 null mutants. Developmental Biology, 2007. 312(1): p. 384-395. 91. Hu, L.H., et al., TGF beta 3 Regulates Periderm Removal Through Delta Np63 in the Developing Palate. Journal of Cellular Physiology, 2015. 230(6): p. 1212-1225. 92. Murray, S.A., K.F. Oram, and T. Gridley, Multiple functions of Snail family genes during palate development in mice. Development, 2007. 134(9): p. 1789-1797. 93. Murdoch, J.N., et al., Genetic interactions between planar cell polarity genes cause diverse neural tube defects in mice. Disease Models & Mechanisms, 2014. 7(10): p. 1153-1163. 94. Greene, N.D.E. and A.J. Copp, Neural Tube Defects. Annual Review of Neuroscience, Vol 37, 2014. 37: p. 221-242. 95. Chiang, C., et al., Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature, 1996. 383(6599): p. 407-413. 96. Ang, S.L. and J. Rossant, Hnf-3-Beta Is Essential for Node and Notochord Formation in Mouse Development. Cell, 1994. 78(4): p. 561-574. 97. Ybot-Gonzalez, P., et al., Neural plate morphogenesis during mouse neurulation is regulated by antagonism of Bmp signalling. Development, 2007. 134(17): p. 3203-3211. 98. Ybot-Gonzalez, P., et al., Sonic hedgehog and the molecular regulation of mouse neural tube closure. Development, 2002. 129(10): p. 2507-2517. 99. Miller, K.A., et al., Cauli: A Mouse Strain with an Ift140 Mutation That Results in a Skeletal Ciliopathy Modelling Jeune Syndrome. Plos Genetics, 2013. 9(8). 100. Murdoch, J.N. and A.J. Copp, The Relationship between Sonic Hedgehog Signaling, Cilia, and Neural Tube Defects. Birth Defects Research Part a-Clinical and Molecular Teratology, 2010. 88(8): p. 633-652.

101. Gurniak, C.B., E. Perlas, and W. Witke, The actin depolymerizing factor n-cofilin is essential for neural tube morphogenesis and neural crest cell migration. Developmental Biology, 2005. 278(1): p. 231-241. 102. Xu, W.M., H. Baribault, and E.D. Adamson, Vinculin knockout results in heart and brain defects during embryonic development. Development, 1998. 125(2): p. 327- 337. 103. Pyrgaki, C., et al., Dynamic imaging of mammalian neural tube closure. Developmental Biology, 2010. 344(2): p. 941-947. 104. Rifat, Y., et al., Regional neural tube closure defined by the Grainy head-like transcription factors. Developmental Biology, 2010. 345(2): p. 237-245. 105. Kim, T.H., et al., Phactr4 regulates neural tube and optic fissure closure by controlling PP1-, Rb-, and E2F1-regulated cell-cycle progression. Developmental Cell, 2007. 13(1): p. 87-102. 106. Santos, L.M.P., et al., Prevention of neural tube defects by the fortification of flour with folic acid: a population-based retrospective study in Brazil. Bulletin of the World Health Organization, 2016. 94(1): p. 22-29. 107. Wald, N.J., et al., Quantifying the effect of folic acid. Lancet, 2001. 358(9298): p. 2069-2073. 108. Spiegelstein, O., et al., Embryonic development of folate binding protein-1 (Folbp1) knockout mice: Effects of the chemical form, dose, and timing of maternal folate supplementation. Dev Dyn, 2004. 231(1): p. 221-31. 109. Tang, L.S., et al., Role of Folbp1 in the regional regulation of apoptosis and cell proliferation in the developing neural tube and craniofacies. Am J Med Genet C Semin Med Genet, 2005. 135c(1): p. 48-58. 110. Piedrahita, J.A., et al., Mice lacking the folic acid-binding protein Folbp1 are defective in early embryonic development. Nat Genet, 1999. 23(2): p. 228-32. 111. Tang, L.S. and R.H. Finnell, Neural and orofacial defects in Folbp1 knockout mice. Birth Defects Research Part a-Clinical and Molecular Teratology, 2003. 67(4): p. 209-218. 112. Freeze, H.H., et al., Neurological Aspects of Human Glycosylation Disorders. Annual Review of Neuroscience, Vol 38, 2015. 38: p. 105-+. 113. Martinez, S., et al., Cellular and molecular basis of cerebellar development. Frontiers in Neuroanatomy, 2013. 7. 114. Sato, T. and A.L. Joyner, The duration of Fgf8 isthmic organizer expression is key to patterning different tectal-isthmo-cerebellum structures. Development, 2009. 136(21): p. 3617-3626. 115. Li, J.Y.H. and A.L. Joyner, Otx2 and Gbx2 are required for refinement and not induction of mid-hindbrain gene expression. Development, 2001. 128(24): p. 4979- 4991. 116. Lewis, P.M., et al., Sonic hedgehog signaling is required for expansion of granule neuron precursors and patterning of the mouse cerebellum. Developmental Biology, 2004. 270(2): p. 393-410. 117. Edmondson, J.C. and M.E. Hatten, Glial-Guided Granule Neuron Migration Invitro - a High-Resolution Time-Lapse Video Microscopic Study. Journal of Neuroscience, 1987. 7(6): p. 1928-1934.

118. Oliver, T.G., et al., Loss of patched and disruption of granule cell development in a pre-neoplastic stage of medulloblastoma. Development, 2005. 132(10): p. 2425- 2439. 119. Heuer, H. and C.A. Mason, Thyroid hormone induces cerebellar Purkinje cell dendritic development via the thyroid hormone receptor alpha 1. Journal of Neuroscience, 2003. 23(33): p. 10604-10612. 120. Sakamoto, H., et al., Dendritic growth and spine formation in response to estrogen in the developing Purkinje cell. Endocrinology, 2003. 144(10): p. 4466-4477. 121. Sakamoto, H., K. Ukena, and K. Tsutsui, Effects of progesterone synthesized de novo in the developing purkinje cell on its dendritic growth and synaptogenesis. Journal of Neuroscience, 2001. 21(16): p. 6221-6232. 122. Salinas, P.C., et al., Maintenance of Wnt-3 Expression in Purkinje-Cells of the Mouse Cerebellum Depends on Interactions with Granule Cells. Development, 1994. 120(5): p. 1277-1286. 123. Surmeier, D.J., P.G. Mermelstein, and D. Goldowitz, The weaver mutation of GIRK2 results in a loss of inwardly rectifying K+ current in cerebellar granule cells. Proceedings of the National Academy of Sciences of the United States of America, 1996. 93(20): p. 11191-11195. 124. Nave, K.A., et al., Jimpy Mutant Mouse - a 74-Base Deletion in the Messenger- Rna for Myelin Proteolipid Protein and Evidence for a Primary Defect in Rna Splicing. Proceedings of the National Academy of Sciences of the United States of America, 1986. 83(23): p. 9264-9268. 125. Chernoff, G.F., Shiverer - an Autosomal Recessive Mutant Mouse with Myelin Deficiency. Journal of Heredity, 1981. 72(2): p. 128-128. 126. Liu, Z.J., et al., Induction of oligodendrocyte differentiation by Olig2 and Sox10: Evidence for reciprocal interactions and dosage-dependent mechanisms. Developmental Biology, 2007. 302(2): p. 683-693. 127. Elbaz, B. and B. Popko, Molecular Control of Oligodendrocyte Development. Trends in Neurosciences, 2019. 42(4): p. 263-277. 128. Kramer, E.M., et al., Oligodendrocytes direct glycosyl phosphatidylinositol- anchored proteins to the myelin sheath in glycosphingolipid-rich complexes. Journal of Biological Chemistry, 1997. 272(14): p. 8937-8945. 129. Berglund, E.O., et al., Ataxia and abnormal cerebellar microorganization in mice with ablated contactin gene expression. Neuron, 1999. 24(3): p. 739-750. 130. CColakoglu, G., et al., Contactin-1 regulates myelination and nodal/paranodal domain organization in the central nervous system. Proceedings of the National Academy of Sciences of the United States of America, 2014. 111(3): p. E394- E403. 131. Scott, H. and V.M. Panin, The role of protein N-glycosylation in neural transmission. Glycobiology, 2014. 24(5): p. 407-417. 132. daCosta, C.J.B., D.E.E. Kaiser, and J.E. Baenziger, Role of glycosylation and membrane environment in nicotinic acetylcholine receptor stability. Biophysical Journal, 2005. 88(3): p. 1755-1764. 133. Houlden, H., Defective N-linked protein glycosylation pathway in congenital myasthenic syndromes. Brain, 2013. 136: p. 692-693.

134. Parkinson, W.M., et al., Synaptic roles for phosphomannomutase type 2 in a new Drosophila congenital disorder of glycosylation disease model. Disease Models & Mechanisms, 2016. 9(5): p. 513-527. 135. Frappaolo, A., et al., COG7 deficiency in Drosophila generates multifaceted developmental, behavioral and protein glycosylation phenotypes. Journal of Cell Science, 2017. 130(21): p. 3637-3649. 136. Arranz, A.M., et al., Hyaluronan Deficiency Due to Has3 Knock-Out Causes Altered Neuronal Activity and Seizures via Reduction in Brain Extracellular Space. Journal of Neuroscience, 2014. 34(18): p. 6164-6176. 137. Montanaro, F. and S. Carbonetto, Targeting dystroglycan in the brain. Neuron, 2003. 37(2): p. 193-196. 138. Yang, Y.M., et al., Disruption of Tmem30a results in cerebellar ataxia and degeneration of Purkinje cells. Cell Death & Disease, 2018. 9. 139. Medina-Cano, D., et al., High N-glycan multiplicity is critical for neuronal adhesion and sensitizes the developing cerebellum to N-glycosylation defect. Elife, 2018. 7. 140. Antoun, H., et al., Cerebellar atrophy: an important feature of carbohydrate deficient glycoprotein syndrome type 1. Pediatric Radiology, 1999. 29(3): p. 194- 198. 141. Hetz, C. and S. Saxena, ER stress and the unfolded protein response in neurodegeneration. Nature Reviews Neurology, 2017. 13(8): p. 477-491. 142. Sun, L.W., et al., Insufficient ER-stress response causes selective mouse cerebellar granule cell degeneration resembling that seen in congenital disorders of glycosylation. Molecular Brain, 2013. 6. 143. Cline, A., et al., A zebrafish model of PMM2-CDG reveals altered neurogenesis and a substrate-accumulation mechanism for N-linked glycosylation deficiency. Molecular Biology of the Cell, 2012. 23(21): p. 4175-4187. 144. Buttiglione, M., et al., A functional interaction between the neuronal adhesion molecules TAG-1 and f3 modulates neurite outgrowth and fasciculation of cerebellar granule cells. Journal of Neuroscience, 1998. 18(17): p. 6853-6870. 145. Deak, K.L., et al., SNPs in the neural cell adhesion molecule 1 gene (NCAM1) may be associated with human neural tube defects. Human Genetics, 2005. 117(2-3): p. 133-142. 146. Polo-Parada, L., et al., Distinct roles of different neural cell adhesion molecule (NCAM) isoforms in synaptic maturation revealed by analysis of NCAM 180 kDa isoform-deficient mice. Journal of Neuroscience, 2004. 24(8): p. 1852-1864. 147. Schwab, M.E., Functions of Nogo proteins and their receptors in the nervous system. Nature Reviews Neuroscience, 2010. 11(12): p. 799-811. 148. Wang, K.C., et al., Oligodendrocyte-myelin glycoprotein is a Nogo receptor ligand that inhibits neurite outgrowth. Nature, 2002. 417(6892): p. 941-944. 149. Um, J.W. and J. Ko, Neural Glycosylphosphatidylinositol-Anchored Proteins in Synaptic Specification. Trends in Cell Biology, 2017. 27(12): p. 931-945. 150. Narisawa, S., N. Frohlander, and J.L. Millan, Inactivation of two mouse alkaline phosphatase genes and establishment of a model of infantile hypophosphatasia. Developmental Dynamics, 1997. 208(3): p. 432-446.

151. Waymire, K.G., et al., Mice Lacking Tissue Nonspecific Alkaline-Phosphatase Die from Seizures Due to Defective Metabolism of Vitamin-B-6. Nature Genetics, 1995. 11(1): p. 45-51. 152. Takeda, J., et al., Deficiency of the Gpi Anchor Caused by a Somatic Mutation of the Pig-a Gene in Paroxysmal-Nocturnal Hemoglobinuria. Cell, 1993. 73(4): p. 703-711. 153. Yuan, X., et al., A hypomorphic PIGA gene mutation causes severe defects in neuron development and susceptibility to complement-mediated toxicity in a human iPSC model. Plos One, 2017. 12(4). 154. Stevens, B., et al., The classical complement cascade mediates CNS synapse elimination. Cell, 2007. 131(6): p. 1164-1178. 155. Zakin, L. and E.M. De Roberts, Inactivation of mouse Twisted gastrulation reveals its role in promoting Bmp4 activity during forebrain development. Development, 2004. 131(2): p. 413-424. 156. Chang, C.B., et al., Twisted gastrulation can function as a BMP antagonist. Nature, 2001. 410(6827): p. 483-487. 157. Billington, C.J., et al., Glycosylation of Twisted gastrulation is required for BMP binding and activity during craniofacial development. Frontiers in Physiology, 2011. 2. 158. Bammens, R., et al., Abnormal cartilage development and altered N-glycosylation in Tmem165-deficient zebrafish mirrors the phenotypes associated with TMEM165-CDG. Glycobiology, 2015. 25(6): p. 669-682. 159. Bammens, R., et al., TMEM165 deficiency is associated with cartilage and glycosylation defects in zebrafish. Glycobiology, 2013. 23(11): p. 1411-1411. 160. Robinson, V., et al., Roles of Eph receptors and ephrins in neural crest pathfinding. Cell and Tissue Research, 1997. 290(2): p. 265-274. 161. Taraviras, S., et al., Signalling by the RET receptor tyrosine kinase and its role in the development of the mammalian enteric nervous system. Development, 1999. 126(12): p. 2785-2797. 162. Pichel, J.G., et al., Defects in enteric innervation and kidney development in mice lacking GDNF. Nature, 1996. 382(6586): p. 73-76. 163. Uesaka, T., et al., Conditional ablation of GFR alpha 1 in postmigratory enteric neurons triggers unconventional neuronal death in the colon and causes a Hirschsprung's disease phenotype. Development, 2007. 134(11): p. 2171-2181. 164. Homma, S., et al., Expression pattern of GDNF, c-ret, and GFR alpha s suggests novel roles for GDNF ligands during early organogenesis in the chick embryo. Developmental Biology, 2000. 217(1): p. 121-137. 165. Song, H.H. and J. Filmus, The role of glypicans in mammalian development. Biochim Biophys Acta, 2002. 1573(3): p. 241-6. 166. Capurro, M.I., et al., Glypican-3 inhibits Hedgehog signaling during development by competing with patched for Hedgehog binding. Dev Cell, 2008. 14(5): p. 700- 11. 167. Carmona-Fontaine, C., et al., A novel role of C3 as a regulator of neural crest migration during embryo development. Molecular Immunology, 2008. 45(16): p. 4132-4132.

168. Carmona-Fontaine, C., et al., Complement Fragment C3a Controls Mutual Cell Attraction during Collective Cell Migration. Developmental Cell, 2011. 21(6): p. 1026-1037.

Chapter 2. Glycosylphosphatidylinositol Biosynthesis and Remodeling are Required for Neural Crest Cell Survival.

Marshall Lukacs1, 2, Tia Roberts1, Praneet Chatuverdi3, Rolf W. Stottmann1, 2, 3, 4#

1Division of Human Genetics 2Medical Scientist Training Program 3Division of Developmental Biology Cincinnati Children’s Medical Center 4Department of Pediatrics University of Cincinnati Cincinnati, OH 45229

#author for correspondence [email protected]

Abstract The glycosylphosphatidylinositol (GPI) anchor attaches nearly 150 proteins to the cell surface. Patients with pathogenic variants in GPI biosynthetic pathway genes display an array of phenotypes including seizures, developmental delay, dysmorphic facial features and cleft palate. There is virtually no mechanism to explain these phenotypes. We identified a novel mouse mutant (cleft lip/palate, edema and exencephaly; Clpex) with a hypomorphic mutation in Post-Glycophosphatidylinositol Attachment to Proteins-2

(Pgap2). Pgap2 is one of the final proteins in the GPI biosynthesis pathway and is required for anchor maturation. We found the Clpex mutation results in a global decrease in surface GPI expression. Surprisingly, Pgap2 showed tissue specific expression with enrichment in the affected tissues of the Clpex mutant. We found the phenotype in Clpex mutants is due to apoptosis of neural crest cells (NCCs) and the cranial neuroepithelium, as is observed in the GPI anchored Folate Receptor 1-/- mouse. We showed folinic acid supplementation in utero can rescue the cleft lip phenotype in Clpex. Finally, we generated a novel mouse model of NCC-specific total GPI deficiency in the Wnt1-Cre lineage. These mutants developed median cleft lip and palate demonstrating a cell autonomous role for GPI biosynthesis in NCC development.

Introduction

Inherited glycophosphatidylinositol deficiency (IGD) disorders are a class of congenital disorders of glycosylation that affect the biosynthesis of the glycosylphosphatidylinositol

(GPI) anchor. The clinical spectrum of IGDs is broad and includes epilepsy, developmental delay, structural brain malformations, cleft lip/palate, skeletal hypoplasia, deafness, ophthalmological abnormalities, gastrointestinal defects, genitourinary defects, heart defects, Hirschsprung’s disease, hyperphosphatasia, and nephrogenic defects [1-

4]. However, across all GPI deficiency disorders, the most penetrant defects affect the central nervous system and the craniofacial complex [1-4]. Indeed, automated image analysis was able to predict the IGD gene mutated in each patient from facial gestalt [2].

Interestingly, facial gestalt was a better predictor of patient mutation than analysis of the degree of GPI biosynthesis by flow cytometry. Little is known about the mechanism(s) that causes these phenotypes or why disparate tissues are differentially affected[4][4].

We sought to determine the mechanism responsible for these phenotypes using a novel mouse model of reduced enzymatic function within the GPI biosynthesis pathway.

The GPI anchor is a glycolipid added post-translationally to nearly 150 proteins which anchors them to the outer leaflet of the plasma membrane and traffics them to lipid rafts

[1]. The biosynthesis and remodeling of the GPI anchor is extensive and requires nearly

30 genes [1]. Once the glycolipid is formed and transferred to the C-terminus of the target protein by a variety of Phosphatidylinositol Glycan (PIG proteins), it is transferred to the

Golgi Apparatus for remodeling by Post-GPI Attachment to Proteins (PGAP proteins).

One of these PGAP proteins involved in remodeling the GPI anchor is Post-

Glycosylphosphatidylinositol Attachment to Proteins 2 (PGAP2). PGAP2 is a

85 transmembrane protein that catalyzes the addition of stearic acid to the lipid portion of the

GPI anchor and cells deficient in Pgap2 lack stable surface expression of a variety of GPI- anchored proteins (GPI-APs) [1,5]. Autosomal recessive mutations in PGAP2 cause

Hyperphosphatasia with Mental Retardation 3 (HPMRS3 OMIM # 614207), an IGD that presents with variably penetrant hyperphosphatasia, developmental delay, seizures, microcephaly, heart defects, and a variety of neurocristopathies including Hirschsprung’s disease, cleft lip, cleft palate, and facial dysmorphia [5-8]. Currently, there is no known molecular mechanism to explain the cause of these phenotypes or therapies for these patients.

In a forward genetic ENU mutagenesis screen, we previously identified the Clpex mouse mutant with Cleft Lip, Cleft Palate, Edema, and Exencephaly (Clpex) [9]. Here we present evidence that this mutant phenotype is caused by a hypo-morphic allele of Pgap2. To date, embryonic phenotypes of GPI biosynthesis mutants have been difficult to study due to the early lethal phenotypes associated with germline knockout of GPI biosynthesis genes [10-13]. The International Mouse Phenotyping Consortium labelled Pgap2 homozygote knockout mice preweaning lethal and the Deciphering the Mechanisms of

Developmental Disorders initiative labelled Pgap2 homozygotes early lethal as no embryos were recovered at embryonic day E9.5. In this study, we took advantage of the

Clpex hypomorphic mutant to determine the mechanism of the various phenotypes and tested the hypothesis that GPI-anchored Folate Receptor 1 (FOLR1) is responsible for the phenotypes observed.

As we observed tissue specific defects in NCCs in the Clpex germline mutant, we sought to determine the cell autonomous requirement for GPI biosynthesis pathway generally in

NCC development. To do this, we took a conditional approach to abolish GPI biosynthesis in NCCs using the Wnt1-Cre transgene and a floxed allele of a critical initiator of GPI biosynthesis. The Clpex mutant and our NCC conditional mutant serve as models for studying the effect of GPI biosynthesis defects in development of the craniofacial complex and testing potential therapeutics in utero for patients.

Results

The Clpex mutant phenotype is caused by a missense mutation in Pgap2.

We previously identified the Clpex (cleft lip and palate, edema, and exencephaly) mutant in a mouse N-ethyl-N-nitrosourea (ENU) mutagenesis screen for recessive alleles leading to organogenesis phenotypes [9]. Clpex homozygous mutants displayed multiple partially penetrant phenotypes. In a subset of 70 mutants on a mixed background from late organogenesis stages (~E16.5-E18.5), we noted cranial neural tube defects

(exencephaly) in 61 (87%), cleft lip in 22 (31%), cleft palate in 13 (19%), and edema in 6 embryos (9%) (Fig. 1A-H). Skeletal preparations of Clpex mutants identified a defect in frontal bone ossification (Fig. 1I-L, n=5/5 mutants) and a statistically significant decrease in limb length (Fig. 1M-P). We previously reported a genetic mapping strategy with the

Mouse Universal Genotyping Array which identified a 44 Mb region of homozygosity for the mutagenized A/J genome on chromosome 7 (Fig. 1Q) [9]. We then performed exome sequencing and sequenced 3 Clpex homozygous mutants. Analysis of single base pair variants which were homozygous in all 3 mutants with predicted high impact and not already known strain polymorphisms in dbSNP left only one candidate variant (Table 1).

