The Role of Glycosylphosphatidylinositol Biosynthesis and Remodeling in Neural

Total Page:16

File Type:pdf, Size:1020Kb

The Role of Glycosylphosphatidylinositol Biosynthesis and Remodeling in Neural The Role of Glycosylphosphatidylinositol Biosynthesis and Remodeling in Neural and Craniofacial Development A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Molecular and Developmental Biology Graduate Program of the University of Cincinnati College of Medicine by Marshall Lukacs B.A. Case Western Reserve University June 2019 Committee Chair: Rolf Stottmann, Ph.D. 1 Abstract Glycosylation is the most abundant posttranslational modification though its role in development is highly understudied. One form of glycosylation involves the anchorage of nearly 150 proteins to the cell membrane by glycosylphosphatidylinositol (GPI). Over thirty genes are involved in the biosynthesis and remodeling of the GPI anchor. Mutations in these genes cause an array of genetic disorders called Inherited GPI Deficiencies (IGDs) with broad clinical phenotypes including epilepsy, craniofacial defects, heart defects, and premature death. This thesis utilized several mouse genetic mouse models to test the requirement for GPI biosynthesis in neural and craniofacial development. We found that the Cleft Lip/Palate, Edema, and Exencephaly (Clpex) mutant mouse phenotype is caused by a hypomorphic mutation in the GPI remodeling gene Post-GPI Attachment to Proteins 2 (Pgap2). We found Pgap2 is required for the survival of neural crest cells and the cranial neuroepithelium. We showed that trafficking of a GPI-anchored survival factor for these cells, Folate Receptor 1, requires Pgap2 for proper localization on the cell membrane. Supplementation with folinic acid to overcome the defective FOLR1 trafficking partially rescued phenotypes in the Clpex mutant. As we established the role of Pgap2 in neural and craniofacial development, we sought to determine the requirement for GPI biosynthesis in these tissues by using a more tailored genetic approach. Pgap2 is required for the one of the final steps in GPI biosynthesis but to completely abolish GPI biosynthesis, we utilized a conditional allele of Phosphatidylinositol Glycan Anchor Biosynthesis Class A, Piga, which is a component of the first committed step in GPI biosynthesis. Others have shown that deletion of Piga results in almost total absence of GPI biosynthesis. Thus we crossed the conditional Piga 2 allele to Wnt1-Cre, neural crest cell specific, and Nestin-Cre, central and peripheral nervous system specific, mice to generate tissue specific knockouts in the developing face and brain, respectively. Knockout of Piga in neural crest cells resulted in craniofacial skeletal hypoplasia and cleft palate confirming the cell autonomous requirement for GPI biosynthesis in neural crest cells for their survival. Conditional ablation of Piga in the central and peripheral nervous system produced a number of interesting phenotypes. We found Piga, Nestin-Cre conditional knockout mice gained less weight than their wildtype littermates and died prematurely before weaning. These mice developed neurological decline, tremor, and an ataxic gait. Behavioral tests showed they are ataxic though they showed no defect in motor strength. Immunohistochemical analysis of the cerebellum showed a defect in Purkinje cell dendritic branching in conditional knockouts. RNA-sequencing of the cerebellum identified a signature of Purkinje cell developmental delay and a strong signature of hypoxia. These data demonstrate that the cerebellum and motor coordination is uniquely sensitive to GPI deficiency. This thesis expands our understanding of the requirement for GPI biosynthesis in the development of the brain and face, the two organ systems most affected by GPI deficiency. 