US008962588B2 a2) United States Patent (0) Patent No.: US 8,962,588 B2 Olsonet al. (45) Date of Patent: *Feb. 24, 2015

(54) MICRO-RNAS THAT CONTROL MYOSIN 2009/0326049 Al 12/2009 Aristarkhovet al. EXPRESSION AND MYOFIBER IDENTITY 2010/0029003 Al 2/2010 Bartel et al. 2010/0280094 Al 11/2010 Beuvinketal. Applicant: The Board of Regents, The University (71) FOREIGN PATENT DOCUMENTS of Texas System, Austin, TX (US) EP 1777301 A2 4/2007 (72) Inventors: Erie N. Olson, Dallas, TX (US); Eva EP 1959012 A2 8/2008 van Rooij, Utrecht (NL) EP 2113567 Al 11/2009 JP 2004-522411 7/2004 (73) Assignee: The Board of Regents, The University JP 2006-502693 1/2006 of Texas System, Austin, TX (US) JP 2006-101790 4/2006 WO WO 02/10453 A2 2/2002 WO WO 03/065993 A2 8/2003 (*) Notice: Subject to any disclaimer, the term of this WO WO 2005/013901 A2 2/2005 patent is extended or adjusted under 35 WO WO 2005/017145 Al 2/2005 U.S.C. 154(b) by 147 days. WO WO 2005/078096 A2 8/2005 WO WO 2005/078139 A2 8/2005 This patent is subject to a terminal dis- WO WO 2005/079397 A2 9/2005 claimer. WO WO 2005/118806 A2 12/2005 = WO WO 2006/013561 A2 2/2006 Appl. No.: 13/796,884 WO WO 2006/047454 A2 5/2006 (21) WO WO 2006/063356 Al 6/2006 WO WO 2006/111512 Al 10/2006 (22) Filed: Mar. 12, 2013 WO WO 2006/137941 A2 12/2006 WO WO 2007/000668 A2 1/2007 (65) Prior Publication Data WO WO 2007/035684 A2 3/2007 WO WO 2007/070483 A2 6/2007 US 2013/0245092 Al Sep. 19, 2013 WO WO 2007/073737 Al 7/2007 WO WO 2007/090073 A2 8/2007 WO WO 2007/112754 A2 10/2007 Related U.S. Application Data WO WO 2008/016924 A2 2/2008 WO WO 2008/042231 A2 4/2008 (63) Continuation of application No. 12/671,436, filed as application No. PCT/US2008/071837 on Jul. 31, (Continued) 2008, now Pat. No. 8,481,507. OTHER PUBLICATIONS (60) Provisional application No. 60/952,911, filed on Jul. 31, 2007, provisional application No. 60/980,113, Chang, “International Search Report,” 4 pages, from International filed on Oct. 15, 2007, provisional application No. Patent Appl. No. PCT/US2008/071837, Korean Intellectual Property 60/980,3 14, filed on Oct. 16, 2007. Office, Daejon, Republic of Korea (mailed Nov. 27, 2009). Chenget al., “MicroRNAsare Aberrantly Expressed in Hypertrophic (51) Int. Cl. Heart,” Am.J. Pathol. 170(6):1831-1840 (2007). CIN 15/11 (2006.01) Sayedet al., “MicroRNAs Play and Essential Role in the Develop- C07H 21/02 (2006.01) ment of Cardiac Hypertrophy,” Cire. Res. 100(3):416-424 (2007). CO7H 21/04 (2006.01) Tatsuguchiet al., “Expression of MicroRNAsis Dynamically Regu- (52) US. Cl. lated During Cardiomyocyte Hypertrophy,” J. Mol. Cell. Cardiol. USPC oon ccc eesereeeeeneneenes 514/44 A; 536/24.5 42(6):1137-1141 (2007). (58) Field of Classification Search (Continued) None See application file for complete search history. Primary Examiner — Richard Schnizer (56) References Cited (74) Attorney, Agent, or Firm — Cooley LLP U.S. PATENT DOCUMENTS (57) ABSTRACT 7,232,806 B2 6/2007 Tuschlet al. 2005/0059005 Al 3/2005 Tuschlet al. 2005/0261218 Al 11/2005 Esauetal. The present invention relates to the identification of two 2006/0019286 Al 1/2006 Horvitz et al. microRNAs, miR-499 and miR-208b, that repress fast skel- 2006/0185027 Al 8/2006 Bartel et al. etal muscle contractile protein genes. Expression ofmiR-499 2007/0287179 Al 12/2007 Tuschlet al. and/or miR-208b can be usedto repress fast fiber genes and 2007/0292878 Al 12/2007 Raymond activate slow fiber genes in the treatment of musculoskeletal 2008/0050744 Al 2/2008 Brownetal. 2008/0176766 Al 7/2008 Brownetal. disorders. Inhibition of miR-499 and/or miR-208b is pro- 2008/0214437 Al 9/2008 Mohapatraetal. posed as a treatment for cardiac hypertrophy, myocardial 2009/0137504 Al 5/2009 Echwaldet al. infarction, and/or heart failure. Pharmaceutical compositions 2009/0143326 Al 6/2009 Obadet al. comprising antagonists and agonists of miR-499 and miR- 2009/0286969 Al 11/2009 Esauetal. 2009/0291906 Al 11/2009 Esauetal. 208b function are also disclosed. 2009/0291907 Al 11/2009 Esauetal. 2009/0293148 Al 11/2009 Renet al. 2009/0317369 Al 12/2009 Hosodaetal. 41 Claims, 39 Drawing Sheets US 8,962,588 B2 Page 2

(56) References Cited Sempere et al., “Expression profiling of mammalian microRNAs uncoversa subset ofbrain-expressed microRNAswith possible roles in murine and human neuronal differentiation”’ Genome Biology, FOREIGN PATENT DOCUMENTS vol. 5:R13, 2004. WO WO 2008/043521 A2 4/2008 Van Rooij et al. “A signature pattern of stress-responsive WO WO 2008/061537 A2 5/2008 microRNAsthat can evoke cardiac hypertrophy and heart failure,” WO WO 2008/074328 A2 6/2008 Proc. Natl. Acad. Sci. USA, vol. 103: 18255-18260, 2006. WO WO 2008/076324 A2 6/2008 Landgrafet al., “A mammalian microRNAexpressionatlas based on WO WO 2008/147839 Al 12/2008 small RNAlibrary sequencing,” Cell, vol. 129: 1401-1414, 2007. — WO WO 2009/026576 Al 2/2009 Landgrafet al., “A mammalian microRNAexpressionatlas based on WO WO 2009/043353 A2 4/2009 small RNA library sequencing,” Cell, Supplementary Table S12, WO WO 2009/058818 A2 5/2009 WO WO 2009/062169 A2 5/2009 2007. WO WO 2009/114681 A2 9/2009 Van Rooij et al., “Control of stress-dependent cardiac growth and WO WO 2009/149182 Al 12/2009 gene expression by a microRNA,”Science, vol. 316: 575-579, 2007. — WO WO 2010/048585 A2 4/2010 Habedanck, Supplementary European Search Report for European OTHER PUBLICATIONS Application No. 08797004.2, 13 pages, European Patent Office, Munich, mailed Sep. 16, 2011. Thum etal., “MicroRNAsin the human Heart. A Clue to Fetal Gene Lorell et al., “Left Ventricular Hypertrophy: Pathogenesis, Detection, Reprogramming in Heart Failure,’ Circulation 116(3):258-267 and Prognosis,” Circulation, vol. 102: 470-479, 2000. (2007). Olson, “Transcriptional Control of Heart Developmentand Disease,” Lagos-Quintanaet al., “New microRNAsfrom mouse and. human,” Symposium Presentation at Duke University, Sep. 26, 2006. RNA,vol. 9:175-179, 2003. Olson, Genetic Pathways in Cardiovascular Development and Dis- Lagos-Quintanaet al., “Identification of tissue-specific microRNAs ease, Symposium Presentation at University of Cincinnati, Sep. from mouse,” Current Biology, vol. 12:735-739, 2002. 2006. U.S. Patent Feb. 24, 2015 Sheet 1 of 39 US 8,962,588 B2

SPSjwISPAS 4

PWOLDATLIOLLOOV WUIODTEOLLOOVYV

UDLOOLEDLLIOVLUC POLOO

FREER

LOL

ERE

LOOUUYY

ELEY

IOS CWI

mon OU

O’DY

REE

no a)

RES

©

ovnwin EAWOYY

UU

OUND OUD

WOOO

EREREREADE ADANDOVYVVWOONDOWDTERY

EP

VD

VO

a Ov

WES

ETO TULL UE

1

O29 3D

TP

LY

“Dig

CLOW

¥ 9

LOOTOLILOVO

DD 05

GL

OOVN

ERED

Q4

38 Y¥

VO

AnnnsewoeO Yyw¥HoOAnONA

TERITERITTE

£9°Se

LOLOVOLOO LOO

LOL

L

WOOO

ALOU

BEEBE

LOO

VEE

ULE CULL

MESRE @ a

LODOI OWO OND

TLE

Sedaaees

LIOODO

LLOODO

¥

oR

OOO

ERE

LS of Q4

deomers ROS-HIL

KR 9°Bh

ODDS DODO LOD

OLELOOYOOOOOOVOE LLEIOOUILDDOOYOEL LLL

BEHRPERERER

GIMCW

LLL

(ce-on

UO

COO

(s

LODO

ar

‘on

RRR

oas)

VOL,

aI

e

Sas}

OHMS

ueluny

«sSSRoH

«BRUM

3ea Bog

{z (it fe {%

'ON

'ON "ON ‘ON

aI

UE GI UI

Os)

O85} O#S} OusS}

O UOIO POPUTTOILIO

© U.S. Patent Feb. 24, 2015 Sheet 2 of 39 US 8,962,588 B2

ODUILU

pes

:

ACSC

LEO loot

° oo 8 8 o oo 8

AVIV a on 0 WH ¢ © N ft uoissaldxe OHIN aAne(ay

cto)

Aynoesuog

=

ML yse4

Eey

aut 1OUIODILS

SSS =

Ue

==

ema

=

Aynoeuoes

|

MOIS

auL-

U.S. Patent Feb. 24, 2015 Sheet 3 of 39 US 8,962,588 B2

Ayinoesyuog

STUTLE MOIS

MNS

uisipioshyjodAH

ecenneerrnereveeemirninaecnesoenanematn

vy

2t

OOS

El

A

eg

WAVi\to)

ssa A

Aypoesu0E9 =

[aQuoA

RET

}se4

Esrey

UES] 78)

U.S. Patent Feb. 24, 2015 Sheet 4 of 39 US 8,962,588 B2

SLIvey UBWINY

Ul

Juesaid

A

UTE

s

Ler

ey SHY

uolIssaidxe

Yas

eaAeyay LE U.S. Patent Feb. 24, 2015 Sheet 5 of 39 US 8,962,588 B2

Le

jeds

leds

LelUb RLU

uoneuiquosey

PSE]

snoBojowopy IS

ucIsIax3 y

dq

4a

;

“OL

Poy-s1D

¢¢

. Mt

: Ame

: Le

'

yeds

jedg

ay a)5lIv aohy JOLOBA

odAy-PHM pexol-] Sunebie;

poaebie U.S. Patent Feb. 24, 2015 Sheet 6 of 39 US 8,962,588 B2

tet

eh Be)

i

Om

yWeay mere

LIBOLH

jeyeucen

~/+

sea

IVIBUOSAY orm

etpere

g

Sahn

“OL

LM

le

\

ul

Bee

RO

vm

trans

LL e U.S. Patent Feb. 24, 2015 Sheet 7 of 39 US 8,962,588 B2

SHA OX

80

Z-Milu

DEGLISAG Ul

Sisolgi4 BINSSSig

9

“SIg pue

AudosedAL Buimojyjos

pousiuimmig U.S. Patent Feb. 24, 2015 Sheet 8 of 39 US 8,962,588 B2

oi

Od

o1ueHsuel]

ei

LST

Oy

rApe

ULES

807-yIW

|

LUE

ULNeUlsje9

te

Event

TEs)

fe) Be

-s@

sueBsuel

eitrlenie

Mex Mri

eletcroys

L

else

uunaulgje5

Bey este

e|

U.S. Patent Feb. 24, 2015 Sheet 9 of 39 US 8,962,588 B2

tot PF

TS OT

OHI-9

MSs L610

— to:

:Bj-u9 be

Eee 3 = oO a. a s 2 2 g OHIN-d

MoOjs

Ee |

—]{_—_———— g +

re). Ue «<——

8 OHW-d -

“DIE | +

LM Pet SHI? =

1SPJ

‘VL Ree 8 Och 09 or

02 Le 3 3 a 3 = ° a

e

Ral

Re mirage

ise U.S. Patent Feb. 24, 2015 Sheet 10 of 39 US 8,962,588 B2

IUSIDILING Toyictcre

SI Bi

GOZ-MIwW

seb

soz-yiw =

6

“OTs

Me)

sii

10

edAy-pyin

emayel

UGISSIIAXA-1BAO eye)

emer = U.S. Patent Feb. 24, 2015 Sheet 11 of 39 US 8,962,588 B2

es

Oo» suet —_

SHINY

eydyje a8 +

jo LM

uONeAIIe

= be) a :Ald

LE -

- P e 009

0081 00S} 002) 006 OO£ ete

S}USABId

wisipiolAujodAu g = a FZ § oy

> se

pue

OL Ayipoequog

e}Eq ~

“SIA

' Ree

JO aus

UOISSeldd/

oeuoos aL ET

Se7-S el AnaeUOD

mom SAADI}O1 t

~

RO bc ue

msi

Ld

Tare to U.S. Patent Feb. 24, 2015 Sheet 12 of 39 US 8,962,588 B2

= > i) = &7 mA a io}bo >

Lad 1

‘S) FIG. -s

Renda ie)

i ‘e:

U.S. Patent Feb. 24, 2015 Sheet 13 of 39 US 8,962,588 B2

PST

LE CATE

Leng

LLL

S0c-HIw

v

Serle ESL syjun

Oh

el

oyoeaquoes

LS@

Bem

oer ett

et Bose

FT soued

“Old Loe

slebiel 12}3/8NS

ejosniy /

LAL

on MCAT

lle

‘ De

$se83S Buyeubis

el Ry

sjeuBis jequauidojaaegq

nid Baty

Aer Lee) U.S. Patent Feb. 24, 2015 Sheet 14 of 39 US 8,962,588 B2

sm= = . orn Oe

od -

2

miR-21 miR-195

ae

®. = oad 43 ee FIG. oS e.. mney nd ft oa o i

U.S. Patent Feb. 24, 2015 Sheet 15 of 39 US 8,962,588 B2

y MAAS

mete

l aleree

OL TPO

“S14

STtow

eh CoM HddvV9 80e-uIW

66r-y!W

q.yAw

-yr

oo ELLE

U.S. Patent Feb. 24, 2015 Sheet 16 of 39 US 8,962,588 B2

DVVOOWO

DVVIO

OVVOW

DOVVONTO

DVVOD

OVVLLLOYVOLYOVUDLYOVLLYLDLIVY--ALYOUELL

OVVLELOWVILVOYUDLYOLLE-LOLYWWWLLO

YTD

WO YO

VOLYOVVSLOSYDD-

WOLVOVYOLDOYDD-

VO

VO VO

LYOVVOLOLYOS-LO

LYOV LYOV

VOLS

VOLS

STS

LVIO- LVYOO-LOLD09--LOSVLELD

LO10D--LOVVLLLS

LO

LOLIO--LLYWELLID

LOD--LOVVLLLo

LOD

--LISVLLLOE

n

>

on on

6o

of8

Po

ens

---

aAnnSnavansvoonnowoWWoAnN

nBeeoenoea

ennnbnebnb

UVTETEL

con

Josseiduiosep

ERE

-ainjoid

2

eB

©

Pda

BoeeBnon

ofnnorbe PUe

St SIU]

“Sid

wy.

(passeidwiooun)

88S

SUL T

t

EL

en bn

O]

YOIND,

eka

pepsau

56a

nb

TL

WOODOOPDO

WELLDYVODD

DOVODDN

DOOD

BYOBNSOPDODIOLNI|NLOOOO—-—s

on

on

DYOOOD

BonSoon

s6eshS5

PREREL

aie

D

sale DOOD

Gz

ODDO

LOPOLLO LODOLLD

WOODY

nDOH5 ----

uleyo

D

LODO LLOIO

LILO -—

Aaeay

66P

WOO

LD

LO

LISI

LOND

LOD

LODDL-— LLODD—

MIU-e1d 66P

UIsoALy

Yiu

—

(sz

(oz

sipeoido.y

wnsoddoizz:on

‘ON

-ON

USBYOIYD

ueBLUNH

BSNOW

al

aI

6oq

038)

FEY OSS)

X

(iz

(0z (ez

(6L (pz

(8b

on

‘ON

‘ON

(ON :on

‘ON

ai

CI al

al

dl Gi al

03s)

oas) OFS)

OSS)

03S) O58) DAS) U.S. Patent Feb. 24, 2015 Sheet 17 of 39 US 8,962,588 B2 tiem Bapyitu Boz-HIM

Pe m eed r es 4 os

G6P

a o 2 & Wi a & o 2 x OM ad alle

Ay-PIIAA a B0e-uI Pi gl ‘Old

a0

gx

8

.

g

i

&

“(66m

qauknn

eer

HodveS:

Hie

HIG

Vv U.S. Patent Feb. 24, 2015 Sheet 18 of 39 US 8,962,588 B2

D a w+ fe

hypert &

cardiac

=ing S ss)ro 17

Ld FIG. a= oy) 2 SI o= S

a & eSa y a =

U.S. Patent Feb. 24, 2015 Sheet 19 of 39 US 8,962,588 B2

ee

Re 80¢-qlw

Aunaequog

66r-y)u 80c-uiw

1sBLj

cee

aJ9lWOo1eS

S+S—=+=

iS=o-=

NNNDNNIOVVVVVODYOOVOVYNY

VENNNONVSNDVOONNOVOVVNN sauary

Ayinoequoy IE}SSHS

MOIS oosniy

St

“DId

LC

ro

aL

- -

sme)sl

G .S

(se

(se

:ON

‘on

Pees

ar

aI

das) Sas)

aas

om U.S. Patent Feb. 24, 2015 Sheet 20 of 39 US 8,962,588 B2

syiw-oAi

Aq

uolssasdxe

cJSiN

aueh

6L °DIa

sjosnlu sjeuBbis SSIUISCIEISONSE

|

ssayg

pajyelis

\

80Z-w!lu 4.2...

jo

JequyoAuw

joljuoD

ZN GGP-YILW

soueb

\se4

cAAWN

= U.S. Patent Feb. 24, 2015 Sheet 21 of 39 US 8,962,588 B2

uv ibt vr

ee/ozsdg-ct-ure

s6/oe/dereTrate

aL) epb/vemnt

eat-ure ezz-ut sze-and

dg-zer-ure ape-aie 4

el goz-uye

°

er-ard

elle

zara

Hes o2G/eee/2Lb/Z06/G62/r6z/de~FEZ/RU %

tot-an! VOM opreure

bebe uayoFyy

ST-uF pete/goT/mr 78 82t-a 66b-dTe get-uie eot-utd ae-urd

cey-ard uaATY]

acog-UTe Torun

by LU * { 1”

2 pure

pue

PUE

zatvapt-ai

es/oz/de-ct-utd

Lovéeot-atw ‘Bog

“80g

reerune sete 49ey

sor-urd

cute occ 2e% 8

“Aey SUT

LBb/veb/oSt/OL/er-uTe

‘asnoy

‘asnoy

emmy

gota

ee-urd 0%

“oO

“UGUNY

LorcoT-utW

‘ueUNnH ‘uPUNY » oeT-an

S28 “Sia

440 ZV

eeu UT

1a

UT cy opts

sz-ara

¥

UT

HR-BIH

Eu

soz-ut

pantesuod

oe

PeAsaSUOD

se-utl

penJesunD de-zpt-anl

49° seat

0

y eat

L¥e-aye

onan

create

peure

PLO

COBESUIAUET ¥G"0 see“

PS

SIFT

SBFTPFWes

rotund sOTT_TWeJ ZTTaUISUST

t

au erat

TY: TMCS

su

£60/b2b/e5t/aT/cT-aIe

a UCoy

em eWO me mz me t szb/aoe-utl erat

z

YEN UNYTM

YRYFH YAMITU [eset

AN Perey

ar-urd LE dcet-aia

avenute

T2TSOO -E

JDJ

JOY 109

6ep/'

ar-at SZZECO

SOqTS

SORTS SOQTs o0g-ute

ter-ui WN .

pend UOC)

WN FdHUHL

i

passtosting

éz-uy

peruasuD] Pesussuoy OaNd

4

‘

WeUny auag YEOH ousy

euay

Ol > » +

bdVYHL

8409 Oro ound

4Ln Un Hn | U.S. Patent Feb. 24, 2015 Sheet 22 of 39 US 8,962,588 B2

quSewes.) skep TZ

TZ

4

fa. 2

quawes.