This was a homozygous missense mutation in the initiating methionine (c.A1G, p.M1V)

87 in exon 3 of post-GPI attachment to proteins 2 (Pgap2). We confirmed the whole exome sequencing result by Sanger Sequencing (Fig. 1R). This mutation abolishes the canonical translation start codon for Pgap2. However, there are alternative start sites of Pgap2 and multiple alternatively spliced transcripts that may lead to production of variant forms of

Pgap2.

Figure 1. The Clpex mutant phenotype is caused by a hypomorphic mutation in Pgap2. Whole mount E18.5 (A, E) and E15.5 (G) WT embryos. Whole mount E18.5 (B, F) and E15.5 (H) Clpex mutant embryos. H&E staining of WT E15.5 (C) and Clpex (D) coronal sections. Skeletal preparation of WT skull ventral view (I), dorsal view (K). Skeletal preparation of Clpex mutant skull ventral view (J) and dorsal view (L). Asterix indicates absent palatine bone in mutant. Skeletal preparation of WT limb (M) and Clpex mutant limb (N). Quantification of WT and mutant radial (O) and humeral (P) length normalized to the crown to rump ratio. Mapping data for Clpex mutation (Q). Sanger sequencing of Pgap2 exon 3 in WT and Clpex mutant with exon 3 highlighted starting at -N. (** p< 0.001).

Table 1. Exome Filtering of the Clpex mutant.

Variant Filters Number Total variants 145,956 Homozygous in all 3 120,393 mutants Chromosome 7 5,854 81-125 Mb 2,196 “High” impact 9

Not in dbSNP 7 Single base pair change 1: Pgap2

To determine whether the Clpex phenotype was caused by the missense mutation in

Pgap2, we performed a genetic complementation test using the Pgap2tm1a (EUCOMM)Wtsi

(hereafter referred to as Pgap2null) conditional gene trap allele. We crossed Pgap2Clpex/+ heterozygotes with Pgap2null/+ heterozygotes to generate Pgap2Clpex/null embryos.

Pgap2Clpex/null embryos displayed neural tube defects, bilateral cleft lip, and edema similar to the Pgap2Clpex/Clpex embryos at E13.5 (Fig. 2 A-H). Pgap2Clpex/null embryos also displayed micro-opthalmia (Fig. 2F) and more penetrant cleft lip and edema phenotypes than observed in Pgap2Clpex/Clpex homozygotes (Fig. 2I). Pgap2Clpex/null embryo viability was decreased in this line with lethality at approximately E13.5-E14.5, precluding analysis of palatal development in these mutants. Histological analysis of the heart in Pgap2Clpex/null

E13.5 embryos showed pericardial effusion, a reduction in thickness of the myocardium, and an underdeveloped ventricular septum and valves (Fig. 2J-Q). As the Clpex allele failed to complement a null allele of Pgap2, we concluded the Clpex phenotype is caused by a hypomorphic allele of Pgap2. The Deciphering Mechanisms of Developmental

Disorders (DMDD) initiative has generated Pgap2null/null homozygotes and classified them

90 as “early lethal” abnormal chorion and trophoblast layer morphology [12]. These data argue Pgap2 is required for early embryogenesis and our Clpex allele must be hypomorphic, as the embryos survive to E18.5.

Figure 2. Pgap2null allele fails to complement Pgap2Clpex allele. Whole mount image of E13.5 WT (A, C, E, and G) and Pgap2Clpex/null mutant (B, D, F, and H). Penetrance of some key phenotypes is compared in I. Cardiac histology of E14.5 WT (J) and Pgap2Clpex/null mutant (K,), scale bar indicates 1 mm. Higher power images of the ventricular septum (L, M), valve (N, O), and myocardial wall (P, Q). Scale bar indicates -Q.

Pgap2 is dynamically expressed throughout development.

Based on the tissues affected in the Clpex mutant, we hypothesized Pgap2 is expressed in the neural folds and facial primordia of the developing mouse embryo at early stages.

We used the lacZ expression cassette within the Pgap2null allele to perform detailed expression analysis of Pgap2 throughout development (n= 21 litters at multiple developmental stages). We performed RNA in situ hybridization in parallel for some stages to test the fidelity of the lacZ expression and found high concordance. Pgap2 was expressed relatively uniformly and ubiquitously at neurulation stages in the mouse from

E7.5- E8.5 (Fig. 3A-D). We also noted extraembryonic expression at E7.5, consistent with the abnormal placental development observed in Pgap2null/null embryos (Fig. 3A,B) [12].

At E9.5-11.5, there was clear enrichment of Pgap2 expression in the first branchial arch

(Fig. 3E-G). Pgap2 in situ hybridization identified a similar pattern of expression as observed in the Pgap2 LacZ reporter allele at E9.5 (Fig.3E) At E10.5 and E11.5, expression was enriched in the limb bud, somites, first branchial arch, eye, forebrain and midbrain (Fig. 3F-J). There was also increased expression at the medial aspects of both medial and lateral nasal processes at E10.5 (Fig. 3G-H), and strong expression in the heart starting at E11.5 (Fig. 3I, J). Later in organogenesis stages, Pgap2 showed more regionalized and enriched expression, including in the ganglion cell layer of the retina at

E12.5 and E14.5 (Fig. 3K, L). At E16.5 Pgap2 was expressed in the salivary gland, epidermis, stomach, nasal conchae, myocardium, bronchi, kidney, uroepithelium, lung parenchyma, a specific layer of the cortex, and ear (Fig. 3M-T). Interestingly, Pgap2 showed lower expression in the liver (Fig. 3S) and most of the brain except for a thin layer of the cortex and the choroid plexus at E16.5 (Fig. 3S, U-V, X). We also noted expression

92 in the genital tubercle (Fig. 3W). We conclude Pgap2 shows tissue specific regions of increased expression which may help to explain why certain tissues such as the craniofacial complex, central nervous system, and heart are differentially affected in GPI biosynthesis mutants. These data are in contrast to previous reports where some GPI biosynthesis genes are shown to be ubiquitously and uniformly expressed, including Pign in the mouse and pigu in zebrafish [10, 14]. Our Pgap2 expression is more consistent with the expression of Pigv which is enriched in C. elegans epidermal tissues [15]

Figure 3. Pgap2 is dynamically expressed throughout embryogenesis. Whole mount Pgap2 Xgal staining in E7.5 (A-B), E8.5 (C-D), E10.5 (F-G) E11.5 (I-J). Pgap2 in situ hybridization at E9.5 (E). Transverse section through the anterior facial tissues at E10.5 (H) at the future site of lip closure. (K-X) Xgal section staining is shown from embryos at E12.5, E14.5, E16, 5 E17.5 and P0. Expression is seen in the ganglion cell layer of the retina (K, L), salivary gland (M), epidermis (N), stomach (O), nasal conchae (P), myocardium (Q), lung parenchyma (R), kidney (S), ear (T), cerebral cortex (U-V), genital

Pgap2 is required for the proper anchoring of GPI-APs, including FOLR1.

PGAP2 is the final protein in the GPI biosynthesis pathway and catalyzes the addition of stearic acid to the GPI anchor [16]. GPI is a glycolipid added post-translationally to nearly

150 proteins in the endoplasmic reticulum (ER) and remodeled in the Golgi apparatus.

GPI anchored proteins (GPI-APs) require the GPI anchor for their presentation in the outer leaflet of the plasma membrane and association with lipid rafts [1, 16]. In the absence of Pgap2, cells lack a variety of GPI-APs on the cell surface leading to a functional GPI deficiency [5-8, 16]. To determine the effect of the Clpex mutation on

Pgap2 function, we performed Fluorescein-labeled proaerolysin (FLAER) flow cytometry staining to quantify the overall amount of the GPI anchor on the cell surface. FLAER is a bacterial toxin conjugated to fluorescein that binds directly to the GPI anchor in the plasma membrane. We hypothesized Pgap2 function is impaired in Clpex mutants due to the

ENU mutation in the initiating methionine. We found mouse embryonic fibroblasts (MEFs) from Clpex mutants displayed a significantly decreased expression of FLAER compared to wildtype MEFs, consistent with a defect in GPI biosynthesis (n=3 separate experiments with 4 WT and 4 Clpex cell lines) (Fig. 4A, B).

Our genetic complementation analysis results suggested the Clpex allele might be a hypomorphic allele of Pgap2. To test this hypothesis, we generated human embryonic kidney (HEK) 293T clones with a 121bp deletion in exon 3 of PGAP2 with CRISPR/Cas9

(termed PGAP2-/- cells; Fig. S1). In parallel, we recapitulated the Clpex mutation in 3 independent clones of HEK293T cells by CRISPR/Cas9 mediated homologous directed repair (termed Clpex KI Clones 1, 4, and 7; Fig.S1). We found there was a statistically

95 significant decrease in FLAER staining between WT and all KI clones and the PGAP2-/- cells. However, we observed no statistical difference in FLAER staining in PGAP2-/- cells when compared to Clpex KI cells (Fig. 4C, D). Therefore, we conclude the Clpex missense mutation severely affects PGAP2 function similar to the effect seen upon total depletion of PGAP2. As a positive control, we used CRISPR/Cas9 to delete phosphatidylinositol glycan anchor biosynthesis, class A (Piga; Fig.S1). Piga is the first gene in the GPI biosynthesis pathway and is absolutely required for GPI biosynthesis [6,

17]. We utilized CRISPR/Cas9 to generate a 29bp out-of-frame deletion in exon 3 of

PIGA. These PIGA-/- cells showed an even further decrease in FLAER staining compared to PGAP2-/- cells, confirming our staining accurately reflects GPI anchor levels (n=4 separate experiments; Fig. 4C-D).

Figure 4. Pgap2 is required for proper anchoring of GPI-APs. (A) FLAER staining of WT (orange) and Clpex (blue) MEFs, (unstained control in grey) with quantification of Mean Fluorescence Intensity (MFI) (B). FLAER staining of WT (orange) Clpex KI Clone 7 (purple), PGAP2-/- (green), PIGA-/- (blue) HEK293T cells, and unstained control (red) (C) with quantification of MFI (D). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001

Current estimates suggest nearly 150 genes encode proteins which are GPI anchored

[18]. Our manual review of the MGI database found 102 GPI-APs have been genetically manipulated and phenotyped in mice [19]. Of these, the null allele of Folr1 has a phenotype most similar to the Clpex mutant with cranial neural tube defects, cleft lip/palate, and heart outflow tract phenotypes [20]. Tashima et. al. previously showed

PGAP2 is required for stable cell surface expression of FOLR1 in CHO cells [16]. To confirm this finding, we overexpressed a myc-tagged FOLR1 construct in WT and

PGAP2-/- 293T cells and assessed the presentation on the plasma membrane by immunocytochemistry for wheat germ agglutinin (WGA). We observed a decrease in co- localization of FOLR1 with WGA in PGAP2-/- cells compared to controls (Fig. 5A-F). In the absence of PIGA, cells lack the surface expression of any GPI-APs [1]. We found

PIGA-/- cells showed decreased co-localization of FOLR1 with WGA similar to PGAP2-/- cells (representative images from n=3 technical replicates) (Fig. 5A-C, G-H). To determine the degree of co-localization between FOLR1-myc and WGA we determined the Pearson coefficient in 60x z-stack images from each genotype (Fig. 5J). We found the PIGA-/- cells have a significantly lower Pearson coefficient than WT cells and PGAP2-

/- cells have an intermediate Pearson coefficient (Fig. 5J). Thus both knockout lines display defective co-localization of FOLR1-myc with WGA compared to controls.

However, both PIGA-/- and PGAP2 -/- cells produced similar amounts of FOLR1 protein by western blot indicating that the defect is in trafficking, and not protein production (Fig.

5K).

Figure 5. Trafficking of FOLR1 to the cell membrane requires GPI biosynthesis and remodeling. Wheat germ agglutinin (WGA) staining in WT (A), PIGA-/- (D), PGAP2-/- (G) HEK293T cells. FOLR1-myc staining in WT (B), PIGA-/- (E), PGAP2-/- (H) HEK293T cells. Merge of WGA and FOLR1 for WT (C), PIGA-/- (F), and PGAP2-/- (I). Pearson Coefficient for co-localization of WGA and FOLR1-myc (J). Western blot for αmyc-FOLR1 (green) and αTubulin (red) loading control from cell lysates of WT, PIGA-/-, and PGAP2-/- cells overexpressing N-myc tagged FOLR1 (K) and Rabbit IgG control for the same cell lysate

Neural crest cells and cranial neuroepithelium display increased apoptosis in the

Clpex mutant.

A number of GPI-APs are critical for cranial neural crest cell (cNCC) migration and survival; including ephrins and FOLR1 [21-29]. This led us to the hypothesis that cNCC migration may be impaired in Clpex mutants ultimately causing the cleft lip and palate phenotype [22]. To test whether cNCC migration was impaired in the Clpex mutant, we performed a NCC lineage trace using the Wnt1-Cre (B6.Cg-H2afvTg (Wnt1-cre) 11RthTg (Wnt1-

GAL4)11Rth/J) in combination with the R26R LacZ reporter (B6.129S4-Gt (ROSA)

26Sortm1Sor/J (R26RTg) to create Wnt1-Cre; R26RTg/wt; Pgap2clpex/clpex mutants in which the NCCS are indelibly labeled with LacZ expression at E9.5 and E11.5 [30-34].

We observed no significant deficit in cNCC migration in the mutant embryos as compared to littermate controls at either stage (representative images of n=2 E9.5 mutants and n=5

E11.5 mutants) (Fig. 6A-F). However, we observed hypoplasia of the medial and lateral nasal processes at E11.5, suggesting the Clpex phenotype is due to earlier defects in

NCC survival (Fig 6E-F). As Pgap2 was highly expressed in the epithelium and epithelial barrier defects are a known cause of cleft palate, we next sought to determine whether the epidermis was compromised in the Clpex mutant [35]. We performed a Toluidine Blue exclusion assay but found no significant defects in barrier formation in the mutant (Fig.

S2).

Folr1-/- mice and zebrafish Folr1 morphants display increased cell death and decreased proliferation in the facial primordia [26, 28, 29, 36]. We hypothesized a similar mechanism may be responsible for the cleft lip and palate in the Clpex mutant embryos. To test this hypothesis, we performed whole mount Nile Blue Sulfate viability staining in WT and

100 homozygous Clpex mutant embryos at E9.5, a stage before we observed hypoplasia of the nasal processes. We found there was an increase in cell death in the facial primordia, including the frontonasal prominence, the first brachial arch, and cranial neuroepithelium in Clpex mutants as compared to controls (representative images from n=12 mutants, 5 separate experiments) (Fig. 6G-J). To confirm this result and determine which cell population was undergoing apoptosis in the Clpex mutants, we performed immunohistochemistry for αAP2 to mark NCCs and the apoptosis marker Cleaved

Caspase 3 (CC3). We found the cNCCs of the first arch and a specific population of cells within the neuroepithelium were undergoing apoptosis significantly more frequently in

Clpex homozygous mutants (Fig. 6K-R). The ratio of CC3-positive to AP2-positive cells revealed a highly significant increase in the percentage of CC3-positive cells in the first arch of Clpex mutants (n= 2 or more sections from 3 WT and 6 Clpex mutants) (Fig. 6U)

We also observed apoptosis in the cranial neuroepithelium at the dorsolateral hinge points (Fig. 6S-T). The dorsolateral hingepoints constrict bilaterally in order to close the neural tube. This apoptosis was exclusively confined to the cranial aspects of the neural tube at the midbrain-hindbrain boundary

101

Figure 6. Clpex cNCCs and neuroepithelium undergo apoptosis at E9.5. Wnt1-Cre, R26R NCC lineage trace in WT (A, C, E) and Clpex mutant (B,D,F) at E9.5 (A,B) and E11.5 (C-F). Nile Blue Sulfate whole mount viability stain in WT (G, I) and Clpex mutant (H, J) E9.5 embryos. WT E9.5 embryo stained for DAPI (K), AP2 (L) CC3 (M; merged image in N). Clpex E9.5 embryo stained for DAPI (O), AP2 (P) CC3 (Q; merged image in R). Higher power image of WT (S) and Clpex mutant (T) neuroepithelium stained with CC3 and DAPI. Quantification of CC3+ cells over AP2+ cells in the first branchial arch Region of Interest (U). **p<0.001. Scale bar indicate

102

Dietary folinic acid supplementation partially rescues cleft lip in Clpex mutants.

Dietary folinic acid supplementation has been shown to rescue the early embryonic lethal phenotype of Folr1-/- mice and these mice can then survive to adulthood [26, 28, 37]. Our data suggest FOLR1 receptor trafficking is impaired in the Clpex mutant (Fig. 4); leading us to hypothesize folinic acid supplementation in utero may rescue the Clpex phenotype.

We further hypothesized the folinic acid diet would have a greater beneficial effect as folinic acid (reduced folate) has a higher affinity for other folate receptors including solute carrier family 19 (folate transporter), member 1 (Slc19a1) and solute carrier family 46, member1 (Slc46a1),) which are not GPI anchored [38]. In comparison, folic acid has a higher affinity for the GPI anchored folate receptors FOLR1 and FOLR2 [39, 40]. We supplemented pregnant Clpex dams from E0-E16.5 with a 25 parts per million (ppm) folinic acid diet, 25 ppm folic acid diet or control diet, and collected Clpex mutants for phenotypic analysis. The folinic acid treatment group had a significantly smaller proportion of mutants with cleft lip (p=0.02) but there was no effect on the incidence of

NTD or cleft palate (Fig. 7A, B). We did note a decrease in mutants with edema, however, this decrease was not statistically significant given our sample size (p=0.06; Fig. 7C, D).

Consistent with our hypothesis, we found the folinic acid reduced the number of mutants with cleft lip by 23% (2/25 mutant vs. 22/70 control), which is more significant than the

10% reduction observed in folic acid treated mice (3/14, Fig. 6C, D). Therefore, we conclude folinic acid treatment increased the viability of Clpex facial primordia and decreased the incidence of cleft lip among Clpex mutants.

103

Figure 7. Folinic Acid treatment in utero partially rescues the cNCC apoptosis and cleft lip in Clpex mutants. Phenotypes observed in Clpex mutants from litters treated from E0-E16.5 with control diet (blue), 25ppm folic acid (orange), or 25ppm folinic acid (grey) (A). Summary of the phenotypes of Clpex mutants from litters treated with the indicated diets (B). (*p<0.05)

104

RNA sequencing reveals changes in patterning genes in Clpex mutants

As folinic acid supplementation could not rescue all phenotypes observed in the Clpex mutant, we took an unbiased transcriptomic approach to determine the major signaling pathway(s) affected upon reduced Pgap2 function. RNA sequencing was performed on pooled RNA samples from wild-type and Clpex homozygous whole mutant embryos at

E9.5 (5 of each in each RNA pool). Sorting differentially expressed genes in ToppGene showed that the most differentially regulated pathways were sequence-specific DNA binding genes including 39 genes (p=1.79x10-7; Table 2; [41]). Among the sequence- specific DNA binding genes, the majority (23/39 genes in the category) were transcription factors which have been implicated in anterior/posterior (A/P) patterning including Cdx2,

Cdx4, Tbxt, Hmx1, Lhx2, and Lhx8 [42-49] (Table 2). Anterior patterning genes were statistically significantly downregulated and posterior patterning genes were statistically significantly upregulated (Table 3). We confirmed changes in expression of three of these

A/P patterning defects by RNA in situ hybridization at E8.5-9.5 (Fig. S3). We identified a decrease in Alx3 in Clpex mutants which is both only an anterior patterning gene with a prominent role in frontonasal development and a genetic target of folate signaling [50].

We investigated Lhx8 because it is expressed in the head at E9.5 and Lhx8-/- mice develop cleft palate [51]. We found Lhx8 was decreased in Clpex mutant heads. Finally, the master posterior patterning gene Tbxt (brachyury) is critical for determining tail length and posterior somite identity [45, 46]. We found Tbxt was shifted anteriorly in Clpex mutants compared to their controls (Fig. S3).

105

The second and third most altered pathways identified by ToppGene were cholesterol transporter activity (p=1.1x10-6), and apolipoprotein binding (p=2.34 x 10-6), respectively.

Upon closer inspection, the genes in these categories were largely genes expressed in the mesendoderm including Alpha fetal protein and the Apolipoprotein gene family. We concluded the decreased expression of these genes in the Clpex mutant embryos is consistent with a defect in mesendoderm induction, rather than specific cholesterol and apolipoprotein activities.

Collectively, these findings from our transcriptomic analysis suggest other GPI-Aps involved in A/P patterning and mesendoderm development may be affected in Clpex homozygous mutant embryos. Multiple other mutations in GPI biosynthesis genes including Pgap1 and Pign lead to defective CRIPTO mediated NODAL/BMP signaling which affects the formation of the A/P axis in the early gastrulating embryo [10, 13, 52,

53]. CRIPTO is a co-receptor for NODAL and necessary for the induction of the anterior visceral endoderm and subsequent forebrain and mesendoderm formation [54, 55].

Mckean et. al. found CRIPTO signaling was impaired in the PignGonzo and Pgap1Beaker GPI biosynthesis mutants, [10]. Furthermore, stem cells from GPI deficient clones are unable to respond to TGFβ superfamily members due to defects in GPI anchored co-receptor anchoring [10, 52]. Zoltewicz et. al. found mutations in Pgap1 lead to defective A/P patterning by affecting other major signaling pathways including Wnt [53]. Our RNA-Seq results are consistent with the existing literature which has established a critical role for

GPI biosynthesis in generating the A/P axis. While this role is well established, few groups have investigated the tissue specific role of GPI biosynthesis after the A-P axis has been

106 established. Interestingly, two studies have found GPI-APs have cell autonomous roles separately in skin and limb development [56, 57]. As we found tissue specific defects in the NCC population in the Clpex mutant, we sought to address a larger question and determine the cell autonomous role for GPI-APs in NCC development.