3 4 Acknowledgements I would like to first thank my mother without whom this work would really not be possible. My mother has supported me unfailingly in my endeavors and supported me in every way. She always believed in my dreams and supported me unconditionally. Four sentences here is really incapable of expressing my gratitude to my mom, she’s an inspiration. I’d also like to thank my mentor, Rolf Stottmann, who had to tolerate my stubborn, critical personality. I’m sure it was a challenge to handle and he always let me pursue my own intellectual interests. Rolf is a very supportive mentor and was always looking out for new opportunities for me. My committee has been very supportive and pushed me to think critically about my data. I’d like to thank my friend Laura Schapiro who threw a party for me when I passed my qualifier even though none of my medical school friends knew what the qualifier meant. It was incredibly thoughtful and kind of her. I have to thank Sandra Zoubovsky and our weekly therapy/hot sake sessions which helped me survive graduate school. I’d like to thank Tia Roberts who spent a summer with me and did an amazing job in the lab. Lastly, I’d like to thank my best friend Matt Sievers who dragged me out of the lab to escape and explore my queer side. 5 Table of Contents Title Page 1 Abstract 2 Acknowledgements 5 Table of Contents 6 Figures and Tables 8 Chapter 1. Introduction A. Summary 10 B. Congenital Disorders of Glycosylation 31 C. GPI Biosynthesis and Remodeling 36 D. Models of Inherited Glycosylphosphatidylinositol Deficiency 43 E. Craniofacial Development 48 F. Neural Development 54 G. Potential Mechanisms of Neurological Defects in CGD 63 H. Potential Mechanisms of Craniofacial Defects in CGD 68 I. References 72 Chapter 2. Glycosylphosphatidylinositol Biosynthesis and Remodeling are Required for Neural Crest Cell Survival A. Abstract 84 B. Introduction 85 C. Results 87 D. Discussion 114 E. Materials and Methods 119 F. Supplemental Figures 127 G. References 131 Chapter 3. CNS Glycosylphosphatidylinositol Deficiency Results in Delayed White Matter Development, Ataxia, and Premature Death in a Novel Mouse Model A. Introduction 137 B. Materials and Methods 140 C. Results 146 6 D. Discussion 162 E. Supplemental Figures 167 F. References 168 Chapter 4. Discussion A. Summary of Findings 172 B. Future Directions: Role of GPI biosynthesis in CNS development 175 C. Future Directions: The role of GPI biosynthesis in other organs 180 D. Future Directions: Determine the pathophysiology of Postnatal neurological defects in IGD 187 E. Future Directions: Therapy for IGD 188 F. Concluding Remarks 191 G. Acknowledgements 192 H. References 193 7 Figures and Tables 1. Chapter 1. Introduction Table 1. GPI anchored proteins and their knockout phenotypes 11 Table 2.GPI biosynthesis genes, knockout phenotypes, and their putative mechanisms 27 Figure 1. Congenital disorders of glycosylation by type 32 Figure 2. Biosynthesis and remodeling of glycophosphatidylinositol 35 Figure 3. Prevalence of clinical phenotypes in all IGD patients 38 Figure 4. Developmental timeline of facial prominence development 51 Figure 5. Developmental timeline of the secondary palate 54 Figure 6. Developmental timeline of neural tube closure 57 Figure 7. Cerebellum anatomy 60 Figure 8. Development of myelinating oligodendrocytes from 62 Oligodendrocyte precursors. 