SHIN

skep

St

©

2

v

791P

[PAD]

GE

F

a On ¢t

ate

N1d

ZT

«

8, UOIsseidxs

‘Ola

uo

GG

> *

sheq

qUuSWed2}

shep

9

he 4

4

sAQREIDY

€E

,

¥ 2

6 O

L

L

L

L

|

Gtr

O°OT

SZ

Sz

os

0°0

JUSLUPS5]

.

.

skep

Ba

9

TZ

DHWD

St

qowesn

7®1P

ST

skep

[eAaq]

Nid

WT

2

UOISSesdxa

¢ uo

“Ora

6

sheq

9

a Aa “

DAILEIEY

aulpeseqg

vy

€

v

|

O

@ a

L

L

cae

L +

Gz't

SZ'O OS°O

oot

00°0

SLO

a

I ia i

U.S. Patent Feb. 24, 2015 Sheet 23 of 39 US 8,962,588 B2

PIOJ

PjOS PjOJ

PIO}

E°TT 8°9E GEL E°T

ce JPJ@BjOS

OIA

JeJajaHS

Ysey

ude

‘T

je}a/BxS

yses

uUlUodosy

jeyajays

‘EL

yseJ umodosy

DeipueD

eudiy ‘OW U.S. Patent Feb. 24, 2015 Sheet 24 of 39 US 8,962,588 B2

g TAB a = = a ° <<

Baseline

ee on om CO MH TF MO N SUUP) GABON

© “

© 5 TAB z 23 o g

FIG, Baseline

| { ij I | | : $a&88s8 8 8¢ & - ee SYUN BANESY

2

9 5 TAB = 8 g

Baseline

eee | anertrnqgaortag Nrrr.rwr = 8 OG So Ga SHUN eARB]EY

U.S. Patent Feb. 24, 2015 Sheet 25 of 39 US 8,962,588 B2

é,

Jossaiday

OHING 1

_.

Ajiyjoesuoo

Je]ajays

g07-yIW

soueb

SHIN? ;

Jsey

jsey

\

/

| ve Sls

802-ulu

a

jearBoyjoishyd

aueb

sjeubis

JH?

I+

peaiBojoyjed

‘jejuawidojeneq

A

I I I

I I I I

pue

| U.S. Patent Feb. 24, 2015 Sheet 26 of 39 US 8,962,588 B2

DoOnnSSo WWUWOWOU

DONNOSDOVAOWOSNNOOWWYVOOVWONS DOW

DOnNSSSwaD DennoDOWnDWOSnnOo

DENNSDS

DDANDSOWNOWOONNOOVWWNNWEnNONpoON-

(S°ON

WON

WNW

GI

wnoWwoaNnowWYYWnANYWhnOonpoaV-- WN WOW

O3S)

Woonnoo

WooOnnooW WW

WOO

80OzZ

TOW

WEY

wI

YW

Wan YYhnoWWononeon-

BR

PERRY

«LS

WhnWwnnonpoav-

noonppnvvnenvnpnvovayyyvonnoonnwwoo-wwnnndenoonn

ennonpony- Nwoanonbony-

~YaWWwOWOSW------pOWWWWwpOOnen PEAT

RENE

RON

HR

-

-

(g

(T

- -

---vnpawavaywywnaonoonnwwopywywnonopnnonn -

-

- -

--wopowawowwwwoonDonnwwooNvwnANDDNNINN - - -

48quINU

Jaquinu

-wapnvwonwnrywwnonosnnywopyywnoandennonn -vnpawnvawywaonopanrwoowWWANAoANooNAN

-whonwawovywwnonoonnwwopyywnondennonn - -YOOOYAYONWYEOONDONNYWODYYWOOADOnADAN

vnoowawaAvwYwnonDDnnwwoSwyvanadenanonn

ee AW doe

dVUHL)

dVyHL)

S@

“pid

326129 J251e3

EERE

«=6¢

aqissod aiqissod

KE

RHEKREKRKER

paypipeid

peylpeid

HHH

ST ov

(€t:ON

$(TTION

§=6(OT:ON

(9:oN §=6(zt:onarogs)

:uonoipeid (Z:on

(6:

(8'ON

ON

GI

TdVUHL

GI

a1

al

ar

di

GI

bas)

O3S)

das)

das)

das)

63s)

03S)

SBPUueYIW

Ysyesqaz

USHdIYD

yabuey

URWNH

142

sun

ULE

duuyD

nbn4

131d

60q

ey

VT ===—sWUT U.S. Patent Feb. 24, 2015 Sheet 27 of 39 US 8,962,588 B2

Bu

BSEIOJON|-TAVUHL

0Sz

B0Z

oot

wit

ULILE os

9¢@ 6uasz

“Old

O@T

aot

wil os

U.S. Patent Feb. 24, 2015 Sheet 28 of 39 US 8,962,588 B2

[B]BJOYSISeF

80¢- soueb

yu

ureyd feJE}OHS [_

I

yUbrq

1se4 ursoAy

SHUN @AHEIOY £¢

Sls JeeJEHS

*L

OM

uruodosy

LAK JSey

SUUP) SAHEOY }PJS}eyHS

“|

utuodosy jseq

r -

r

O04

OFL 82h

SLU SARE[AY U.S. Patent Feb. 24, 2015 Sheet 29 of 39 US 8,962,588 B2

A AIT DHING

PDD SdPoVO DOPOD SDOVILOILOLLILS

DLS

OVLLOLILSLLOOYYYLYO qg0z-yiu

VO

LOLS

SAY JO

LOLO

LOLOLLID LOLDLLLD

NOONHASSYVVYOVVOOVOVTOY

LOLLLO LE

LLL

n

2 UosU!

Seenenee

nnnénenn

OVEYWOTUS, OVYV

OWUYUOWYDO ovuvwoue DUN

YWOVWOOVOVWLY

WOUND

BwD

o6e 2D

bon

no UII

8¢

qn DVOVWLWLYWO

JWOVWLVLYVO

OWDWWLWLYWO

DWOVULYLO

VOWWLYLYWD

seeeebSnnn

Snnnnnofee ©

“DIa

SET

fe (MIT

&

ze

LUD

2

A pazedo]

LLY NAIA MTLUUHIL

nonbebb5

VOLYOLILLE OO YOLYS YO LOLYOOLLIA SHeonono

onB 5

LIS

6

LVOLOLLL LVS ULIMIT

LO.LLLL

LOLLL LOLLL

o--

Si qgoz-yIW a807-ylw

G807-Ulwi-oad

syecedog,

unssodo(re

UEUNH

@SNOW

Boa

Wa

*x (22

(OE (TE (Ze (ce (Se ‘ON

‘ON

1ON

‘ON *ON ‘ON

‘ON

(9¢ dI

dI

AI CI AI dr dI

‘on

Ogs)

ous)

ous) oas) ous)

Oas) as)

aI

a5) U.S. Patent Feb. 24, 2015 Sheet 30 of 39 US 8,962,588 B2

(2

(§

1ON (ON

GT

at

O85)

das)

NPNNNPOSVYUVOVYODYOVWOW NDNOSDDYVYWWOOYDPYO

cut

ooo

um TMT

-— MITT

PUBIS

PUBl}s

Selaray

Salata

ett

ANCIENT

tydars

YUN

qgoz7-Mw

gOZ-uIW

LULA

gq

A

sepnooesyxe

STE qzudu

1U0Aiqua

auSb jeqeuad

ty

6%

ay

Agbs

eudje eye

BVaq

‘OIA

eo°tz

ail

x11

BI

UISOA]

‘¢ ‘pL

‘gud ‘puAW

‘LUA ‘ZUAW ‘eyAy ‘J ‘guéy

LL

LUA

yA UAW

O01

GEO

IOP)

ET

8Lb

j

ray wi

sew

CS @sibr'st (@arhevor aw

YY

Ul

ZA

OY

a varays

U.S. Patent Feb. 24, 2015 Sheet 31 of 39 US 8,962,588 B2 flid 66P-uiel g0c we RN 0¢

“Sls agnz- er

Hil

une

Fes

Qe

22

qi

uaw

=

e ~

*

g

e z “a3 It

EE t22 WL = dD see snpjog

e <

3 Heo

5 a

8 o¢ Sh 2 aL

QRGE~HIS

BOT-HNE

Abbe

FE fel

OHIN=

wit

3 2

aa

Be a eo oo U.S. Patent Feb. 24, 2015 Sheet 32 of 39 US 8,962,588 B2

St

elem eye

eR

€173

AS

Nld

Bods

Let ee

erey

Nid

Merce

nm

Comolli wa»

jeuuoU

.

elere qgot-alw

66P-yluW

soc-ulu

key

me U.S. Patent Feb. 24, 2015 Sheet 33 of 39 US 8,962,588 B2

SCL

SAeP

TZ

Roy

UVM

ee

sAep

PRM

ST

ee

emtelil-](alel-emey

‘Od

sAepe

aL

skep

‘

e

0

Awe]

qgoz-alw soc-yiu

he U.S. Patent Feb. 24, 2015 Sheet 34 of 39 US 8,962,588 B2

80¢-uiur RCey hy

sed UNIV euog Es BIBWIODIES Sats

Fes LIER

pos sauey

«,

IEeIONS

eyAt

| aosniy

e11U0 (RCL

e€€ MUM

“Old ey

l=] [telco

Mts

ict 10d 80z-uIW

DL pyAOe

LM LEE

_ 66P-ylwW qgoz-unu qsoz-ulw

V

T y U.S. Patent Feb. 24, 2015 Sheet 35 of 39 US 8,962,588 B2

Buljapouies

osty

jeaibojouzed rf

“480c-ut

mr sEoireta(@

seipseo

eee

Beer) oy

OS1Y-667-ay!w

ve

WK

_ BLO

|

“DIA

VEC)

qZOHW

UIST

OS1u:807-wIul rey

_ NTR

vd

MV

|

Sum U.S. Patent Feb. 24, 2015 Sheet 36 of 39 US 8,962,588 B2

q80e-ylwu

THWweg

IHweg we

{

feces [eae

«

———

Lely

£ “

qx

Ae

i

£°9 . qy

TOT

LemiVeLL-e

d XO1

dq

9z

d

THES Inujfed

X01

*

i

Lom

q4

ole]

™

6'b

uoneuiquiosay

IHweg

pt=)

snoBbojowopH

|

eel

*

-a

El odAq-PIEM

pajaiuey Bunjebiel

BIPHV

SPly

AOJIIA

qeod-ulu

Fr} wo1yD U.S. Patent Feb. 24, 2015 Sheet 37 of 39 US 8,962,588 B2

ez

ron

uz

at

tox

ois)

at

SMIW-OAI

NNNONWOSNOWOSNONOWOWTwToON

is

03)

sonar

DDOANNDDWYWWOVWD

ois)

NONNODWVWVVVODTOOWOTvnV

OU}

S}ejndiuew

yoeoidde

9€

“DIA

Oo}

OVD

sayseoudde

,aBuods,

VVOV:98072 *80c-a 667-aTw

ajosnu

~a Ful Tul

OAJA

[233]394S

uf U.S. Patent Feb. 24, 2015 Sheet 38 of 39 US 8,962,588 B2

Aare

Ce

LOS

jurinw

gesan

ON

LA

ae

ays

- yee

Bogor

ZN

peey

INDY

Begg,

ee

ogden

dA,

BL

ee

LAA

Bu

BIN

nw

26

ge

Old

66p

JURLA

Ww

OUS

q

BOAIGMIA

C45)

SZ

ad] eqnyeh

BRE

HAA

+

U.S. Patent Feb. 24, 2015 Sheet 39 of 39 US 8,962,588 B2

A = 80 D ild-type MCK Tg miR-499 3 , ‘ — 5€ 70 miR-499 5 60 WT 3°?¢ a miR-499: g2BS 40 i S530 oe g 20 MCKTg = 40 miR-499 o i 8 Baa 6oO FG= al x= Gs w

C BMHC Tnni2 TnnT3 E PTU ° _ “ miR-499 _ Tg 50 . 12 miR-208 WT KO wWTKO WT KO : “oy 1 1 40 0.8: 30: 0.8 36 8 miR-499

o4 04 10 oe 0.2

a 0 o rpenk wg roh gal twa go ga°rG ga°"R 30rd miR-208b =i 6 x=s rs a ” “ 2500 2000] WT F 15004 Ml KO TnnT3 Tnnl2 1000+ 140 ml pMHC regular chow PiU PIU & 120 7 miR-499 Tg 100 - 80 - 60 - 40 4 20 4