Table 2. RNA Sequencing ToppGene Pathway Enrichment Analysis.

107

Table 3. Anterior/Posterior Transcription Factors Differentially Expressed in Clpex Mutants Compared to Controls.

A Anterior TFs TPM

Gene Log2 FC P-value WT Clpex Myt1 -1.09 9.63E-09 4.84 2.05 Lhx8 -1.56 0.004589 1.95 0.59 Lhx2 -0.70 9.73E-05 34.96 19.48 Alx3 -0.71 0.001724 18.68 10.36 Nkx2-4 -2.37 0.009815 1.89 0.31

B Posterior TFs TPM

Gene Log2 FC P-value WT Clpex Cdx2 1.89 0 4 13.53 Cdx4 2.04 0 3.21 12.12 Evx1 1.60 3.14E-08 1.06 2.97 Hoxc10 1.12 8.57E-11 10.01 19.83 Hoxd11 1.07 1.69E-06 2.43 4.59

Nkx1-2 1.77 2.50E-12 1.97 6.13

Tbxt 1.69 0 3.35 9.89

108

NCC-specific deletion of Piga completely abolishes GPI biosynthesis and leads to median cleft lip, cleft palate, and craniofacial skeletal hypoplasia

We observed cell type specific apoptosis in the cNCCs in the Clpex mutant and to further our understanding we sought to determine the cell autonomous role of GPI biosynthesis more generally in these cells. Phosphatidylinositol glycan anchor biosynthesis, class A

(Piga) is part of the GPI-N-acetylglucosaminyltransferase complex that initiates GPI biosynthesis from phosphatidylinositol and N-acetylglucosamine [1]. Piga is totally required for the biosynthesis of all GPI anchors and Piga deletion totally abolishes GPI biosynthesis [11, 58, 59]. We first performed RNA whole mount in situ hybridization for

Piga and showed it has a similar regionalized expression as we observed in the Pgap2 expression experiments. Piga expression at E11.5 is enriched in the first branchial arch, heart, limb, and CNS (representative images from n=8 antisense and 2 sense controls over 3 separate experiments) (Fig. 8A-F). However, Piga showed a unique enrichment in the medial aspect of both medial nasal processes as opposed to the Pgap2 expression which appeared to line the nasal pit epithelium. Other GPI biosynthesis genes showed a similar regionalization pattern of expression (Fig. S4).

109

Figure 8. Piga expression. Piga is expressed in the first branchial arch, medial nasal process, limb bud and deletion of Piga in the Wnt1-Cre lineage results in NCC cells that lack GPI biosynthesis. WMISH of WT E11.5 embryo stained with αsense Piga probe (A, C, E) or sense Piga probe (B, D, E). FLAER flow cytometry staining of WT (orange, blue) and Piga hemizygous cKO MPNMCs (green). FLAER quantified (H). Fb=Forebrain, Mb=Midbrain, BA1=Branchial Arch 1, MNP=Medial Nasal Process, Lb= Limb bud. **=p<0.001.

110

To determine the NCC specific role for GPI biosynthesis we generated a novel model of tissue-specific GPI deficiency in the neural crest cell lineage with Pigaflox/X; Wnt1-Cre mosaic conditional KO (cKO) mutants and Pigaflox/Y; Wnt1-Cre hemizygous cKO mutants.

To confirm the loss of GPI biosynthesis in these mutants, we cultured Mouse Palatal and

Nasal Mesenchymal Cells (MPNMCs) from WT and mutant palates and performed

FLAER staining as above. We found mutant MPMNCs lack virtually all GPI anchors on the cell surface (n=4 WT and 3 Mutant cell lines stained in two separate experiments)

(Fig. 8 G, H).

Analysis of mosaic cKOs at E15.5-16.5 showed mild median cleft lip and cleft palate in all mutants examined (n=6 mutants; Fig. 9A-F). Hemizygous cKOs showed a more severe median cleft lip and cleft palate in all mutants examined (n=7 mutants; Fig. 8G-L).

Skeletal preparations to highlight bone and cartilage demonstrates hypoplasia of the craniofacial skeleton, cleft palate (n=5/5 mutants examined; Fig. 9M-R).

These data confirm for the first time a cell autonomous role for GPI biosynthesis in cNCCs during development. As we reduced the amount of Piga from the mosaic cKO to the hemizygous cKO, we observed a worsening of the cleft lip/palate phenotype including more severe hypoplasia of the palatal shelves and widening of the median cleft lip. These data are consistent with the hypothesis that the dosage of GPI biosynthesis is related to the severity of the phenotype with mutants with less residual GPI anchor expression showing more severe phenotypes. Surprisingly, we found hemizygous cKO mutants are capable of forming all the bones and cartilage of the craniofacial skeleton, though they are all hypoplastic.

111

These data are consistent with the hypothesis that GPI biosynthesis is involved in the survival of early cNCCs as we observed in the Clpex homozygous mutants and not in the later patterning or differentiation of cNCCs. The critical requirement for GPI biosynthesis appears to be at early stages of cNCC survival just after they have migrated from the dorsal neural tube, and before they have committed to differentiation to bone or cartilage.

112

Figure 9. Conditional knockout of Piga abolishes GPI biosynthesis in NCCs and leads to craniofacial phenotypes. Whole mount images of E15.5 WT (A), mosaic Piga cKO (D), E16.5 WT (G) and hemizygous Piga cKO (J). Ventral view of the secondary palate of E15.5 WT (B), Mosaic cKO (E), E16.5 WT (H) and hemizygous cKO (K). H&E staining of E15.5 WT (C), mosaic cKO (F), E16.5 WT (I), and hemizygous cKO (L), arrowhead indicates cleft palate. Alazarin red and alcian blue staining of E16.5 WT skull (M-O) and hemizygous Piga cKO skull (P-R). Asterix indicates cleft palate. Fr=Frontal bone, Pa = Parietal bone, iPa= interparietal bone, Zy=Zygomatic bone, Mn=Mandible, pMx= Premaxilla, Nas= Nasal bone. Scale bar indica in M-R.

113

Discussion

In this study we aimed to determine the role of GPI biosynthesis in craniofacial development with two novel models of GPI deficiency. First, we characterized the phenotype of the ENU-induced Clpex allele which shows partially penetrant cranial neural tube defects, bilateral cleft lip/palate, and edema. We found by mapping and whole exome sequencing the Clpex mutation is a homozygous missense allele in the initiating methionine of Pgap2, the final enzyme in the GPI biosynthesis pathway. The Clpex allele failed to complement a null allele of Pgap2, confirming the Clpex mutant is caused by a hypomorphic mutation in Pgap2. By expression analysis with a Pgap2tm1a (lacZ) reporter allele, we found Pgap2 is enriched in the first branchial arch, limb bud, neuroepthelium and around the interior aspect of the nasal pits during lip closure at E9.5-E11.5. In later stages of organogenesis, Pgap2 is widely expressed and enriched in epithelia. These data argue expression of GPI biosynthesis genes is dynamic during development and not simply uniform and ubiquitous. FLAER flow cytometry and expression of a tagged

FOLR1A showed that reduced levels of Pgap2 affected GPI biosynthesis, though not as severely as a total knockout for the GPI biosynthesis pathway, PIGA-/-. Molecular analysis showed the Clpex mutants have increased apoptosis in cNCCs and cranial neuroepithelium. Folinic acid diet supplementation in utero partially rescued this apoptosis and the cleft lip in Clpex mutants. Finally, we generated a NCC tissue specific

GPI deficient model to determine the cell autonomous role of GPI biosynthesis. Pigaflox/X;

Wnt1-Cre mosaic cKO mutants and Pigaflox/Y; Wnt1-Cre hemizygous cKO mutants displayed fully penetrant median cleft lip/cleft palate and craniofacial hypoplasia similar

114 to our germline Clpex mutant, confirming a cell autonomous role for GPI biosynthesis in craniofacial development.

Contrary to previous studies of other GPI biosynthesis pathway genes, we found Pgap2 clearly shows enriched expression in certain tissues during certain stages of development. We observed a similar pattern in Piga RNA expression suggesting GPI biosynthesis genes share similar gene enrichment domains. These tissues are the most affected in GPI biosynthesis mouse mutants and include the craniofacial complex, CNS, limb, and heart. This may mean Pgap2 and other GPI biosynthesis genes are required in certain tissues for anchoring GPI-APs critical to that tissue. Alternatively, these areas may be particularly “GPI-rich.”

A variety of mutants have been described in the GPI biosynthesis pathway with a wide array of phenotypes [1, 4]. While germline mutants in this pathway remain poorly understood, recent research in Paroxysmal Nocturnal Hemoglobinuria (PNH) caused by somatic mutations in PIGA has revolutionized our understanding of GPI deficiency related pathology. In PNH, clones of GPI deficient hematopoietic stem cells proliferate in the bone marrow and give rise to blood cells that lack GPI-anchored CD55/59 which are required to prevent complement-mediated lysis of red blood cells. PNH patients suffer from episodes of hemolysis and thrombosis which can be deadly [60]. Blockade of complement in these patients via eculizumab, a monoclonal antibody that inhibits the conversion of C5 to C5a, has been shown to greatly improve survival [61-64]. Thus, a single GPI-AP seems to be largely responsible for the disease observed in these patients.

In this study we aimed to identify a single GPI-AP that could be responsible for all the phenotypes observed in our germline GPI biosynthesis Clpex mutant. Of the known GPI-

115

AP knockout models, Clpex shares the most phenotypic overlap with the Folr1-/- mouse.

We directly tested the hypothesis that FOLR1 deficiency is solely responsible for the

Clpex phenotype by dietary supplementation of folinic acid during embryonic development. To our surprise, folinic acid supplementation could partially rescue the cleft lip phenotype but not the NTD or cleft palate (Fig. 6C,D). These data also argue high dose folinic acid in utero may be a possible therapeutic for some phenotypes in patients with GPI biosynthesis variants. Further research is required to test whether the positive effect of folinic acid on the Clpex mutants could be observed in other GPI biosynthesis mutants. These data also argue the phenotypes observed in germline Clpex mutants do not share a single mechanism and are not due to the loss of a single GPI-AP. Given the varied response in different tissues to the rescue regimens utilized here, it is likely loss of different GPI-

Many GPI-APs could be responsible for the phenotypes we observe in the Clpex mutant but were not tested explicitly in this work. Notably, the two receptors for Glial Derived

Neurotrophic Factor (GDNF) are GPI- anchored (GFRA1, GFRA2). GFRA1 and GFRA2 are known to be critical for the survival and development of NCCs in the gut during enteric nervous system development [65-67] Interestingly, Gfra1and 2 are expressed in the craniofacial complex during development [68, 69]. Whether GDNF plays a crucial in cNCC survival remains to be explored. Other candidate GPI-APs that may be affected by loss of Pgap2 include one form of Neural Cell Adhesion Molecule (NCAM), a critical neural cell adhesion. NCAM-/- mice display defects in neural tube development including kinking and delayed closure [70]. A third candidate includes the glypican family members which are GPI anchored heparin sulfate proteoglycans that play critical roles in cell-cell signaling

116 and have been shown to modulate critical patterning gradients in the neural tube and face including Sonic Hedgehog and Wnt [71-74]. Other GPI-AP knockout models display NTDs including Repulsive guidance molecule A/B (Rgma) and Ephrin A5 (Efna5). However,

Rgma-/- mice do not develop increased apoptosis in the neuroepithelium as observed in

Clpex mutants [75]. Efna5-/- mice appear to form DLHPs though the neural folds do not fuse in the midline which is less severe than the defect we observe in Clpex mutants [22].

Therefore, we find it unlikely the loss of these GPI-APs are primarily responsible for the defects observed in the Clpex mutant although contributions to the phenotype may come from abnormal presentation of one or several of these GPI-Aps on the cellular membranes.

It has been known for decades that treatment of embryos with phospholipase C to release

GPI-APs from the cell surface causes NTD in utero [76]. To investigate the cause of the

NTD in Clpex mutants, we performed histological and immunohistochemical analysis of the mutant at neurulation stages. We found the Clpex mutant fails to form dorsolateral hinge points and the cranial neuroepithelium is apoptotic in the region of the developing

DLHP. Neuroepithelial apoptosis was restricted to the midbrain/hindbrain boundary and likely explains why Clpex mutants develop cranial NTDs as opposed to caudal NTDs such as spina bifida. These cellular defects likely underlie the NTD but the cause of the neuroepithelial apoptosis remains unclear as the NTD did not respond to folinic acid supplementation. It remains controversial, but the NTD in Folr1-/- mice may be related to an expansion of the Shh signaling domain that patterns the neural tube [36, 77]. Indeed, many Shh gain-of-function mutants develop NTD as Shh expansion impairs the formation of DLHPs and closure of the neural tube [77]. Our RNA sequencing analysis did not

117 identify a dysregulation in the Shh signaling pathway so there are likely differences in the mechanism responsible for the NTD in Folr1-/- mice and Clpex mutants.

To determine alternative mechanisms responsible for the Clpex phenotype, we performed

RNA sequencing from E9.5 WT and Clpex mutants. We found the largest differences in gene expression were in A/P patterning genes and mesendoderm induction genes. The

A/P axis and induction of mesendoderm has been shown to require GPI-anchored

CRIPTO, a Tgfβ superfamily member co-receptor of NODAL. A variety of studies have shown CRIPTO/Tgfβsuper family members pathway function is impaired in GPI biosynthesis mutants because CRIPTO is GPI-anchored and cleavage of the anchor affects CRIPTO function [10, 52].

While GPI deficiency has been studied in the context of A/P patterning, this is the first study to implicate GPI biosynthesis in the survival of neural crest cells in a cell autonomous fashion. Indeed, the enrichment of Piga in the developing medial nasal process and the median cleft lip/cleft palate and craniofacial hypoplasia in our Piga cKOs confirms a unique cell autonomous role for GPI biosynthesis in these structures.

Interestingly, these mutants do not show a complete loss of the craniofacial skeleton, rather a general, mild hypoplasia consistent with a role for GPI biosynthesis in early NCC survival, but not later patterning or differentiation.

Our study provides potential mechanistic explanations for the developmental defects observed in a GPI biosynthesis mutant model. We propose GPI biosynthesis is involved in anchoring critical survival factors for NCCs and the neuroepithelium. In GPI deficient

118 states, NCCs undergo apoptosis leading to hypoplastic nasal processes and palatal shelves. As we reduced the degree of GPI biosynthesis from the germline Clpex mutant hypomorph to our totally GPI deficient NCC cKO model, we observed a worsening of the craniofacial phenotype as witnessed by the fully penetrant cleft lip/cleft palate and craniofacial hypoplasia. These data argue the degree of GPI deficiency correlates with the severity of the phenotype. In the neuroepithelium, loss of neuroepithelial cells at the

DLHPs result in failure to bend and close the neural tube. Conditional ablations of critical

GPI biosynthesis genes in other affected tissues including the CNS and heart will likely lead to new understandings of the diverse pathology of inherited glycophosphatidylinositol deficiency.

Materials and Methods

Animal husbandry

All animals were maintained through a protocol approved by the Cincinnati Children’s

Hospital Medical Center IACUC committee (IACUC2016-0098). Mice were housed in a vivarium with a 12-h light cycle with food and water ad libitum. The Clpex line was previously published by Stottmann et. al. [9]. Pigaflox (B6.129-Pigatm1) mice were obtained from RIKEN and previous were previously generated by Taroh Kinoshita and Junji

Takeda [11]. Wnt1-Cre (B6.Cg-H2afvTg(Wnt1-cre)11RthTg(Wnt1-GAL4)11Rth/J) mice and R26R LacZ reporter (B6.129S4 Gt(ROSA)26Sortm1Sor/J; R26RTg) mice were purchased from Jackson

Laboratories and previously published. Pgap2null (Pgap2tm1a(EUCOMM)Wtsi) mice were obtained from EUCOMM and genotyped using their suggested primers. Primers used to genotype all animals are listed in Table S1. Sample2Snp custom Taqman probes were designed by Thermo-Fisher and used to genotype the point mutation in the Clpex line.

119

Mapping and Sequencing

Mapping of the Clpex mutation was previously described [9]. Whole exome sequencing was done at the CCHMC DNA Sequencing and Genotyping Core. The Pgap2 exon 3 variant was Sanger sequenced using the Zymo DNA clean & Concentrator kit (Zymo

Research Corporation, Irvine, CA).

Whole Mount In Situ Hybridization

RNA in situ hybridization was performed as previously described [78]. Briefly, whole E8-

E11.5 embryos were fixed overnight in 4% PFA at 4°C and dehydrated through a

-13 minutes at room temperature, post-fixed in 4% PFA/0.2% glutaraldehyde and blocked with hybridization buffer prior to hybridization overnight at 65°C with constant agitation. The samples were washed and incubated with an anti-Dig antibody (Roche #11093274910) o/n at 4°C. Embryos were washed and incubated with NBT/BCIP (SIGMA) or BM Purple

(Roche #11442074001) from 4 hours at room temperature to o/n at 4°C .

Piga (#MR222212), Pgap2 (#MR2031890) Pigp (#MR216742), Pigu (#MR223670), Pigx

(#MR201059), Lhx8 (#MR226908), and Tbxt (#MR223752) plasmids were obtained from

Origene (Rockville, MD). Antisense probes were generated from PCR products containing T3 overhangs. Piga, Pgap2, Pigp, Pigu, Pigx, Lhx8, and Tbxt antisense probes were generated from 910, 750, 556, 952, and 416, 519, and 665 base pair products, respectively. The PCR products were purified, in vitro transcription was performed with digoxigenin-labeled dUTP (Roche #11277073910), and the probe was purified with the MEGAclear Transcription Clean-up kit (Thermo #AM1908) per the manufacturer’s instructions. For sense probes, the plasmids were cut with XhoI restriction

120 enzyme after the coding sequence and T7 RNA polymerase was used for in vitro transcription. The Alx3 probe was generated by in vitro transcription of a 790bp PCR product from Alx3 plasmid (DNASU #MmCD00081160) containing T3 overhangs.

MEF/MPNMC production and FLAER staining

MEFs were generated from E13.5 embryos. Embryos were dissected in PBS, decapitated, and eviscerated. The remaining tissue was incubated in trypsin o/n at 4°C to allow for enzymatic action on the tissue and remaining fibroblasts were passaged in complete DMEM containing 10%FBS and penicillin/streptomycin. MEFs were stained

Alexafluor-488 proaerolysin (FLAER)/1x106 cells (CedarLane Labs, Burlington, Ontario,

Canada) and flow cytometry was performed on Becton-Dickinson FACSCanto II flow cytometer in the CCHMC Research flow cytometry core. Mouse Palatal Nasal

Mesenchymal Cells (MPNMCs) were generated from E13.5-E14.5 microdissected embryo heads in a protocol similar to that used for MEPMS [79]. The lower jaw, eyes and brain were removed and the remaining upper jaw and nasal mesenchyme were lysed in

0.25% trypsin for 10 min at 37°C, passaged through a P1000 pipette several times to create a single cell suspension, and cultured in 12 well plates. These cells displayed a stellate mesenchymal cell appearance after culture overnight. They were then stained after 72 hours from isolation with FLAER.

CRISPR Knockout/Knock-in gene editing

We utilized a double guide approach to generate knockout clones with deletions in

PGAP2 and PIGA in HEK293T cells. Two small guide RNAs targeting exon 3 of either

121

PGAP2 or PIGA were designed using Benchling software (Benchling, San Francisco, CA) and 5’ overhangs were added for cloning into CRISPR/Cas9 PX459M2 puromycin- resistance vector [80]. We also generated a single gRNA and donor oligonucleotide for homologous recombination to recapitulate the Clpex mutation in 293T cells (Integrated

DNA Technologies ultramer). We cloned these guides into the PX459M2 plasmid using the one-step digestion-ligation with BbsI enzyme as described by Ran et. al. [81]. Two guides per gene were transfected in WT 293T cells using Lipofectamine 3000 and cells

cells were plated at clonal density into a 96 well plate and single clones were scored approximately one week post seeding. Single clones were Sanger sequenced to confirm deletion of the target exon 3 sequence of either PIGA or PGAP2. PIGA clones carry a

50bp out-of-frame deletion in PIGA and lack virtually all GPI expression on the cell surface by FLAER flow cytometry staining. PGAP2 clones carry a 121bp out-of-frame deletion in

PGAP2. Clpex Knock-in clones were Sanger sequenced to identify clones carrying the desired knock-in mutation and clones with indels were discarded. Primers for sgRNA cloning and PCR amplification of targeted regions can be found in Table S1. Sequencing of clones is presented in Fig. S1.

Immunofluorescence

293T cells were transfected with FOLR1-myc constructs (Origene #RC212291using

Lipofectamine 3000, incubated for 48 hours, then fixed for 15 min in 4% PFA, and blocked in 4% normal goat serum. They were stained o/n at 4°C with 1:500 rabbit anti-myc (Abcam ab9106), washed the next day and stained with 1:500 488-congugated goat anti-rabbit

122

(Thermo Fischer #W21405) and counter-stained with DAPI. They were visualized on a

Zeiss widefield microscope

E9.5 embryos were dissected, fixed in 4% PFA o/n, equilibrated in 30% sucrose o/n, cryo- embedded in OCT, and sectioned from 10- ctions were subjected to antigen retrieval by citrate retrieval buffer, blocked in 4% normal goat serum, incubated in primary antibody 1:20 mouse anti-AP2 (Developmental Studies Hybridoma Bank,

University of Iowa, 3B5 supernatant) and 1:300 rabbit anti-Cleaved Caspase 3 (Cell

Signaling Technology, Danvers, MA #9661) o/n in humid chamber. Sections were incubated with secondary antibody 1:1000 Alexafluor 488-congugated goat anti-rabbit

(Thermo #A11008) and 1:1000 Alexafluor 594 conjugated goat anti-mouse (Thermo

A11008) and counterstained with DAPI. Sections were imaged on Nikon C2 confocal microscope and CC3+ cells and AP2+ cells were quantified with Nikon Elements software brightspot analysis.