2. Chapter 2. Glycosylphosphatidylinositol Biosynthesis and Remodeling are Required for Neural Crest Cell Survival Figure 1. The Clpex mutant phenotype is caused by a hypomorphic Mutation in Pgap2 89 Table 1. Exome filtering of the Clpex mutant 90 Figure 2. Pgap2null allele fails to complement Pgap2Clpex allele 91 Figure 3. Pgap2 is dynamically expressed throughout embryogenesis 94 Figure 4. Pgap2 is required for proper anchoring of GPI-APs 97 Figure 5. Trafficking of FOLR1 to the cell membrane requires GPI biosynthesis and remodeling 99 Figure 6. Clpex cNCCs and neuroepithelium undergo apoptosis at E9.5 102 Figure 7. Folinic Acid treatment in utero partially rescues the cNCC apoptosis and cleft lip in Clpex mutants 104 Table 2. RNA Sequencing ToppGene Pathway Enrichment Analysis. 107 8 Table 3. Anterior/Posterior transcription factors differentially expressed in Clpex mutants compared to controls 108 Figure 8. Deletion of Piga in the Wnt1-Cre lineage leads to profound NCC GPI deficiency 110 Figure 9. Conditional knockout of Piga abolishes GPI biosynthesis in NCCs and leads to median cleft lip/palate and craniofacial hypoplasia 113 Table S1. Primers 127 Figure S1. Generation of CRISPR-edited cell lines 128 Figure S2. Clpex mutants are not defective at barrier formation 129 Figure S3. Anterior/Posterior patterning defects in Clpex mutants 129 Figure S4. Embryonic expression of GPI biosynthesis genes 130 3. Chapter 3. CNS Glycosylphosphatidylinositol Deficiency Results in Delayed White Matter Development, Ataxia, and Premature Death in a Novel Mouse Model Figure 1. Piga expression in the CNS 147 Figure 2. Deletion of Piga in the Nestin-Cre lineage results in CNS GPI deficiency 151 Figure 3. CNS GPI deficiency results in cerebellar hypoplasia, decreased weight gain, and decreased survival 153 Figure 4. CNS GPI deficiency results in hindlimb clasping, ataxia, and tremor 156 Figure 5. CNS GPI deficiency delays white matter development 158 Figure 6. CNS GPI deficiency impairs Purkinje cell arborization and alters the cerebellar transcriptome 161 Table S1. PCR Primers 167 Figure S1. Piga Mosaic cKO phenotype videos 168 4. Chapter 4. Discussion Figure 1. The requirement for GPI biosynthesis in diverse tissues during 186 development 9 Chapter 1. Introduction Summary The glycosylphosphatidylinositol (GPI) anchor is a posttranslational modification required for the cell surface expression of nearly 150 distinct proteins (Table
Recommended publications
  • Anti-FOLR2 Purified Cat
    EXBIO Praha, a.s. • Nad Safinou II 341 • 252 50 Vestec • Czech Republic [email protected][email protected][email protected] • www.exbio.cz Technical Data Sheet Product Anti-FOLR2 Purified Cat. Number/Size 11-696-C025 0.025 mg 11-696-C100 0.1 mg For Research Use Only. Not for use in diagnostic or therapeutic procedures. Antigen FOLR2 Clone EM-35 Format Purified Reactivity Human Negative species Mouse Application FC (QC tested), IP, WB, ICC Application details Western blotting: Non-reducing conditions. Flow cytometry: Recommended dilution: 1-4 µg/ml Isotype Mouse IgG1 Specificity The mouse monoclonal antibody EM-35 recognizes an extracellular epitope on FOLR2, a 30-40 kDa cell surface protein serving as a receptor for folic acid. Other names Folate receptor beta, FBP, FR-P3, FR-BETA, BETA-HFR, FBP/PL-1 Immunogen BW5147alpha,beta- cells Entrez Gene ID 2350 Gene name FOLR2 NCBI Full Gene Name folate receptor beta UniProt ID P14207 Concentration 1 mg/ml Preparation Purified by protein-A affinity chromatography Formulation Phosphate buffered saline (PBS) solution with 15 mM sodium azide Storage and handling Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Images and References www.exbio.cz The product is intended For Research Use Only. Diagnostic or therapeutic applications are strictly forbidden. Products shall not be used for resale or transfer to third parties either as a stand-alone product or as a manufacture component of another product without written consent of EXBIO Praha, a.s. EXBIO Praha, a.s.