0

WT KO KO & WT KO KO & miR-499 Tg miR-499 Tg

PIG. 39

US 8,962,588 B2 1 2 MICRO-RNAS THAT CONTROL MYOSIN With respect to cardiac hypertrophy, one theory regards EXPRESSION AND MYOFIBER IDENTITY this as a disease that resembles aberrant developmentand,as such,raises the question ofwhether developmentalsignals in CROSS-REFERENCE TO RELATED the heart can contribute to hypertrophic disease. Cardiac APPLICATIONS hypertrophy is an adaptive response of the heart to virtually all forms of cardiac disease, including those arising from This application is a continuation of U.S. application Ser. hypertension, mechanical load, myocardial infarction, car- No. 12/671,436, filed Jun. 25, 2010, whichis a national stage diac arrhythmias, endocrine disorders, and genetic mutations in cardiac contractile protein genes. While the hypertrophic application of International Application No. PCT/US2008/ response is initially a compensatory mechanism that aug- 071837, filed Jul. 31, 2008, which claims the benefit of U.S. Provisional Application No. 60/952,911, filed Jul. 31, 2007; ments cardiac output, sustained hypertrophy can lead to dilated cardiomyopathy (DCM), heart failure, and sudden US. Provisional Application No. 60/980,113, filed Oct. 15, 2007, and U.S. Provisional Application No. 60/980,3 14, filed death. In the United States, approximately half a million individuals are diagnosed with heart failure each year, with a Oct. 16, 2007, all of which are herein incorporated by refer- encein their entireties. 15 mortality rate approaching 50%. The causes andeffects of cardiac hypertrophy have been extensively documented, but STATEMENT OF GOVERNMENT SUPPORT the underlying molecular mechanisms have not been eluci- dated. Understanding these mechanismsis a major concern in This invention was made with grant support undergrantno. the prevention and treatment of cardiac disease and will be HL53351-06 from the NationalInstitutes of Health. The gov- crucialas a therapeutic modality in designing new drugsthat ernmenthas certain rights in the invention. specifically target cardiac hypertrophy andcardiac heart fail- ure. DESCRIPTION OF THE TEXT FILE SUBMITTED Treatment with pharmacological agents representsthepri- ELECTRONICALLY mary mechanism for reducing or eliminating the manifesta- 25 tions of heart failure. Diuretics constitute the first line of The contents of the text file submitted electronically here- treatment for mild-to-moderate heart failure. If diuretics are with are incorporated herein by reference in their entirety: A ineffective, vasodilatory agents, such as angiotensin convert- computer readable format copy ofthe Sequence Listing(file- ing enzyme (ACE) inhibitors(e.g., enalopril and lisinopril) or name: MIRG 004 03US SeqList ST25.txt, date recorded: inotropic agent therapy (i.e., a drug that improves cardiac Mar. 12, 2013 file size 9 kilobytes). 30 output by increasing the force ofmyocardial muscle contrac- tion) may be used. Unfortunately, many of these standard FIELD OF THE INVENTION therapies have numerous adverse effects and are contraindi- cated in some patients. Thus, the currently used pharmaco- The present invention relates generally to the fields of logical agents have severe shortcomingsin particular patient developmental biology and molecular biology. More particu- 35 populations. The availability ofnew,safe and effective agents larly, it concerns gene regulation and cellular physiology in would undoubtedly benefit patients who either cannot use the cardiomyocytes and skeletal muscle cells. Specifically, the pharmacological modalities presently available, or who do invention relates to the inhibition of a MEF2-dependent not receive adequate relief from those modalities. miRNAthatresults in reduced expression of }-myosin heavy The ratio of a- to B-MHCisoforms in the adult heart is a chain B-MHC) as well as a second miRNA that is co-ex- 40 major determinant of cardiac contractility. }-MHC,the major pressed with B-MHCInhibiton of these miRNAsprovides a myosin isoform in the adult heart, displays relatively low treatmentfor cardiac hypertrophy and heart failure. Also con- ATPase activity, whereas a-MHChas high ATPaseactivity. templated is up-regulation of these two miRNAsto treat In responseto a variety of pathological stimuli such as myo- musculoskeletal diseases where fast-to-slow muscle fiber cardialinfarction, hypertension, and other disorders, }-MHC switch is desired. 45 expression increases, while a-MHC expression decreases with a consequent reduction in myofibrillar ATPase activity BACKGROUND OF THE INVENTION and reduced shortening velocity ofcardiac myofibers, leading to eventual contractile dysfunction. Remarkably, minor Heart disease and its manifestations, including coronary changes in a-MHCcontentof the heart can have a profound artery disease, myocardial infarction, congestive heart failure influence on cardiac performance. and cardiac hypertrophy, clearly presents a major health risk Numerous signaling pathways, especially those involving in the United States today. The cost to diagnose, treat and aberrant calcium signaling, drive cardiac hypertrophy and support patients suffering from these diseases is well into the pathological remodeling (Heineke & Molkentin, 2006). billions of dollars. Two particularly severe manifestations of Hypertrophic growth in responseto stress involves different heart disease are myocardial infarction and cardiac hypertro- signaling pathways and gene expression patterns than physi- phy. With respect to myocardial infarction, typically an acute ological hypertrophy as occurs in response to exercise. thrombocytic coronary occlusion occurs in a coronary artery Stress-mediated myocardial hypertrophy is a complex phe- as a result of atherosclerosis and causes myocardial cell nomenon associated with numerous adverse consequences death. Because cardiomyocytes, the heart muscle cells, are with distinct molecular and histological characteristics caus- terminally differentiated and generally incapableof cell divi- ing the heart to fibrose, dilate and decompensate which, sion, they are generally replaced by scar tissue when they die through myocyte degeneration and death, often culminates in during the course of an acute myocardial infarction. Scar heart failure. As such, there has been intense interest in deci- tissue is not contractile, fails to contribute to cardiac function, phering the underlying molecular mechanismsand in discov- and often plays a detrimentalrole in heart function by expand- ering novel therapeutic targets for suppressing adverse car- ing during cardiac contraction, or by increasing the size and diac growth. effective radius of the ventricle, for example, becoming Adult skeletal muscle fibers can be categorized into fast hypertrophic. and slow twitch subtypes based on specialized contractile and US 8,962,588 B2 3 4 metabolic properties. These properties reflect the expression target prediction models. Although increasingly sophisti- of specific sets of fast and slow contractile protein isoforms of cated computational approachesto predict miRNAsandtheir myosin heavy andlight chains, tropomyosin, and troponins, targets are becoming available, target prediction remains a as well as myoglobin (Naya et al., 2000). Slow-twitch major challenge and requires experimental validation. muscles are primarily used in chronic activities such as pos- Ascribing the functions of miRNAsto the regulation of spe- ture maintenance and sustained locomotor activity. Fast- cific mRNAtargets is further complicated by the ability of twitchfibersare used primarily for high-force burst activities. individual miRNAsto base pair with hundreds of potential The adult skeletal muscle phenotypeis not static but instead high and low affinity mRNA targets and by the targeting of retains the ability to adjust to variations in load bearing and multiple miRNAs to individual mRNAs. Enhanced under- contractile usage patterns, resulting in adaptations in mor- 10 standing ofthe functions ofmiRNAswill undoubtedly reveal phology, phenotype, and contractile properties. For example, regulatory networks that contribute to normal development, the removalofbody loading in the microgravity environment differentiation, inter- and intra-cellular communication,cell of space flight results in a marked degree of muscle atrophy cycle, angiogenesis, apoptosis, and manyother cellular pro- and an altered protein phenotype that correlates with a slow- cesses. Recently, the inventors reported a cardiac-specific to-fast change in contractile and metabolic properties for both 15 microRNA, miR-208, which is encoded by an intron of the rodents and humans(Tsika et al., 2002; Baldwin and Haddad, a-myosin heavy chain (MHC) gene, andis required for up- 2001; Edgerton and Roy, (2000); Fitts et al., 2000). regulation of B-MHCexpression in responseto cardiac stress Disuse atrophy, which is a muscular atrophy that results and for repression of fast skeletal muscle genes in the heart from lack ofmuscle use, is typically seen in bedridden people, (see co-pending application WO2008/016924, which is people with limbs in casts, or those whoare inactive for other 20 herein incorporated by reference in its entirety). The present reasons. Disruptions in myofiberelectrical activity, including invention expands on the involvement of microRNAsin the denervation, also lead to muscle atrophy. After short periods heart and skeletal muscle. of disuse, muscle atrophy is reversible. Extreme disuse of a muscle, however, may result in a permanentloss of skeletal SUMMARY OF THE INVENTION muscle fibers and the replacementof those fibers by connec- 25 tive tissue. It is contemplated that by repressing fast fiber The inventors have discovered key roles of microRNAsas genesin skeletal muscle and thereby activating the reciprocal regulators of the growth, function and stress responsiveness expression of slow fiber genes, the symptomsof muscleatro- of the heart, revealing undiscovered regulatory mechanisms phy may be reduced or prevented. There is also a positive and potential therapeutic targets for heart disease. Accord- correlation of insulin resistance (a deficiency of insulin- 30 ingly, the present invention provides a method of treating stimulated glucose uptake seen in patients with type I] diabe- pathologic cardiac hypertrophy, heart failure, or myocardial tes mellitus) with the percentage of slow-versus fast-twitch infarction in a subject in needthereof. In one embodiment, the muscle fibers. method comprises identifying a subject having cardiac hyper- MicroRNAshave recently been implicated in a numberof trophy, heart failure, or myocardial infarction; and inhibiting biological processes including regulation of developmental 35 expression or activity of miR-499 and/or miR-208b in heart timing, apoptosis, fat metabolism, and hematopoietic cell cells of said subject. In another embodiment, the method differentiation among others. MicroRNAs (miRs) are small, further comprises administering to the subject a second non-protein coding RNAsof about18 to about 25 nucleotides therapy. The second therapy may be, for example, a beta in length thatare derived from individual miRNA genes, from blocker, an ionotrope, a diuretic, ACE inhibitor, AII antago- introns of protein coding genes, or from poly-cistronic tran- 40 nist, BNP, a Ca**-blocker, and ERA, or an HDACinhibitor. scripts that often encode multiple, closely related miRNAs. In some embodiments of the invention, inhibiting the See review of Carringtonet al. (2003). MiRsact as repressors expression or activity of miR-499 and/or miR-208b com- of target mRNAsby promoting their degradation, when their prises administering an antagomir of miR-499 and/or miR- sequences are perfectly complementary, or by inhibiting 208b. In one embodiment, the present invention provides a translation, when their sequences contain mismatches. 45 miR-499 or miR-208b antagomir. In another embodiment, miRNAsare transcribed by RNA polymeraseII (pol II) or miR-499 and/or miR-208b expression oractivity is inhibited RNA polymeraseIII (pol IIT; see Qi et al. (2006) Cellular & by administering an antisense oligonucleotide that targets the Molecular Immunology Vol. 3:411-419) andarise from initial mature miR499 and/or miR-208b sequence. In yet another transcripts, termed primary miRNA transcripts (pri-miR- embodiment, miR-499 and/or miR-208b expressionor activ- NAs), that are generally several thousand bases long. Pri- 50 ity is inhibited by administering an inhibitory RNA molecule, miRNAsare processed in the nucleus by the RNase Drosha wherein the inhibitory RNA molecule comprises a sequence into about 70- to about 100-nucleotide hairpin-shaped pre- having identity to the mature miR-499 and/or miR-208b cursors (pre-miRNAs). Following transport to the cytoplasm, sequence. The inhibitory RNA molecule maybe a ribozyme, the hairpin pre-miRNAis further processed by Dicer to pro- siRNA or shRNA molecule. duce a double-stranded miRNA. The mature miRNAstrand is 55 The present invention also provides a methodofpreventing then incorporated into the RNA-induced silencing complex pathologic hypertrophy or heart failure in a subject in need (RISC), where it associates with its target mRNAs by base- thereof comprising identifying a subjectat risk ofdeveloping pair complementarity. In the relatively rare cases in which a pathologic cardiac hypertrophyor heart failure; and inhibit- miRNA base pairs perfectly with an mRNAtarget, it pro- ing expression or activity of miR-499 or miR-208b in heart motes mRNA degradation. More commonly, miRNAs form 60 cells of said subject. In one embodiment, inhibiting com- imperfect heteroduplexes with target mRNAs, affecting prises delivering to the heart cells an inhibitor of miR-499 or either mRNAstability or inhibiting mRNAtranslation. miR-208b. In another embodiment, the subject at risk may The 5' portion of a miRNAspanning bases 2-8, termed the exhibit one or more risk factors selected from the group ‘seed’ region, is especially important for target recognition consisting of long standing uncontrolled hypertension, (Krenz and Robbins, 2004; Kiriazis and Kranias, 2000). The 65 uncorrected valvular disease, chronic angina, recent myocar- sequence of the seed, together with phylogenetic conserva- dial infarction, congenital predisposition to heart disease, and tion of the target sequence, forms the basis for many current pathological hypertrophy. US 8,962,588 B2 5 6 Antagomirs, antisense oligonucleotides, inhibitory RNA decreased according to the methods of the present invention molecules, or other modulators of miR-499 or miR-208b include: troponin 12; troponin T3, myosin light chain, or expression or activity may be administered by any method alpha skeletal actin. knownto those in the art suitable for delivery to the targeted Thepresent invention also encompassesa transgenic, non- organ, tissue, or cell type. For example, in certain embodi- human mammal, the cells ofwhichfail to express a functional ments of the invention, the modulator of miR-499 or miR- miR-499 and/or miR-208b. In another embodiment, the 208b may be administered by parenteral administration, such invention provides a transgenic, non-human mammal, the as intravenousinjection, intraarterial injection, intrapericar- cells of which comprise a miR-499 and/or miR-208b coding dial injection, or subcutaneous injection, or by direct injec- region underthe control of a heterologous promoteractive in tion into the tissue (e.g., cardiac tissue, skeletal muscle tis- the cells of said non-human mammal. In some embodiments, sue). In some embodiments, the modulator of miR-499 or the mammalis a mouse. miR-208b may be administered by oral, transdermal, intrap- The present invention provides a methodfor identifying a eritoneal, subcutaneous, sustainedrelease, controlled release, modulator ofmiR-499 and/or miR-208b. In one embodiment, delayed release, suppository, or sublingual routes of admin- the method comprises contacting a cell with a candidate sub- istration. In other embodiments, the modulator ofmiR-499 or stance; assessing miR-499 and/or miR-208b activity or miR-208b may be administered by a catheter system. expression; and comparing the activity or expression in step The present invention also contemplates a methodoftreat- (b) with the activity or expression in the absence ofthe can- ing or preventing a musculoskeletal disorder in a subject in didate substance, wherein a difference between the measured need thereof. In one embodiment, the method comprises 20 activities or expression indicates that the candidate substance identifying a subject having or at risk of a musculoskeletal is amodulator ofmiR-499 and/or miR-208b. The cell may be disorder; and increasing the expression and/or activity of contacted with the candidate substancein vitro or in vivo. The miR-499 and/or miR-208b in skeletal muscle cells of said candidate substance may be a protein, a peptide, a polypep- subject. The musculoskeletal disorder may include, for tide, a polynucleotide, an oligonucleotide, or small molecule. example, disuse atrophy, muscle wasting in responseto anti- The modulator ofmiR-499 and/or miR-208b maybe an ago- gravity, and denervation. In some embodiments, increasing nist or antagonist of miR-499 and/or miR-208b. The modu- the expression and/or activity of miR-499 and/or miR-208b lator of miR-499 and/or miR-208b may be an agonist or comprises administering to said subject a polynucleotide antagonist of an upstream regulator of miR-499 and/or miR- comprising a mature miR-499 and/or mature miR-208b 208b, such as miR-208. sequence. In other embodiments, increasing the expression The presentinvention also provides a pharmaceutical com- and/or activity of miR-499 and/or miR-208b comprises position comprising an inhibitor of miR-499 and/or miR- administering to said subject an expression vector that 208b. The inhibitor may be an antagomir,an antisense oligo- encodes miR-499 and/or miR-208b. In another embodiment, nucleotide, or an inhibitory RNA molecule. In another the method further comprises administering to the subject a embodiment, the present invention provides a pharmaceutical 35 non-miR-499 or miR-208b therapy. composition comprising a polynucleotide containing a In one embodiment, the present invention provides a mature sequence of miR-499 and/or miR-208b. The poly- methodof regulating cardiac or skeletal muscle contractility nucleotide may be contained within an expression vector. comprising administering a modulator of miR-499 and/or miR-208b expression or activity to heart or skeletal muscle 40 BRIEF DESCRIPTION OF THE DRAWINGS cells. In another embodiment, there is provided a method of regulating cardiac contractile protein gene expression com- The invention maybe better understood by reference to one prising administering a modulator of miR-499 and/or miR- or more of these drawings in combination with the detailed 208b expressionoractivity to heart cells. In another embodi- description of specific embodiments presented herein. ment, there is provided a method ofregulating skeletal muscle 45 FIG. 1A-B. miR-208 is encoded by the a-MHCgeneandis contractile protein gene expression comprising administering expressed specifically in the heart. (FIG. 1A) MiR-208 is a modulator of miR-499 and/or miR-208b expression or encoded within an intron of the a-MHCgene.Asterisks indi- activity to skeletal muscle cells. In still another embodiment, cate sequence conservation. (FIG. 1B) Detection ofmiR-208 the present invention provides a method of inducing a fiber transcripts by Northern analysis of adult mousetissues. U6 type switch of a skeletal muscle cell comprising administer- mRNAservesas a loading control. ing a modulator of miR-499 and/or miR-208b expression or FIG. 2A-B. Regulation ofa- and B-MHC.(FIG. 2A) Regu- activity to the skeletal muscle cell. The modulator may be an lation of class switch by thyroid hormone and TRE.(FIG. 2B) agonist or an antagonist ofmiR-499 and/or miR-208b expres- Model for stress/hypothyroidism in fast-to-slow muscle fiber sion or activity. In some embodiments, the expression of contractility switch. THRAP1, PURbeta, myostatin (a.k.a. GDF8), Sox 6 and fast FIG. 3. Detection of miR-208 in humanheart. Transcripts contractile proteins are increased in a cell by contacting the for a-MHC and miR-208 were detected by Northern blot of cell with a miR-499 inhibitor. In other embodiments, expres- cardiac tissue from six normalindividuals andsix individuals sion of THRAP1, PURbeta, myostatin, Sox 6 and fast con- with idiopathic cardiomyopathy. A close correlation exists tractile proteins are decreased in a cell by contacting the cell betweenthe level ofexpression of a-MHCand pre-miR-208, with a miR-499 agonist. In another embodiment, the expres- whereas mature miR-208 expression is maintained after the sion ofSp3, Myostatin, PURbeta, THRAP1, andfast contrac- latter has been down-regulated. tile proteins are increasedin a cell by contacting the cell with FIG. 4A-B. Generation of miR-208 mutant mice. (FIG. a miR-208b inhibitor. In still another embodiment, the 4A) Strategy to generate miR-208 mutant mice by homolo- expression of Sp3, Myostatin, PURbeta, THRAP1, and fast gous recombination. The pre-miRNA sequence wasreplaced contractile proteins are decreased in a cell by contacting the with aneomycin resistance cassette flanked by loxP sites. The cell with a miR-208b agonist. Examples of fast skeletal neomycin cassette was removed in the mouse germline by muscle contractile protein genes that may be increased or breeding heterozygous mice to transgenic mice harboring the US 8,962,588 B2 7 8 CAG-Cre transgene. (FIG. 4B) Detection of miR-208 tran- FIG. 20. miR-499 regulates myosin switching and fiber scripts by Northern analysis of hearts from wild-type and type identity by targeting THRAP1, PURbeta and GDF8 miR-208 mutant mice. (a.k.a myostatin). FIG. 5. Western analysis of a-MHC and B-MHCprotein FIG. 21A-C Inhibition of a-MHC expression leads to levels in hearts of neonatal mice of the indicated genotypes. decreased levels of miR-208. (FIG. 4A-B) Relative expres- Two mice of each genotype were analyzed. GAPDH was sion levels for a- and B-MHCtranscripts at 0, 3, 6, 9, 12, 15, detected as a loading control. 18 and 21 days of PTU exposure. (FIG. 4C) Northern blot FIG. 6. MiR-208~- mice show reduced cardiac hypertro- analysis ofmiR-208 in cardiac rat tissue at the indicated time points during PTU treatment. phyin responseto pressure overload. Histological sections of FIG. 22. Upregulation of fast skeletal genes in miR-208 hearts of wild-type and miR-208-* mice stained for Masson knock-out. trichrome. The absence of miR-208 diminishes hypertrophy FIG. 23. Dysregulation of cardiac stress response genes in and fibrosis seen in wild-type mice subjected to TAB for 21 miR-208 knock-out mice. days. Scale bar equals 2 mm in top panel and 20 um for FIG. 24. A modelfor the role of miR-208 in cardiac gene bottom panel. 15 regulation. The a-MHC gene encodes miR-208, which nega- FIG. 7. MiR-208-mice show reduced cardiac hypertro- tively regulates expression of THRAP1 and skeletal muscle phy in response to calcineurin activation. Histological sec- genes amongadditionaltargets. The a- and B-MHC genesare tions of hearts of 6 week-old mice expressing a calcineurin linked and miR-208is required for up-regulation of B-MHC transgene (CnA-Tg) and hearts of miR-208-"; CnA-Tg in response to stress signaling and blockade to T3 signaling stained for Masson trichrome. Absence of miR-208 dimin- by PTU.a- and B-MHC promote fast and slow contractility, ishes hypertrophy and fibrosis seen in CnA-Tg mice. Scale respectively. bar=2 mm for top panel, 20 um for bottom panel. FIG. 25. THRAP1 as a predicted target of miR-208. FIG. 8. Mir-208-" mice fail to up-regulate B-MHC in Sequence alignment of putative miR-208 binding site in 3' response to Thoracic Aortic Banding (TAB)and calcineurin UTR ofTHRAP!1 showsa high level of complementarity and activation. 25 sequence conservation (SEQ ID NOS: 6-13). FIG. 9. Western analysis ofa and B-MHCproteinlevels in FIG. 26. 3' UTR THRAP!1 luciferase assay. Expression of adult wild-type and miR-208 transgenic animals. GAPDH a luciferase gene containing the 3' UTR of THRAP!1 is wasdetected as a loading control. decreasedin cells co-transfected with miR-208, but not miR- FIG. 10. MiR-208-~ mice fail to up-regulate B-MHC in 126 (control). FIG. 27. Up-regulation of fast skeletal muscle genes in response to hypothyroidism with propylthiouracil (PTU) hearts of miR 208 mutant mice. treatment. FIG. 28. Structure of the Myh7 locus 6-MHC) and the FIG. 11. Schematic diagram of the role of miR-208 in the position of the miR-208b coding region within it (SEQ ID control of B-MHCexpression. NO: 27 and SEQ ID NOS: 30-36). FIG. 12. Schematic diagram of the role of miR-208 in the FIG. 29A-B. miR-208 and miR-208b developed due to a regulation of B-MHCand fast skeletal muscle gene expres- genomic duplication of the myosin heavy chain genes (myh6 sion via Thrap1. and myh7, aka a-MHC and 6-MHC). miR-208 and miR- FIG. 13. Mechanismsofaction of microRNAsduring car- 208b are co-expressed with a-MHC and B-MHC (FIG. 29A) diac hypertrophy. and share a homologousseed region althoughthetotal mature FIG. 14. Northern blot showing expression of miR-499 in 40 miR5 differ by 3 bases in sequence (FIG. 29B) (SEQ ID NO: hearts of wild-type, miR-208-’~ and miR-208~’~ mice. There 27 and SEQ ID NO:5). is a direct correlation between the expression ofmiR-208 and FIG. 30A-D. The myomiRsare co-expressed and co-regu- miR-499, as well as Myh7b in wild-type and mutant mice. lated with their myosin host-gene. (FIG. 30A) Northern FIG. 15. Structure of the Myh7b locus andthe position of analysis showsthat mir-208b is expressed at very low levels the miR-499 coding region within it. 45 in the heart at baseline conditions and1s not expressedin fast FIG. 16A-D. miR-208 regulates cardiac myh7b expres- skeletal muscle fibers, such as gastrocnemius/plantaris (GP), sion. (FIG. 16A) Myh7b, like miR-499, is specifically tibialis anterior (TA) or extensor digitorum longus (EDL). expressed in the heart and slow skeletal muscle (soleus). MiR-208b is highly expressed in the slow skeletal muscle (FIG. 16B) Real-time PCRanalysis for miR-499 on heart and soleus. (FIG. 30B) Realtime PCR analysis for the indicated 4 skeletal muscle types (gastrocnemius/plantaris (GP), tibi- myosin genes showsthat blockade ofthyroid receptorsignal- alis anterior (TA) extensor digitorum longus (EDL), or ing by feeding animals PTU-containing chow represses soleus) confirms that miR-499 is predominantly expressed in a-MHCand induces B-MHCexpression in cardiac tissue of the heart and soleus. Only minorlevels of miR-499 expres- rats. This effect can be reversed by subsequent supplementa- sion can be detected in TA and EDL. (FIG. 16C) In situ tion of thyroid hormone(T3). The expression of myh7b mir- hybridization indicates that during embryogenesis, myh7b is rors the expression pattern of 8-MHCto a lesser extent. (FIG. specifically expressed in the heart and somites. (FIG. 16D) 30C) Shortly after birth there is a shift from B-MHC towards Northern blot analysis for both wild-type and miR-208 more a@-MHC. While miR-208 is responsible for miR-499 mutant animals shows that in the absence of miR-208, the activation in adult heart, Northern blot analysis on cardiac expression of miR-499 is specifically absent in the heart, samples of pl, p6 and adult wild-type and miR-208 mutant while it is still expressed in soleus (lowerblot). 60 animals indicate the presence of miR-208b, generated from FIG. 17. Northern blot showing expression of miR-499 in the B-MHCgene,to be sufficient to drive miR-499 expression wild-type mice with heart disease. MI, myocardialinfarction. even in the absence of miR-208. (FIG. 30D) Northern blot CnA Tg, calcineurin transgenic mice. analysis for the myomiRsindicates that miR-208b mirrors the FIG. 18. Schematic diagram of the regulation of miR-499 reduced induction of 8-MHC in responseto stress signaling by miR-208 in cardiac muscle. 65 in the absence of miR-208. MiR-208 knockout animals exert FIG. 19. Schematic diagram of the regulation of miR-499 a reduced increase in B-MHC in response to stress and by miR-208 in both cardiac and skeletal muscle. hypothyroidism. While northern analysis shows a severe US 8,962,588 B2 9 10 induction of miR-208b in wild-type (WT) animals in level of miR-499 in all muscle types. (FIG. 38B) Real-time response to PTU,the induction ofmiR-208bin the absence of PCRanalysis showsthat transgenic overexpression results in miR-208 (knockout, KO) is only minor. Note that the pres- effective overexpression of miR-499 comparedto the base- ence of either 208a or 208b is sufficient to activate myh7b/ line cardiac expressionlevel, with the highest levels in the fast miR-499. skeletal muscle types (GP, TA and EDL). (FIG. 38C) Real- FIG. 31. Hypothyroidism with PTU treatment strongly time PCR analysis on muscle tissue of either wild-type or induces miR-208b expression. Although miR-208b, like transgenic animals showsthat overexpression of miR-499is B-MHC,is hardly expressed in the heart under baseline con- sufficient to drive B-MHCexpression in soleus, TA and EDL, ditions, its expression is strongly induced in response to while it represses fast skeletal troponin 12 (TnnI2) and T3 hypothyrodism. This induction can be reversed by subse- 10 (TnnT3) in heart, soleus and EDL. (FIG. 38D) Metachro- quent supplementation of thyroid hormone (T3). matic ATPasestaining of snap-frozen histological sections of FIG. 32. Time-dependent induction of miR-208b during myofibers ofboth wild-type and miR-499 transgenic animals hypothyroidism with PTU treatment. Induction of miR-208b show a dramatic increase in slow myofibers in fast fibers by PTU treatmentis evident after 3 days. This PTU-induced (EDL) of the transgenic mice. (FIG. 38E) The repressive expression ofmiR-208b increases with duration ofPTU treat- 15 effect ofmiR-208 ablation on §}-MHCexpression in response ment. to PTU is absent when miR-499 is re-introduced. Transgeni- FIG. 33A-C. miR-208 regulates the expression of miR- cally reintroducing miR-499in heart ofmiR-208 mutantani- 208b and miR-499, (A) Northern blot showing that the mals results in a severe induction of $-MHCandits corre- expression of miR-499 and miR-208b are dose-dependently sponding miRNA, miR-208b. (FIG. 38F) While miR-208 downregulated in miR-208 heterozygote (+/-) and homozy- 20 removal induces an inappropriate induction of fast skeletal gote (KO) mutant animals. (B) MiR-208b is upregulated in genes, miR-499 very potently represses these genes when miR-208 trangenic animals which correlates with B-MHC transgenically expressed in the miR-208 mutant animals. expression. (C) Schematic diagram of the regulation ofmiR- 499 by miR-208 in cardiac muscle. DETAILED DESCRIPTION OF ILLUSTRATIVE FIG. 34. Schematic model of miR-208 regulation of car- 25 EMBODIMENTS diac remodeling. miR-208 regulates cardiac remodeling either directly or indirectly through the regulation ofmiR-499 Cardiac and skeletal muscles respondto a variety ofpatho- and miR-208b expression. physiological stimuli such as workload, thyroid hormonesig- FIG. 35. Schematic modelof targeting strategy to design a naling and injury by modulating the expression of myosin miR-208b knockout mouse model. 30 isoforms, which regulate the efficiency of contraction. FIG. 36. Schematic of a transgenic mouse model overex- Recently, the inventors reported a_ cardiac-specific pressing binding site regions for both miR-499 and miR- microRNA, miR-208, which is encoded by an intron of the 208b. Skeletal muscle specific overexpression ofbinding site a-myosin heavy chain (MHC) gene, andis required for up- regions for both miR-499 and miR-208b using a skeletal and regulation of B-MHCexpression in responseto cardiac stress heart muscle specific promoter (muscle creatine kinase 35 and for repression of fast skeletal muscle genes in the heart (MCK)) should scavenge miR-208b and miR-499 in both (see co-pending application WO2008/016924, which is heart and skeletal muscle, thereby generating a knockdown herein incorporated by referencein its entirety). for both miRNAs (SEQ ID NOS: 5, 26 and 27). Here, the inventors extend their earlier work and show that FIG. 37A-D. Myh7b/miR-499 expression is dependent on miR-208 is also required for cardiac expression of closely MEF2. (FIG. 37A) A gel mobility shift assay was performed 40 related microRNAs, miR-499 and miR-208b, which are using nuclear extracts from COS-1 cells transfected with encodedby an intron ofthe Myh7b gene and the BMHCgene, either empty pcDNA-Flag or Flag-MEF2C andthe radiola- respectively. Expression of Myh7b and miR-499 inthe heart, beled MEF2 site as probe. While pcDNA-Flag is unable to as well as in slow skeletal muscle, is controlled by the MEF2 bind the radiolabeled MEF2-site (lane 1), overexpression of transcription factor, a signal-dependent regulator of striated MEF2C induces binding (lane 2) which can be supershifted 45 muscle gene expression. Forced expression of miR-499 or with 1 wg of polyclonal Flag antibody (lane 3). Specific and miR-208 is sufficient to mediate a fast to slow myofiber nonspecific competitors were used at 50-fold molar excess conversion in vivo. Mir-208 and miR-499 can negatively (lane 4-6). (FIG. 37B) COScells (24-well plates, 5x10* cells/ regulate the expression ofThrap1, a thyroid hormonereceptor well) were transfected with 100 ng of the myh7b-luciferase coregulator, and members of the PUR family of transcription reporters (wild-type and Mef2 mutant), 50 ng expression 50 factors, which in turn negatively regulate B-MHCexpression vectors encoding Mef2c, a Mef2 co-activator, myocardin pro- in cardiac and skeletal muscle. Sox6 functions as a repressor teins and 30 ng of pCMV-lacZ. Activation of the myh7b of slow fiber type-specific genes. Knockdown of Sox6 reporter by Mef2c and myocardin required the Mef2-binding expression in wild-type myotubes results in a significant site. (FIG. 37C) MEF2site is essential for cardiac expression increase in B-MHCexpression. Analysis of the B-MHCpro- of myh7b/miR-499. LacZ transgenic mouse embryos were 55 moter revealed a Sox consensus sequence which suggests that generated, and stained for expression of B-galactosidase at Sox6 playsa critical role in thefiber type differentiation of E12.5 and p1. While a region 0.8 Kb upstream of the myh7b fetal skeletal muscle and $-MHC regulation in the heart. gene wassufficientto drive cardiac lacZ expression, mutation These findings unveil a common regulatory mechanism in of the MEF2 site abolished expression in the heart. (FIG. which Myh genes regulate the gene expression patterns of 37D) Northern blot analysis indicates that miR-499 expres- 60 striated muscles by encoding regulatory microRNAsthat sion is increased in hearts of cardiac specific MEF2D trans- govern contractility and signal responsiveness. Strategies to genic animals, while the level of miR-499 is decreased in manipulate skeletal and cardiac muscle gene expression by hearts where MEF2Cand-D are deleted. modulating miR-499 expression in the settings of striated FIG. 38A-F. miR-499 regulates the expression of B-MHC muscle diseases are described in lightof these discoveries. and fast skeletal genes. (FIG. 38A) Northern blot analysis for 65 The inventors have also discovered the genometo contain miR-499 indicates that transgenic overexpression of miR- a second version of miR208, called miR-208b, which is 499, using a muscle specific promoter, efficiently induces the located within the B-MHC geneatintron 31, and like B-MHC, US 8,962,588 B2 11 12 miRNA208bis expressed solely in the heart and slow skeletal MiR-208, which has been shown to regulate miR-499 muscle (soleus). The sequence of this microRNA is largely expression, is an intronic miRNA that is located within an overlapping with miR-208 with a 100% homology in the so intron of the a-MHC gene. Theprecise intron location is called seed region, the region of the microRNAthat defines dependent on the particular species and specific transcript. mRNAtargets ofa certain miRNA.Thus, miR-208b can have For example,in humans, miR-208 is encoded within the 28” profound effects on cardiac contractility in humans, and intron ofthe a-MHCgene, while in mice, it is encoded within modulation of miR-208b to regulate cardiac contractility is the 29” intron. The pre-miRNAencoding sequences for miR- also contemplated by the invention. 208 for human, mouse,rat, and canine are provided in SEQ ID Thus, the invention encompasses agonism ofmiR-499 and/ NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or miR-208b expressionoractivity, either by therapeutically 10 respectively. The mature miR-208 sequence is provided in activating the endogenous miR-208b gene or miR-208 gene SEQ ID NO:5. Like a-MHC, miR-208is expressedsolely in (to upregulate miR-499) or introducing exogenous miR-499 the heart. (FIG. 1).