Western blotting

293T cells were transfected with FOLR1-myc constructs using Lipofectamine 3000, incubated for 48 hours and lysed in RIPA buffer containing Protease Inhibitor cocktail

(Roche #11697498001). Lysate protein concentration was determined by BCA assay and electrophoresis was performed on a 10% Tris-glycine gel. Protein was transferred to a

PVDF membrane, blocked in Odyssey blocking buffer and incubated o/n at 4°C with

1:1000 Rabbit anti-myc (abcam ab9106) and 1:1000 Mouse anti-Tubulin (Sigma #T6199) antibodies). Membranes were washed and incubated for 1 hour in 1:15000 goat anti-

123 rabbit IRDye 800CW (LICOR # 926-32211)and 1:15000 goat anti-mouse IRDye 680Rd

(LICOR, #926-68070) and visualized on LICOR Odyssey imaging system.

Nile Blue Sulfate Viability Stain

E9.5 embryos were dissected in PBS and placed immediately into 10ml of complete

DMEM containing 50ul of 1.5% Nile blue stock solution (Sigma #N5632-25G) for 30 minutes at 37°C to allow for uptake of the dye. They were then washed for 1 hour in PBS at 4°C and immediately visualized.

Histology

Whole embryos E8-E16.5 were fixed in formalin and embedded in paraffin for coronal sectioning and stained with hematoxylin and eosin using standard methods.

NCC lineage trace and Xgal staining

Clpex heterozygous females were crossed to Wnt1-Cre R26R transgenic mice as described in results. Whole embryos were fixed in 4% PFA for 15 minutes at RT, washed in lacZ buffer, and stained in a solution containing 1mg/mL X-gal (Sigma #B4252) [82].

They were washed 3 times in PBS-T and imaged after several hours in X-gal stain at room temperature.

Diet

Clpex pregnant dams were treated with either control chow, chow + 25ppm folic acid, or chow + 25ppm folinic acid generated by Envigo (Indianapolis, Indiana) from E0-E16.5 ad libitum. They were euthanized at either E9.5 or E16.5 to assess phenotype

124

RNA Sequencing

5 WT and 5 Clpex mutant E9.5 embryos were snap frozen on dry ice. RNA was isolated and pooled samples of each genotype were used for paired-end bulk-RNA sequencing

(BGI-Americas, Cambridge, MA). RNA-Seq analysis pipeline steps were performed using

CSBB [Computational Suite for Bioinformaticians and Biologists: https://github.com/csbbcompbio/CSBB-v3.0]. CSBB has multiple modules, RNA-Seq module is focused on carrying out analysis steps on sequencing data, which comprises of quality check, alignment, quantification and generating mapped read visualization files.

Quality check of the sequencing reads was performed using FASTQC

(http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc). RNA-Seq reads for the mutant and wildtype were paired-end and had ~43 and ~31 million reads respectively. Reads were mapped (to mm10 version of Mouse genome) and quantified using RSEM-v1.3.0

[83].Differential expression analysis was carried out by EBSeq

[https://www.biostat.wisc.edu/~kendzior/EBSEQ/] [84]. Differential transcripts are filtered based on LogFC and p-value. Filtered DE transcripts are used for functional and pathway enrichment using toppgene [https://toppgene.cchmc.org/] [41].

Skeletal Preparation

For skeletal preparation, E16.5-E18.5 embryos were eviscerated and fixed for 2 days in

95% ethanol. They were stained overnight at room temperature in Alcian blue solution

(Sigma #A3157) containing 20% glacial acetic acid. They were destained for 24 hours in

95% ethanol and slightly cleared in a 1% KOH solution o/n at room temperature. They were then stained o/n in Alazarin red solution (Sigma #A5533) containing 1% KOH. They

125 were then cleared for 24 hours in 20% glycerol/1%KOH solution. Finally, they were transferred to 50% glycerol/50% ethanol for photographing.

Barrier Function assay

E18.5 embryos were dehydrated through a methanol series and then rehydrated. Next, they were placed in 0.1% Toludine Blue (Sigma #89640) in water for 2 minutes on ice.

They were destained in PBS on ice and imaged.

Statistical Analysis

Statistical analysis was performed using Graphpad Prism (GraphPad Software, San

Diego, CA). All tests but diet results were unpaired, two-tailed t-tests and significance was labelled with one asterix=p<0.05 and two asterix= p<0.001. For statistical analysis of phenotypes observed for embryos under varying diet conditions, z-test of proportions was used.

ACKNOWLEDGEMENTS. This works was supported by the Cincinnati Children’s

Research Foundation, NIH (R.W.S. R01NS085023) and the American Cleft Palate -

Craniofacial Association (Paul W. Black, MD Grant for Emerging Researchers to M.J.L.).

AUTHOR CONTRIBUTIONS. M.L., T.R., P.C., R.W.S. generated and analyzed the data.

M.L. and R.W.S. conceived, designed, and wrote the study.

126

Table S1. Primers

127

Figure S1. Generation of CRISPR-mediated cell lines. Sanger sequencing of PIGA-/- clone and WT parental line (A). PCR product of PIGA exon 3 from WT, heterozygous, and KO single clonal lines showing a homozygous 29bp deletion in PIGA exon 3 (B). Sanger sequencing of PGAP2-/- clone and WT parental line showing a 121bp homozygous deletion in PGAP2 exon 3 (C). PCR product of PGAP2 exon 3 from WT, heterozygous, and KO single clonal lines (D). Sanger sequencing of Clpex Knock-in clone and WT parental line with highlighlighted A>G mutation in Clpex line(E). PCR product of PGAP2 exon 3 from WT and Knock-in single clones (F).

128

Figure S2. Clpex mutants are not defective at barrier formation. Toluidine blue barrier assay in WT (A), Clpex cleft palate mutant (B), Clpex Cleft lip/palate mutant (C), and Clpex NTD mutant (D).

Figure S3. Anterior/Posterior patterning defects in Clpex mutants. Whole mount in situ hibridization for anterior marker Alx3 in WT and Mut (A-D). Whole mount in situ hibridization for anterior marker Lhx8 in WT and Mut (E, F). Whole mount in situ hibridization for posterior marker Tbxt in WT and Mut (G-J).

129

Figure S4. Embryonic expression of GPI biosynthesis genes. Whole mount in situ hybridizaiton of WT E11.5 embryos with αsense probes to Pigp (A, B), Pigu (C,D), and Pigx (E,F). Sense probe control in situ hybridization for Pigp (G,H), Pigu (I,J), and Pigx (K,L).

130

References

1. Kinoshita, T., Biosynthesis and deficiencies of glycosylphosphatidylinositol. Proc Jpn Acad Ser B Phys Biol Sci, 2014. 90(4): p. 130-43. 2. Knaus, A., et al., Characterization of glycosylphosphatidylinositol biosynthesis defects by clinical features, flow cytometry, and automated image analysis. Genome Med, 2018. 10(1): p. 3. 3. Tarailo-Graovac, M., et al., The genotypic and phenotypic spectrum of PIGA deficiency. Orphanet J Rare Dis, 2015. 10: p. 23. 4. Bellai-Dussault, K., et al., Clinical variability in inherited glycosylphosphatidylinositol deficiency disorders. Clin Genet, 2018. 5. Hansen, L., et al., Hypomorphic mutations in PGAP2, encoding a GPI-anchor- remodeling protein, cause autosomal-recessive intellectual disability. Am J Hum Genet, 2013. 92(4): p. 575-83. 6. Jezela-Stanek, A., et al., Congenital disorder of glycosylphosphatidylinositol (GPI)- anchor biosynthesis--The phenotype of two patients with novel mutations in the PIGN and PGAP2 genes. Eur J Paediatr Neurol, 2016. 20(3): p. 462-73. 7. Krawitz, P.M., et al., PGAP2 mutations, affecting the GPI-anchor-synthesis pathway, cause hyperphosphatasia with mental retardation syndrome. Am J Hum Genet, 2013. 92(4): p. 584-9. 8. Naseer, M.I., et al., A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family. J Neurol Sci, 2016. 371: p. 121-125. 9. Stottmann, R.W., et al., Focusing forward genetics: a tripartite ENU screen for neurodevelopmental mutations in the mouse. Genetics, 2011. 188(3): p. 615-24. 10. McKean, D.M. and L. Niswander, Defects in GPI biosynthesis perturb Cripto signaling during forebrain development in two new mouse models of holoprosencephaly. Biol Open, 2012. 1(9): p. 874-83. 11. Nozaki, M., et al., Developmental abnormalities of glycosylphosphatidylinositol- anchor-deficient embryos revealed by Cre/loxP system. Lab Invest, 1999. 79(3): p. 293-9. 12. Mohun, T., et al., Deciphering the Mechanisms of Developmental Disorders (DMDD): a new programme for phenotyping embryonic lethal mice. Dis Model Mech, 2013. 6(3): p. 562-6. 13. Zoltewicz, J.S., et al., oto is a homeotic locus with a role in anteroposterior development that is partially redundant with Lim1. Development, 1999. 126(22): p. 5085-95. 14. Nakano, Y., et al., Biogenesis of GPI-anchored proteins is essential for surface expression of sodium channels in zebrafish Rohon-Beard neurons to respond to mechanosensory stimulation. Development, 2010. 137(10): p. 1689-98. 15. Budirahardja, Y., T.D. Doan, and R. Zaidel-Bar, Glycosyl phosphatidylinositol anchor biosynthesis is essential for maintaining epithelial integrity during Caenorhabditis elegans embryogenesis. PLoS Genet, 2015. 11(3): p. e1005082. 16. Tashima, Y., et al., PGAP2 is essential for correct processing and stable expression of GPI-anchored proteins. Mol Biol Cell, 2006. 17(3): p. 1410-20.

131

17. Johnston, J.J., et al., The phenotype of a germline mutation in PIGA: the gene somatically mutated in paroxysmal nocturnal hemoglobinuria. Am J Hum Genet, 2012. 90(2): p. 295-300. 18. UniProt Consortium, T., UniProt: the universal protein knowledgebase. Nucleic Acids Res, 2018. 46(5): p. 2699. 19. Smith, C.L., et al., Mouse Genome Database (MGD)-2018: knowledgebase for the laboratory mouse. Nucleic Acids Res, 2018. 46(D1): p. D836-D842. 20. Piedrahita, J.A., et al., Mice lacking the folic acid-binding protein Folbp1 are defective in early embryonic development. Nat Genet, 1999. 23(2): p. 228-32. 21. Santiago, A. and C.A. Erickson, Ephrin-B ligands play a dual role in the control of neural crest cell migration. Development, 2002. 129(15): p. 3621-32. 22. Holmberg, J., D.L. Clarke, and J. Frisen, Regulation of repulsion versus adhesion by different splice forms of an Eph receptor. Nature, 2000. 408(6809): p. 203-6. 23. Li, J., et al., Xenopus reduced folate carrier regulates neural crest development epigenetically. PLoS One, 2011. 6(11): p. e27198. 24. Rosenquist, T.H., Folate, homocysteine and the cardiac neural crest. Dev Dyn, 2013. 242(3): p. 201-18. 25. Rosenquist, T.H., et al., High-affinity folate receptor in cardiac neural crest migration: a gene knockdown model using siRNA. Dev Dyn, 2010. 239(4): p. 1136- 44. 26. Spiegelstein, O., et al., Embryonic development of folate binding protein-1 (Folbp1) knockout mice: Effects of the chemical form, dose, and timing of maternal folate supplementation. Dev Dyn, 2004. 231(1): p. 221-31. 27. Tang, L.S., et al., Developmental consequences of abnormal folate transport during murine heart morphogenesis. Birth Defects Res A Clin Mol Teratol, 2004. 70(7): p. 449-58. 28. Zhu, H., et al., Cardiovascular abnormalities in Folr1 knockout mice and folate rescue. Birth Defects Res A Clin Mol Teratol, 2007. 79(4): p. 257-68. 29. Wahl, S.E., et al., The role of folate metabolism in orofacial development and clefting. Dev Biol, 2015. 405(1): p. 108-22. 30. Brewer, S., et al., Wnt1-Cre-mediated deletion of AP-2alpha causes multiple neural crest-related defects. Dev Biol, 2004. 267(1): p. 135-52. 31. Chai, Y., et al., Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development, 2000. 127(8): p. 1671-9. 32. Soriano, P., Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet, 1999. 21(1): p. 70-1. 33. Brault, V., et al., Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development, 2001. 128(8): p. 1253-64. 34. Danielian, P.S., et al., Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr Biol, 1998. 8(24): p. 1323-6. 35. Ingraham, C.R., et al., Abnormal skin, limb and craniofacial morphogenesis in mice deficient for interferon regulatory factor 6 (Irf6). Nat Genet, 2006. 38(11): p. 1335- 40. 36. Tang, L.S. and R.H. Finnell, Neural and orofacial defects in Folp1 knockout mice [corrected]. Birth Defects Res A Clin Mol Teratol, 2003. 67(4): p. 209-18.

132

37. Tang, L.S., et al., Role of Folbp1 in the regional regulation of apoptosis and cell proliferation in the developing neural tube and craniofacies. Am J Med Genet C Semin Med Genet, 2005. 135c(1): p. 48-58. 38. Zhao, R., et al., Rescue of embryonic lethality in reduced folate carrier-deficient mice by maternal folic acid supplementation reveals early neonatal failure of hematopoietic organs. J Biol Chem, 2001. 276(13): p. 10224-8. 39. Jansen, G. and G.J. Peters, Novel insights in folate receptors and transporters: implications for disease and treatment of immune diseases and cancer. Pteridines, 2015. 26(2): p. 41-53. 40. Jakubowski, H., et al., Genetic or nutritional disorders in homocysteine or folate metabolism increase protein N-homocysteinylation in mice. FASEB J, 2009. 23(6): p. 1721-7. 41. Chen, J., et al., ToppGene Suite for gene list enrichment analysis and candidate gene prioritization. Nucleic Acids Res, 2009. 37(Web Server issue): p. W305-11. 42. Savory, J.G., et al., Cdx2 regulation of posterior development through non-Hox targets. Development, 2009. 136(24): p. 4099-110. 43. Chawengsaksophak, K., et al., Cdx2 is essential for axial elongation in mouse development. Proc Natl Acad Sci U S A, 2004. 101(20): p. 7641-5. 44. van Nes, J., et al., The Cdx4 mutation affects axial development and reveals an essential role of Cdx genes in the ontogenesis of the placental labyrinth in mice. Development, 2006. 133(3): p. 419-28. 45. Abe, K., K. Yamamura, and M. Suzuki, Molecular and embryological characterization of a new transgene-induced null allele of mouse Brachyury locus. Mamm Genome, 2000. 11(3): p. 238-40. 46. Shedlovsky, A., T.R. King, and W.F. Dove, Saturation germ line mutagenesis of the murine t region including a lethal allele at the quaking locus. Proc Natl Acad Sci U S A, 1988. 85(1): p. 180-4. 47. Munroe, R.J., et al., Mouse H6 Homeobox 1 (Hmx1) mutations cause cranial abnormalities and reduced body mass. BMC Dev Biol, 2009. 9: p. 27. 48. Porter, F.D., et al., Lhx2, a LIM homeobox gene, is required for eye, forebrain, and definitive erythrocyte development. Development, 1997. 124(15): p. 2935-44. 49. Ando, H., et al., Lhx2 mediates the activity of Six3 in zebrafish forebrain growth. Dev Biol, 2005. 287(2): p. 456-68. 50. Lakhwani, S., P. Garcia-Sanz, and M. Vallejo, Alx3-deficient mice exhibit folic acid- resistant craniofacial midline and neural tube closure defects. Dev Biol, 2010. 344(2): p. 869-80. 51. Zhao, Y., et al., Isolated cleft palate in mice with a targeted mutation of the LIM homeobox gene lhx8. Proc Natl Acad Sci U S A, 1999. 96(26): p. 15002-6. 52. Chen, G., et al., Trophoblast differentiation defect in human embryonic stem cells lacking PIG-A and GPI-anchored cell-surface proteins. Cell Stem Cell, 2008. 2(4): p. 345-55. 53. Zoltewicz, J.S., et al., Wnt signaling is regulated by endoplasmic reticulum retention. PLoS One, 2009. 4(7): p. e6191. 54. Thomas, P. and R. Beddington, Anterior primitive endoderm may be responsible for patterning the anterior neural plate in the mouse embryo. Current Biology, 1996. 6(11): p. 1487-1496.

133

55. Rossant, J. and P.P.L. Tam, Blastocyst lineage formation, early embryonic asymmetries and axis patterning in the mouse. Development, 2009. 136(5): p. 701- 713. 56. Ahrens, M.J., et al., Convergent extension movements in growth plate chondrocytes require gpi-anchored cell surface proteins. Development, 2009. 136(20): p. 3463-74. 57. Tarutani, M., et al., Tissue-specific knockout of the mouse Pig-a gene reveals important roles for GPI-anchored proteins in skin development. Proc Natl Acad Sci U S A, 1997. 94(14): p. 7400-5. 58. Miyata, T., et al., The cloning of PIG-A, a component in the early step of GPI- anchor biosynthesis. Science, 1993. 259(5099): p. 1318-20. 59. Watanabe, R., et al., PIG-A and PIG-H, which participate in glycosylphosphatidylinositol anchor biosynthesis, from a protein complex in the endoplasmic reticulum. Journal of Biological Chemistry, 1996. 271(43): p. 26868- 26875. 60. Hill, A., et al., Paroxysmal nocturnal haemoglobinuria. Nat Rev Dis Primers, 2017. 3: p. 17028. 61. Brodsky, R.A., et al., Multicenter phase 3 study of the complement inhibitor eculizumab for the treatment of patients with paroxysmal nocturnal hemoglobinuria. Blood, 2008. 111(4): p. 1840-7. 62. Rother, R.P., et al., Discovery and development of the complement inhibitor eculizumab for the treatment of paroxysmal nocturnal hemoglobinuria. Nat Biotechnol, 2007. 25(11): p. 1256-64. 63. Hillmen, P., et al., Effect of the complement inhibitor eculizumab on thromboembolism in patients with paroxysmal nocturnal hemoglobinuria. Blood, 2007. 110(12): p. 4123-8. 64. Hillmen, P., et al., The complement inhibitor eculizumab in paroxysmal nocturnal hemoglobinuria. N Engl J Med, 2006. 355(12): p. 1233-43. 65. Tomac, A.C., et al., Glial cell line-derived neurotrophic factor receptor alpha1 availability regulates glial cell line-derived neurotrophic factor signaling: evidence from mice carrying one or two mutated alleles. Neuroscience, 2000. 95(4): p. 1011- 23. 66. Enomoto, H., et al., GFR alpha1-deficient mice have deficits in the enteric nervous system and kidneys. Neuron, 1998. 21(2): p. 317-24. 67. Rossi, J., et al., Retarded growth and deficits in the enteric and parasympathetic nervous system in mice lacking GFR alpha2, a functional neurturin receptor. Neuron, 1999. 22(2): p. 243-52. 68. Golden, J.P., et al., Expression of neurturin, GDNF, and their receptors in the adult mouse CNS. J Comp Neurol, 1998. 398(1): p. 139-50. 69. Visel, A., C. Thaller, and G. Eichele, GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res, 2004. 32(Database issue): p. D552-6. 70. Rabinowitz, J.E., U. Rutishauser, and T. Magnuson, Targeted mutation of Ncam to produce a secreted molecule results in a dominant embryonic lethality. Proc Natl Acad Sci U S A, 1996. 93(13): p. 6421-4.

134

71. Bassuk, A.G., et al., Copy number variation analysis implicates the cell polarity gene glypican 5 as a human spina bifida candidate gene. Hum Mol Genet, 2013. 22(6): p. 1097-111. 72. Capurro, M.I., et al., Glypican-3 inhibits Hedgehog signaling during development by competing with patched for Hedgehog binding. Dev Cell, 2008. 14(5): p. 700- 11. 73. Galli, A., et al., Glypican 4 modulates FGF signalling and regulates dorsoventral forebrain patterning in Xenopus embryos. Development, 2003. 130(20): p. 4919- 29. 74. Song, H.H. and J. Filmus, The role of glypicans in mammalian development. Biochim Biophys Acta, 2002. 1573(3): p. 241-6. 75. Niederkofler, V., et al., Repulsive guidance molecule (RGM) gene function is required for neural tube closure but not retinal topography in the mouse visual system. J Neurosci, 2004. 24(4): p. 808-18. 76. O'Shea, K.S. and M.H. Kaufman, Phospholipase C-induced neural tube defects in the mouse embryo. Experientia, 1980. 36(10): p. 1217-9. 77. Murdoch, J.N. and A.J. Copp, The relationship between sonic Hedgehog signaling, cilia, and neural tube defects. Birth Defects Res A Clin Mol Teratol, 2010. 88(8): p. 633-52. 78. Belo, J.A., et al., Cerberus-like is a secreted factor with neuralizing activity expressed in the anterior primitive endoderm of the mouse gastrula. Mechanisms of Development, 1997. 68(1-2): p. 45-57. 79. Fantauzzo, K.A. and P. Soriano, Generation of an immortalized mouse embryonic palatal mesenchyme cell line. PLoS One, 2017. 12(6): p. e0179078. 80. Ran, F.A., et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc, 2013. 8(11): p. 2281-2308. 81. Ran, F.A., et al., Genome engineering using the CRISPR-Cas9 system. Nature Protocols, 2013. 8(11): p. 2281-2308. 82. Behringer, R., Manipulating the mouse embryo : a laboratory manual. Fourth edition. ed. 2014, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. xxii, 814 pages. 83. Li, B. and C.N. Dewey, RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics, 2011. 12: p. 323. 84. Leng, N., et al., EBSeq: an empirical Bayes hierarchical model for inference in RNA-seq experiments. Bioinformatics, 2013. 29(8): p. 1035-43.