    [Show full text]
  • Short Reports a Small Interstitial Deletion in the GPC3 Gene Causes Simpson-Golabi-Behmel Syndrome in a Dutch-Canadian Family
    J Med Genet 1999;36:57–58 57 Short reports J Med Genet: first published as 10.1136/jmg.36.1.57 on 1 January 1999. Downloaded from A small interstitial deletion in the GPC3 gene causes Simpson-Golabi-Behmel syndrome in a Dutch-Canadian family Jian Y Xuan, Rhiannon M Hughes-Benzie, Alex E MacKenzie Abstract prisingly, a family member with the apparent Deletions in the heparan sulphate proteo- stigmata of SGBS including Wilms tumour glycan encoding glypican 3 (GPC3) gene appeared not to inherit the SGBS chromosome have recently been documented in several in a previous linkage study.2 The definition of Simpson-Golabi-Behmel syndrome the GPC3 mutation has allowed the unequivo- (SGBS) families. However, no precisely cal documentation of a normal GPC3 status in defined SGBS mutation has been pub- this child. lished. We report here a 13 base pair DNA (extracted from peripheral blood and deletion which causes a frameshift and tumour tissues) was obtained from members of premature termination of the GPC3 gene the SGBS family and unrelated controls. PCR in the Dutch-Canadian SGBS family in amplification of exon 2 of the GPC3 gene was whom the trait was originally mapped. Our performed using the oligonucleotide primers analysis shows that a discrete GPC3 disa- EX2 A (5' gtttgccctgtttgccatg 3') and EX2 B (5' bling mutation is suYcient to cause SGBS. caaataatgatgccactaagc 3') producing a 329 bp Furthermore, our finding of a GPC3 nor- fragment in normal subjects.8 The reactions mal daughter of an SGBS carrier with contained 1 µg of DNA, 50 ng of each primer, skeletal abnormalities and Wilms tumour 0.2 mmol/l of each of the four dNTPs (dATP, raises the possibility of a trans eVect from dCTP, dGTP, and dTTP), and 1.2 U of Ta q the maternal carrier in SGBS kindreds.
    [Show full text]
  • Membrane Tension Buffering by Caveolae: a Role in Cancer?
    Cancer and Metastasis Reviews (2020) 39:505–517 https://doi.org/10.1007/s10555-020-09899-2 Membrane tension buffering by caveolae: a role in cancer? Vibha Singh1 & Christophe Lamaze1 Published online: 30 May 2020 # Springer Science+Business Media, LLC, part of Springer Nature 2020 Abstract Caveolae are bulb-like invaginations made up of two essential structural proteins, caveolin-1 and cavins, which are abundantly present at the plasma membrane of vertebrate cells. Since their discovery more than 60 years ago, the function of caveolae has been mired in controversy. The last decade has seen the characterization of new caveolae components and regulators together with the discovery of additional cellular functions that have shed new light on these enigmatic structures. Early on, caveolae and/ or caveolin-1 have been involved in the regulation of several parameters associated with cancer progression such as cell migration, metastasis, angiogenesis, or cell growth. These studies have revealed that caveolin-1 and more recently cavin-1 have a dual role with either a negative or a positive effect on most of these parameters. The recent discovery that caveolae can act as mechanosensors has sparked an array of new studies that have addressed the mechanobiology of caveolae in various cellular functions. This review summarizes the current knowledge on caveolae and their role in cancer development through their activity in membrane tension buffering. We propose that the role of caveolae in cancer has to be revisited through their response to the mechanical forces encountered by cancer cells during tumor mass development. Keywords Caveolae . Cancer . Mechanosensing . Mechanotransdcution . Membrane tension .
    [Show full text]
  • Anti-FOLR2 Antibody (ARG41860)
    Product datasheet [email protected] ARG41860 Package: 100 μl anti-FOLR2 antibody Store at: -20°C Summary Product Description Mouse Monoclonal antibody recognizes FOLR2 Tested Reactivity Hu Tested Application WB Host Mouse Clonality Monoclonal Clone 1905CT501.41.76 Isotype IgG2b, kappa Target Name FOLR2 Antigen Species Human Immunogen Recombiant protein of Human FOLR2. Conjugation Un-conjugated Alternate Names Folate receptor 2; BETA-HFR; FBP; Folate receptor beta; Folate receptor, fetal/placental; FBP/PL-1; FR- beta; FR-P3; Placental folate-binding protein; FR-BETA Application Instructions Application table Application Dilution WB 1:1000 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Human placenta Calculated Mw 29 kDa Observed Size ~ 33 kDa Properties Form Liquid Purification Purification with Protein G. Buffer PBS and 0.09% (W/V) Sodium azide. Preservative 0.09% (W/V) Sodium azide Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C or below. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol FOLR2 Gene Full Name folate receptor 2 (fetal) Background The protein encoded by this gene is a member of the folate receptor (FOLR) family, and these genes exist in a cluster on chromosome 11.