Human pre-miR-208 (SEQ ID NO: 14) aegggegage ttttggcecg ggttatacct gatgctcacg tataagacga gcaaaaaget tgttggtcag a

Mouse pre-miR-208 (SEQ ID NO: 15) acegggtgage ttttggcecg ggttatacct gactctcacg tataagacga gcaaaaaget tgttggtcag a

Rat pre-miR-208 (SEQ ID NO: 16) acegggtgage ttttggcecg ggttatacct gactctcacg tataagacga gcaaaaaget tgttggtcag a

Canine pre-miR-208 (SEQ ID NO: 17) acgeatgage ttttggctcg ggttatacct gatgctcacg tataagacga gcaaaaaget tgttggtcag a or miR-208b into the heart, either using the miRNAitself or Using the PicTar algorithm for the identification ofmiRNA by the use of adenoviral vectors or other means of ectopic targets (Krek et al., 2005), the inventors identified thyroid expression to elevate B-MHC expression. The up-regulation hormonereceptor associated protein 1 (THRAP1) as a pre- of several fast skeletal muscle contractile protein genesin the dicted target for miR-208. THRAP1 3' UTR sequences from hearts of miR-208 mutant mice suggests that miR-208 and human, chimp, mouse, rat, canine, chicken, fugu, and miR-208b typically repress the fast skeletal muscle gene pro- zebrafish are provided in SEQ ID NO:6, SEQ ID NO:7, SEQ gram, which implicates a similar role for miR-499 in skeletal ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and cardiac muscle. Thus, activation of these genes in the SEQ ID NO:12, and SEQ ID NO:13, respectively (FIG. 25). heart represents a potential approach to regulate cardiac con- Ina further search for microRNAsthat might be involved in tractility. the regulation ofmuscle contractility, the inventors found the In addition, the inventors present use of miR-499 and/or BMHCgeneto contain miR208b, whichis closely related to miR-208b to repress fast fiber genes in skeletal muscle 40 miR-208, in intron 31. Expression of miR-208b follows that thereby activating the reciprocal expression of slow fiber of BMHC,namely it is expressed solely in the heart and slow genes. Expression of slow fiber genes are coupled to skeletal muscle (soleus). The sequence of this microRNA is enhancedinsulin sensitivity and skeletal muscle endurance. largely overlapping with miR-208 with a 100% homology in Repression of slow fiber genes and activation of fast fiber the so called seed region (indicated by underlining), the part genesin skeletal muscle is associated with numerous muscu- 45 of the microRNA that helps to define mRNAtargets of a loskeletal disorders including disuse atrophy, muscle wasting certain miRNA: in responseto anti-gravity, and denervation. Thus,the present inventors have discoveredthat, like miR- 208, miR-499 is a muscle-specific and essential regulator of (SEQ ID No: 5) B-MHCgene expressionin the heart. In addition, miR-208b 50 miR-208 AUAAGACGAGCAAAAAGCUUGU was discovered to bea muscle-specific and essential regulator of myosin gene expression in the heart that in addition regu- (SEQ ID NO: 27) miR-208b AUAAGACGAACAAAAGGUUUGU lates cardiac fibrosis. Both of these discoveries are com- pletely novel as is the use of these microRNAs to control The pre-miRNA encoding sequences for miR-208b for cardiac contractility and skeletal muscle function. 55 human, mouse, rat, canine, opposum, and X. tropicalis are Analysis of the genomic location of the miR-499 gene provided in SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, showedit to be contained within the 20” intron ofthe Myh7b SEQ ID NO:33, SEQ ID NO:34, and SEQ ID NO:35, respec- gene, a homolog of the a-MHC gene (FIG. 15; SEQ ID tively. (FIG. 28). FIG. 28 also shows the stem-loop structure NO:26 recites the mature miRNA sequence; SEQ ID NO:25 of the miR-208b precursor sequence (SEQ ID NO:36). shows the stem-loop structure of the precursor sequence). Methods ofTreating Cardiac Hypertrophy, Heart Failure, and The pre-miRNA encoding sequences for miR-499 for mouse, Myocardial Infarction rat, human, canine, opposum, chicken and X. tropicalis are The present invention provides a method for treating provided in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, pathologic cardiac hypertrophy, heart failure, or myocardial SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID infarction in a subject in needthereof. In one embodiment, the NO:24, respectively. (FIG. 15). The Myh7b gene is conserved method comprises identifying a subject having cardiac hyper- in vertebrates and is expressed solely in the heart and slow trophy, heart failure, or myocardial infarction and inhibiting skeletal muscle (e.g. soleus). expression or activity of miR-499 and/or miR-208b in heart US 8,962,588 B2 13 14 cells of the subject. In another embodiment, the method com- target polynucleotide sequence. The antagomirs may be at prises identifying a subject at risk of developing pathologic least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or cardiac hypertrophy, heart failure, or myocardial infarction 99% complementary to a mature miRNA sequence. In some and inhibiting expressionoractivity ofmiR-499 and/or miR- embodiments, the antagomir may be substantially comple- 208b in heart cells of the subject. The subject at risk of mentary to a mature miRNA sequence, that is at least about developing pathologic cardiac hypertrophy or heart failure 95%, 96%, 97%, 98%, or 99% complementary to a target mayexhibit one or morerisk factors including, for example, polynucleotide sequence. In other embodiments, the antago- long standing uncontrolled hypertension, uncorrected valvu- mirs are 100% complementary to the mature miRNA lar disease, chronic angina, recent myocardial infarction, con- sequence. genital predisposition to heart disease or pathological hyper- Inhibition ofmicroRNA function may also be achieved by trophy. In certain embodiments, the subject at risk may be administering antisense oligonucleotides targeting the diagnosed as having a genetic predisposition to cardiac mature miR-499, miR-208, or miR-208b sequences. Theanti- hypertrophy. In some embodimentsofthe invention, the sub- sense oligonucleotides maybe ribonucleotides or deoxyribo- ject at risk may have a familialhistory of cardiac hypertrophy. nucleotides. Preferably, the antisense oligonucleotides have In another embodiment, the present invention provides a at least one chemical modification. Antisense oligonucle- methodof preventing cardiac hypertrophy anddilated cardi- otides may be comprised of one or more “locked nucleic omyopathyin a subject in need thereof comprising inhibiting acids”. “Locked nucleic acids” (LNAs) are modified ribo- expression or activity of miR-499 and/or miR-208b in heart nucleotides that contain an extra bridge between the 2' and 4' cells of the subject. In yet a further embodiment, the present carbons of the ribose sugar moiety resulting in a “locked” invention provides a methodof inhibiting progression of car- 20 conformation that confers enhanced thermalstability to oli- diac hypertrophy in a subject in need thereof comprising gonucleotides containing the LNAs. Alternatively, the anti- inhibiting expression or activity of miR-499 and/or miR- sense oligonucleotides may comprise peptide nucleic acids 208bin heart cells ofthe subject. In certain embodiments, the (PNAs), which contain a peptide-based backbonerather than present invention provides a method of increasing exercise a sugar-phosphate backbone. Other chemical modifications tolerance, reducing hospitalization, improving quality of life, that the antisense oligonucleotides may contain include, but decreasing morbidity, and/or decreasing mortality in a sub- are not limited to, sugar modifications, such as 2'-O-alkyl ject with heart failure or cardiac hypertrophy comprising (e.g. 2'-O-methyl, 2'-O-methoxyethyl), 2'-fluoro, and 4' thio inhibiting expression or activity of miR-499 and/or miR- modifications, and backbone modifications, such as one or 208b in heart cells of the subject. more phosphorothioate, morpholino, or phosphonocarboxy- Thus, the present invention provides methods for the treat- late linkages (see, for example, U.S. Pat. Nos. 6,693,187 and ment of cardiac hypertrophy, heart failure, or myocardial 7,067,641, which are herein incorporated by reference in their infarction utilizing inhibitors ofmiR-499 or miR-208b. Pref- entireties). In some embodiments, suitable antisense oligo- erably, administration of a miR-499 and/or miR-208b inhibi- nucleotides are 2'-O-methoxyethy] “gapmers” which contain tor results in the improvement of one or more symptoms of 2'-O-methoxyethyl-modified ribonucleotides on both 5' and cardiac hypertrophy,heart failure, or myocardial infarction in 3' ends with at least ten deoxyribonucleotides in the center. the subject, or in the delay in the transition from cardiac These “gapmers” are capable of triggering RNase H-depen- hypertrophy to heart failure. The one or more improved dent degradation mechanisms of RNAtargets. Other modifi- symptoms maybe, for example, increased exercise capacity, cationsof antisense oligonucleotides to enhancestability and increased cardiac ejection volume,decreased left ventricular improve efficacy, such as those described in U.S. Pat. No. end diastolic pressure, decreased pulmonary capillary wedge 40 6,838,283, which is herein incorporated by reference in its pressure, increased cardiac output, increased cardiac index, entirety, are knownin the art and are suitable for use in the lowered pulmonary artery pressures, decreased left ventricu- methods of the invention. Preferable antisense oligonucle- lar end systolic and diastolic dimensions, decreased cardiac otides useful for inhibiting the activity of microRNAsare fibrosis, decreased collagen deposition in cardiac muscle, about 19 to about 25 nucleotides in length. Antisense oligo- decreased left and right ventricular wall stress, decreased wall 45 nucleotides may comprise a sequencethatis at least partially tension, increased quality of life, and decreased disease complementary to a mature miRNA sequence,e.g. at least related morbidity or mortality. In addition, use of inhibitors of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% miR-499 and/or miR-208b mayprevent cardiac hypertrophy complementary to a mature miRNA sequence. In some and its associated symptomsfrom arising. embodiments,the antisense oligonucleotide may be substan- The function of miRNAs may be inhibited by the admin- tially complementary to a mature miRNA sequence,thatis at istration of antagomirs. Initially described by Kriitzfeldt and least about 95%, 96%, 97%, 98%, or 99% complementary to colleagues (Kriitzfeldt et al., 2005), “antagomirs”are single- a target polynucleotide sequence. In one embodiment, the stranded, chemically-modified ribonucleotides that are at antisense oligonucleotide comprises a sequencethat is 100% least partially complementary to the miRNA sequence. complementary to a mature miRNA sequence. Antagomirs may comprise one or more modified nucleotides, 55 Another approach for inhibiting the function of miR-499, such as 2'-O-methyl-sugar modifications. In some embodi- miR-208, and miR-208b is administering an inhibitory RNA ments, antagomirs comprise only modified nucleotides. molecule having at least partial sequence identity to the Antagomirs may also comprise one or more phosphorothio- mature miR-499, miR-208, and miR-208b sequences. The ate linkages resulting in a partial or full phosphorothioate inhibitory RNA molecule may be a double-stranded, small backbone. To facilitate in vivo delivery and stability, the interfering RNA (siRNA) or a short hairpin RNA molecule antagomir maybelinked to a cholesterol moiety at its 3' end. (shRNA) comprising a stem-loop structure. The double- Antagomirs suitable for inhibiting miRNAs may be about 15 stranded regions of the inhibitory RNA molecule may com- to about 50 nucleotides in length, more preferably about 18 to prise a sequencethatis at least partially identical, e.g. about about 30 nucleotides in length, and most preferably about 20 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% iden- to about 25 nucleotides in length.“Partially complementary” tical, to the mature miRNA sequence. In some embodiments, refers to a sequence that is at least about 75%, 80%, 85%, the double-stranded regions of the inhibitory RNA comprise 90%, 95%, 96%, 97%, 98%, or 99% complementary to a a sequencethatis at least substantially identical to the mature US 8,962,588 B2 15 16 miRNA sequence. “Substantially identical” refers to a embodiment, an inhibitor of miR-499 is an inhibitory RNA sequencethatis at least about 95%, 96%, 97%, 98%, or 99% molecule comprising a double-stranded region, wherein the identical to a target polynucleotide sequence. In other double-stranded region comprises a sequence having 100% embodiments, the double-stranded regions of the inhibitory identity to the mature miR-499 sequence (SEQ ID NO:26). In RNA molecule may contain 100% identity to the target another embodiment, an inhibitor ofmiR-208is an inhibitory miRNAsequence. RNA molecule comprising a double-stranded region, Theinhibitory nucleotide molecules described herein pref- wherein the double-stranded region comprises a sequence erably target the mature sequence of miR-499 (SEQ ID NO: having 100% identity to the mature miR-208 sequence (SEQ 26), miR-208 (SEQ ID NO:5), or miR-208b (SEQ ID NO: ID NO:5). In another embodiment, an inhibitor ofmiR-208b 27). In some embodiments, inhibitors of miR-499, miR-208, 10 is an inhibitory RNA molecule comprising a double-stranded and miR-208b are antagomirs comprising a sequencethatis region, wherein the double-stranded region comprises a perfectly complementary to the mature miR-499, mature sequence having 100% identity to the mature miR-208b miR-208, or mature miR-208b sequence. In one embodiment, sequence (SEQ ID NO:27). In some embodiments, inhibitors an inhibitor of miR-499 is an antagomir having a sequence ofmiR-208, miR-208b, and miR-499 function are inhibitory that is partially or perfectly complementary to 5'-UUAA- 15 RNA molecules which comprise a double-stranded region, GACUUGCAGUGAUGUUU-3' (SEQ ID NO: 26). In wherein said double-stranded region comprises a sequence of another embodiment, an inhibitor ofmiR-208is an antagomir at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or having a sequencethat is partially or perfectly complemen- 99% identity to the mature miR-208, miR-208b, or miR-499 tary to 5'-AUAAGACGAGCAAAAAGCUUGU-3' (SEQ ID sequence. NO:5). In another embodiment, an inhibitor of miR-208b is 20 The presentinvention also contemplates methodsfor scav- an antagomir having a sequencethatis partially or perfectly enging or clearing miR-499 and/or miR-208b antagonists complementary to 5'-AUAAGACGAACAAAAGGUUUGU following treatment. The method may comprise overexpress- (SEQ ID NO:27). ing binding sites for the miR-499 and/or miR-208b antago- In some embodiments, inhibitors of miR-499, miR-208, nists in cardiac tissue. In another embodiment, the present and miR-208b are chemically-modified antisense oligonucle- 25 invention provides a methodfor scavenging or clearing miR- otides. In one embodiment, an inhibitor of miR-499 is a 499 and/or miR-208b following treatment. In one embodi- chemically-modified antisense oligonucleotide comprising a ment, the method comprises overexpression of binding site sequence substantially complementary to 5'-UUAAGACU- regions for miR-499 and/or miR-208b in skeletal muscle UGCAGUGAUGUUU-3' (SEQ ID NO: 26). In another using a skeletal and heart muscle specific promoter (muscle embodiment, an inhibitor of miR-208 is a chemically-modi- 30 creatine kinase (MCK)). The bindingsite regions preferably fied antisense oligonucleotide comprising a sequence sub- contain a sequence of the seed region for miR-499 and/or stantially complementary to 5'-AUAAGACGAG- miR-208b. In some embodiments, the binding site may con- CAAAAAGCUUGU-3' (SEQ ID NO: 5). In another tain a sequence from the 3'UTR of one or moretargets of embodiment, an inhibitor ofmiR-208b is a chemically-modi- miR-499 or miR-208b, such as THRAP1 or PURbeta. In fied antisense oligonucleotide comprising a sequence sub- 35 another embodiment, a miR-499 and/or miR-208b antagonist stantially complementary to 5'- may be administered after miR-499 and/or miR-208b to AUAAGACGAACAAAAGGUUUGU(SEQ ID NO:27). As attenuate or stop the function of the microRNA. used herein “substantially complementary” refers to a Combined Therapy sequencethatis at least about 95%, 96%, 97%, 98%, 99%, or In another embodimentofthe invention,it is envisioned to 100% complementary to a target polynucleotide sequence 40 use an inhibitor ofmiR-499 or miR-208b in combination with (e.g. mature or precursor miRNA sequence). other therapeutic modalities. Current medical managementof Antisense oligonucleotides may comprise a sequence that cardiac hypertrophyin the setting ofa cardiovascular disorder is substantially complementary to a precursor miRNA includesthe useofat least two types ofdrugs inhibitors ofthe sequence(pre-miRNA)for miR-499, miR-208, or miR-208b. renin-angiotensin system, and f-adrenergic blocking agents In some embodiments, the antisense oligonucleotide com- 45 (Bristow, 1999). Therapeutic agentsto treat pathologic hyper- prises a sequencethat is substantially complementary to a trophy in the setting of heart failure include angiotensin II sequence located outside the stem-loop region of the pre- converting enzyme (ACE) inhibitors and B-adrenergic recep- miR-499, pre-miR-208, or pre-miR-208b sequence. In one tor blocking agents (Eichhorn and Bristow, 1996). Other embodiment, an inhibitor ofmiR-499 function is an antisense pharmaceutical agents that have been disclosed for treatment oligonucleotide having a sequence that is substantially 50 of cardiac hypertrophy include angiotensin II receptor complementary to a pre-miR-499 sequence selected from the antagonists (U.S. Pat. No. 5,604,251) and neuropeptide Y group consisting of SEQ ID NO:18, SEQ ID NO:19, SEQ ID antagonists (WO 98/33791). NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 and Non-pharmacological treatment is primarily used as an SEQ ID NO:24.In another embodiment, an inhibitor ofmiR- adjunct to pharmacological treatment. One means of non- 208 function is an antisense oligonucleotide having a 55 pharmacological treatment involves reducing the sodium in sequencethat is substantially complementary to a pre-miR- the diet. In addition, non-pharmacological treatment also 208 sequenceselected from the group consisting of SEQ ID entails the elimination of certain precipitating drugs, includ- NO: 14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17. ing negative inotropic agents (e.g., certain calcium channel In still another embodiment, an inhibitor of miR-208b func- blockers and antiarrhythmic drugs like disopyramide), car- tion is an antisense oligonucleotide having a sequencethatis 60 diotoxins (e.g., amphetamines), and plasma volume expand- substantially complementary to a pre-miR-208b sequence ers (e.g., nonsteroidal anti-inflammatory agents and gluco- selected from the group consisting of SEQ ID NO:30, SEQ corticoids). ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, Thus, in addition to the therapies described above, one may and SEQ ID NO:35. also provide to the subject more “standard” pharmaceutical In other embodiments of the invention, inhibitors of miR- 65 cardiac therapies with the inhibitor of miR-499 and/or miR- 499, miR-208, and miR-208b may be inhibitory RNA mol- 208b. Examples of other therapies include, without limita- ecules, such as ribozymes, siRNAs, or shRNAs. In one tion, so-called “beta blockers,” anti-hypertensives, cardioton- US 8,962,588 B2 17 18 ics, anti-thrombotics, vasodilators, hormone antagonists, subject, and such individual determinations are within the iontropes, diuretics, endothelin receptor antagonists, calcium skill of those of ordinary skill in the art. channel blockers, phosphodiesterase inhibitors, ACE inhibi- Non-limiting examples of a pharmacological therapeutic tors, angiotensin type 2 antagonists and cytokine blockers/ agent that may be used in the present invention include an inhibitors, and HDAC inhibitors. The combination therapy antihyperlipoproteinemic agent, an antiarteriosclerotic agent, also may involve inhibiting the expression or activity of both an antithrombotic/fibrinolytic agent, a blood coagulant, an miR-499 and miR-208b,or inhibiting the expressionoractiv- antiarrhythmic agent, an antihypertensive agent, a vasopres- ity of miR-208, and/or additional miRNAs involvedin car- sor, a treatment agent for congestive heart failure,an antiangi- diac remodeling such as miR-21 and miR-195. Combination nal agent, an antibacterial agent or a combination thereof. therapy may also include overexpression of particular 10 In addition, it should be noted that any ofthe following may microRNAs, such as miR-29. be used to develop newsets of cardiac therapy target genes as Combinations maybe achieved by contacting cardiac cells B-blockers were used in the present examples (see below). with a single composition or pharmacological formulation While it is expected that many of these genes may overlap, that includes an inhibitor of miR-499 or miR-208b and a new genetargets likely can be developed. standard pharmaceutical agent, or by contacting the cell with 15 In certain embodiments, administration of an agent that twodistinct compositions or formulations, at the same time, lowers the concentration of one of more blood lipids and/or wherein one composition includes an inhibitor ofmiR-499 or lipoproteins, known herein as an “antihyperlipoproteinemic,” miR-208b andthe other includes the standard pharmaceutical may be combined with a cardiovascular therapy according to agent. Alternatively, the therapy using an inhibitor of miR- the present invention, particularly in treatment of atherscle- 499 and/or miR-208b may precedeor follow administration 20 rosis and thickenings or blockages of vascular tissues. In of the other agent(s) by intervals ranging from minutes to certain embodiments, an antihyperlipoproteinemic agent weeks. In embodiments where the standard pharmaceutical may comprise an aryloxyalkanoic/fibric acid derivative, a agent and miR-499 or miR-208b inhibitor are applied sepa- resin/bile acid sequesterant, a HMG CoAreductase inhibitor, rately to the cell, one would generally ensure that a significant a nicotinic acid derivative, a thyroid hormoneor thyroid hor- period of time did not expire between the time of each deliv- 25 moneanalog, a miscellaneous agent or a combination thereof. ery, such that the pharmaceutical agent and miR-499 or miR- Non-limiting examples of aryloxyalkanoic/fibric acid 208b inhibitor wouldstill be able to exert an advantageously derivatives include beclobrate, enzafibrate, binifibrate, combined effect on the cell. In such instances, it is contem- ciprofibrate, clinofibrate, clofibrate (atromide-S), clofibric plated that one would typically contact the cell with both acid, etofibrate, fenofibrate, gemfibrozil (lobid), nicofibrate, modalities within about 12-24 hours of each other and, more 30 pirifibrate, ronifibrate, simfibrate and theofibrate. preferably, within about 6-12 hours ofeach other, with a delay Non-limiting examples of resins/bile acid sequesterants time of only about 12 hours being most preferred. In some include cholestyramine (cholybar, questran), colestipol situations, it may be desirable to extend the time period for (colestid) and polidexide. treatmentsignificantly, however, where several days (2, 3, 4, Non-limiting examples of HMG CoAreductase inhibitors 5, 6 or7) to several weeks(1, 2,3, 4, 5, 6, 7 or 8) lapse between 35 include lovastatin (mevacor), pravastatin (pravochol) or sim- the respective administrations. vastatin (zocor). It also is conceivable that more than one administration of Non-limiting examples of nicotinic acid derivatives either an inhibitor of miR-499 and/or miR-208b,or the other include nicotinate, acepimox, niceritrol, nicoclonate, nico- pharmaceutical agent will be desired. In this regard, various mol and oxiniacic acid. combinations may be employed. By way of illustration, 40 Non-limiting examples of thyroid hormonesand analogs wherethe inhibitor of miR-499 or miR-208b is “A” and the thereof include etoroxate, thyropropic acid and thyroxine. other agent is “B”’, the following permutations based on 3 and Non-limiting examples of miscellaneous antihyperlipo- 4 total administrations are exemplary: proteinemics include acifran, azacosterol, benfluorex, (f-ben- zalbutyramide, carnitine, chondroitin sulfate, clomestrone, 45 detaxtran, dextran sulfate sodium, 5, 8, 11, 14, 17-eicosapen-