135

Chapter 3. CNS Glycosylphosphatidylinositol Deficiency Results in Delayed White Matter Development, Ataxia, and Premature Death in a Novel Mouse Model

Marshall Lukacs1, 2, Rolf W. Stottmann1, 2, 3, 4#

#author for correspondence [email protected]

136

Introduction

Inherited Glycosylphosphatidylinositol Deficiency (IGD) is defined by a deficiency of the cell surface glycosylphosphatidylinositol (GPI) anchor [1, 2]. The GPI anchor is a glycolipid that is added post translationally to nearly 150 proteins and is required for membrane anchoring and lipid raft trafficking of these proteins [1, 3]. Over twenty genes are required for the biosynthesis and remodeling of the GPI anchor in the endoplasmic reticulum and Golgi apparatus. IGD patients display a wide array of phenotypes including neural, craniofacial, cardiac, renal, hepatic, ophthalmologic, skeletal, dental, dermatologic, and sensorineural defects [1, 2, 4]. This wide array of phenotypes highlights the broad requirement for GPI biosynthesis and remodeling in the development of many organ systems.

A recent review of all IGD patients found that the most commonly affected organ system, regardless of the mutated gene in the GPI biosynthesis pathway, is the central nervous system (CNS) [2]. These defects include structural CNS defects including microcephaly, thin corpus callosum, small cerebellum, white matter immaturity, and cortical atrophy.

Clinical findings include epilepsy, developmental delay, intellectual disability, hypotonia, hyperreflexia, chorea, ataxia, and behavioral abnormalities with variable penetrance [2,

5-7]. EEG imaging reveals abnormal electrical activity including hypsarrythmia indicative of epileptic encephalopathy in the CNS in nearly all patients [2, 8, 9]. Often the epilepsy in these patients is intractable and severely impairs their quality of life. Some reports have shown Vitamin B6 is beneficial in treating IGD-related epilepsy. It has been hypothesized the benefit of Vitamin B6 is related to the defects in GPI-anchored tissue nonspecific alkaline phosphatase which dephosphorylates B6 and allows it to pass the membrane and

137 participate in in γ-aminobutyric acid (GABA) synthesis [10, 11]. However, it is unclear if all patients respond to Vitamin B6 supplementation and no rigorous study has tested this hypothesis mostly because mouse models of IGD are unavailable. Little is known about the requirement for GPI biosynthesis in the CNS or the mechanisms that lead to these clinical phenotypes. Therapy is currently limited to symptomatic treatment and most patients will die before age 5 by cardiac arrest, aspiration pneumonia, or central respiratory failure [12]. There is a clear need to understand the pathophysiology that results from GPI deficiency in the CNS.

The initiation of GPI biosynthesis requires Phosphatidylinositol Glycan Anchor

Biosynthesis Class A, Piga, a component of the phosphatidylinositol N- acetylglucosaminyltransferase complex. This complex generates N-acetylglucosamine- phosphatidylinositol (GlcNac-PI) by transferring N-acetylglucosamine (GlcNac) from

UDP-GlcNac to phosphatidylinositol (PI). GlcNac-PI is the first precursor in the biosynthesis of the GPI anchor and deletion of Piga completely abolishes GPI biosynthesis [1, 3]. Patients with germline mutations in Piga develop a form of IGD termed

Multiple Congenital Anomalies-Hypotonia-Seizures Syndrome 2 (MCAHS2: OMIM

300868) [13]. A recent review of MCAHS2 patients found 10/10 patients developed seizures, abnormal EEG findings, developmental delay and intellectual disability. 8/10 patients had hypotonia and 5/10 had hyperreflexia indicating CNS disease [12]. 7/10 patients developed white matter defects including thin corpus callosum and white matter immaturity. 5/10 patients displayed cerebellar hypoplasia and 5/10 developed cortical atrophy. Thus, Piga deficiency serves as a representative model to study the broad requirement for GPI biosynthesis in CNS development.

138

Other groups have taken a conditional approach to ablate GPI biosynthesis in specific tissues by combining a floxed allele of Piga with Cre recombinase under tissue specific promoters. This approach revealed an important role for GPI biosynthesis in skin, limb, and blood development [14-16]. However, germline knockout of Piga using CMV-Cre resulted in embryonic lethality with neural tube defect, edema, and cleft lip/palate precluding the analysis of the postnatal neurological phenotype [17]. To overcome this problem, we sought to conditionally ablate GPI biosynthesis after the closure of the neural tube, at embryonic day E9.5 in mouse. To completely abolish GPI biosynthesis at this stage, we chose to use Cre recombinase under the control of the rat Nestin promoter

(Nestin-Cre) combined with a conditional allele of Piga with flanking loxP sites (Pigaflox) to drive deletion of Piga broadly in the central and peripheral nervous system starting at

E11.5 [18]. As Piga resides on the X-chromosome, we generated Pigaflox/Y, Nes-Cre+ hemizygous cKO males (hemizygous cKO) with complete deletion of Piga in the Nestin lineage and Pigaflox/WT, Nes-Cre mosaic cKO females (mosaic cKO) containing one flox allele of Piga and one WT Piga allele. Due to random X inactivation, these females develop a mosaic cKO of Piga in the Nestin lineage. Both hemizygous cKO and mosaic cKO animals survived to postnatal stages and developed some of the CNS phenotypes observed in IGD patients including white matter immaturity, gait imbalance, motor incoordination, and early death. Our conditional knockout approach allowed us to investigate the requirement for GPI biosynthesis for the first time in vivo in the mammalian

CNS. We show GPI biosynthesis is critical for white matter and Purkinje cell development.

This model may also be used to test novel drugs to treat IGD in the future.

139

Materials and Methods

Animal Husbandry

All animals were maintained through a protocol approved by the Cincinnati Children’s

Hospital Medical Center IACUC committee (IACUC2016-0098). Mice were housed in a vivarium with a 12-h light cycle with food and water ad libitum. Pigaflox (B6.129-Pigatm1,

#RBRC06211) mice were obtained from RIKEN and previous were previously generated by Taroh Kinoshita and Junji Takeda [17]. Mice were genotyped for the Pigaflox allele using Riken’s three primer protocol. B6.Cg-Tg (Nes-cre) 1Kln/J Nestin-Cre mice were obtained from Jackson Laboratories and genotyped using Jackson lab recommended general Cre genotyping. Progeny of the Pigaflox x Nestin-Cre mice were kept alive as long as possible during testing and sacrificed when they became moribund (immobile) at approximately P20. Primers used for genotyping are available in Table S1.

In Situ Hybridization

Whole E11.5 embryos were fixed overnight in 4% PFA at 4°C and dehydrated through a methanol series. Samples were treated with 4.5ug/mL Proteinase K for 7-13 minutes at room temperature, post-fixed in 4% PFA/0.2% glutaraldehyde and blocked with hybridization buffer prior to hybridization overnight at 65°C with constant agitation. The samples were washed and incubated with an anti-Dig antibody (Roche #11093274910) o/n at 4°C. Embryos were washed and incubated with BM Purple (Roche #11442074001) from 4 hours at room temperature to o/n at 4°C.

140

Piga (#MR222212), plasmid was obtained from Origene (Rockville, MD). Antisense probes were generated from PCR products containing T3 overhangs. Piga antisense probe was generated from 910 base pair PCR product. Primers are listed in Table S1.

The PCR products were purified, in vitro transcription was performed with digoxigenin- labeled dUTP (Roche #11277073910), and the probe was purified with the MEGAclear

Transcription Clean-up kit (Thermo #AM1908) per the manufacturer’s instructions. For sense probes, the plasmids were cut with XhoI restriction enzyme after the coding sequence and T7 RNA polymerase was used for in vitro transcription.

PCR of brain regions

Mice were euthanized and brains were immediately dissected for tissue from a variety of brain regions including the cortex, cerebellum, and subcortical areas. Tail biopsies were taken as controls. Tissue was lysed in 50mM sodium hydroxide and boiled on a hot plate for fifteen minutes. The samples were then neutralized with 1M Tris and centrifuged. DNA was then used to complete PCR using a program with 60oCannealing temperature and

34 cycles of amplification for Piga flox allele genotyping and a program with

64oCannealing temperature with 34 cycles of amplification for Cre genotyping. Primers are available in Table S1.

Histology

Brains were dissected and fixed in 10% formalin for 24-48 hours, washed in 70% ethanol, and paraffin embedded by the CCHMC Pathology Core. Brains were sectioned by microtome at 10-20 µm and stained with hematoxylin & eosin using standard methods.

141

Weight

Litters were weighed individually every day using a standard metric balance from P1 to

P21.

Tail Suspension Test

P15-P18 mice were held by the tail for ten seconds in the air and their hindlimb posture was observed. The mice were given a score from 0-4. 4 indicates the normal hindlimb separation in which they are widely spread when suspended by the tail. Score of 3 means the hindlimbs are more vertical though they barely touch. Score of 2 means the hindlimbs are close and often touching, and 1 indicates profound weakness in which both hindlimbs are almost always clasped together. Score of 0 is given only if the hindlimbs are clasped for the entire ten seconds the mouse is suspended [19].

Righting Reflex

Postnatal day 7-8 mice were placed supine and the time to flip over onto their abdomens was measured in seconds and recorded as a latency to right themselves to a prone position [19]. Three trials were performed consecutively and each trial time was plotted.

Forelimb Wire Hang

Mice were placed on a thin wire suspended by their forelimbs over a padded drop zone.

The pups were placed on the wire such that the experimenter could observe their grip on the wire. The pups were then released and the time before they fell off the wire was measured in seconds and recorded as a latency to fall [19]. Three trials were performed in sequence and each trial latency to fall was plotted.

142

Rotarod

Rotarod was performed by the CCHMC Animal Behavior Core [20]. Researchers were blinded to the genotypes of the animals tested. Rotarod apparatus (San Diego

Instruments) was used with SDI software with the 4 to 40 RPM protocol for mice. The apparatus has four chambers and four mice were tested at the same time. The photobeam sensor detects and records the time and distance each mouse travels before falling from the rod. The test was allowed to run for 360 seconds. The test starts at 4RPM for 30 seconds and increases to 16RPM for 110 seconds, then 28RPM for 110 seconds, and finally 40RPM for 110 seconds. The latency to fall in seconds and distance traveled was recorded automatically and the mice were allowed to rest for 15 minutes before each successive trial. Four trials were performed sequentially on each mouse.

Immunohistochemistry

Immunohistochemistry was performed on formalin-fixed, paraffin embedded brain tissue harvested from P19 animals. Briefly, tissue was sectioned at 10-20µm, sections were blocked for one hour at room temperature in 4% normal goat serum in PBST, and incubated in primary antibody (1:500 chicken anti-mouse Myelin Basic Protein antibody,

Aves Inc., #MBP) overnight at 4°C. The next day, slides were washed in PBS, and incubated in 1:500 biotinylated goat anti-chicken antibody (Aves Inc., #B-1005) for one hour at room temperature. The slides were washed and incubated in ABC mix (Vectastain

ABC HRP Kit, #PK-4000) for 1 hour at room temperature. The slides were washed and developed in 0.5 mg/mL DAB (Sigma) activated with 30% hydrogen peroxide. Slides were incubated in DAB for approximately 5 minutes, washed in PBS, sealed with Cytoseal, and imaged by light microscopy.

143

Western Blotting

Brains were microdissected and the cortex and cerebellum were removed. Subcortical tissue was lysed in 800uL RIPA buffer+ Protease inhibitor. Lysate protein concentration was determined by BCA assay and electrophoresis was performed on a 10% Tris-glycine gel. Protein was transferred to a PVDF membrane, blocked in Odyssey blocking buffer and incubated o/n at 4°C with 1:1000 Rabbit anti-PIGA (Proteintech #13679-1-AP) and

1:1000 Mouse anti-Tubulin (Sigma #T6199) antibodies. Membranes were washed and incubated for 1 hour in 1:15000 goat anti-rabbit IRDye 800CW (LICOR # 926-32211)and

1:15000 goat anti-mouse IRDye 680Rd (LICOR, #926-68070) and visualized on LICOR

Odyssey imaging system. Protein concentration was determined by normalized PIGA signal to Tubulin signal in Image Studio Lite Ver 5.2.

Immunofluorescence

Postnatal day 0-23 mice were euthanized with isoflurane and their brains were microdissected in PBS. They were fixed in 4% PFA o/n, equilibrated in 30% sucrose o/n, cryo-embedded in OCT, and sectioned from 10-20µM by cryostat. Sections were subjected to antigen retrieval by citrate retrieval buffer, blocked in 4% normal goat serum, incubated in primary antibodies o/n at 40C. Antibodies were utilized in the following dilutions: 1:200 rabbit anti-PIGA (Proteintech #13679-1-AP), 1:1000 mouse anti-NeuN

(Millipore #MAB377), 1:1000 Rat anti-CD68 (Biorad #MCA1957T), 1:4000 rabbit anti-

Calbindin (abcam #ab25085), 1:500 Rat anti-Myelin Basic Protein (Aves #MBP). Sections were incubated with secondary antibody 1:1000 Alexafluor 488-congugated goat anti- rabbit (Thermo #A11008) and 1:1000 Alexafluor 594 conjugated goat anti-mouse

(Thermo A11008) and counterstained with DAPI. Sections were imaged on Nikon C2

144 confocal 703 microscope and CD68+ cells/area were quantified with Nikon Elements software 704 brightspot analysis.

RNA sequencing

RNA sequencing was performed with Beijing Genomics Institute on the BGISEQ-500 platform. mRNA molecules from P20 right cerebellar hemispheres of 3 WT and 3 Mosaic cKO mice were purified from total RNA using oligo(dT)-attached magnetic beads. mRNA molecules were fragmented into small pieces using fragmentation reagent after reaction a certain period in proper temperature. First-strand cDNA was generated using random hexamer-primed reverse transcription, followed by a second-strand cDNA synthesis. The synthesized cDNA was subjected to end-repair and then was 3’ adenylated. Adapters were ligated to the ends of these 3’ adenylated cDNA fragments. This process was to amplify the cDNA fragments with adapters from previous step. PCR products were purified with Ampure XP Beads (AGENCOURT), and dissolved in EB solution. Library was validated on the Agilent Technologies 2100 bioanalyzer. The double stranded PCR products were heat denatured and circularized by the splint oligo sequence. The single strand circle DNA (ssCir DNA) were formatted as the final library. The library was amplified with phi29 to make DNA nanoball (DNB) which had more than 300 copies of one molecular. The DNBs were load into the patterned nanoarray and single end 50 (pair end 100/150) bases reads were generated in the way of combinatorial Probe-Anchor

Synthesis (cPAS).

145

Results

Piga is expressed broadly in the CNS with enrichment in the corpus callosum and

Purkinje cells.

To determine the role of glycosylphosphatidylinositol biosynthesis in neural development after neurulation, we sought to determine the expression of Piga in the embryonic and postnatal brain. To examine embryonic expression post neurulation, we performed whole mount in situ hybridization for Piga at E11.5 with a Piga anti-sense riboprobe and a sense riboprobe as a control. We found Piga is expressed in the first branchial arch (BA1), medial nasal process (MNP), forebrain (Fb), Midbrain (Mb), and limb bud (Lb) (Fig. 1 A-

F). We conclude Piga is expressed in the CNS at post-neurulation stage.

Publicly available single cell RNA sequencing data sets of the adult mouse cortex shows a broad expression of Piga in a variety of neural cell types but a clear enrichment in astrocytes and newly formed/myelinating oligodendrocytes [21] (Fig. 1G). To continue our expression analysis in the postnatal CNS at the protein level, we performed immunofluorescence for PIGA protein with a commercially available polyclonal αPIGA antibody validated for western blot with HELA cell lysate and immunohistochemistry using paraffin-embedded mouse lung and rat liver. We found PIGA protein is enriched for the corpus callosum and periventricular areas at P0 (Fig. 1 H-I). At P10, higher expression was maintained in the periventricular areas and PIGA expression was evident in the

Purkinje cells of the cerebellum at this stage (Fig. 2J, K). Higher power images revealed clear staining of the Purkinje cell cytoplasm and dendrites (Fig. 1K). Therefore we concluded that PIGA shows increased expression at P0 in developing white matter areas such as the corpus callosum and cerebral peduncle. Once the mature morphology of the

146 cerebellum is established at P10, PIGA is strongly expressed in the Purkinje cells, the major output of the cerebellum.

Figure 1. Piga expression in the CNS. Whole mount in situ hybridization for Piga in E11.5 WT embryos with Piga α-sense (A,C,E) and sense (B, D, F) riboprprobes. Expression of Piga from single cell RNA-seq of the adult mouse cortex (G). P0 PIGA (Green) expression in the corpus callosum (CC) and periventricular areas (H, I). P10 PIGA expression in the developing cerebellum (J), and Purkinje cells (K). Piga (Green), Neuronal marker NeuN (Red), DAPI counterstain. Fb=forebrain, Mb=Midbrain, BA1=Branchial Arch 1, MNP=Medial Nasal Process, Lb= Limb bud, Oligo=Oligodendrocyte, OPC= Oligodendrocyte Progenitor Cell.

147

Deletion of Piga in the Nestin-Cre lineage results in CNS GPI deficiency

As very few studies have focused on the role of glycosylation in neural development, we aimed to first take a broad approach to delete GPI biosynthesis in the entire CNS/PNS.

We hypothesized this broad approach would illuminate the critical requirement for GPI biosynthesis in neural development beyond neurulation. We are unable to study the effect of GPI biosynthesis in later stage neurogenesis in the germline Piga null mice because these mutants develop neural tube defects or die very early in development [17].

We obtained the conditional Piga allele, B6.129-Pigawhich has been used in two studies to delete Piga tissue-specifically with Cre/lox technology [14, 17]. LoxP sites were inserted in intron 5/6 of the mouse Piga gene, followed by a PGK-neo cassette flanked by two loxP sites. Upon Cre recombination, the final exon of Piga is deleted and GPI biosynthesis is severely disrupted indicating the allele efficiently abolishes Piga function

[14, 17]. We crossed these mice to mice expressing Cre recombinase under the rat

Nestin promoter, B6.Cg-Tg(Nes-cre)1Kln/J allele. This Nestin-Cre allele has been shown to mediate loxP excision at E11.5 in the forebrain, midbrain, hindbrain, and spinal cord and maintain expression in neural stem cells throughout development [18, 22, 23].

Therefore, targeting by this Nestin-Cre transgene is broad and includes neurons, astrocytes, and oligodendrocytes.

Piga is located on the X chromosome in mouse and human resulting in drastically different degrees of Piga deletion in male versus female progeny from Pigaflox crosses with Nestin-

Cre. Males with one copy of Pigaflox/Y; Nestin-Cre+/- are termed hemizygous conditional knockout (cKO) males and theoretically lack all Piga expression in the Nestin lineage.

Females used in this study are mosaic cKOs with the genotype Pigaflox/X; Nestin Cre+/-

148 carrying one floxed allele and one WT allele of Piga. We chose to continue our behavioral studies with mosaic cKO females because they survive significantly longer than hemizygous cKO males and develop phenotypes observed in IGD patients including ataxia, decreased lifespan, and neurological decline.

Mice were mated and progeny were analyzed at E16.5-postnatal stages. To confirm the

Cre targeted Piga in the CNS we performed PCR with three primers spanning the targeted region (Fig. 2A). Primers 1 and 2 generate a product at approximately 400bp in the untargeted tissues from flox animals. The distance between Primer 1 and 3 in Piga flox animals is nearly 5kb which is too large for PCR amplification. Upon exposure to Cre, exon 6 and PGK-neo are excised between the loxP sites bringing primer 1 and 3 in close enough proximity to generate a 600bp product in Piga deleted (Piga del) DNA (Fig. 2B).

We found Nestin-Cre targeted Piga in multiple CNS tissues in Piga hemizygous cKO mice as evidenced by the Piga Del PCR product in hemizygous conditional knockout males.

Tissues showing Piga deletion included the cortex, cerebellum, subcortical structures including the thalamus, hypothalamus, midbrain, pons, and medulla (Fig. 2B, lane 2-4).

However, Piga excision was not noted in genomic DNA from the tail of the same animal, indicating that the targeting was specific (Fig. 2B, lane 1). We did observe some remaining

Piga flox band in the CNS tissues indicating that the Cre did not target absolutely every cell in these tissues and may reflect non-neural tissues such as blood vessels, blood, and microglia which are not targeted by Nestin cre. We conclude our conditional approach targets Piga for deletion in the CNS.

It is known that mothers with one mutant allele of Piga display skewing of X inactivation towards the affected X chromosome carrying the mutant allele likely due to a survival

149 advantage to cells that express the WT PIGA allele early in development [12]. Thus, we were concerned skewing toward the WT X chromosome would result in higher residual

PIGA expression than the expected 50% of WT in mosaic cKOs. To confirm the protein level of PIGA was reduced in the brain of Piga mosaic cKO females, we performed western blotting for PIGA in subcortical lysate including the thalamus, basal ganglia, pons, midbrain, and medulla. Western blotting showed a reduction of PIGA protein in mosaic to approximately 50-75% of WT expression levels when normalized to tubulin loading control (Fig.2 C-D). These data confirm PIGA protein reduction in the brain of the mosaic cKO mice.

150

Figure 2. Deletion of Piga in the Nestin-Cre lineage results in CNS GPI deficiency. Genotyping strategy for identifying Piga flox (primer 1+2, 350bp product), Piga deleted (Del) (primer 1+3, 600bp product) (A). PCR of tail and various CNS structures of Piga hemizygous cKO male mouse (B). Western blot of PIGA (Green) in subcortical tissues from WT and Piga Mosaic cKO female littermates, and Tubulin loading control (Red) (C). Quantification of PIGA/tubulin signal from Western blot of N=6 WT and N=3 Mosaic cKO subcortical lysates (D). CB= cerebellum, Subcort=subcortical tissues. Asterisks indicates p<0.05.