    [Show full text]
  • Pancreatic Beta Cells Express a Diverse Set Ofhomeobox Genes
    Proc. Nati. Acad. Sci. USA Vol. 91, pp. 12203-12207, December 1994 Biochemistry Pancreatic beta cells express a diverse set of homeobox genes (Lim motif/Lmx gene/Nkx gene/Alx gene/Vdx homeobox) ABRAHAM RUDNICK*t, THAI YEN LING*, HIROKI ODAGIRI*, WILLIAM J. RUTTER*t, AND MICHAEL S. GERMAN*t§ *Hormone Research Institute and Departments of tMedicine and tBiochemistry and Biophysics, University of California, San Francisco, CA 94143-0534 Contributed by William J. Rutter, August 22, 1994 ABSTRACT Homeobox genes, which are found in all RIPE3B element (16) and the P1 element (8) [also called CT1 eukaryotic organisms, encode transcriptional regulators in- (9)] lie on either side of the IEB1 element. The A/T elements volved in cell-type differentiation and development. Several and the E boxes function synergistically: none of the ele- homeobox genes encoding homeodomain proteins that bind and ments can function in isolation, but combination of an E box activate the insulin gene promoter have been described. In an and an A/T element results in dramatic activation of tran- attempt to identify additional beta-cell homeodomain proteins, scription (11, 16, 19). A number of complexes from beta-cell we designed primers based on the sequences of beta-cell nuclei bind to the A/T elements (6, 8-11, 16, 19). Some homeobox genes cdx3 and lmxl and the Drosophia homeodo- proteins in these complexes have been cloned, and they all main protein Antennapedia and used these primers to amplffy contain homeodomains. The A/T-binding proteins that have inserts by PCR from an insulinoma cDNA library.
    [Show full text]
  • Program Nr: 1 from the 2004 ASHG Annual Meeting Mutations in A
    Program Nr: 1 from the 2004 ASHG Annual Meeting Mutations in a novel member of the chromodomain gene family cause CHARGE syndrome. L.E.L.M. Vissers1, C.M.A. van Ravenswaaij1, R. Admiraal2, J.A. Hurst3, B.B.A. de Vries1, I.M. Janssen1, W.A. van der Vliet1, E.H.L.P.G. Huys1, P.J. de Jong4, B.C.J. Hamel1, E.F.P.M. Schoenmakers1, H.G. Brunner1, A. Geurts van Kessel1, J.A. Veltman1. 1) Dept Human Genetics, UMC Nijmegen, Nijmegen, Netherlands; 2) Dept Otorhinolaryngology, UMC Nijmegen, Nijmegen, Netherlands; 3) Dept Clinical Genetics, The Churchill Hospital, Oxford, United Kingdom; 4) Children's Hospital Oakland Research Institute, BACPAC Resources, Oakland, CA. CHARGE association denotes the non-random occurrence of ocular coloboma, heart defects, choanal atresia, retarded growth and development, genital hypoplasia, ear anomalies and deafness (OMIM #214800). Almost all patients with CHARGE association are sporadic and its cause was unknown. We and others hypothesized that CHARGE association is due to a genomic microdeletion or to a mutation in a gene affecting early embryonic development. In this study array- based comparative genomic hybridization (array CGH) was used to screen patients with CHARGE association for submicroscopic DNA copy number alterations. De novo overlapping microdeletions in 8q12 were identified in two patients on a genome-wide 1 Mb resolution BAC array. A 2.3 Mb region of deletion overlap was defined using a tiling resolution chromosome 8 microarray. Sequence analysis of genes residing within this critical region revealed mutations in the CHD7 gene in 10 of the 17 CHARGE patients without microdeletions, including 7 heterozygous stop-codon mutations.