A/B/A B/A/B B/B/A A/A/B B/A/A A/B/B B/B/B/A B/B/A/B taenoic acid, eritadenine, furazabol, meglutol, melinamide, A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B B/B/B/A mytatrienediol, ornithine, y-oryzanol, pantethine, pentaeryth- A/A/A/B B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/A/B/B B/B/A/B ritol tetraacetate, a-phenylbutyramide, pirozadil, probucol (lorelco), B-sitosterol, sultosilic acid-piperazine salt, tiad- Other combinationsare likewise contemplated. 50 enol, triparanol and xenbucin. Treatment regimens would vary depending ontheclinical Non-limiting examples of an antiarteriosclerotic include situation. However, long-term maintenance would appearto pyridinol carbamate. be appropriate in most circumstances. It also may be desirable In certain embodiments, administration of an agent that to treat hypertrophy with inhibitors of miR-499 and/or miR- aids in the removal or prevention of blood clots may be 208b intermittently, such as within a brief window during 55 combined with administration of a modulator, particularly in disease progression. treatment of athersclerosis and vasculature (e.g., arterial) Pharmacological therapeutic agents and methods of blockages. Non-limiting examples of antithrombotic and/or administration, dosages, etc., are well knownto thoseof skill fibrinolytic agents include anticoagulants, anticoagulant in the art (see for example, the “Physicians Desk Reference”, antagonists, antiplatelet agents, thrombolytic agents, throm- Klaassen’s “The Pharmacological Basis of Therapeutics”, 60 bolytic agent antagonists or combinationsthereof. “Remington’s Pharmaceutical Sciences”, and “The Merck In certain embodiments, antithrombotic agents that can be Index, Eleventh Edition”, incorporated herein by reference in administered orally, such as, for example, aspirin and wafarin relevant parts), and may be combined with the invention in (coumadin), are preferred. light of the disclosures herein. Somevariation in dosage will Non-limiting examples of anticoagulants include aceno- necessarily occur depending on the condition of the subject 65 coumarol, ancrod, anisindione, bromindione, clorindione, being treated. The person responsible for administration will, coumetarol, cyclocumarol, dextran sulfate sodium, dicuma- in any event, determine the appropriate dose for the individual rol, diphenadione, ethyl biscoumacetate, ethylidene dicou- US 8,962,588 B2 19 20 marol, fiuindione, heparin, hirudin, lyapolate sodium, pamil, prenylamine, terodiline, verapamil), a dihydropyri- oxazidione, pentosan polysulfate, phenindione, phenprocou- dine derivative (felodipine, isradipine, nicardipine, nife- mon, phosvitin, picotamide, tioclomarol and warfarin. dipine, nimodipine, nisoldipine, nitrendipine) a piperazinde Non-limiting examples of antiplatelet agents include aspi- derivative (e.g., cinnarizine, flunarizine, lidoflazine) or a rin, a dextran, dipyridamole (persantin), heparin, sulfinpyra- micellaneous calctum channel blocker such as bencyclane, none(anturane) andticlopidine (ticlid). etafenone, magnesium, mibefradil or perhexyline. In certain Non-limiting examples ofthrombolytic agents includetis- embodiments a calcium channel blocker comprises a long- sue plaminogen activator (activase), plasmin, pro-urokinase, acting dihydropyridine (nifedipine-type) calcium antagonist. urokinase (abbokinase) streptokinase (streptase), anistre- Non-limiting examples of miscellaneous antiarrhythmic plase/APSAC (eminase). 10 agents include adenosine (adenocard), digoxin (lanoxin), In certain embodiments wherein a subject is suffering from acecamide, ajmaline, amoproxan,aprindine, bretylium tosy- a hemorrhageoran increased likelihood ofhemorrhaging, an late, bunaftine, butobendine, capobenic acid, cifenline, dis- agent that may enhance blood coagulation may be used. Non- opyranide, hydroquinidine, indecamide, ipatropium bro- limiting examples of a blood coagulation promoting agents mide, lidocaine, lorajmine, lorcamide, meobentine, include thrombolytic agent antagonists and anticoagulant moricizine, pirmenol, prajmaline, propafenone, pyrinoline, antagonists. quinidine polygalacturonate, quinidine sulfate and viquidil. Non-limiting examples of anticoagulant antagonists Non-limiting examples of antihypertensive agents include include protamine and vitamine K1. sympatholytic, alpha/beta blockers, alpha blockers, anti-an- Non-limiting examples of thrombolytic agent antagonists giotensin II agents, beta blockers, calctum channel blockers, include amiocaproic acid (amicar) and tranexamic acid (am- 20 vasodilators and miscellaneous antihypertensives. stat). Non-limiting examples of antithrombotics include Non-limiting examples of an alpha blocker, also known as anagrelide, argatroban, cilstazol, daltroban, defibrotide, an a-adrenergic blocker or an a-adrenergic antagonist, enoxaparin, fraxiparine, indobufen, lamoparan, ozagrel, include amosulalol, arotinolol, dapiprazole, doxazosin, picotamide, plafibride, tedelparin,ticlopidine andtriflusal. ergoloid mesylates, fenspiride, indoramin, labetalol, nicer- Non-limiting examples of antiarrhythmic agents include goline, prazosin, terazosin,tolazoline, trimazosin and yohim- Class I antiarrhythmic agents (sodium channel blockers), bine. In certain embodiments, an alpha blocker may comprise Class II antiarrhythmic agents (beta-adrenergic blockers), a quinazoline derivative. Non-limiting examples of quinazo- Class III antiarrhythmic agents (repolarization prolonging line derivatives include alfuzosin, bunazosin, doxazosin,pra- drugs), Class IV antiarrhythmic agents (calcium channel zosin, terazosin and trimazosin. blockers) and miscellaneous antiarrhythmic agents. 30 In certain embodiments, an antihypertensive agent is both Non-limiting examples of sodium channel blockers an alpha and beta adrenergic antagonist. Non-limiting include Class IA, Class IB and Class IC antiarrhythmic examples of an alpha/beta blocker comprise labetalol (nor- agents. Non-limiting examples of Class IA antiarrhythmic modyne,trandate). agents include disppyramide (norpace), procainamide (pron- Non-limiting examples of anti-angiotensin I] agents estyl) and quinidine (quinidex). Non-limiting examples of include angiotensin converting enzymeinhibitors and angio- Class IB antiarrhythmic agents include lidocaine (xylocalne), tensin II receptor antagonists. Non-limiting examples of tocamide (tonocard) and mexiletine (mexitil). Non-limiting angiotensin converting enzyme inhibitors (ACE inhibitors) examples of Class IC antiarrhythmic agents include encam- include alacepril, enalapril (vasotec), captopril, cilazapril, ide (enkaid) and flecamide (tambocor). delapril, enalaprilat, fosinopril, listnopril, moveltopril, perin- Non-limiting examplesof a beta blocker, otherwise known 40 dopril, quinapril and ramipril. Non-limiting examples of an asa B-adrenergic blocker, a B-adrenergic antagonist or a Class angiotensin II receptor blocker, also knownas an angiotensin II antiarrhythmic agent, include acebutolol (sectral), alpre- II receptor antagonist, anANG receptorblocker or anANG-II nolol, amosulalol, arotinolol, atenolol, befunolol, betaxolol, type-1 receptor blocker (ARBS), include angiocandesartan, bevantolol, bisoprolol, bopindolol, bucumolol, bufetolol, eprosartan, irbesartan, losartan and valsartan. bufuralol, bunitrolol, bupranolol, butidrine hydrochloride, 45 Non-limiting examples of a sympatholytic include a cen- butofilolol, carazolol, carteolol, carvedilol, celiprolol, ceta- trally acting sympatholytic or a peripherially acting sym- molol, cloranolol, dilevalol, epanolol, esmolol (brevibloc), patholytic. Non-limiting examples of a centrally acting sym- indenolol, labetalol, levobunolol, mepindolol, metipranolol, patholytic, also known as an central nervous system (CNS) metoprolol, moprolol, nadolol, nadoxolol, nifenalol, sympatholytic, include clonidine (catapres), guanabenz nipradilol, oxprenolol, penbutolol, pindolol, practolol, prone- (wytensin) guanfacine (tenex) and methyldopa (aldomet). thalol, propanolol (inderal), sotalol (betapace), sulfinalol, Non-limiting examples of a peripherally acting sym- talinolol, tertatolol, timolol, toliprolol and xibinolol. In cer- patholytic include a ganglion blocking agent, an adrenergic tain embodiments, the beta blocker comprises an aryloxypro- neuron blocking agent, a B-adrenergic blocking agent or a panolamine derivative. Non-limiting examples of arylox- alpha] -adrenergic blocking agent. Non-limiting examples of ypropanolamine derivatives include acebutolol, alprenolol, a ganglion blocking agent include mecamylamine(inversine) arotinolol, atenolol, betaxolol, bevantolol, bisoprolol, bopin- and trimethaphan (arfonad). Non-limiting examples of an dolol, bunitrolol, butofilolol, carazolol, carteolol, carvedilol, adrenergic neuron blocking agent include guanethidine(is- celiprolol, cetamolol, epanolol, indenolol, mepindolol, melin) and reserpine (serpasil). Non-limiting examples of a metipranolol, metoprolol, moprolol, nadolol, nipradilol, B-adrenergic blocker include acenitolol (sectral), atenolol oxprenolol, penbutolol, pindolol, propanolol, talinolol, terta- (tenormin), betaxolol (kerlone), carteolol (cartrol), labetalol tolol, timolol and toliprolol. (normodyne,trandate), metoprolol (lopressor), nadanol(cor- Non-limiting examples of an agent that prolong repolar- gard), penbutolo] (levatol), pindolol (visken), propranolol ization, also known as a Class III antiarrhythmic agent, (inderal) and timolol (blocadren). Non-limiting examples of include amiodarone (cordarone) and sotalol (betapace). alpha] -adrenergic blocker include prazosin (minipress), dox- Non-limiting examples of a calcium channel blocker, oth- azocin (cardura) and terazosin (hytrin). erwise knownas a Class IV antiarrhythmic agent, include an In certain embodiments a cardiovasculator therapeutic arylalkylamine (e.g., bepridile, diltiazem, fendiline, gallo- agent may comprise vasodilator (e.g., a cerebral vasodilator, a US 8,962,588 B2 21 22 a coronary vasodilator or a peripheral vasodilator). In certain pentamethonium bromide, pentolinium tartrate, phenactro- preferred embodiments, a vasodilator comprises a coronary pinium chloride and trimethidinium methosulfate. vasodilator. Non-limiting examples of a coronary vasodilator Non-limiting examples of reserpine derivatives include include amotriphene, bendazol, benfurodil hemisuccinate, bietaserpine, deserpidine, rescinnamine, reserpine and syros- benziodarone, chloracizine, chromonar, clobenfurol, cloni- ingopine. trate, dilazep, dipyridamole, droprenilamine, efloxate, eryth- Non-limiting examples of sulfonamide derivatives include rityl tetranitrane, etafenone, fendiline, floredil, ganglefene, ambuside, clopamide, furosemide, indapamide, quineth- herestrol bis(B-diethylaminoethy! ether), hexobendine,itra- azone,tripamide and xipamide. min tosylate, khellin, lidoflanine, mannitol hexanitrane, Vasopressors generally are used to increase blood pressure medibazine, nicorglycerin, pentaerythritol tetranitrate, pen- 10 during shock, which may occur during a surgical procedure. trinitrol, perhexyline, pimethylline, trapidil, tricromyl, tri- Non-limiting examples of a vasopressor, also known as an metazidine, trolnitrate phosphate and visnadine. antihypotensive, include amezinium methyl] sulfate, angio- In certain embodiments, a vasodilator may comprise a tensin amide, dimetofrine, dopamine, etifelmin, etilefrin, chronic therapy vasodilator or a hypertensive emergency gepefrine, metaraminol, midodrine, norepinephrine, vasodilator. Non-limiting examples of a chronic therapy 15 pholedrine and synephrine. vasodilator include hydralazine (apresoline) and minoxidil Non-limiting examples of agents for the treatment of con- (oniten). Non-limiting examples of a hypertensive emer- gestive heart failure include anti-angiotensin II agents, after- gency vasodilator include nitroprusside (nipride), diazoxide load-preload reduction treatment, diuretics and inotropic (hyperstat IV), hydralazine (apresoline), minoxidil (loniten) agents. and verapamil. 20 In certain embodiments, an animal subject that can not Non-limiting examples of miscellaneous antihyperten- tolerate an angiotensin antagonist may be treated with a com- sives include ajmaline, y-aminobutyric acid, bufeniode, cicle- bination therapy. Such therapy may combine administration tainine, ciclosidomine, a cryptenamine tannate, fenoldopam, of hydralazine (apresoline) and isosorbide dinitrate (isordil, flosequinan, ketanserin, mebutamate, mecamylamine, meth- sorbitrate). yldopa, methyl 4-pyridyl ketone thiosemicarbazone, 25 Non-limiting examples of a diuretic include a thiazide or muzolimine, pargyline, pempidine, pinacidil, piperoxan, pri- benzothiadiazine derivative (e.g., althiazide, bendroflumet- maperone, a protoveratrine, raubasine, rescimetol, ril- hazide, benzthiazide, benzylhydrochlorothiazide, buthiazide, menidene, saralasin, sodium nitrorusside, ticrynafen, tri- chlorothiazide, chlorothiazide, chlorthalidone, cyclopenthi- methaphan camsylate, tyrosinase and urapidil. azide, epithiazide, ethiazide, ethiazide, fenquizone, hydro- Incertain embodiments, an antihypertensive may comprise 30 chlorothiazide, hydroflumethiazide, methyclothiazide, meti- an arylethanolamine derivative, a benzothiadiazine deriva- crane, metolazone, paraflutizide, polythizide, tive, a N-carboxyalkyl(peptide/lactam) derivative, a dihydro- tetrachloromethiazide, trichlormethiazide), an organomercu- pyridine derivative, a guanidine derivative, a hydrazines/ph- rial (e.g., chlormerodrin, meralluride, mercamphamide, mer- thalazine, an imidazole derivative, a quanternary ammonium captomerin sodium, mercumallylic acid, mercumatilin compound,a reserpine derivative or a suflonamidederivative. 35 dodium, mercurouschloride, mersaly]), a pteridine(e.g., fur- Non-limiting examples of arylethanolamine derivatives therene, triamterene), purines (e.g., acefylline, 7-morpholi- include amosulalol, bufuralol, dilevalol, labetalol, proneth- nomethyltheophylline, pamobrom, protheobromine, theo- alol, sotalol and sulfinalol. bromine), steroids including aldosterone antagonists (e.g., Non-limiting examples of benzothiadiazine derivatives canrenone,oleandrin, spironolactone), a sulfonamide deriva- include althizide, bendroflumethiazide, benzthiazide, ben- 40 tive (e.g., acetazolamide, ambuside, azosemide, bumetanide, zylhydrochlorothiazide, buthiazide, chlorothiazide, chlortha- butazolamide, chloraminophenamide, clofenamide, clopam- lidone, cyclopenthiazide, cyclothiazide, diazoxide, epithiaz- ide, clorexolone, diphenylmethane-4,4'-disulfonamide, dis- ide, ethiazide, fenquizone, hydrochlorothizide, ulfamide, ethoxzolamide, furosemide, indapamide, mefru- hydroflumethizide, methyclothiazide, meticrane, metola- side, methazolamide, piretanide, quinethazone, torasemide, zone, paraflutizide, polythizide, tetrachlormethiazide and 45 tripamide, xipamide), a uracil (e.g., aminometradine, ami- trichlormethiazide. sometradine), a potassium sparing antagonist (e.g., Non-limiting examples of N-carboxyalkyl(peptide/lac- amiloride, triamterene) or a miscellaneous diuretic such as tam) derivatives include alacepril, captopril, cilazapril, dela- aminozine, arbutin, chlorazanil, ethacrynic acid, etozolin, pril, enalapril, enalaprilat, fosinopril, lisinopril, moveltipril, hydracarbazine, isosorbide, mannitol, metochalcone, perindopril, quinapril and ramipril. 50 muzolimine, perhexyline, ticrnafen and urea. Non-limiting examples of dihydropyridine derivatives Non-limiting examples of a positive inotropic agent, also include amlodipine, felodipine, isradipine, nicardipine, nife- known as a cardiotonic, include acefylline, an acetyldigi- dipine, nilvadipine, nisoldipine and nitrendipine. toxin, 2-amino-4-picoline, aminone, benfurodil hemisucci- Non-limiting examples of guanidine derivatives include nate, bucladesine, cerberosine, camphotamide, convalla- bethanidine, debrisoquin, guanabenz, guanacline, guanadrel, 55 toxin, cymarin, denopamine,deslanoside, digitalin, digitalis, guanazodine, guanethidine, guanfacine, guanochlor, guan- digitoxin, digoxin, dobutamine, dopamine, dopexamine, oxabenz and guanoxan. enoximone, erythrophleine, fenalcomine, gitalin, gitoxin, Non-limiting examples ofhydrazines/phthalazines include glycocyamine, heptaminol, hydrastinine, ibopamine,a lana- budralazine, cadralazine, dihydralazine, endralazine, hydra- toside, metamivam, milrinone, nerifolin, oleandrin, ouabain, carbazine, hydralazine, pheniprazine, pildralazine and 60 oxyfedrine, prenalterol, proscillaridine, resibufogenin, scil- todralazine. laren, scillarenin, strphanthin, sulmazole, theobromine and Non-limiting examples of imidazole derivatives include xamoterol. clonidine, lofexidine, phentolamine, tiamenidine andtoloni- In particular embodiments, an intropic agent is a cardiac dine. glycoside, a beta-adrenergic agonist or a phosphodiesterase Non-limiting examples of quanternary ammonium com- 65 inhibitor. Non-limiting examples of a cardiac glycoside pounds include azamethonium bromide, chlorisondamine includes digoxin (lanoxin) and digitoxin (crystodigin). Non- chloride, hexamethonium, pentacynium bis(methylsulfate), limiting examples ofa B-adrenergic agonistinclude albuterol, US 8,962,588 B2 23 24 bambuterol, bitolterol, carbuterol, clenbuterol, clorprenaline, regulate the expression of fast skeletal muscle contractile denopamine,dioxethedrine, dobutamine (dobutrex), dopam- protein genes. MiR-208b, which is encoded by an intron of ine (intropin), dopexamine, ephedrine, etafedrine, ethylnore- the B-MHCgene,differs from miR-208 by only three bases pinephrine, fenoterol, formoterol, hexoprenaline, ibopamine, and is expressed solely in heart and slow skeletal muscle. isoetharine, isoproterenol, mabuterol, metaproterenol, meth- Thus, miR-208b mayalso regulate the fast skeletal muscle oxyphenamine, oxyfedrine, pirbuterol, procaterol, protoky- gene program and determinefiberidentity. lol, reproterol, rimiterol, ritodrine, soterenol, terbutaline, tre- In skeletal muscle, the repression of slow fiber genes and toquinol, tulobuterol and xamoterol. Non-limiting examples activation of fast fiber genes is associated with numerous of a phosphodiesterase inhibitor include aminone(inocor). musculoskeletal disorders, including, but not limitedto, dis- Antianginal agents may comprise organonitrates, calcium 10 use atrophy, muscle wasting in response to anti-gravity, and channel blockers, beta blockers and combinations thereof. denervation. Thus, expression of miR-208, miR-208b, or Non-limiting examples of organonitrates, also known as miR-499 in skeletal muscle cells may be useful in repressing nitrovasodilators, include nitroglycerin (nitro-bid,nitrostat), isosorbide dinitrate (isordil, sorbitrate) and amy]nitrate (as- fast fiber genes and thereby activating the reciprocal expres- sion of slow fiber genes. Accordingly, the present invention pirol, vaporole). 15 Endothelin (ET) is a 21-aminoacid peptide that has potent also encompasses a methodfortreating or preventing a mus- physiologic and pathophysiologic effects that appear to be culoskeletal disorder in a subject in need thereof. In one involved in the developmentofheart failure. The effects ofET embodiment, the method comprises identifying a subject hav- are mediated through interaction with two classes of cell ing or at risk of a musculoskeletal disorder and increasing the surface receptors. The type A receptor (ET-A)is associated 20 expression and/or activity of miR-499 and/or miR-208b in with vasoconstriction and cell growth while the type B recep- skeletal muscle cells of said subject. In some embodiments, tor (ET-B) is associated with endothelial-cell mediated increasing the expression and/or activity of miR-499 and/or vasodilation and with the release of other neurohormones, miR-208b may comprise administering an agonist of miR- such as aldosterone. Pharmacologic agents that can inhibit 499 and/or miR-208bto the skeletal muscle of a subject who either the production of ET orits ability to stimulate relevant 25 has, oris at risk for developing, a musculoskeletal disorder. In cells are known in the art. Inhibiting the production of ET another embodiment, the present invention provides methods involvesthe use ofagents that block an enzyme termed endot- of treating or preventing muscle wasting in response to a helin-converting enzymethat is involved in the processing of reduced gravity environment by administering an agonist of the active peptide from its precursor. Inhibiting the ability of miR-499 and/or miR-208b to the skeletal muscle. In another ETto stimulate cells involves the use of agents that block the 30 embodiment, the present invention provides methodsoftreat- interaction ofET withits receptors. Non-limiting examples of ing or preventing muscle atrophy by administering miR-499 endothelin receptor antagonists (ERA) include Bosentan, or miR-208b to the skeletal muscle. Enrasentan, Ambrisentan, Darusentan, Tezosentan, Atrasen- In addition, the results shown herein suggestthat strategies tan, Avosentan, Clazosentan, Edonentan, sitaxsentan, TBC to enhance slow fiber gene expression by elevating miR-499 3711, BQ 123, and BQ 788. 35 In certain embodiments, the secondary therapeutic agent or miR-208b expression can be used to augmentinsulin sen- may comprise a surgery of some type, which includes, for sitivity. Skeletal muscle accounts for the majority of insulin- example, preventative, diagnostic or staging, curative and stimulated glucose uptake in humans. Insulin resistance is a palliative surgery. Surgery, and in particular a curative sur- deficiency of insulin-stimulated glucose uptake seen in gery, may be used in conjunction with other therapies, such as 40 patients with type II diabetes mellitus. There is a positive the present invention and one or more other agents. correlation of insulin resistance and the percentage of slow- Such surgical therapeutic agents for vascular and cardio- versus fast-twitch muscle fibers. Thus, in another embodi- vascular diseases and disorders are well known to those of ment, the present invention contemplates a method of aug- skill in the art, and may comprise, but are not limited to, menting insulin sensitivity in skeletal muscle comprising performing surgery on an organism, providing a cardiovas- 45 increasing the expression and/or activity of miR-499 and/or cular mechanical prostheses, angioplasty, coronary artery miR-208b in skeletal muscle cells. reperfusion, catheter ablation, providing an implantable car- In some embodiments of the invention, increasing the dioverter defibrillator to the subject, mechanical circulatory expression oractivity of miR-499 or miR-208b in a cell may support or a combination thereof. Non-limiting examples ofa comprise administering an agonist of miR-499 or miR-208b. mechanical circulatory support that may be used in the 50 Tn one embodiment, an agonist ofmiR-499 or miR-208b may present invention comprise an intra-aortic balloon counter- bea polynucleotide comprising the mature miR-499 or miR- pulsation, left ventricular assist device or combination 208b sequence. In another embodiment, the polynucleotide thereof. comprises the sequence ofSEQ ID NO: 26 or SEQ ID NO:27. Methodsof Treating Musculoskeletal Diseases In another embodiment, the agonist ofmiR-499 or miR-208b Thepresent invention also provides a methodofdecreasing 55 maybe a polynucleotide comprising the pri-miRNA orpre- the expressionoractivity of a fast skeletal muscle contractile miRNA sequence for miR-499 or miR-208b. The polynucle- protein genein skeletal muscle cells. In one embodiment, the otide comprising the mature miR-499 or miR-208b sequence method comprises administering miR-499 and/or miR-208b may be single stranded or double stranded. The polynucle- to the skeletal musclecells. otides may contain one or more chemical modifications, such The up-regulation of several fast skeletal muscle contrac- 60 as locked nucleic acids, peptide nucleic acids, sugar modifi- tile protein genes wasobservedin the hearts of mice lacking cations, such as 2'-O-alky] (e.g. 2'-O-methyl, 2'-O-methoxy- both miR-208 alleles. This up-regulation of fast skeletal ethyl), 2'-fluoro, and 4' thio modifications, and backbone muscle contractile protein genes in the hearts of miR-208 modifications, such as one or more phosphorothioate, mor- knockout mice indicates that miR-208 normally functions to pholino, or phosphonocarboxylate linkages. In one embodi- repress the fast skeletal muscle gene program. A concomitant 65 ment, the polynucleotide comprising a miR-499 or miR-208b reduction of miR-499 expression was observed in miR-208 sequence is conjugated to cholesterol. In another embodi- mutant mice, suggesting that miR-499 mayalso negatively ment, the agonist of miR-499 or miR-208b may be an agent US 8,962,588 B2 25 26 distinct from miR-499 or miR-208b that acts to increase, Throughout this application, the term “expression con- supplement, or replace the function of miR-499 and/or miR- struct” is meant to include any type of genetic construct 208b. containing a nucleic acid coding for a gene product in which In another embodiment, the agonist of miR-499 or miR- part or all of the nucleic acid encoding sequenceis capable of 208b maybe expressed in vivo from a vector. A “vector” is a being transcribed. The transcript may be translated into a composition of matter which can be usedto deliver a nucleic protein, but it need notbe. In some embodiments, expression acid ofinterestto the interior of a cell. Numerous vectors are only includes transcription of the nucleic acid encoding a known in the art including, but not limited to, linear poly- geneofinterest. nucleotides, polynucleotides associated with ionic or In certain embodiments, the nucleic acid encoding a the amphiphilic compounds, plasmids, and viruses. Thus, the 10 polynucleotide of interest is under transcriptional control of a term “vector” includes an autonomously replicating plasmid promoter. A “promoter”refers toa DNA sequence recognized or a virus. Examples of viral vectors include, but are not by the synthetic machinery ofthecell, or introduced synthetic limited to, adenoviral vectors, adeno-associated virus vec- machinery, required to initiate the specific transcription of a tors, retroviral vectors, and the like. An expression construct gene. The term promoterwill be used hereto refer to a group can be replicated in a living cell, or it can be made syntheti- 15 of transcriptional control modules that are clustered around cally. For purposesofthis application, the terms “expression the initiation site fora RNA polymerase. Muchofthe thinking construct,” “expression vector,” and “vector,” are used inter- about how promoters are organized derives from analyses of changeably to demonstrate the application of the invention in several viral promoters, including those for the HSV thymi- a general, illustrative sense, and are not intendedto limit the dine kinase (tk) and SV40early transcription units. These invention. 20 studies, augmented by more recent work, have shown that In one embodiment, an expression vector for expressing promoters are composedofdiscrete functional modules, each miR-499 or miR-208b comprises a promoter “operably consisting of approximately 7-20 bp of DNA,and containing linked”to a polynucleotide encoding miR-499 or miR-208b. one or more recognition sites for transcriptional activator or The phrase “operably linked” or “under transcriptional con- repressorproteins. trol” as used herein meansthat the promoter is in the correct 25 Atleast one module in each promoter functionsto position location and orientation in relation to a polynucleotide to the start site for RNA synthesis. The best known example of control the initiation oftranscription by RNA polymerase and this is the TATA box,but in some promoters lacking a TATA expression of the polynucleotide. The polynucleotide encod- box, such as the promoter for the mammalian terminal deoxy- ing miR-499 may encode the primary-microRNA-499 nucleotidyl transferase gene and the promoter for the SV40 sequence (pri-miR-499), the precursor-microRNA-499 30 late genes, a discrete element overlying the start site itself sequence (pre-miR-499) or the mature miR-499 sequence. helpsto fix the place of initiation. The polynucleotide encoding miR-208b may encodethepri- Additional promoter elements regulate the frequency of mary-microRNA-208b sequence(pri-miR-208b), the precur- transcriptional initiation. Typically, these are located in the sor-microRNA-208b sequence (pre-miR-208b)or the mature region 30-110 bp upstream ofthestart site, although a number miR-208b sequence. In some embodiments, the expression 35 ofpromoters have recently been shownto contain functional vector comprises a polynucleotide operably linked to a pro- elements downstream of the start site as well. The spacing moter, wherein said polynucleotide comprises the sequence between promoter elements frequently is flexible, so that of SEQ ID NO: 26 or SEQ ID NO:27. The polynucleotide promoterfunction is preserved when elements are inverted or comprising the sequence of SEQ ID NO: 26 or SEQ ID NO: movedrelative to one another. In the tk promoter,the spacing 27 may be about 18 to about 2000 nucleotides in length, about 40 between promoter elements can be increased to 50 bp apart 70 to about 200 nucleotides in length, about 20 to about 50 before activity begins to decline. Depending on the promoter, nucleotides in length, or about 18 to about 25 nucleotides in it appears that individual elements can function either co- length. In other embodiments, the polynucleotide encoding operatively or independently to activate transcription. miR-499 or miR-208b is located in a nucleic acid encoding an In other embodiments, the human cytomegalovirus (CMV) intron or in a nucleic acid encoding an untranslated region of 45 immediate early gene promoter, the SV40 early promoter, the an mRNAor in a non-coding RNA.In one embodiment, the Rous sarcomavirus long terminal repeat, rat insulin pro- expression construct may contain sequences from the 20” moter, RNA pol II promoter, and glyceraldehyde-3-phos- intron from the Myh7b gene. In another embodiment, the phate dehydrogenase promoter can be used to obtain high- expression construct may contain sequences from the 31° level expression of the polynucleotide of interest. The use of intron from the Myh7 (B-MHC)gene. 50 other viral or mammalian cellular or bacterial phage promot- In another embodiment, an expression vector may be used ers which are well-knownin the art to achieve expression of to deliver an inhibitor of miR-499 and/or miR-208bto a cell a polynucleotide of interest is contemplated as well, provided or subject. An expression vectorfor expressing an inhibitor of that the levels ofexpression aresufficient for a given purpose. miR-499 or miR-208b comprises a promoter operably linked By employing a promoter with well-known properties, the to a polynucleotide encoding an antisense oligonucleotide, 55 level and pattern of expression of the polynucleotideof inter- wherein the sequence of the expressed antisense oligonucle- est following transfection or transformation can be opti- otide is partially or perfectly complementary to the mature mized. Further, selection of a promoter that is regulated in miR-499 or miR-208b sequence. In yet another embodiment, responseto specific physiologic signals can permit inducible an expression vector for expressing an inhibitor of miR-499 expression of the gene product. Tables 1 and 2 list several or miR-208b comprises one or more promoters operably 60 regulatory elements that may be employed,in the context of linked to a polynucleotide encoding a shRNA or siRNA, the present invention, to regulate the expressionofthe gene of wherein the expressed shRNA or siRNA comprises a interest. This list is not intended to be exhaustiveofall the sequencethatis identical or partially identical to the mature possible elements involved in the promotion of gene expres- miR-499 or miR-208b sequence.“Partially identical” refers sion but, merely, to be exemplary thereof. to a sequencethat is at least about 75%, 80%, 85%, 90%, 65 Enhancers are genetic elements that increase transcription 95%, 96%, 97%, 98%, or 99% identical to a target polynucle- from a promoter located at a distant position on the same otide sequence. molecule of DNA. Enhancers are organized muchlike pro- US 8,962,588 B2 27 28 moters. That is, they are composed of many individualele- Below is a list of viral promoters, cellular promoters/en- ments, each of which binds to one or more transcriptional hancers and inducible promoters/enhancers that could be proteins. used in combination with the nucleic acid encoding a gene of The basic distinction between enhancers and promotersis operational. An enhancer region as a whole mustbe able to interest in an expression construct (Table 1 and Table 2). stimulate transcription at a distance; this need notbe true ofa Additionally, any promoter/enhancer combination (as per the promoter region or its component elements. On the other Eukaryotic Promoter Data Base EPDB) could also be used to hand, a promoter must have one or more elements that direct drive expression of the gene. Eukaryotic cells can support initiation of RNA synthesis at a particular site and in a par- cytoplasmictranscription from certain bacterial promoters if ticular orientation, whereas enhancerslack these specificities. 10 Promoters and enhancers are often overlapping and contigu- the appropriate bacterial polymerase is provided, either as ous, often seeming to have a very similar modular organiza- part of the delivery complex or as an additional genetic tion. expression construct.