151

CNS GPI deficiency results in decreased survival and weight, but does not grossly affect the structure of the brain

We hypothesized GPI deficiency in the CNS lineage would result in structural defects of the brain as has been observed in IGD patients including cerebellar hypoplasia, dilated lateral ventricles, and microcephaly [13]. To our surprise, we found no significant structural defects in the cortex of Piga mosaic cKO mice at birth or up to P23 (Fig. 3 A-

D). We observed mild hypoplasia of the cerebellum in Piga mosaic cKO mice as evidenced by H&E staining (Fig. 3E, F). As we followed mutants over time, we observed that both the Piga mosaic cKO females and the Piga hemizygous cKO males gained less weight than their WT littermates and were easily identifiable by this phenotype (Fig. 3G).

By P7, all mutants were approximately half the weight of their WT littermates. As we followed the mutants we also noticed they died postnatally with the oldest mutant only surviving to P23 (Fig. 3H). Piga hemizygous cKO males that lack all GPI biosynthesis in the CNS die on average twice as quickly as the mosaic cKO females suggesting a gene dosage effect (Fig. 3H). We hypothesize that the genetic mosaicism in females allows for residual expression of Piga, and allows them to survive longer than hemizygous cKO males.

152

Figure 3. CNS GPI deficiency results in cerebellar hypoplasia, decreased weight gain, and decreased survival. Coronal H&E section of WT and Mosaic cKO cortex at E18.5 (A, B). Gross whole brain of WT and Mosaic cKO at P22 (C, D). H&E section of the cerebellar hemisphere in WT and Mosaic cKO (E, F). Average weight of WT and Mosaic cKO mice from P0 to P15 (G). Survival curve of WT (black), Mosaic cKO (Red), and Hemizygous cKO (Blue) mice (H).

153

CNS GPI deficiency results in neurological decline and ataxia,

While the cause of death in mutants remains unclear, all mosaic cKO mice developed progressive ataxia, tremor, and a hindlimb clasping phenotype. Moribund mutants were unable to walk but moved their forelimbs and hindlimbs spontaneously while laying on their side in the host cage. Moribund mutants were euthanized at this stage according to

CCHMC IAUCUC protocol.

Between Postnatal days P10 to P19, we observed a progressive hindlimb clasping phenotype that worsened over time in the mosaic cKO mutants. In the tail suspension test, we scored the hindlimb clasping phenotype according to standard protocols and noted a statistically significantly lower score in the mutants indicating a neurological phenotype (Fig. 4 A-C). Hindlimb clasping is common to many models of neurological disease with a wide variety of pathophysiologies in the brain and spinal cord [24].

As the mosaic cKOs displayed a general indicator of neurological disease at early postnatal stages, we sought to test other aspects of neurodevelopment in the mutants including developmental landmarks such as reflexes. First, we performed the Righting

Reflex test which tests the ability of the mouse to right itself into a prone position after being placed in a supine position. Mosaic cKOs and hemizygous cKOs were severely impaired in their ability to right themselves as measured by the latency to right themselves in seconds (Fig. 4D). These data indicate the mutants are defective at either the labyrinth reflex, limb coordination and/or strength as they actively attempt to right themselves but they cannot complete the task. To test their strength, we performed the forelimb wire hang test. In this test, the mice are suspended on a wire by their forelimbs over a padded surface and their latency to fall is measured in seconds. Interestingly, we found the

154 mosaic cKOs performed just as well as WT littermates in the forelimb wire hang. In fact, they are able to suspend themselves from the wire slightly longer than their WT littermates

(Fig. 4E). These data indicate the function of the skeletal muscle system and strength is not impaired in the mutants. As the mosaic cKOs are defective at surface righting but not the forelimb wire hang, we suspected mutants have a defect in limb coordination.

Over time, the mutants developed ataxia and a persistent tremor (SFig.1). The signs of are first noticeable at approximately P12 and progressively worsen until approximately

P20 when the mutants became moribund. To quantify the ataxia phenotype, we performed rotarod testing with the CCHMC Animal Behavior Core. The rotarod assays motor coordination and balance by challenging the mice to maintain their balance on a rotating rod that increases in speed of rotation gradually. We found the mosaic cKOs travel less in the rotarod test and have a significantly decreased latency to fall compared to WT littermates at P12 and P15 (Fig. 4F, G). The early lethality of the hemizygous cKO males precluded rotarod analysis. These data indicate the mosaic cKOs have defective motor coordination and balance.

155

Figure 4. CNS GPI deficiency results in hindlimb clasping, ataxia, and tremor. Hindlimb clasping score of WT and Mosaic cKO littermates at P16 (A). Images of WT and Mosaic cKO littermates with Mosaic cKO displaying hindlimb clasping (B, C). Surface righting reflex test in WT and Mosaic cKO littermates (D). Forelimb Wire Hang test in WT and Mosaic cKO littermates (E). Rotarod testing of WT and Mosaic cKO littermates at P12 and P15, distance travelled (F) and latency to fall (G). *=P<0.05, **=P<0.01, ***=P<0.001, ****=P<0.0001

156

CNS GPI deficiency delays white matter development

To determine the cause of the phenotype observed in mosaic cKO mice, we reviewed the phenotypes of mouse knockouts for neural GPI-AP genes, as they were available on the

Mouse Genome Informatics resource. Recent reviews of neural GPI-APs highlighted the diverse importance of GPI-APs in many neural processes including axon outgrowth, regeneration, synapse formation, neuron cell adhesion, and oligodendrocyte development [25, 26]. Of the GPI-AP knockout mouse models, our Piga mosaic cKO mutants most resemble the phenotype observed in the Contactin 1-/- mouse [27, 28].

Contactin 1-/- mice weigh significantly less than their WT littermates, develop progressive ataxia, and die at approximately P19. Colakoglu et. al. showed Contactin 1 is critical for oligodendrocyte development and mutants lack proper CNS myelination and display defects in cerebellum microorginization. Indeed, multiple mutants in myelin development display an ataxic, tremor, and early death phenotype [27]. Given the phenotypic similarity between Contactin 1-/- mice and Piga mosaic cKOs we sought to determine the degree of myelination in Piga mosaic cKO mutants.

We performed immunohistochemistry for Myelin Basic Protein (MBP) in sagittal sections from WT and Mosaic cKO mutants at P19. We found mutants showed reduced MBP staining compared to controls indicating that myelination is defective in the mosaic cKO mutants (Fig. 5).We conclude developmental myelination is impaired in Piga mosaic cKO mutants. This phenotype has been observed in multiple IGD patients and may be partially responsible for the tremor and early death we observe in the Piga mosaic cKO mutants.

[2].

157

Figure 5. CNS GPI deficiency delays white matter development. N=3/4 mutants delayed. Immunohistochemistry of αMBP in WT (A, C) and Mosaic cKO mice (B, D). CB= cerebellum, CC=corpus callosum, MB=midbrain, Md=medulla, Ps=pons, Th=thalamus.

158

CNS GPI deficiency impairs Purkinje cell dendritic arborization

The ataxia we observed in the Piga mosaic cKOs suggested a defect in the cerebellum, the major coordinator of motor movement. Defects in either granule cell development or

Purkinje cell development can lead to ataxic phenotypes [29]. Granule cells are the major excitatory input to Purkinje cells and Purkinje cells are the major output of the cerebellum by synapsing with many diverse inputs and making inhibitory outputs to deep cerebellar nuclei. Given the expression pattern of Piga in the postnatal brain, we hypothesized defects in the Purkinje cell layer were responsible for the ataxic phenotype in Piga mosaic cKO mice. To assess defects in cerebellum development we performed immunofluorescence for NeuN to determine the morphology of the inner granular layer and Calbindin staining to determine the morphology of the Purkinje cells. The granule cell layer of the cerebellum did not appear to be affected by NeuN staining but the Purkinje cell layer showed marked defects in Purkinje cell dendritic arborization in the molecular layer. The dendritic tree is less elaborated and less branched in the Piga mosaic cKO mice compared to WT littermates (Fig. 6 A, B) The dendritic tree of the Purkinje cell makes

150,000-200,000 contacts with parallel fibers of granule cells which provide excitatory inputs to the PCs. Defects in the morphogenesis of the PC dendritic tree have been found in a variety of ataxic mouse models [30, 31].

To obtain a broader picture of the differences between the WT and Piga Mosaic cKO cerebella, we performed RNA-seq on bulk right cerebellar hemispheres in 3 WT and 3

Piga mosaic cKO littermates at P20. Differential Gene expression analysis identified 176 genes upregulated (Log2Fold Change ≥1, Padjusted <0.05), 67 down regulated (Lof2Fold

Change ≤1, Padjusted <0.05) and 17,370 genes that showed no statistical difference in

159

Piga mosaic cKO cerebella compared to wildtype controls (Fig. C). Gene Ontology (GO) analysis identified an enrichment for pathways including neuropeptide signaling, iron transport, response to hypoxia, and circadian rhythm for the upregulated genes in the

Piga mosaic cKO mutant (Fig. 6D). Of note, the three most highly expressed genes included Myelin protein zero, Tyrosine hydroxylase, and Perlipin 4 (Fig. 6E).

160

Figure 6. CNS GPI deficiency impairs Purkinje cell arborization and alters the cerebellum transcriptome. Purkinje cell (αCalbindin Green) and granule cell (αNeuN Red) immunofluorescence in WT and Mosaic cKO mice (A, B). Representative images from N= 4/4 Mosaic cKOs. Volcano plot of differentially expressed genes from RNA sequencing of WT and Piga Mosaic cKO right cerebellar hemisphere at P20, blue = downregulated genes and red = upregulated genes (C). GO analysis of upregulated genes in the Piga Mosaic cKO cerebella (D). Top 3 upregulated genes in Piga Mosaic cKO by log2Fold Change (E).

161

Discussion

In this work we investigated the role of GPI biosynthesis in the developing CNS as it is the most affected organ system in patients with defects in GPI biosynthesis [32]. We found the initiating enzyme required for GPI biosynthesis, Piga, is highly expressed in the corpus callosum, periventricular areas of the CNS, and Purkinje cells. We then deleted

Piga in the CNS/PNS using a conditional approach with Pigaflox mice and Nestin-Cre to determine the requirement for GPI biosynthesis in this lineage. We found these mutants do not develop structural defects of the brain but develop severe ataxia, tremor, gain less weight than their WT littermates, and die prematurely. As this phenotype resembled other mouse mutants with defects in myelination and IGD patients develop defects in developmental myelination, we sought to determine the degree of myelination in the mutants. We found by αMBP staining, mosaic cKO mutants have severe defects in developmental myelination compared to WT littermates confirming a requirement for GPI biosynthesis in myelination. We also found severe defects in motor coordination and striking defects in Purkinje cell arborization in the mosaic cKO cerebellum. Similar ataxic phenotypes and reduced lifespan have been observed in other models of CDG including the PMM2 KD, Cog7 KD, and ATP6AP2 KD mutant flies demonstrating that motor coordination critically requires normal glycosylation across species [33]. These data illuminate a novel role for the GPI anchor posttranslational modification in the mouse CNS and provides mechanistic insight into the pathophysiology of IGD.

We were interested to find the expression pattern of Piga in the postnatal CNS suggested a role for GPI biosynthesis in white matter development. Piga was strongly expressed in the corpus callosum and the cerebral peduncle, two highly myelinated structures.

162

Myelination is critical to protect axons, increase conduction velocity along the axon, and allow communication between neurons in the CNS especially for motor coordination and learning. Classic models of hypomyelination such as the rumpshaker and quaker mouse mutants display similar phenotypes as those observed in the mosaic cKO mice including truncal ataxia, tremor, and early death [34]. Indeed, the GPI-anchored contactin family members display a very similar phenotype to that observed in the Piga mosaic cKO mice including ataxia, tremor, small body size, and premature death around P20 [27, 28].

Recently, it was shown that Contactin-1 is expressed in oligodendrocytes and is critical for normal myelination [27]. We hypothesize deficiency in the GPI-anchoring of Contactin-

1 contributes to the hypomyelination phenotype we observe in the Piga mosaic cKO mice.

While Contactin-1 is a promising candidate, there are several other GPI-APs in the CNS that regulate many functions including synaptic plasticity, axon outgrowth, and regeneration [25]. We hypothesize that the phenotype observed in the Piga mosaic cKO mice highlights the critical early requirements for GPI biosynthesis in the postnatal brain.

Indeed, the mosaic cKO mice are moribund by P21 consistent with the lethality seen in a variety of hypomyelination mutants. In contrast, the hemizygous cKO males die even before myelination has really begun, around P10, arguing that GPI biosynthesis is critical for other CNS functions earlier in development. However, we were unable to identify the cause of death in the hemizygous cKO mice and this function of GPI biosynthesis remains unclear.

The most common phenotypes observed in all IGD patients are intellectual disability/developmental delay, and epilepsy. We noticed several episodes of mutants flailing their hindlimbs and forelimbs while on their backs after they fell due to their ataxic

163 gait, and then they experienced a sustained period of rigid paralysis with limbs outstretched followed by a short period of inactivity (data not shown). These events may be consistent with a seizure but the early lethality in our mutants precludes a rigorous analysis of the “seizure phenotype” in the mutants by EEG monitoring. These phenotypes are consistent with the “severe” presentation of Piga deficiency in which patients die earlier, display severely delayed myelination with thin corpus callosum compared to more

“mild” forms of Piga deficiency [12, 35]. Further research with a less severe model of GPI biosynthesis deficiency may prove as a better model to study the seizure phenotype as observed in IGD patients. Knock-in of patient variants with the “moderate phenotype” by

CRISPR/Cas9 technology, or Piga deletion with a Cre with less broad expression may achieve a more moderate defect in GPI biosynthesis and provide a longer-lived model of

IGD with the seizure phenotype.

It has been known for decades that somatic mutations in Piga in the hematopoietic lineage result in a hemolytic anemia called Paroxysmal Nocturnal Hemoglobinuria (PNH). PNH red blood cells are devoid of two critical negative regulators of the complement cascade, the GPI-APs CD55 and CD59. Without GPI biosynthesis, RBCs become the target of aberrant complement and lead to a life threatening hemolytic anemia. Recent research has shown a clinically available complement inhibitor can almost completely halt the PNH disease process [36, 37]. Others have hypothesized the GPI-APs CD59/CD55 may also be critical to protect neurons from complement in the CNS. Indeed, one group that derived neurons from Piga deficient patient induced pluripotent stem cells showed that these neurons are more susceptible to complement-mediated lysis in culture [38]. We identified a mild enrichment for immune activation genes in the Piga mosaic cKO cerebellum but

164 they were not among the top hits from GO analysis which included response to hypoxia, neuropeptide signaling, and iron transport. Further work is required to determine if the immune response is truly overactive in the GPI deficient neural tissues by analyzing the cortical neurons which may be responsible for the seizure phenotype observed in IGD patients

The strongest signal from our RNA-seq experiment by adjusted P-value was Tyrosine hydroxylase (Th). Interestingly, though Purkinje cells are not dopaminergic, it has been shown that wildtype PCs go through a short phase of Th expression during develop which decreases by P19. In a variety of ataxic mutants including the pogo, Lrp5/6, β-catenin cKO, and dilute mutants, the Purkinje cells abnormally retain Th expression to later postnatal stages. Indeed, many stimuli seem to activate Th expression in Purkinje cells including mechanical stimulation and a variety of genetic defects. This retained Th positivity is thought to mark a delay in PC maturation though the exact role of Th in this process is unclear.

Our RNA sequencing results also suggest a role for hypoxia in the pathology of the cerebellar defect observed in the Piga Mosaic cKO mice. Hypoxia has been shown to delay the maturation of the cerebellum. How GPI deficiency could result in hypoxia remains unclear. Possibly alterations in lipid metabolism due to the blockade in GPI biosynthesis allows for the accumulation of lipid precursors including phosphatidylinositol

(PI). If PI were to accumulate then subsequent peroxidation may lead to the generation of reactive oxygen species and a resulting hypoxic response. This remains to be tested.

Alternatively, vasculature development may be impaired in the Piga mosaic cKO

165 cerebellum leading to regional hypoxia. Further evaluation of vascular development of the

Piga mosaic cKO by CD31 staining would help define this defect.

We propose that our conditional knockout model may serve as an excellent model for preclinical trials of drugs for IGD as the phenotype is robust, quantifiable, and the mosaic cKO survives long enough postnatally to be treated with experimental compounds.

Degree of myelination by immunohistochemistry and ataxia scoring by rotarod serve as convenient end points to examine in experimental settings of preclinical drug trials. A synthetic intermediate of GlcNac-PI would be one promising candidate to test in this model as the intermediate may bypass the requirement for Piga and possibly provide the precursor necessary for GPI biosynthesis. We hope the research presented here can aid in developing novel therapies for IGD patients.

166

Table S1. PCR Primers

Primer Name Sequence Purpose mPiga G4 ACCTCCAAAGACTGAGCTGTTG 420 bp Flox, 250bp WT, 550bp (Primer 1) null for Piga flox genotyping. Triple primer PCR mPiga G3 CCTGCCTTAGTCTTCCCAGTAC 420 bp Flox, 250bp WT, 550bp (Primer 2) null for Piga flox genotyping. Triple primer PCR mPigalox TGTGGGTTTCAGTTCATTTCAGA 420 bp Flox, 250bp WT, 550bp (Primer 3) null for Piga flox genotyping. Triple primer PCR IMR1084 (Cre GCG GTC TGG CAG TAA AAA CTA TC genotyping: cre transgene, F) 200bp Cre + IMR1085 (Cre GTG AAA CAG CAT TGC TGT CAC TT genotyping: cre transgene, R) 200bp Cre + mPiga WMISH TGTCACCCATGCTTATGGAA PCR with T3 overhang for F WMISH mPiga WMISH ATTAACCCTCACTAAAGGCAATGTCCC PCR with T3 overhang for R CGACTTCACTT WMISH probe

167

A B

Supplemental Figure 1. Piga Mosaic cKO phenotype videos. P18 Piga mosaic cKO (upper right) and WT littermate (lower left) (A). P19 Piga mosaic cKO (right) and WT littermate (left) (B).

168

References 1. Kinoshita, T., Biosynthesis and deficiencies of glycosylphosphatidylinositol. Proc Jpn Acad Ser B Phys Biol Sci, 2014. 90(4): p. 130-43. 2. Bellai-Dussault, K., et al., Clinical variability in inherited glycosylphosphatidylinositol deficiency disorders. Clinical Genetics, 2019. 95(1): p. 112-121. 3. Kinoshita, T., Glycosylphosphatidylinositol (GPI) Anchors: Biochemistry and Cell Biology: Introduction to a Thematic Review Series. Journal of Lipid Research, 2016. 57(1): p. 4-5. 4. Freeze, H.H., Understanding Human Glycosylation Disorders: Biochemistry Leads the Charge. Journal of Biological Chemistry, 2013. 288(10): p. 6936-6945. 5. Knaus, A., et al., Characterization of glycosylphosphatidylinositol biosynthesis defects by clinical features, flow cytometry, and automated image analysis. Genome Medicine, 2018. 10. 6. Knaus, A., et al., Rare Noncoding Mutations Extend the Mutational Spectrum in the PGAP3 Subtype of Hyperphosphatasia with Mental Retardation Syndrome. Human Mutation, 2016. 37(8): p. 737-744. 7. Pagnamenta, A.T., et al., Analysis of exome data for 4293 trios suggests GPI- anchor biogenesis defects are a rare cause of developmental disorders. European Journal of Human Genetics, 2017. 25(6): p. 669-679. 8. Nguyen, T.T.M., et al., Mutations in PIGS, Encoding a GPI Transamidase, Cause a Neurological Syndrome Ranging from Fetal Akinesia to Epileptic Encephalopathy. American Journal of Human Genetics, 2018. 103(4): p. 602-611. 9. Swoboda, K.J., et al., A Novel Germline PIGA Mutation in Ferro-Cerebro- Cutaneous Syndrome: A Neurodegenerative X-Linked Epileptic Encephalopathy With Systemic Iron-Overload. American Journal of Medical Genetics Part A, 2014. 164(1): p. 17-28. 10. Kuki, I., et al., Vitamin B-6-Responsive Epilepsy Due to Inherited Gpi Deficiency. Neurology, 2013. 81(16): p. 1467-1469. 11. Thompson, M.D., et al., Hyperphosphatasia with neurologic deficit: A pyridoxine- responsive seizure disorder? Pediatric Neurology, 2006. 34(4): p. 303-307. 12. Tarailo-Graovac, M., et al., The genotypic and phenotypic spectrum of PIGA deficiency. Orphanet Journal of Rare Diseases, 2015. 10. 13. Johnston, J.J., et al., The Phenotype of a Germline Mutation in PIGA: The Gene Somatically Mutated in Paroxysmal Nocturnal Hemoglobinuria. American Journal of Human Genetics, 2012. 90(2): p. 295-300. 14. Tarutani, M., et al., Tissue-specific knockout of the mouse Pig-a gene reveals important roles for GPI-anchored proteins in skin development. Proceedings of the National Academy of Sciences of the United States of America, 1997. 94(14): p. 7400-7405.