    [Show full text]
  • EHD2 Is a Mechanotransducer Connecting Caveolae Dynamics with Gene Transcription
    EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription Satish Kailasam Mani, Cesar Valades-Cruz, Stéphanie Torrino, Wei-Wei Shen, Cedric Blouin, Satish Kailasam Mani, Christine Viaris de Lesegno, Pierre Bost, Alexandre Grassart, Darius Köster, et al. To cite this version: Satish Kailasam Mani, Cesar Valades-Cruz, Stéphanie Torrino, Wei-Wei Shen, Cedric Blouin, et al.. EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription. Journal of Cell Biology, Rockefeller University Press, 2018, 217 (12), pp.4092-4105. 10.1083/jcb.201801122. inserm- 02426440 HAL Id: inserm-02426440 https://www.hal.inserm.fr/inserm-02426440 Submitted on 2 Jan 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - ShareAlike| 4.0 International License REPORT EHD2 is a mechanotransducer connecting caveolae dynamics with gene transcription Stéphanie Torrino1,2,3*, Wei‑Wei Shen1,2,3*, Cédric M. Blouin1,2,3, Satish Kailasam Mani1,2,3, Christine Viaris de Lesegno1,2,3, Pierre Bost4,5, Alexandre Grassart6, Darius Köster7, Cesar Augusto Valades‑Cruz2,3,8, Valérie Chambon2,3,8, Ludger Johannes2,3,8, Paolo Pierobon9, Vassili Soumelis4, Catherine Coirault10, Stéphane Vassilopoulos10, and Christophe Lamaze1,2,3 Caveolae are small invaginated pits that function as dynamic mechanosensors to buffer tension variations at the plasma membrane.
    [Show full text]
  • Congenital Disorders of Glycosylation from a Neurological Perspective
    brain sciences Review Congenital Disorders of Glycosylation from a Neurological Perspective Justyna Paprocka 1,* , Aleksandra Jezela-Stanek 2 , Anna Tylki-Szyma´nska 3 and Stephanie Grunewald 4 1 Department of Pediatric Neurology, Faculty of Medical Science in Katowice, Medical University of Silesia, 40-752 Katowice, Poland 2 Department of Genetics and Clinical Immunology, National Institute of Tuberculosis and Lung Diseases, 01-138 Warsaw, Poland; [email protected] 3 Department of Pediatrics, Nutrition and Metabolic Diseases, The Children’s Memorial Health Institute, W 04-730 Warsaw, Poland; [email protected] 4 NIHR Biomedical Research Center (BRC), Metabolic Unit, Great Ormond Street Hospital and Institute of Child Health, University College London, London SE1 9RT, UK; [email protected] * Correspondence: [email protected]; Tel.: +48-606-415-888 Abstract: Most plasma proteins, cell membrane proteins and other proteins are glycoproteins with sugar chains attached to the polypeptide-glycans. Glycosylation is the main element of the post- translational transformation of most human proteins. Since glycosylation processes are necessary for many different biological processes, patients present a diverse spectrum of phenotypes and severity of symptoms. The most frequently observed neurological symptoms in congenital disorders of glycosylation (CDG) are: epilepsy, intellectual disability, myopathies, neuropathies and stroke-like episodes. Epilepsy is seen in many CDG subtypes and particularly present in the case of mutations
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3؅-Phosphate Kinase/PTEN Pathway1
    [CANCER RESEARCH 63, 1382–1388, March 15, 2003] Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3؅-Phosphate Kinase/PTEN Pathway1 Ana I. Jimenez, Paloma Fernandez, Orlando Dominguez, Ana Dopazo, and Montserrat Sanchez-Cespedes2 Molecular Pathology Program [A. I. J., P. F., M. S-C.], Genomics Unit [O. D.], and Microarray Analysis Unit [A. D.], Spanish National Cancer Center, 28029 Madrid, Spain ABSTRACT the cell cycle in G1 (8, 9). However, the intrinsic mechanism by which LKB1 activity is regulated in cells and how it leads to the suppression Germ-line mutations in LKB1 gene cause the Peutz-Jeghers syndrome of cell growth is still unknown. It has been proposed that growth (PJS), a genetic disease with increased risk of malignancies. Recently, suppression by LKB1 is mediated through p21 in a p53-dependent LKB1-inactivating mutations have been identified in one-third of sporadic lung adenocarcinomas, indicating that LKB1 gene inactivation is critical in mechanism (7). In addition, it has been observed that LKB1 binds to tumors other than those of the PJS syndrome. However, the in vivo brahma-related gene 1 protein (BRG1) and this interaction is required substrates of LKB1 and its role in cancer development have not been for BRG1-induced growth arrest (10). Similar to what happens in the completely elucidated. Here we show that overexpression of wild-type PJS, Lkb1 heterozygous knockout mice show gastrointestinal hamar- LKB1 protein in A549 lung adenocarcinomas cells leads to cell-growth tomatous polyposis and frequent hepatocellular carcinomas (11, 12). suppression. To examine changes in gene expression profiles subsequent to Interestingly, the hamartomas, but not the malignant tumors, arising in exogenous wild-type LKB1 in A549 cells, we used cDNA microarrays.