TABLE1

Promoter and/or Enhancer

Promoter/Enhancer References

Immunoglobulin Heavy Chain Banerji et al., 1983; Gilles et al., 1983; Grossched]etal., 1985; Atchinsonetal., 1986, 1987; Imler etal., 1987; Weinberger et al., 1984; Kiledjian et al., 1988; Porton et al; 1990 Immunoglobulin Light Chain Queenetal., 1983; Picard et al., 1984 T-Cell Receptor Luria et al., 1987; Winoto et al., 1989; Redondoetal; 1990 HLA DQ and/or DQ B Sullivan etal., 1987 a f-Interferon Goodbourn et al., 1986; Fujita et al., 1987; Goodbournet al., 1988 Interleukin-2 Greeneetal., 1989 Interleukin-2 Receptor Greeneetal., 1989; Lin etal., 1990 MHCClass II 5 Kochet al., 1989 MHCClass IIT HLA-DRa Sherman et al., 1989 f-Actin Kawamotoet al., 1988; Ng et al.; 1989 Muscle Creatine Kinase (MCK) Jaynes et al., 1988; Horlick et al., 1989; Johnsonet al., 1989 Prealbumin (Transthyretin) Costa et al., 1988 Elastase I Ornitz et al., 1987 Metallothionein (MTID Karin et al., 1987; Culotta et al., 1989 Collagenase Pinkert et al., 1987; Angelet al., 1987 Albumin Pinkert et al., 1987; Troncheet al., 1989, 1990 a-Fetoprotein Godboutet al., 1988; Campereet al., 1989 t-Globin Bodineetal., 1987; Perez-Stable et al., 1990 6-Globin Trudel et al., 1987 c-fos Cohenetal., 1987 c-HA-ras Triesman, 1986; Deschampsetal., 1985 Insulin Edlundetal., 1985 Neural Cell Adhesion Molecule (NCAM) Hirshet al., 1990 a,-Antitrypain Latimeret al., 1990 H2B (TH2B) Histone Hwanget al., 1990 Mouse and/or Type I Collagen Ripeet al., 1989 Glucose-Regulated Proteins Changet al., 1989 (GRP94 and GRP78) Rat Growth Hormone Larsen et al., 1986 Human Serum Amyloid A (SAA) Edbrooket al., 1989 Troponin I (TN I) Yutzey et al., 1989 Platelet-Derived Growth Factor Pechet al., 1989 (PDGF) Duchenne Muscular Dystrophy Klamutet al., 1990 SV40 Banerji et al., 1981; Moreauet al., 1981; Sleigh et al., 1985; Firak et al., 1986; Herr et al., 1986; Imbraetal., 1986; Kadeschet al., 1986; Wanget al., 1986; Ondek et al., 1987; Kuhlet al., 1987; Schaffner etal., 1988 Polyoma Swartzendruberetal., 1975; Vasseuret al., 1980; Katinka et al., 1980, 1981; Tyndell et al., 1981; Dandoloet al., 1983; de Villiers et al., 1984; Henet al., 1986; Satake et al., 1988; Campbell and/or Villareal, 1988 Retroviruses Kriegler et al., 1982, 1983; Levinsonet al., 1982; Kriegler et al., 1983, 1984a, b, 1988; Bosze et al., 1986; Miksicek et al., 1986; Celanderet al., 1987; Thiesenet al., 1988; Celanderet al., 1988; Choi et al., 1988; Reisman etal., 1989 Papilloma Virus Campoet al., 1983; Lusky et al., 1983; Spandidos and/or Wilkie, 1983; Spalholz et al., 1985; Lusky et al., 1986; Cripe etal., 1987; Gloss et al., 1987; Hirochikaetal., 1987; Stephenset al., 1987. Hepatitis B Virus Bulla et al., 1986; Jameel etal., 1986; Shaul et al., 1987; Spandauet al., 1988; Vanniceet al., 1988 US 8,962,588 B2 29 30 TABLE 1-continued