169

15. Ahrens, M.J., et al., Convergent extension movements in growth plate chondrocytes require gpi-anchored cell surface proteins. Development, 2009. 136(20): p. 3463-3474. 16. Visconte, V., et al., Phenotypic and functional characterization of a mouse model of targeted Pig-a deletion in hematopoietic cells. Haematologica-the Hematology Journal, 2010. 95(2): p. 214-223. 17. Nozaki, M., et al., Developmental abnormalities of glycosylphosphatidylinositol- anchor-deficient embryos revealed by Cre/IoxP system. Laboratory Investigation, 1999. 79(3): p. 293-299. 18. Tronche, F., et al., Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nature Genetics, 1999. 23(1): p. 99-103. 19. Feather-Schussler, D.N. and T.S. Ferguson, A Battery of Motor Tests in a Neonatal Mouse Model of Cerebral Palsy. Jove-Journal of Visualized Experiments, 2016(117). 20. McAuliffe, J.J., et al., Desflurane, Isoflurane, and Sevoflurane Provide Limited Neuroprotection against Neonatal Hypoxia-Ischemia in a Delayed Preconditioning Paradigm. Anesthesiology, 2009. 111(3): p. 533-546. 21. Zhang, Y., et al., An RNA-Sequencing Transcriptome and Splicing Database of Glia, Neurons, and Vascular Cells of the Cerebral Cortex (vol 35, pg 11929, 2014). Journal of Neuroscience, 2015. 35(2): p. 864-866. 22. Giusti, S.A., et al., Behavioral phenotyping of Nestin-Cre mice: Implications for genetic mouse Models of psychiatric disorders. Journal of Psychiatric Research, 2014. 55: p. 87-95. 23. Graus-Porta, D., et al., beta 1-class integrins regulate the development of laminae and folia in the cerebral and cerebellar cortex. Neuron, 2001. 31(3): p. 367-379. 24. Lalonde, R. and C. Strazielle, Brain regions and genes affecting limb-clasping responses. Brain Research Reviews, 2011. 67(1-2): p. 252-259. 25. Um, J.W. and J. Ko, Neural Glycosylphosphatidylinositol-Anchored Proteins in Synaptic Specification. Trends in Cell Biology, 2017. 27(12): p. 931-945. 26. Freeze, H.H., et al., Neurological Aspects of Human Glycosylation Disorders. Annual Review of Neuroscience, Vol 38, 2015. 38: p. 105-+. 27. CColakoglu, G., et al., Contactin-1 regulates myelination and nodal/paranodal domain organization in the central nervous system. Proceedings of the National Academy of Sciences of the United States of America, 2014. 111(3): p. E394- E403. 28. Berglund, E.O., et al., Ataxia and abnormal cerebellar microorganization in mice with ablated contactin gene expression. Neuron, 1999. 24(3): p. 739-750. 29. Cendelin, J., From mice to men: lessons from mutant ataxic mice. Cerebellum Ataxias, 2014. 1: p. 4. 30. Wang, J.Y., et al., Sun1 deficiency leads to cerebellar ataxia in mice. Disease Models & Mechanisms, 2015. 8(8): p. 957-+. 31. Becker, E.B.E., et al., A point mutation in TRPC3 causes abnormal Purkinje cell development and cerebellar ataxia in moonwalker mice. Proceedings of the National Academy of Sciences of the United States of America, 2009. 106(16): p. 6706-6711.

170

32. Bellai-Dussault, K., et al., Clinical variability in inherited glycosylphosphatidylinositol deficiency disorders. Clin Genet, 2018. 33. Frappaolo, A., et al., Modeling Congenital Disorders of N-Linked Glycoprotein Glycosylation in Drosophila melanogaster. Frontiers in Genetics, 2018. 9. 34. Duncan, I.D. and A.B. Radcliff, Inherited and acquired disorders of myelin: The underlying myelin pathology. Exp Neurol, 2016. 283(Pt B): p. 452-75. 35. Kato, M., et al., PIGA mutations cause early-onset epileptic encephalopathies and distinctive features. Neurology, 2014. 82(18): p. 1587-96. 36. Kinoshita, T., Molecular genetics, biochemistry, and biology of PNH. Rinsho Ketsueki, 2017. 58(4): p. 353-362. 37. Hillmen, P., et al., The complement inhibitor eculizumab in paroxysmal nocturnal hemoglobinuria. New England Journal of Medicine, 2006. 355(12): p. 1233-1243. 38. Yuan, X., et al., A hypomorphic PIGA gene mutation causes severe defects in neuron development and susceptibility to complement-mediated toxicity in a human iPSC model. Plos One, 2017. 12(4). 39. Lund, T.C., Hematopoietic stem cell transplant for lysosomal storage diseases. Pediatr Endocrinol Rev, 2013. 11 Suppl 1: p. 91-8. 40. Cartier, N., et al., The role of microglia in human disease: therapeutic tool or target? Acta Neuropathol, 2014. 128(3): p. 363-80.

171

Chapter 4. Discussion

Summary of Findings

In this dissertation, we used a variety of models of GPI deficiency to determine the role of this posttranslational modification in various stages of development. An ENU-induced hypomorph of Pgap2, the Clpex mutant, highlighted the requirement for GPI biosynthesis in lip, palate, neural tube, and heart development that was previously unappreciated in germline knockout models. We found GPI biosynthesis is required in cranial NCCs of the first arch and the neuroepithelium for cell survival. Based on the known requirement for

GPI-anchored FOLR1 in neural crest cells, we were able to partially rescue the cleft lip with folinic acid supplementation in utero. To show this requirement was cell autonomous, we ablated GPI biosynthesis completely in neural crest cells using a conditional allele of

Piga, the first enzyme in the GPI biosynthesis pathway and necessary for all GPI biosynthesis, driven by Wnt1-Cre to target the NCC lineage. The Piga conditional knockout mice developed median cleft lip and cleft palate but were able to pattern and form all the correct skeletal elements of the craniofacial complex though they were hypoplastic. Thus, we concluded GPI biosynthesis is required to maintain the survival of a portion of cNCCs and deficiencies in GPI biosynthesis effectively limit the pool of cNCCs that give rise to the craniofacial complex including the lip, palate, and skeleton.

Given the oddly specific requirement for GPI biosynthesis in the survival of a subset of

NCCs, we hypothesized GPI biosynthesis would show similar unique requirements in the nervous system. Germline knockouts of GPI biosynthesis genes develop neural tube defects, thus precluding the analysis of the postnatal brain [1]. Therefore, we took a

172 conditional approach to delete Piga in the Nestin lineage, which includes nearly all neurons and glia, starting at E10.5 after neural tube closure. To our surprise, we found these cKO animals gained less weight than their WT littermates, died prematurely, and developed tremor/ataxia. We found Piga was expressed in the developing white matter and highly expressed in the Purkinje cells of the cerebellum at early postnatal stages.

Based on this expression pattern and the phenotype observed in cKOs, we sought to determine the degree of myelination and Purkinje cell development in our model. We found white matter development was delayed and the arborization of Purkinje cell dendrites was reduced compared to controls. Interestingly, we did not observe gross, structural defects in the cortex of conditional knockouts such as microcephaly, cortical underdevelopment or atrophy as has been observed in some PIGA deficient patients, but we did observe cerebellar hypoplasia in cKOs as has been observed in IGD [2, 3]. We concluded that certain aspects of neural development were uniquely sensitive to GPI deficiency including myelination and cerebellar development.

Overall, this dissertation aimed to define the requirement for GPI biosynthesis in development and challenge the general assumption that glycosylation plays a broad nonspecific role in every tissue. Glycosylation mutant animals and patients with mutations in glycosylation pathways show a wide array of fairly unique phenotypes including neuromuscular defects, cleft lip/palate, joint laxity, blindness, among many other phenotypes [4]. Therefore, glycosylation is required in multiple tissues but the roles different forms of glycosylation play in different tissues are diverse and vastly understudied. Foundational experiments using the conditional Piga knockout in different

173 tissues during development would greatly aid in our understanding of this critical posttranslational modification that affects many proteins.

GPI Biosynthesis Genes are expressed dynamically throughout development

Too often, cellular processes are relegated to the category of “housekeeping” and are largely ignored. This includes but is not limited to microtubule genes, ribosomal genes, and genes involved in biosynthetic processes such as glycosylation. However, recent research has shown that deficiency in these genes result in tissue specific defects. For example, deficiency of ribosomal biosynthesis genes has been shown to disproportionally affect neural crest cell development [5]. Furthermore, it is often assumed that transcription of the genes that control these processes are static and uniform across all tissues during development. We found genes in the GPI biosynthesis pathway are quite the opposite, with changes in expression of different genes at different times in development. For example, expression of Pgap2 is enriched specifically in the ganglion cell layer of the retina and later in one stripe of the cortex during brain development. The roles of these specific expression domains are unknown. Even between GPI biosynthesis genes, Piga and Pgap2 show different expression patterns. For example, Piga is expressed in the most medial aspect of the medial nasal prominence while Pgap2 is expressed in a ring like pattern around the nasal pit at the same stage. Furthermore,

Pgap2 mutants developed bilateral cleft lip while Piga cKO mice developed median cleft lip highlighting the subtle differences in expression domains and resulting phenotypes.

Though these genes are in a linear biosynthetic pathway, they show distinct spatial expression patterns and beg the question: why are these genes regulated in this way? A bioinformatic survey of the regulatory landscape of the Piga and Pgap2 loci would be one

174 way of addressing this question. We know virtually nothing about how glycosylation genes are regulated during development and whether or not they are controlled by some master transcription factor.

Future Directions: Role of GPI biosynthesis in CNS development

Neural Tube Closure

While we were able to partially rescue the cleft lip in Clpex mutants with folinic acid supplementation, the neural tube defect remained resistant. Oddly, the apoptosis in the neural tube was restricted to the midbrain/hindbrain boundary and only occurred bilaterally at the sites of dorsolateral hinge point formation. Previous studies hypothesized that GPI biosynthesis is necessary for cell-cell adhesion and the bending of the tube [1,

6]. However, our findings fit more with a survival defect in the DLHP site. This finding is still surprising to me and I don’t seem to find this pattern of apoptosis in the literature. In the Folr1-/- mouse, the apoptosis is not nearly so specific [7, 8]. Defects of the opposing gradient of Shh and BMP in the neural tube are often the cause of failure to form the

DLHPs [9]. However, we did not observe any defects in Shh/BMP signaling in Clpex mutants either by in situ hybridization or RNA sequencing. It will be of interest in the future to determine the apoptosis pattern in other GPI deficient mutants to determine if this is a unique phenomenon to GPI pathway mutant NTDs. One could possibly perform laser capture microdissection of the DLHPs and RNA sequencing or proteomics to determine the cause of this apoptosis. Furthermore, to definitely determine which proteins are lost from the cell surface in GPI deficient mutants such as the Clpex mutant, one could perform microdissection of the neural tube at E8.5, biotinylate the surface proteins with a membrane biotinylation kit, pulldown these proteins with streptavidin, and perform mass

175 spectrometry in WT versus mutant. There is some evidence that not only GPI-APs are affected in GPI deficient states because GPI biosynthesis may affect the trafficking of other proteins, as has been shown for rhodopsin and postulated for ceramide [10, 11].

One could use a similar approach in NCCs by crossing a GPI deficient mutant such as the Piga Wnt1-Cre cKO mouse with a Wnt1-GFP transgene to label all NCCs during development. Then one could cell sort GFP+ NCCs in this mouse mutant, biotinylated membrane protein, pulldown these proteins with streptavidin, and perform mass spectrometry on the membrane bound protein fraction. These experiments would define the subset of membrane proteins affected by GPI biosynthesis defects in two of the most affected tissues in IGD patients, the neuroepithelium and the neural crest.

Oligodendrocytes

Most surprising to us, Piga showed a very distinct expression pattern at the protein level in the postnatal brain. Piga expression was increased in the corpus callosum at P0 and then highly upregulated in the Purkinje cells of the cerebellum. The white matter expression is interesting because IGD patients show delayed myelination and atrophy/hypoplasia of white matter structures including the corpus callosum [2, 3].

Clement Chow at the University of Utah found a pan-glial cKO of Piga in flies resulted in a “bang-sensitive” phenotype reminiscent of the seizure phenotype observed in IGD

(Clement Chow, personal communication). Interestingly, it has been shown that maturing oligodendrocytes are rich in GPI-APs in lipid rafts [12]. To address the requirement for

GPI biosynthesis in oligodendrocytes in mice, Olig2-Cre could be used to target Piga and abolish GPI biosynthesis in the oligodendrocyte lineage [13]. Analysis of the white matter phenotype, immunofluorescence for oligodendrocyte maturation markers, and Scanning

176

Electron Microscopy of myelinated axons in these conditional KOs would greatly advance our understanding of the requirement for GPI biosynthesis in myelination.

Purkinje Cells

Given the expression of Piga in Purkinje cells, we reviewed the glycosylation literature for other patient phenotypes related to the cerebellum. Other glycosylation genes have been shown to be expressed in Purkinje cells and cerebellar defects appear to be a common phenotype in CDG, not just IGD [14]. Autopsy of PMM2-CDG patients have shown gliosis and Purkinje cell dropout confirming the cerebellum is affected in human patients [15].

We found the branching of Purkinje cells were significantly underbranched in the Piga mosaic cKO mice suggesting GPI-APs are involved in the branching morphogenesis of

Purkinje cells. Compared to other classic ataxic mutants like the Weaver mouse, we saw no gross defects in the development of granule cells that synapse on the Purkinje cells and rather an intrinsic defect in the PCs themselves [16]. The cell intrinsic role of GPI biosynthesis in Purkinje cells could be easily addressed by conditional ablation of Piga in the Pcp2 (PC) lineage with PCP2-Cre and the floxed allele of Piga [17]. Expression analysis of other key glycosylation genes such as PMM2 (the most commonly mutated

CDG gene), Srd5a3 (a critical early step in N-glycosylation), DPGAT1 (synthesizer of dolichol-phosphate, the major building block in N-glycosylation), OST complex genes

(glycosyltransferase that adds the N-glycan to protein substrates) would provide great insight as to whether Purkinje cells are uniquely “glyco-rich” neurons. Furthermore,

Purkinje cells can be tagged with GFP under the L7 promoter and isolated by

Fluorescence Assisted Cell Sorting (FACS) and cell surface proteins could be analyzed by biotinylating the cell surface proteins and performing mass-spectrometry of the

177 streptavidin pulled down cell surface proteome [18]. Repeating this experiment in conditional knockdown of various glycosylation mutants would expand our understanding of the requirement of glycosylation in Purkinje cell development.

Neurons

Multiple groups have focused on the role of GPI biosynthesis in cortical neurons even though our expression analysis showed that PIGA is more highly expressed in the developing white matter and Purkinje cells. It is thought that the predominant seizure phenotype in IGD patients is due to primarily neuronal defects. The mouse models presented in this dissertation are too severe to allow for testing of later neural phenotypes such as learning deficits or seizures. To definitively address the question of neuronal role of GPI, one could use a conditional approach by crossing Piga flox allele with Synapsin

Cre, or Nex-cre to drive recombination in neurons [19, 20]. One could monitor seizure development robustly with EEG readings over time and video monitoring. A model that recapitulates the IGD seizure phenotype would be extremely valuable as intractable seizure disorders are a major cause of morbidity in IGD patients. GPI biosynthesis may play a critical role in neurons in several distinct ways:

1. Complement-mediated neuronal apoptosis

In vitro, one group has shown that Piga deficient neurons derived from patient iPSCs are susceptible to complement mediated lysis supposedly because they lack GPI-anchored

CD55 and CD59, two major negative regulators of complement activation on the cell surface [21]. We hypothesize that neuron-driven recombination would make the neurons susceptible to endogenous complement-mediated lysis as has been seen in vitro.

178

Antibodies such as αC5b-9 (the membrane attack complex) would be able to show whether or not complement was overactive in these conditional knockouts and add greatly to our understanding of the pathophysiology of IGD. Commercial biologics like eculizumab can be used to block complement activation and prevent formation of the

MAC complex. Intrathecal injections of eculizumab and monitoring disease progression in the Piga, Nestin cKO or Synapsin-Cre cKO model would determine whether or not complement mediated neuronal apoptosis plays a role in IGD neuropathology. One could confirm these findings by crossing the Piga, Nestin cKO model to the Complement 5a receptor (C5aR) knockout, or C5 knockout mice to abolish complement activation though a genetic approach. Deletion of C5 will result in a failure to form the MAC complex and

C5aR deletion would impair the recruitment and activation of innate immune cells.

Recently, this genetic approach has been performed in lysosomal storage disease mouse models and showed complement activation plays a major role in the pathology of lysosomal storage disease [22].

2. GABA synthesis

The GPI-AP Tissue Nonspecific Alkaline Phosphatase is known to be necessary for

Vitamin B6 trafficking. B6 is an essential co-factor for the biosynthesis of GABA, the major inhibitory neurotransmitter [23]. Decreases in GABA are a possible explanation for the seizure phenotype observed in IGD patients. One could test this hypothesis by determining the level of GABA synthesis in a neuron specific GPI deficient model [24, 25].

Multiple FDA-approved drugs target the GABA signaling pathway and defining the link between IGD related epilepsy and GABA would help tailor clinical therapy.

3. Axon/Neurite Outgrowth

179

Multiple GPI-APs are involved in axon and neurite outgrowth including Neural Cell

Adhesion Molecule 1 (NCAM1) and Nogo Receptor [26-28]. Defects in either of these

GPI-APs impair learning, memory, and/or coordination in mice [29, 30]. One could determine the neurite outgrowth of cultured neurons from Piga, Synapsin-Cre cKO mice to test this requirement more thoroughly. Defects in neurite outgrowth and neuron connectivity is a known cause of intellectual disability and determining whether this underlies the ID seen in IGD patients would help explain one of the most common phenotypes observed in IGD [31].

Future Directions: The role of GPI biosynthesis in other organs

Heart

It remains unclear how deficiencies in GPI biosynthesis affect cardiac development. In fact, cardiac defects are a common finding across CDGs of all kinds with a penetrance of approximately 20% [32]. We found membranous ventricular septal defects and underdeveloped valves in the compound Clpex/Pgap2 null mutants. We also found Pgap2 is expressed in the cardiomyocytes themselves starting at approximately E12.5, after the heart has begun beating and circulating fetal blood in the embryo. Therefore, it would be reasonable to hypothesize that GPI biosynthesis is involved in the latter stage of heart development after cardiac looping. There are several cardiac associated GPI-APs including Vascular Cell Adhesion Molecule 1 (VCAM1), Lymphocyte Antigen 6 family member E (LY6E), Glypican 3 (GPC3), and Ephrin A1 (EFNA1). Vcam1-/- mice die at

E11.5 due to reductions in the compact layer of the myocardium and interventricular septum [33]. Ly6e-/- mice die in mid-gestation due to cardiac defects including thin myocardium and underdeveloped interventricular septum [34]. Gpc3-/- mice develop

180 ventricular and atrial septal defects and double outlet right ventricle [35]. Efna1-/-mice develop a peculiar phenotype including thickened valves due to an increase in epithelial- mesenchymal transition [36]. Thus multiple GPI-APs play critical roles in heart development, specifically in regulating myocardial thickness and valve development.

Some of these defects have been observed in IGD patients, including life threatening complications. Interestingly, heart defects were also observed in the patient knock-in mouse model of PMM2-CDG, a completely distinct model of CDG with defects in N- glycosylation [32, 37].

The role of GPI biosynthesis in cardiomyocyte development could be addressed with conditional ablation of Piga in the αMyosin Heavy Chain, or Troponin lineage with their respective promoter-driven Cre recombinase mice [38, 39]. Tests such as fetal echocardiogram, micro CT imaging, and basic histology at E12.5-E18.5 would be able to measure a structural defect in the structure and function of the embryonic heart. We hypothesize that there would be serious defects including thin myocardial wall and

VSD/ASD. One could also test the requirement for GPI in valve development with Piga conditional knockout in the Tie2-Cre lineage which marks the endocardial lineage and the cells that undergo EMT to form the valve from endocardium [40].

Enteric Nervous System (ENS)

Preliminary studies in the guts of Piga, Wnt1-Cre cKO mice showed a defect in enteric neuron differentiation at embryonic time points (data not shown). These studies would

181 need to be elaborated and expanded to firmly conclude the role of GPI biosynthesis in the ENS. GPI-anchored GDNF receptors GFRα/β would be good candidates for mediating this effect as these molecules are critically involved in the proliferation/migration/survival of trunk neural crest cells [41, 42]. One could perform a lineage trace of the trunk NCC lineage with Wnt1-Cre, Rosa26-LacZ and section guts at the developmental time points of trunk NCC migration to determine whether GPI biosynthesis is necessary for NCC migration in these tissues. Subsequent staining with cleaved caspase 3 would determine whether GPI deficient trunk NCCs are apoptotic similar to what we observed in Clpex mutants cranial NCCs. One could also isolate intestine ex vivo from WT and Piga, Wnt1-Cre cKO mice and measure the time it takes an artificial pellet to pass through the intestine to measure gut motility. We would hypothesize that if ENS function is impaired, gut motility would be impaired in this assay

[43]. These data would help explain the pathophysiology of Hirschsprung’s disease which has been observed in a subset of IGD patients [3].

Gut epithelium

A major morbidity of IGD is gastrointestinal defects with failure to thrive and poor feeding

[3]. Patient gut motility assays and gastric emptying studies are necessary to determine whether this is a defect in gut motility. The cause of this is currently unknown but we found very high expression of Pgap2 in the gut epithelium including the small and large intestine and the stomach. Glycosylation is thought to play a role in forming a barrier between the gut epithelium and intestinal microbiota. In a recent study, deletion of GPI-anchored

Lypd8 from the gut epithelium impaired the gut epithelial barrier and predisposed mice to

Dextran Sulfate Sodium-induced colitis [44]. Conditional ablation of Piga from the gut

182 epithelium using Villin-Cre would be a useful model to determine the requirement for GPI biosynthesis in this tissue during development [45]. Comparing the effects of Piga, Villin-

Cre cKO with a Piga, Wnt1-Cre NCC cKO would be fascinating and help to determine the cause of the gastrointestinal disease in IGD; i.e. whether the contribution is mostly due to defects in the ENS or gut epithelium. We hypothesize that both tissues may be defective in germline GPI mutants. Skin (Krt5-Cre) cKO of Piga resulted in ichthyosis and serious barrier defects with an incredibly thick, impermeable stratum corneum [11]. Perhaps glycosylation in the epithelium is required for proper cell interface between the epithelium and the lumen to allow for beating of microvilli. Simple body weight time course, and histology/ barrier permeability assays of the gut epithelium in a Piga, Villin-Cre cKO would address the role of GPI biosynthesis in this tissue. We hypothesize the cKO mice will lose weight over time, and develop inflammation consisting of innate and adaptive immune cells in the gut epithelium due to defective barrier function.