    [Show full text]
  • A Spontaneous Mutation in Contactin 1 in the Mouse
    A Spontaneous Mutation in Contactin 1 in the Mouse Muriel T. Davisson1*, Roderick T. Bronson1, Abigail L. D. Tadenev1, William W. Motley1, Arjun Krishnaswamy2, Kevin L. Seburn1, Robert W. Burgess1 1 The Jackson Laboratory, Bar Harbor, Maine, United States of America, 2 Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, United States of America Abstract Mutations in the gene encoding the immunoglobulin-superfamily member cell adhesion molecule contactin1 (CNTN1) cause lethal congenital myopathy in human patients and neurodevelopmental phenotypes in knockout mice. Whether the mutant mice provide an accurate model of the human disease is unclear; resolving this will require additional functional tests of the neuromuscular system and examination of Cntn1 mutations on different genetic backgrounds that may influence the phenotype. Toward these ends, we have analyzed a new, spontaneous mutation in the mouse Cntn1 gene that arose in a BALB/c genetic background. The overt phenotype is very similar to the knockout of Cntn1, with affected animals having reduced body weight, a failure to thrive, locomotor abnormalities, and a lifespan of 2–3 weeks. Mice homozygous for the new allele have CNTN1 protein undetectable by western blotting, suggesting that it is a null or very severe hypomorph. In an analysis of neuromuscular function, neuromuscular junctions had normal morphology, consistent with previous studies in knockout mice, and the muscles were able to generate appropriate force when normalized for their reduced size in late stage animals. Therefore, the Cntn1 mutant mice do not show evidence for a myopathy, but instead the phenotype is likely to be caused by dysfunction in the nervous system.
    [Show full text]
  • Dystroglycanopathies; Natural History and Clinical Observations
    Dystroglycanopathies; natural history and clinical observations Katherine Mathews, MD Disclosures • Research funding: NIH, CDC, Friedreich Ataxia Research Alliance • Clinical trial funding (current and recent): PTC Therapeutics, Serepta Therapeutics, Eli Lilly, BioMarin (Prosensa), Horizon therapeutics, , aTyr Pharma. • Advisory board member: MDA, FSH Society, Serepta Therapeutics, aTyr Pharma, Marathon. • No conflicts pertinent to today’s talk Randomly chosen photos of my Wash U connections… Trainee Attending Outline • Introduce the dystroglycanopathies • Two clinically important observations from the natural history study • Preliminary discussion of outcome measures Iowa Wellstone Muscular Dystrophy Cooperative Research Center Kevin P. Campbell, PhD Steven A. Moore, MD, PhD • Professor and Roy J. Carver • Professor of Pathology Biomedical Research Chair in Molecular Physiology and Biophysics • Professor of Neurology and Internal Medicine • Investigator, Howard Hughes Medical Institute Iowa Wellstone Muscular Dystrophy Center Wellstone Medical Student Fellows Jamie Eskuri (2010-2011) Steve McGaughey (2011-2012) Katie Lutz (2012-2013) Cameron Crockett (2013-2014) Pediatric Neurology Resident Pediatric Hospitalist Pediatric Neurology Resident Pediatric Neurology Resident Boston Children’s Hospital Washington University, St. Louis University of Iowa Washington University, St. Louis Julia Collison Braden Jensen (2014-2015) Brianna Brun (2015-2016) Courtney Carlson (2016-2017) CCOM Medical student, M1 CCOM medical student, M3 CCOM medical
    [Show full text]