Promoter and/or Enhancer

Promotetr/Enhancer References

Human Immunodeficiency Virus Muesinget al., 1987; Hauberet al., 1988; Jakobovits et al., 1988; Fenget al., 1988; Takebeetal., 1988; Rosen et al., 1988; Berkhoutet al., 1989; Laspiaet al., 1989; Sharp et al., 1989; Braddocket al., 1989 Cytomegalovirus (CMV) Weberet al., 1984; Boshart et al., 1985; Foecking etal., 1986 Gibbon Ape Leukemia Virus Holbrooket al., 1987; Quinnet al., 1989

TABLE 2 to enhance message levels and to minimize read through from

15 the cassette into other sequences. Inducible Elements In certain embodimentsof the invention, the cells contain- ing nucleic acid constructs of the present invention may be Element Inducer References

identified in vitro or in vivo by including a marker in the MT II Phorbol Ester (TFA) Palmiter et al., 1982; expression construct. Such markers would confer an identi- Heavy metals Haslinger et al., 1985; 20 fiable changeto the cell permitting easy identificationof cells Searle et al., 1985; Stuart et al., 1985; Imagawaet containing the expression construct. Usually the inclusion of al., 1987, Karin et al., a drug selection markeraids in cloning andin the selection of 1987; Angelet al., 1987b; transformants, for example, genes that confer resistance to McNeall et al., 1989 neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and MMTV (mouse Glucocorticoids Huanget al., 1981; Lee et mammary tumor al., 1981; Majorset al., 25 histidinol are useful selectable markers. Alternatively, virus) 1983; Chandleret al., enzymes such as herpes simplex virus thymidine kinase (tk) 1983; Ponta et al., 1985; or chloramphenicol acetyltransferase (CAT) may be Sakaiet al.,1988 employed. Immunologic markers also can be employed. The §-Interferon poly(@)x Tavernieret al., 1983 selectable marker employedis not believed to be important, poly(re) Adenovirus 5 E2 EIA Imperiale et al., 1984 30 so long as it is capable of being expressed simultaneously Collagenase Phorbol Ester (TPA) Angelet al., 1987a with the nucleic acid encoding a gene product. Further Stromelysin Phorbol Ester (TPA) Angelet al., 1987b examples of selectable markers are well known to one of skill SV40 Phorbol Ester (TPA) Angelet al., 1987b Murine MX Gene Interferon, Hug et al., 1988 in the art. Newcastle There are a numberof ways in which expression vectors Disease Virus 35 may introduced into cells. In certain embodiments of the GRP78 Gene A23187 Resendezet al., 1988 invention, the expression construct comprises a virus or engi- a-2-Macroglobulin IL-6 Kunzet al., 1989 Vimentin Serum Rittling et al., 1989 neered construct derived from a viral genome. Theability of MHCClass I Gene Interferon Blanar et al., 1989 certain viruses to enter cells via receptor-mediated endocyto- H-2kb sis, to integrate into host cell genomeandexpressviral genes HSP70 EIA, SV40 Large T Tayloret al., 1989, 1990a, 40 stably andefficiently have made them attractive candidates Antigen 1990b Proliferin Phorbol Ester-TPA Mordacq et al., 1989 for the transfer offoreign genes into mammaliancells (Ridge- Tumor Necrosis Factor PMA Henselet al., 1989 way, 1988; Nicolas and Rubenstein, 1988; Baichwal and Thyroid Stimulating Thyroid Hormone Chatterjee et al., 1989 Sugden, 1986; Temin, 1986). Hormone a@ Gene Oneofthe preferred methodsfor in vivo delivery involves