Respiratory Epithelium

Respiratory complications including pneumonia are common in IGD but the mechanism is largely unknown. We found Pgap2 was expressed in the respiratory epithelium, similar to epithelial expression observed in the gut. Perhaps glycosylation in the respiratory epithelium acts as barrier and allows for hydration of the surface epithelium for cilia. Thick, under hydrated mucus like the mucus that forms in cystic fibrosis, impair the ability of cilia to beat and clear mucus resulting in the trapping of bacteria [46]. One hypothesis is that defects in GPI biosynthesis impair the glycocalyx of the respiratory epithelium resulting in an inability to maintain water in the mucus at the cell surface. This may cause thick, under- hydrated mucus similar to cystic fibrosis. One could test the requirement for GPI

183 biosynthesis in respiratory epithelium by knocking out Piga in the FoxJ1-Cre lineage to delete GPI biosynthesis in the ciliated respiratory epithelium [47]. One could perform cilia beat frequency analysis in the trachea of these mutants using fluorescent beads to determine the rate of mucocilliary clearance. If the hydration of mucus is impaired in the mutant, one would expect ciliary beat frequency to be decreased. If mucocilliary clearance is impaired in this model, perhaps IGD patients would benefit from therapies such as those used in CF such as high frequency chest compression devices or mucolytics [48, 49]

Eye

We found expression of Pgap2 in the ganglion cell layer of the retina and eye expression of Piga. The function of this expression domain remains unknown and we didn’t focus our work on the retina or eye in our models. Eye defects of a wide variety are common in

CDG, from nystagmus to retinal degeneration. For example, a founder mutation in dolichol synthesis gene DHDDS in Ashkenazi Jews results in retinitis pigmentosa without other salient features [50]. Furthermore, it was shown in flies that rhodopsin trafficking relies on GPI biosynthesis [10]. Thus glycosylation plays one or more roles in eye development which has essentially not been explored in mammalian model systems. One could test the requirement for GPI biosynthesis in retinal development by conditional ablation of Piga in the mouse Rx (mRx)-Cre lineage. This conditional KO should ablate

Piga in all retinal precursors/retinal pigment epithelium [51]. Histology and staining for the layers of the retina of Piga, mRX cKO mice would illuminate the requirement for GPI biosynthesis in development of the retina.

184

Summary

A summary of the tissue specific roles of GPI biosynthesis are laid out in Figure 1. There is direct evidence for some but not all roles for each tissue/process detailed. Much further investigation is required to understand heart, gut, and mature neuronal phenotypes specifically. Putative causal GPI-APs/mechanisms for further investigation are listed under each tissue/process.

185

Figure 1. The requirement for GPI biosynthesis in diverse tissues during development. Tissues or processes are labelled according to the developmental timeline and putative causative GPI-APs or GPI-related processes are listed below each tissue. A=anterior, P=posterior, AVE=anterior visceral endoderm, ENS= enteric nervous system, MAC=membrane attack complex, RBC=red blood cell.

186

Future Directions: Determine the pathophysiology of postnatal neurological defects in IGD

Premature death in Piga Hemizygous, Nestin-Cre cKO males

We found Piga hemizygous Nestin cKO males died at P0-P9 compared to the approximate P20 death observed in Piga mosaic Nestin cKO females. We attributed this difference in survivability to a gene dosage effect as males lack all functional PIGA protein while female retain half of PIGA protein expression due to random X inactivation. The cause of death in the Piga hemizygous cKOs was never determined. A full pathological assessment of moribund males would be of great value. Hemizygous cKO males died before the disease processes we observed in mosaic cKO females developed, including white matter developmental delay, ataxia, and cerebellar defects. We hypothesize inflammation may play a role as we observed significant increases in activated microglia in late stages of the mosaic cKO females. Whether or not hemizygous males show this microglial activation or gliosis (marked by GFAP staining) at earlier stages (P5-P9) has yet to be determined. IGD patients experience a significantly reduced lifespan, with many dying in the first decade of life, usually due to respiratory failure and complications related to dependence on mechanical ventilators. The underlying cause of this early death remains elusive in patients.

Microglial activation in Piga, Nestin Mosaic cKOs

We saw an enrichment in inflammatory pathway genes in the Piga Mosaic cKO cerebella indicating some immune process may be at play. We also observed incompletely penetrant microglial activation in sections of Piga mosaic cKO cerebella. The role of

187 microglia in neurodevelopmental disease is highly debated. In several diseases including

Alzheimer’s disease, prion diseases, and lysosomal storage diseases; it has been shown that microglial number and activation is protective against disease progression. Indeed, bone marrow transplant to replace the apoptotic microglia is one of the commonly used therapies in a number of lysosomal storage diseases [52]. However, it has been shown in other models that microglia can be toxic to neurons and oligodendrocytes. Indeed, it has been shown microglia may be actively damaging in mouse models of multiple sclerosis and spinal muscular atrophy [53]. The role of microglia can be easily addressed as microglia can be depleted with intrathecal injections of PLX3397, a small molecule

Colony Stimulating Factor-1 (CSF-1) receptor inhibitor. Microglia rely on CSF-1 cytokine for survival in the brain and blocking this receptor essentially depletes the entire brain of microglia [54]. Thus, depleting microglia and assessing the severity of the phenotype would identify the beneficial or malicious role of microglial activation in Piga mosaic cKO females. Autopsies of IGD patients would greatly expand our understanding of the disease process as well. Simple staining’s including GFAP staining for gliosis and simple histological assessment would greatly advance our understanding of this disease process.

Future Directions: Therapy for IGD

Bypass therapy with Synthetic Intermediates

Several groups have shown that supplementation of patients with compounds that bypass the need for a biosynthetic enzyme can be effective at treating the underlying deficiency

(See Introduction). The family of a patient with Piga deficiency have partnered with a company in Germany to generate a synthetic form of GlcNac-PI, the precursor of GPI

188 produced by the Piga complex, in an effort to bypass the need for Piga (http://piga- cdg.com/research/current-research-projects/). To test the efficacy of these compounds, simple tests could be undertaken by supplementing Piga KO 293T cells with the supplement and staining for FLAER, a flow cytometric staining for cell surface GPI expression. Further in vivo testing would require novel animal models. Models such as flies deficient in Piga using the Gal4-UAS system, patient fibroblasts and iPSCs, and Piga deficient mice will be essential for preclinical testing of these compounds. Delivery to the

CNS will be a critical component of these in vivo tests. Some drug companies have used liposomal packaging of hydrophilic drugs to increase their hydrophobicity and enhance their passage through the blood brain barrier. In fact, Glycomine is using this approach to deliver mannose-1-P in patients with PMM2-CDG

(http://www.apcdg.com/uploads/4/1/1/9/41196831/10-

_cdg__treatment_2017_for_sharing.pdf). A similar approach might be beneficial at delivering hydrophilic GlcNac-PI in PIGA-CDG. While generating our own model of Piga,

Nestin-Cre cKO mice, Kinoshita and Murakami’s group at Osaka University have received a CDG-CARE grant to test a synthetic form of GlcNac-PI in a mouse model of brain- specific Piga deficiency (http://cdgcare.com/wp-content/uploads/2018/11/CDG-

Newsletter-Volume-06-Final.pdf). Results on the efficacy of this novel therapy may be available soon.

Gene Therapy/Genetic Counseling

With the advent of CRISPR/Cas9 technology, precise editing of the genome has become possible. Unfortunately, in IGD the mutations are diverse and don’t seem to fall in a single

“hotspot” unlike cystic fibrosis, for example, with recurrent F508 mutations responsible for

189 nearly 66% of all CF cases [55]. Thus, gene therapy would be difficult for IGD. However, as Piga is X-linked and all cases of Piga deficiency have been identified in males that inherited their mother’s mutant allele of Piga, carrier testing in mothers would be beneficial for family planning. Skewing of X inactivation in unaffected PIGA-CDG mothers protects females from developing the disease [2]. As exome sequencing becomes more widely available, mothers carrying Piga mutations may be able to receive prenatal genetic counseling to consider screening their oocytes for Piga mutation status and undergo in vitro fertilization with unaffected eggs.

Small molecule screen for novel drugs in IGD fly model

The power of drosophila models allows for high throughput testing of drugs. One could utilize the drosophila Piga, neural cKO fly which develops an abnormal upslanted wing phenotype which is easily identifiable. A small molecule drug screen for compounds to correct this phenotype would be very possible given the ease of scoring this phenotype

(Clement Chow, personal communication). Mutant flies could be grown in a 96 well plate format with a unique drug compound in each well and scored overtime for their wing phenotype. Clement Chow at University of Utah is performing a genetic suppressor screen in Piga cKO flies which will be greatly beneficial, but a complementary small molecule screen would greatly enhance the translational impact of this work. Small molecule screening libraries with hundreds of FDA approved drugs are commercially available and have been used in several other fly disease models to identify novel therapies for diseases including Fragile X and Parkinson’s disease [56, 57].

190

Concluding Remarks

We hope that the work presented in this dissertation advances our understanding of the pathophysiology of IGD and provides novel insights to the requirement for GPI biosynthesis in development of the CNS and face. Clearly much more work is required to understand all of the functions of GPI biosynthesis in development and the suggestions for further experiments detailed in this discussion would greatly advance our knowledge to this end. Hypotheses in any of the organ systems described above could be easily turned into grant proposals or rotation projects and would only require the purchase of the required tissue-specific Cre recombinase mouse. To me, the most exciting avenues are therapeutic approaches including the synthetic intermediates and small molecule screens. The clear, reproducible phenotype in the Piga, Nestin mosaic cKO mice provides a reliable end point for drug testing in a preclinical model. Collaboration with the Chow and Kinoshita labs would accelerate this work and provide therapies for patients more quickly. Small communities like those working on rare disease should be collaborative and supportive. To me, there is nothing more rewarding than helping patients and their families such as the extraordinary Nguyen family that initiated the PIGA-CDG drug trials with the Kinoshita group and suggested to Clement Chow to make the Piga cKO fly model

(you can read the story on Clement’s website: http://www.chowlab.org/blog-native). The more we learn about GPI and development the closer we will get toward helping these families.

191

Acknowledgements

We thank the CCHMC Animal Behavior Core for performing the rotarod tests performed in this dissertation. We thank Tia Roberts for her great work as a BRIMS student that showed that Piga is required for NCC development. We thank Steve Crone for providing antibodies and support in understanding the Piga, Nestin-Cre cKO phenotype. We thank

Ron Waclaw for providing antibodies for myelin staining. This work was supported by UC

MSTP program, NINDS, and an ACPA Emerging Researcher Grant.

192

References

1. Nozaki, M., et al., Developmental abnormalities of glycosylphosphatidylinositol- anchor-deficient embryos revealed by Cre/loxP system. Lab Invest, 1999. 79(3): p. 293-9. 2. Tarailo-Graovac, M., et al., The genotypic and phenotypic spectrum of PIGA deficiency. Orphanet Journal of Rare Diseases, 2015. 10. 3. Bellai-Dussault, K., et al., Clinical variability in inherited glycosylphosphatidylinositol deficiency disorders. Clin Genet, 2018. 4. Freeze, H.H., et al., Solving Glycosylation Disorders: Fundamental Approaches Reveal Complicated Pathways. American Journal of Human Genetics, 2014. 94(2): p. 161-175. 5. Yelick, P.C. and P.A. Trainor, Ribosomopathies: Global process, tissue specific defects. Rare Diseases, 2015. 3(1). 6. O'Shea, K.S. and M.H. Kaufman, Phospholipase C-induced neural tube defects in the mouse embryo. Experientia, 1980. 36(10): p. 1217-9. 7. Piedrahita, J.A., et al., Mice lacking the folic acid-binding protein Folbp1 are defective in early embryonic development. Nat Genet, 1999. 23(2): p. 228-32. 8. Tang, L.S., et al., Role of Folbp1 in the regional regulation of apoptosis and cell proliferation in the developing neural tube and craniofacies. Am J Med Genet C Semin Med Genet, 2005. 135c(1): p. 48-58. 9. Murdoch, J.N. and A.J. Copp, The relationship between sonic Hedgehog signaling, cilia, and neural tube defects. Birth Defects Res A Clin Mol Teratol, 2010. 88(8): p. 633-52. 10. Satoh, T., et al., GPI biosynthesis is essential for rhodopsin sorting at the trans- Golgi network in Drosophila photoreceptors. Development, 2013. 140(2): p. 385- 394. 11. Tarutani, M., et al., Tissue-specific knockout of the mouse Pig-a gene reveals important roles for GPI-anchored proteins in skin development. Proceedings of the National Academy of Sciences of the United States of America, 1997. 94(14): p. 7400-7405. 12. Kramer, E.M., et al., Oligodendrocytes direct glycosyl phosphatidylinositol- anchored proteins to the myelin sheath in glycosphingolipid-rich complexes. Journal of Biological Chemistry, 1997. 272(14): p. 8937-8945. 13. Zawadzka, M., et al., CNS-Resident Glial Progenitor/Stem Cells Produce Schwann Cells as well as Oligodendrocytes during Repair of CNS Demyelination. Cell Stem Cell, 2010. 6(6): p. 578-590. 14. Barone, R., A. Fiumara, and J. Jaeken, Congenital Disorders of Glycosylation with Emphasis on Cerebellar Involvement. Seminars in Neurology, 2014. 34(3): p. 357- 366. 15. Aronica, E., et al., Congenital disorder of glycosylation type Ia: a clinicopathological report of a newborn infant with cerebellar pathology. Acta Neuropathologica, 2005. 109(4): p. 433-442. 16. Surmeier, D.J., P.G. Mermelstein, and D. Goldowitz, The weaver mutation of GIRK2 results in a loss of inwardly rectifying K+ current in cerebellar granule cells.

193

Proceedings of the National Academy of Sciences of the United States of America, 1996. 93(20): p. 11191-11195. 17. Barski, J.J., K. Dethleffsen, and M. Meyer, Cre recombinase expression in cerebellar Purkinje cells. Genesis, 2000. 28(3-4): p. 93-98. 18. Tomomura, M., et al., Purification of Purkinje cells by fluorescence-activated cell sorting from transgenic mice that express green fluorescent protein. European Journal of Neuroscience, 2001. 14(1): p. 57-63. 19. Zhu, Y., et al., Ablation of NF1 function in neurons induces abnormal development of cerebral cortex and reactive gliosis in the brain. Genes & Development, 2001. 15(7): p. 859-876. 20. Goebbels, S., et al., Genetic targeting of principal neurons in neocortex and hippocampus of NEX-Cre mice. Genesis, 2006. 44(12): p. 611-621. 21. Yuan, X., et al., A hypomorphic PIGA gene mutation causes severe defects in neuron development and susceptibility to complement-mediated toxicity in a human iPSC model. Plos One, 2017. 12(4). 22. Pandey, M.K., et al., Complement drives glucosylceramide accumulation and tissue inflammation in Gaucher disease. Nature, 2017. 543(7643): p. 108-+. 23. Coburn, S.P., Vitamin B-6 Metabolism and Interactions with TNAP. Subcell Biochem, 2015. 76: p. 207-38. 24. Kuki, I., et al., Vitamin B-6-Responsive Epilepsy Due to Inherited Gpi Deficiency. Neurology, 2013. 81(16): p. 1467-1469. 25. Waymire, K.G., et al., Mice Lacking Tissue Nonspecific Alkaline-Phosphatase Die from Seizures Due to Defective Metabolism of Vitamin-B-6. Nature Genetics, 1995. 11(1): p. 45-51. 26. Doherty, P. and F.S. Walsh, CAM-FGF receptor interactions: A model for axonal growth. Molecular and Cellular Neuroscience, 1996. 8(2-3): p. 99-111. 27. Doherty, P., J. Cohen, and F.S. Walsh, Neurite Outgrowth in Response to Transfected N-Cam Changes during Development and Is Modulated by Polysialic Acid. Neuron, 1990. 5(2): p. 209-219. 28. Williams, G., et al., Ganglioside inhibition of neurite outgrowth requires Nogo receptor function - Identification of interaction sites and development of novel antagonists. Journal of Biological Chemistry, 2008. 283(24): p. 16641-16652. 29. Lazar, N.L., et al., Missense mutation of the reticulon-4 receptor alters spatial memory and social interaction in mice. Behavioural Brain Research, 2011. 224(1): p. 73-79. 30. Bukalo, O., et al., Conditional ablation of the neural cell adhesion molecule reduces precision of spatial learning, long-term potentiation, and depression in the CA1 subfield of mouse hippocampus. Journal of Neuroscience, 2004. 24(7): p. 1565- 1577. 31. Pavlowsky, A., J. Chelly, and P. Billuart, Emerging major synaptic signaling pathways involved in intellectual disability. Mol Psychiatry, 2012. 17(7): p. 682-93. 32. Marques-da-Silva, D., et al., Cardiac complications of congenital disorders of glycosylation (CDG): a systematic review of the literature. Journal of Inherited Metabolic Disease, 2017. 40(5): p. 657-672.

194

33. Kwee, L., et al., Defective Development of the Embryonic and Extraembryonic Circulatory Systems in Vascular Cell-Adhesion Molecule (Vcam-1) Deficient Mice. Development, 1995. 121(2): p. 489-503. 34. Zammit, D.J., et al., Essential role for the lymphostromal plasma membrane Ly-6 superfamily molecule thymic shared antigen 1 in development of the embryonic adrenal gland. Molecular and Cellular Biology, 2002. 22(3): p. 946-952. 35. Ng, A., et al., Loss of glypican-3 function causes growth factor-dependent defects in cardiac and coronary vascular development. Developmental Biology, 2009. 335(1): p. 208-215. 36. Frieden, L.A., et al., Regulation of Heart Valve Morphogenesis by Eph Receptor Ligand, Ephrin-A1. Developmental Dynamics, 2010. 239(12): p. 3226-3234. 37. Chan, B., et al., A mouse model of a human congenital disorder of glycosylation caused by loss of PMM2. Human Molecular Genetics, 2016. 25(11): p. 2182-2193. 38. Agah, R., et al., Gene recombination in postmitotic cells - Targeted expression of cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo. Journal of Clinical Investigation, 1997. 100(1): p. 169- 179. 39. Jiao, K., et al., An essential role of Bmp4 in the atrioventricular septation of the mouse heart. Genes & Development, 2003. 17(19): p. 2362-2367. 40. Kisanuki, Y.Y., et al., Tie2-Cre transgenic mice: A new model for endothelial cell- lineage analysis in vivo. Developmental Biology, 2001. 230(2): p. 230-242. 41. Uesaka, T., et al., Conditional ablation of GFR alpha 1 in postmigratory enteric neurons triggers unconventional neuronal death in the colon and causes a Hirschsprung's disease phenotype. Development, 2007. 134(11): p. 2171-2181. 42. Cacalano, G., et al., GFR alpha 1 is an essential receptor component for GDNF in the developing nervous system and kidney. Neuron, 1998. 21(1): p. 53-62. 43. Hoibian, E., et al., Distal Colon Motor Dysfunction in Mice with Chronic Kidney Disease: Putative Role of Uremic Toxins. Toxins, 2018. 10(5). 44. Okumura, R., et al., Lypd8 promotes the segregation of flagellated microbiota and colonic epithelia. Nature, 2016. 532(7597): p. 117-+. 45. Madison, B.B., et al., cis elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. Journal of Biological Chemistry, 2002. 277(36): p. 33275-33283. 46. Abdullah, L.H., et al., Defective postsecretory maturation of MUC5B mucin in cystic fibrosis airways. Jci Insight, 2017. 2(6). 47. Zhang, Y., et al., A Transgenic FOXJ1-Cre system for gene inactivation in ciliated epithelial cells. American Journal of Respiratory Cell and Molecular Biology, 2007. 36(5): p. 515-519. 48. Pittman, J.E. and T.W. Ferkol, The Evolution of Cystic Fibrosis Care. Chest, 2015. 148(2): p. 533-542. 49. Nicolini, A., et al., Effectiveness of treatment with high-frequency chest wall oscillation in patients with bronchiectasis. Bmc Pulmonary Medicine, 2013. 13. 50. Zelinger, L., et al., A Missense Mutation in DHDDS, Encoding Dehydrodolichyl Diphosphate Synthase, Is Associated with Autosomal-Recessive Retinitis Pigmentosa in Ashkenazi Jews. American Journal of Human Genetics, 2011. 88(2): p. 207-215.

195

51. Klimova, L., et al., Generation of mRx-Cre Transgenic Mouse Line for Efficient Conditional Gene Deletion in Early Retinal Progenitors. Plos One, 2013. 8(5). 52. Gomes-Leal, W., Microglial physiopathology: how to explain the dual role of microglia after acute neural disorders? Brain and Behavior, 2012. 2(3): p. 345-356. 53. Chu, F.N., et al., The roles of macrophages and microglia in multiple sclerosis and experimental autoimmune encephalomyelitis. Journal of Neuroimmunology, 2018. 318: p. 1-7. 54. Gerber, Y.N., et al., CSF1R Inhibition Reduces Microglia Proliferation, Promotes Tissue Preservation and Improves Motor Recovery After Spinal Cord Injury. Frontiers in Cellular Neuroscience, 2018. 12. 55. Davidson, D.J. and D.J. Porteous, The genetics of cystic fibrosis lung disease. Thorax, 1998. 53(5): p. 389-397. 56. Qurashi, A., et al., Chemical screen reveals small molecules suppressing fragile X premutation rCGG repeat-mediated neurodegeneration in Drosophila. Human Molecular Genetics, 2012. 21(9): p. 2068-2075. 57. Kovacs, T., et al., The small molecule AUTEN-99 (autophagy enhancer-99) prevents the progression of neurodegenerative symptoms. Scientific Reports, 2017. 7.

196