45 the use of an adenovirus expression vector. “Adenovirus Ofparticular interest are muscle specific promoters (e.g. expression vector” is meant to include those constructs con- muscle creatine kinase), and moreparticularly, cardiac spe- taining adenovirus sequencessufficient to (a) support pack- cific promoters. These include the myosin light chain-2 pro- aging ofthe construct and(b) to express a polynucleotide that moter (Franz et al., 1994; Kelly et al., 1995), the alpha actin has been cloned therein. The expression vector comprises a promoter (Moss et al., 1996), the troponin 1 promoter genetically engineered form of adenovirus. Knowledge ofthe (Bhavsar et al., 1996); the Na*/Ca?* exchanger promoter genetic organization of adenovirus, a 36 kB, linear, double- stranded DNA virus, allows substitution of large pieces of (Barneset al., 1997), the dystrophin promoter (Kimuraetal., adenoviral DNA with foreign sequences up to 7 kB (Grun- 1997), the alpha7 integrin promoter (Ziober and Kramer, haus and Horwitz, 1992). In contrast to retrovirus, the aden- 1996), the brain natriuretic peptide promoter (LaPointeetal., 55 oviral infection of host cells does not result in chromosomal 1996) and the alpha B-crystallin/small heat shock protein integration because adenoviral DNAcan replicate in an epi- promoter (Gopal-Srivastava, 1995), alpha myosin heavy somal manner without potential genotoxicity. Also, adenovi- chain promoter (Yamauchi-Takihara et al., 1989) and the ruses are structurally stable, and no genomerearrangement ANFpromoter (LaPointeet al., 1988). has been detected after extensive amplification. Adenovirus WhereacDNaAinsert is employed, one will typically desire 60 can infect virtually all epithelial cells regardless of their cell to include a polyadenylation signal to effect proper polyade- cycle stage. nylation of the gene transcript. The nature of the polyadeny- Adenovirusis particularly suitable for use as a genetrans- lation signal is not believed to be crucial to the successful fer vector because of its mid-sized genome, ease of manipu- practice of the invention, and any such sequence may be lation, high titer, wide target cell range and high infectivity. employed such as human growth hormone and SV40 poly- 65 Both ends of the viral genome contain 100-200 base pair adenylation signals. Also contemplated as an elementof the inverted repeats (ITRs), which are cis elements necessary for expression cassette is a terminator. These elements can serve viral DNA replication and packaging. US 8,962,588 B2 31 32 Other than the requirement that the adenovirus vector be 1983). The media containing the recombinantretrovirusesis replication defective, or at least conditionally defective, the then collected, optionally concentrated, and used for gene nature of the adenovirus vector1s not believed to be crucial to transfer. Retroviral vectors are able to infect a broad variety of the successful practice of the invention. The adenovirus may cell types. However, integration and stable expression require be of any of the 42 different known serotypes or subgroups the division of host cells (Paskindet al., 1975). A-F. Adenovirus type 5 of subgroup C is the preferred starting Other viral vectors may be employed as expression con- material in order to obtain the conditional replication-defec- structs in the present invention. Vectors derived from viruses tive adenovirus vector for use in the present invention. This is such as vaccinia virus (Ridgeway, 1988; Baichwal and Sug- because Adenovirus type 5 is a human adenovirus about den, 1986; Coupar et al., 1988) adeno-associated virus (AAV) which a great deal of biochemical and genetic information is 10 (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat known, andit has historically been used for most construc- and Muzycska, 1984) and herpesviruses may be employed. tions employing adenovirus as a vector. They offer several attractive features for various mammalian Asstated above,the typical vector according to the present cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sug- invention is replication defective and will not have an aden- den, 1986; Couparet al., 1988; Horwichetal., 1990). ovirus E1 region. Thus, it will be most convenient to intro- 15 In order to effect expression of sense or antisense gene duce the polynucleotide encoding the geneofinterest at the constructs, the expression construct must be delivered into a position from which the El-coding sequences have been cell. This delivery may be accomplishedin vitro, as in labo- removed. However, the position of insertion of the construct ratory procedures for transformingcells lines, or in vivo or ex within the adenovirus sequencesis not critical to the inven- vivo, as in the treatment of certain disease states. One mecha- tion. The polynucleotide encoding the gene of interest may 20 nism for delivery is via viral infection where the expression also beinserted in lieu of the deleted E3 region in E3 replace- construct is encapsidated in an infectious viral particle. mentvectors, as described by Karlsson et al. (1986), or in the Several non-viral methods for the transfer of expression E4 region where a helper cell line or helper virus comple- constructs into cultured mammalian cells also are contem- ments the E4 defect. plated by the present invention. These include calcium phos- Adenovirus vectors have been used in eukaryotic gene 25 phate precipitation (Graham and Van Der Eb, 1973; Chen and expression (Levrero et al., 1991; Gomez-Foix et al., 1992) Okayama, 1987; Rippeet al., 1990) DEAE-dextran (Gopal, and vaccine development (Grunhausand Horwitz, 1992; Gra- 1985), electroporation (Tur-Kaspaet al., 1986; Potteret al., ham and Prevec, 1991). Recently, animal studies suggested 1984), direct microinjection (Harland and Weintraub, 1985), that recombinant adenovirus could be used for gene therapy DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et (Stratford-Perricaudet and Perricaudet, 1991; Stratford-Per- 30 al., 1979) and lipofectamine-DNA complexes,cell sonication ricaudetet al., 1990; Rich et al., 1993). Studies in adminis- (Fechheimer et al., 1987), gene bombardment using high tering recombinant adenovirus to different tissues include velocity microprojectiles (Yang et al., 1990), and receptor- trachea instillation (Rosenfeld et al., 1991; Rosenfeld et al., mediated transfection (Wu and Wu, 1987; Wu and Wu,1988). 1992), muscle injection (Ragotet al., 1993), peripheral intra- Someofthese techniques may be successfully adapted for in venous injections (Herz and Gerard, 1993) and stereotactic 35 Vivo or ex Vivo use. inoculation into the brain (Le Gal La Salle et al., 1993). Once the expression construct has been delivered into the Retroviral vectors are also suitable for expressing the poly- cell the nucleic acid encoding the gene of interest may be nucleotides of the invention in cells. The retroviruses are a positioned and expressedatdifferent sites. In certain embodi- group of single-stranded RNA viruses characterized by an ments, the nucleic acid encoding the gene may be stably ability to convert their RNA to double-stranded DNA in 40 integrated into the genomeofthe cell. This integration may be infected cells by a process of reverse-transcription (Coffin, in the cognate location and orientation via homologous 1990). The resulting DNAthenstably integrates into cellular recombination (gene replacement)or it may be integrated in chromosomes as a provirus and directs synthesis of viral a random, non-specific location (gene augmentation). In yet proteins. The integration results in the retention of the viral further embodiments, the nucleic acid may be stably main- gene sequencesin the recipient cell and its descendants. The 45 tained in the cell as a separate, episomal segment of DNA. retroviral genomecontainsthree genes, gag, pol, and env that Such nucleic acid segments or “episomes” encode sequences code for capsid proteins, polymerase enzyme, and envelope sufficient to permit maintenance andreplication independent components, respectively. A sequence found upstream from of or in synchronization with the host cell cycle. How the the gag gene contains a signal for packaging of the genome expression construct is delivered to acell and where in the cell into virions. Two long terminal repeat (LTR) sequences are 50 the nucleic acid remains is dependent on the type of expres- presentat the 5' and 3' ends ofthe viral genome. These contain sion construct employed. strong promoter and enhancer sequences and are also In yet another embodimentofthe invention, the expression required for integration in the host cell genome (Coffin, construct may simply consist of naked recombinant DNA or 1990). plasmids. Transfer of the construct may be performed by any In order to construct a retroviral vector, a nucleic acid 55 of the methods mentioned above which physically or chemi- encoding a geneofinterest is insertedinto the viral genome in cally permeabilize the cell membrane. This is particularly the place of certain viral sequences to produce a virus that is applicable for transfer in vitro but it may be applied to in vivo replication-defective. In order to produce virions, a packag- use as well. Dubensky et al. (1984) successfully injected ing cell line containing the gag,pol, and env genes but without polyomavirus DNAin the form ofcalcium phosphateprecipi- the LTR and packaging components is constructed (Mann et 60 tates into liver and spleen of adult and newborn mice demon- al., 1983). When a recombinant plasmid containing a cDNA, strating active viral replication and acute infection. Ben- together with the retroviral LTR and packaging sequencesis venisty and Neshif (1986) also demonstrated that direct introduced into this cell line (by calctum phosphate precipi- intraperitoneal injection of calctum phosphate-precipitated tation for example), the packaging sequence allows the RNA plasmids results in expression of the transfected genes. It is transcript of the recombinant plasmid to be packaged into 65 envisioned that DNA encoding a gene of interest may also be viral particles, which are then secreted into the culture media transferred in a similar manner in vivo and express the gene (Nicolas and Rubenstein, 1988; Temin, 1986; Mann etal., product. US 8,962,588 B2 33 34 In still another embodimentof the invention for transfer- (EGF)hasalso been used to deliver genes to squamous car- ring anaked DNA expression construct into cells may involve cinoma cells (Myers, EPO 0273085). particle bombardment. This method depends onthe ability to In other embodiments, the delivery vehicle may comprise a accelerate DNA-coated microprojectiles to a high velocity ligand and a liposome. For example, Nicolau et al. (1987) allowing them to pierce cell membranesandenter cells with- employed lactosyl-ceramide, a galactose-terminal asialgan- out killing them (Klein et al., 1987). Several devices for glioside, incorporated into liposomes and observed an accelerating small particles have been developed. One such increase in the uptake of the insulin gene by hepatocytes. device relies on a high voltage discharge to generate an elec- Thus, it is feasible that a nucleic acid encoding a particular trical current, which in turn provides the motive force (Yang gene also maybespecifically delivered into a cell type by any et al., 1990). The microprojectiles used have consisted of number of receptor-ligand systems with or without lipo- biologically inert substances such as tungsten or gold beads. somes. For example, epidermal growth factor (EGF) may be Selected organs includingthe liver, skin, and muscle tissue used as the receptor for mediated delivery of a nucleic acid of rats and mice have been bombarded in vivo (Yanget al., 1990; Zelenin et al., 1991). This may require surgical expo- into cells that exhibit upregulation ofEGF receptor. Mannose sure of the tissueor cells, to eliminate any intervening tissue can be usedto target the mannosereceptoron liver cells. Also, between the gun andthe target organ, i.e., ex vivo treatment. antibodies to CD5 (CLL), CD22 dymphoma), CD25 (T-cell Again, DNA encodinga particular gene maybe delivered via leukemia) and MAA (melanoma) can similarly be used as this methodandstill be incorporatedby the present invention. targeting moieties. In a further embodiment of the invention, the expression In particular example, the polynucleotide may be admin- a construct may be entrapped in a liposome. Liposomes are 20 istered in combination with a cationic lipid. Examples of vesicular structures characterized by a phospholipid bilayer cationic lipids include, but are not limited to, lipofectin, membraneand an inner aqueous medium. Multilamellarlipo- DOTMA, DOPE, and DOTAP. The publication of somes have multiple lipid layers separated by aqueous WO/0071096, which is specifically incorporated by refer- medium. They form spontaneously when phospholipids are ence, describes different formulations, such as a DOTAP: suspended in an excess of aqueous solution. The lipid com- cholesterol or cholesterol derivative formulation that can ponents undergo self-rearrangement before the formation of effectively be used for gene therapy. Other disclosures also closed structures and entrap water and dissolved solutes discuss different lipid or liposomal formulations including between the lipid bilayers (Ghosh and Bachhawat, 1991). nanoparticles and methods of administration; these include, Also contemplated are lipofectamine-DNA complexes. butare not limited to, U.S. Patent Publication 20030203865, Liposome-mediated nucleic acid delivery and expression 20020150626, 20030032615, and 20040048787, which are of foreign DNAin vitro has been very successful. Wongetal., specifically incorporated by reference to the extent they dis- (1980) demonstrated the feasibility of liposome-mediated close formulations and other related aspects ofadministration delivery and expression of foreign DNA in cultured chick and delivery of nucleic acids. Methods used for forming embryo, HeLa and hepatoma cells. Nicolau et al., (1987) particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877, accomplished successful liposome-mediated gene transfer in 302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972, rats after intravenous injection. 900, which are incorporated by reference for those aspects. In certain embodimentsofthe invention,the liposome may In certain embodiments, gene transfer may more easily be be complexed with a hemagglutinating virus (HVJ). This has performed under ex vivo conditions. Ex vivo gene therapy been shownto facilitate fusion with the cell membrane and refers to the isolation of cells from an animal, the delivery of promote cell entry of liposome-encapsulated DNA (Kaneda 40 a nucleic acid into the cells in vitro, and then the return of the et al., 1989). In other embodiments, the liposome may be modified cells back into an animal. This may involve the complexed or employed in conjunction with nuclear non- surgical removalof tissue/organs from an animalorthe pri- histone chromosomalproteins (HMG-1) (Kato et al., 1991). mary culture of cells andtissues. In yet further embodiments, the liposome may be complexed Drug Formulations and Routes forAdministration to Subjects or employed in conjunction with both HVJ and HMG-1. In 45 The present invention also encompasses a pharmaceutical that such expression constructs have been successfully composition comprising an inhibitor or agonist of miR-499 employed in transfer and expression of nucleic acid in vitro and/or miR-208b. Where clinical applications are contem- and in vivo, then they are applicable for the present invention. plated, pharmaceutical compositions will be prepared in a Where a bacterial promoter is employed in the DNA con- form appropriate for the intended application. Generally, this struct, it also will be desirable to include within the liposome will entail preparing compositions that are essentially free of an appropriate bacterial polymerase. pyrogens, as well as other impurities that could be harmful to Other expression constructs which can be employed to humansor animals. deliver a nucleic acid encoding a particular geneinto cells are Colloidal dispersion systems, such as macromolecule receptor-mediated delivery vehicles. These take advantage of complexes, nanocapsules, microspheres, beads, and lipid- the selective uptake ofmacromolecules by receptor-mediated based systems including oil-in-water emulsions, micelles, endocytosis in almostall eukaryotic cells. Because ofthe cell mixed micelles, and liposomes, may be used as delivery type-specific distribution of various receptors, the delivery vehicles for the oligonucleotide inhibitors of microRNA can be highly specific (Wu and Wu, 1993). function or constructs expressing particular microRNAs. Receptor-mediated gene targeting vehicles generally con- Commercially available fat emulsions that are suitable for sist of two components: a cell receptor-specific ligand and a delivering the nucleic acids of the invention to cardiac and DNA-binding agent. Several ligands have been used for skeletal muscle tissues include Intralipid®, Liposyn®, Lipo- receptor-mediated gene transfer. The most extensively char- syn® II, Liposyn® III, Nutrilipid, and other similar lipid acterized ligands are asialoorosomucoid (ASOR) (Wu and emulsions. A preferred colloidal system for use as a delivery Wu, 1987) and transferrin (Wagner et al., 1990). Recently, a vehicle in vivo is a liposome(i.e., an artificial membrane synthetic neoglycoprotein, which recognizes the same recep- vesicle). The preparation and use of such systems is well tor as ASOR,has been usedas a gene delivery vehicle (Ferkol knownin the art. Exemplary formulations are also disclosed et al., 1993; Perales et al., 1994) and epidermal growth factor in U.S. Pat. Nos. 5,981,505; 6,217,900; 6,383,512; 5,783, US 8,962,588 B2 35 36 565; 7,202,227; 6,379,965; 6,127,170; 5,837,533; 6,747,014; that easy injectability exists. Preparations should be stable and WO03/093449, which are herein incorporated byrefer- under the conditions of manufacture and storage and should ence in their entireties. be preserved against the contaminating action ofmicroorgan- One will generally desire to employ appropriate salts and isms, such as bacteria and fungi. Appropriate solvents or buffers to render delivery vehicles stable and allow for uptake dispersion media may contain, for example, water, ethanol, by target cells. Buffers also will be employed when recom- polyol (for example, glycerol, propylene glycol, and liquid binant cells are introduced into a subject. Aqueous composi- polyethylene glycol, and thelike), suitable mixtures thereof, tions ofthe present invention comprise an effective amount of and vegetable oils. The proper fluidity can be maintained, for the delivery vehicle comprising the inhibitor polynucleotides example, by the use of a coating, such as lecithin, by the or miRNApolynucleotide sequences(e.g. liposomesor other maintenance of the required particle size in the case of dis- complexes or expression vectors) or cells, dissolved or dis- persion and by the use of surfactants. The prevention of the persed in a pharmaceutically acceptable carrier or aqueous action of microorganisms can be brought about by various medium. The phrases “pharmaceutically acceptable” or “pharmacologically acceptable” refers to molecular entities antibacterial an antifungal agents, for example, parabens, and compositions that do not produce adverse, allergic, or chlorobutanol, phenol, sorbic acid, thimerosal, and the like. other untoward reactions when administered to an animal or In manycases,it will be preferable to include isotonic agents, a human.Asused herein, “pharmaceutically acceptable car- for example, sugars or sodium chloride. Prolonged absorp- rier” includes solvents, buffers, solutions, dispersion media, tion of the injectable compositions can be brought about by coatings, antibacterial and antifungal agents, isotonic and the use in the compositions ofagents delaying absorption, for absorption delaying agents and the like acceptable for use in 20 example, aluminum monostearate and gelatin. formulating pharmaceuticals, such as pharmaceuticals suit- Sterile injectable solutions maybe prepared by incorporat- able for administration to humans. The use of such media and ing the active compounds in an appropriate amount into a agents for pharmaceutically active substances is well known solvent along with any other ingredients (for example as in the art. Except insofar as any conventional media or agent enumerated above) as desired, followedbyfiltered steriliza- is incompatible with the active ingredients of the present tion. Generally, dispersions are prepared by incorporating the invention, its use in therapeutic compositions is contem- various sterilized active ingredients into a sterile vehicle plated. Supplementary active ingredients also can be incor- which contains the basic dispersion medium andthe desired poratedinto the compositions, providedthey do not inactivate other ingredients, e.g., as enumerated above. In the case of the vectors or cells of the compositions. sterile powders for the preparation of sterile injectable solu- The active compositions of the present invention may 30 tions, the preferred methods of preparation include vacuum- include classic pharmaceutical preparations. Administration drying and freeze-drying techniques which yield a powder of ofthese compositions accordingto the present invention may the active ingredient(s) plus any additional desired ingredient be via any common route so long as the target tissue is from a previously sterile-filtered solution thereof. available via that route. This includes oral, nasal, or buccal. The compositions of the present invention generally may Alternatively, administration may be by intradermal, subcu- 35 taneous, intramuscular, intraperitoneal or intravenousinjec- be formulated in a neutral or salt form. Pharmaceutically- tion, or by direct injection into cardiac tissue. Pharmaceutical acceptable salts include, for example, acid addition salts compositions comprising miRNA inhibitors or expression (formed with the free amino groups ofthe protein) derived constructs comprising miRNA sequences mayalso be admin- from inorganic acids (e.g., hydrochloric or phosphoric acids, istered by catheter systems or systems that isolate coronary 40 or from organic acids (e.g., acetic, oxalic, tartaric, mandelic, circulation for delivering therapeutic agents to the heart. Vari- and thelike. Salts formed with the free carboxyl groups ofthe ous catheter systems for delivering therapeutic agents to the protein can also be derived from inorganic bases (e.g., heart and coronary vasculature are known in the art. Some sodium, potassium, ammonium,calcium, or ferric hydrox- non-limiting examples of catheter-based delivery methods or ides) or from organic bases(e.g., isopropylamine, trimethy- coronary isolation methods suitable for use in the present 45 lamine,histidine, procaine andthe like. invention are disclosed in U.S. Pat. Nos. 6,416,510; 6,716, Upon formulation, solutionsare preferably administered in 196; 6,953,466, WO 2005/082440, WO 2006/089340, U.S. a manner compatible with the dosage formulation and in such Patent Publication No. 2007/0203445, U.S. Patent Publica- amountas is therapeutically effective. The formulations may tion No. 2006/0148742, and U.S. Patent Publication No. easily be administered in a variety of dosage forms such as 2007/0060907, which are all herein incorporated by refer- injectable solutions, drug release capsules and the like. For ence in their entireties. Such compositions would normally be parenteral administration in an aqueous solution, for administered as pharmaceutically acceptable compositions, example, the solution generally is suitably buffered and the as described supra. liquid diluentfirst rendered isotonic for example with suffi- The active compounds mayalso be administered parenter- cient saline or glucose. Such aqueoussolutions may be used, ally or intraperitoneally. By way ofillustration, solutions of for example, for intravenous, intramuscular, subcutaneous the active compounds as free base or pharmacologically and intraperitoneal administration. Preferably, sterile aque- acceptable salts can be prepared in water suitably mixed with ous media are employedas is knownto those of skill in theart, a surfactant, such as hydroxypropylcellulose. Dispersions particularly in light of the present disclosure. By way of can also be preparedin glycerol, liquid polyethylene glycols, illustration, a single dose may be dissolved in 1 ml of isotonic and mixtures thereofandin oils. Under ordinary conditions of NaC]solution and either added to 1000 ml ofhypodermocly- storage and use, these preparations generally contain a pre- sis fluid or injected at the proposedsite of infusion, (see for servative to prevent the growth of microorganisms. example, “Remington’s Pharmaceutical Sciences” 15th Edi- The pharmaceutical forms suitable for injectable use or tion, pages 1035-1038 and 1570-1580). Some variation in catheter delivery include, for example, sterile aqueous solu- dosage will necessarily occur depending on the condition of tionsor dispersions andsterile powders for the extemporane- the subject being treated. The person responsible for admin- ous preparation ofsterile injectable solutions or dispersions. istration will, in any event, determine the appropriate dose for Generally, these preparationsare sterile and fluid to the extent the individual subject. Moreover, for human administration, US 8,962,588 B2 37 38 preparations should meetsterility, pyrogenicity, general inhibitors of miR-499 and/or miR-208b are useful in the safety and purity standards as required by FDA Office of prevention or treatment or reversal of cardiac hypertrophy, Biologics standards. heart failure, or myocardial infarction. Identified agonists of Any of the compositions described herein may be com- miR-499 and/or miR-208b are useful in the treatment or prised in a kit. In a non-limiting example, an individual prevention of musculoskeletal disorders. Modulators of miR miRNAis includedin a kit. The kit may further include water 499 and/or miR-208b may be included in pharmaceutical and hybridization bufferto facilitate hybridization of the two compositions for the treatment of cardiac disorders and/or strands of the miRNAs. In some embodiments, the kit may musculoskeletal disorders according to the methods of the include one or more oligonucleotides for inhibiting the func- present invention. tion of a target miRNA.The kit may also include one or more These assays may comprise random screening of large transfection reagent(s) to facilitate delivery of the miRNA or libraries of candidate substances; alternatively, the assays miRNA inhibitors to cells. may be used to focus on particular classes of compounds The components of the kits may be packaged either in selected with an eye towards structural attributes that are aqueous media or in lyophilized form. The container means believed to make them morelikely to inhibit or enhance the of the kits will generally include at least one vial, test tube, expression and/or function of miR-499 and/or miR-208b. To flask, bottle, syringe or other container means, into which a identify a modulator ofmiR-499 or miR-208b, one generally component maybeplaced, and preferably, suitably aliquoted. will determine the function of a miR-499 and/or miR-208b in Wherethere is more than one componentin the kit (labeling the presence and absence of the candidate substance. For reagent and label may be packagedtogether), the kit also will example, a method generally comprises: generally contain a second, third or other additional container (a) providing a candidate substance; into which the additional components may be separately (b) admixing the candidate substance with a miR-499 and/ placed. However, various combinations of components may or miR-208b; be comprisedin a vial. The kits of the present invention also (c) measuring miR-499 and/or miR-208b activity; and will typically include a means for containing the nucleic (d) comparingthe activity in step (c) with the activity in the acids, and any other reagent containers in close confinement 25 absenceof the candidate substance, for commercial sale. Such containers may include injection or wherein a difference between the measuredactivities indi- blow-moldedplastic containers into which the desired vials cates that the candidate substanceis, indeed, a modula- are retained. tor of miR-499 and/or miR-208b. Whenthe componentsofthe kit are provided in one and/or Assays also may be conductedin isolated cells, organs, or in moreliquid solutions, the liquid solution is an aqueous solu- living organisms. tion, with a sterile aqueous solution being particularly pre- Assessing the miR-499 or miR-208bactivity or expression ferred. may comprise assessing the expression level of miR-499 or However, the components of the kit may be provided as miR-208b. Thosein the art will be familiar with a variety of dried powder(s). When reagents and/or componentsare pro- methods for assessing RNA expression levels including, for vided as a dry powder, the powder can be reconstituted by the example, northern blotting or RT-PCR. Assessing the miR- addition ofa suitable solvent. It is envisioned that the solvent 499 or miR-208b activity or expression may comprise assess- mayalso be provided in another container means. ing the activity of miR-499 or miR-208b. In some embodi- The container means will generally include at least one ments, assessing the activity of miR-499 or miR-208b vial, test tube, flask, bottle, syringe and/or other container comprises assessing expressionor activity ofa gene regulated means, into which the nucleic acid formulations are placed, 40 by miR-499 or miR-208b. Genes regulated by miR-499 preferably, suitably allocated. The kits may also comprise a include, for example, B-myosin heavy chain andfast skeletal second container meansfor containing a sterile, pharmaceu- muscle protein genes, such as troponin 12, troponin T3, myo- tically acceptable buffer and/or other diluent. sin light chain, and « skeletal actin. Genes regulated by miR- Thekits ofthe present invention will also typically include 208b include, for example, Sp3, Myostatin, PURbeta, a means for containing the vials in close confinement for 45 THRAPI, and fast skeletal muscle protein genes. In certain commercial sale, such as, e.g., injection and/or blow-molded embodiments of the invention, assessing the activity of miR- plastic containers into which the desired vials are retained. 499 or miR-208b comprises assessing the ratio of a-myosin Such kits may also include components that preserve or heavy chain expression level to B-myosin heavy chain expres- maintain the miRNA or miRNAinhibitory oligonucleotides sion level in the heart. In other embodiments, assessing the or that protect against their degradation. Such components activity of miR-499 or miR-208b comprises assessing the may be RNAse-free or protect against RNAses. Such kits expression level of the different B-myosin heavy chain iso- generally will comprise, in suitable means, distinct containers forms in skeletal muscles. Those in the art will be familiar for each individual reagentor solution. with a variety ofmethods for assessing the activity or expres- A kit will also include instructions for employing the kit sion ofgenes regulated by miR-499 or miR-208b. Such meth- components as well the use of any other reagent not included ods include, for example, northern blotting, RT-PCR, ELISA, in the kit. Instructions may include variations that can be or western blotting. implemented. A kit may also include utensils or devices for It will, of course, be understood that all the screening administering the miRNA agonist or antagonist by various methods of the present invention are useful in themselves administration routes, such as parenteral or catheter admin- notwithstanding the fact that effective candidates may not be istration. 60 found. The invention provides methodsfor screening for such Tt is contemplated that such reagents are embodiments of candidates, not solely methodsoffinding them. kits ofthe invention. Such kits, however, are not limited to the As used herein the term “candidate substance”refers to any particular items identified above and may include any reagent molecule that may potentially modulate the B-MHC-regulat- used for the manipulation or characterization of miRNA. ing aspects of miR-499 and/or miR-208b. One will typically Methodsfor Identifying Modulators 65 acquire, from various commercial sources, molecular librar- The present invention further comprises methodsfor iden- ies that are believed to meet the basiccriteria for useful drugs tifying a modulator of miR-499 and/or miR-208b.Identified in an effort to “brute force”the identification of useful com- US 8,962,588 B2 39 40 pounds. Screening of such libraries, including combinatori- embodiment, there is provided a method of regulating skel- ally-generated libraries (e.g., antagomirlibraries), is a rapid etal muscle contractile protein gene expression comprising and efficient way to screen a large numberofrelated (and administering a modulator of miR 499 and/or miR-208b unrelated) compounds for activity. Combinatorial expression or activity to skeletal muscle cells. In still another approachesalso lend themselves to rapid evolution of poten- embodiment, the present invention provides a method of tial drugs by the creation of second, third, and fourth genera- inducing a fiber type switch of a skeletal muscle cell com- tion compounds modeled on active, but otherwise undesir- prising administering a modulator of miR 499 and/or miR- able compounds. Non-limiting examples of candidate 208b expression or activity to the skeletal muscle cell. The substances that may be screened according to the methods of modulator may be an agonist or an antagonist of miR 499 the present invention are proteins, peptides, polypeptides, 10 and/or miR-208b expression or activity. In some embodi- polynucleotides, oligonucleotides or small molecules. Modu- ments, the expression of THRAP1, PURbeta, myostatin, and lators of miR-499 and/or miR-208b may also be agonists or Sox 6 are increased in a cell by contacting the cell with a antagonists of an upstream regulators of miR-499 and/or miR-499 inhibitor. In other embodiments, expression of miR-208b, such as miR-208. THRAP1, PURbeta, myostatin, and Sox 6 are decreased in a A quick, inexpensive and easy assay to run is an in vitro 15 cell by contacting the cell with a miR-499 agonist. In another assay. Such assays generally use isolated molecules, can be embodiment, the expression of Sp3, Myostatin, PURbeta, run quickly and in large numbers, thereby increasing the and THRAP!1are increased in a cell by contacting the cell amountof information obtainable in a short period of time. A with a miR-208b inhibitor. In still another embodiment, the variety ofvessels may be usedto run the assays, including test expression of Sp3, Myostatin, PURbeta, and THRAP1 are tubes, plates, dishes and other surfaces such as dipsticks or 20 decreased in a cell by contacting the cell with a miR-208b beads. agonist. A technique for high throughput screening of compounds In certain embodimentsof the invention, there is provided is described in WO 84/03564, which1s herein incorporated by a method of reducing B-MHCexpression in heart cells com- reference in its entirety. Large numbers of small antogomir prising administering an inhibitor of miR 499 and/or miR- compounds may be synthesized on a solid substrate, such as 25 208b expression oractivity to the heart cells. In other embodi- plastic pins or some other surface. Such molecules can be ments of the invention, there is provided a method of rapidly screening fortheir ability to hybridize to miR-499 or elevating B-MHC expression in heart cells comprising miR-208b. increasing endogenous miR 499 and/or miR-208b expression The present invention also contemplates the screening of or activity or administering exogenous miR-499 and/or miR- compounds for their ability to modulate miR-499 or miR- 30 208b to heart cells. In one embodimentofthe invention, there 208b activity and expression in cells. Various cell lines, is provided a method of increasing the expression of a fast including those derived from skeletal muscle cells, can be skeletal muscle contractile protein gene in heart cells com- utilized for such screening assays, including cells specifically prising administering to the heart cells an inhibitor of miR- engineered for this purpose. Primary cardiac cells also may be 499 and/or miR-208b expression or activity. In another used, as can the H9C2cellline. 35 embodimentofthe invention, there is provided a method of In vivo assays involve the use of various animal models of decreasing the expression offast skeletal muscle contractile a heart disease or musculoskeletal disease, including trans- protein gene in heart cells comprising increasing endogenous genic animals, that have been engineered to have specific miR 499 and/or miR-208b expression or activity or adminis- defects, or carry markers that can be used to measure the tering exogenous miR-499 and/or miR-208b to the heart ability of a candidate substance to reach and effect different 40 cells. Examples of fast skeletal muscle contractile protein cells within the organism. Due totheir size, ease of handling, genes that may be increased or decreased according to the and information on their physiology and genetic make-up, methods of the present invention include, but are not limited mice are a preferred embodiment, especially for transgenics. to, troponin 12; troponin T3, myosin light chain, or alpha However, other animals are suitable as well, includingrats, skeletal actin. rabbits, hamsters, guinea pigs, gerbils, woodchucks, cats, 45 In one embodiment, the present invention provides a dogs, sheep, goats, pigs, cows, horses and monkeys (includ- method for treating pathologic cardiac hypertrophy, heart ing chimps, gibbons and baboons). Assaysfor inhibitors may failure, or myocardial infarction in a subject in need thereof be conducted using an animal model derived from any of comprising: identifying a subject having cardiac hypertrophy, these species. heart failure, or myocardial infarction; and administering an Treatmentofanimals with test compoundswill involve the 50 miR-499 and/or miR-208b inhibitor to the subject. In certain administration of the compound, in an appropriate form, to embodimentsof the invention the miR-499 and/or miR-208b the animal. Administration will be by any route that could be inhibitor may be identified by a method comprising: (a) con- utilized for clinical purposes. Determining the effectiveness tacting a cell with a candidate substance; (b) assessing miR- of a compound in vivo may involve a variety of different 499 and/or miR-208b activity or expression; and (c) compar- criteria, including but notlimited to alteration ofhypertrophic 55 ing the activity or expression in step (b) with the activity or signaling pathways and physical symptoms of hypertrophy. expression in the absence ofthe candidate substance, wherein Also, measuring toxicity and dose responses can be per- a reduction in the activity or expression of miR-499 and/or formed in animals in a more meaningful fashion than in in miR-208b in the cell contacted with the candidate substance vitro or in cyto assays. compared to the activity or expression in the cell in the In one embodiment, the present invention provides a 60 absence of the candidate substance indicates that the candi- methodof regulating cardiac and/or skeletal muscle contrac- date substanceis an inhibitor of miR-499 and/or miR-208b. tility comprising administering a modulator of miR 499 and/ In another embodiment, the present invention provides a or miR-208b expression or activity to heart and/or skeletal methodfor treating a musculoskeletal disorder in a subject in muscle cells. In another embodiment, there is provided a need thereof comprising: identifying a subject having a mus- methodof regulating cardiac contractile protein gene expres- 65 culoskeletal disorder or at risk for developing a musculosk- sion comprising administering a modulator of miR 499 and/ eletal disorder; and administering an miR 499 and/or miR- or miR-208b expression or activity to heart cells. In another 208b agonist to the subject. In certain embodiments of the US 8,962,588 B2 41 42 invention, the miR 499 and/or miR-208b agonist may be DNA for microinjection are described in Palmiter et al. identified by a method comprising: (a) contacting a cell with (1982); and in Sambrooket al. (2001). a candidate substance; (b) assessing miR 499 and/or miR- In an exemplary microinjection procedure, female mice six 208b activity or expression; and (c) comparing the activity or weeksofage are inducedto superovulate with a 5 IU injection expression in step (b) with the activity or expression in the (0.1 cc, ip) of pregnant mare serum gonadotropin (PMSG; absence ofthe candidate substance, wherein an increase in the Sigma) followed 48 hourslater by a 5 IU injection (0.1 cc, ip) activity or expression ofmiR 499 and/or miR-208b inthe cell ofhuman chorionic gonadotropin (hCG;Sigma). Females are contacted with the candidate substance comparedto the activ- placed with males immediately after hCG injection. Twenty- ity or expression in the cell in the absence of the candidate one hours after hCG injection, the mated females are sacri- substance indicates that the candidate substance is an agonist ficed by C02 asphyxiation or cervical dislocation and of miR-499 and/or miR-208b. embryosare recovered from excised oviducts and placed in Transgenic Animals Dulbecco’s phosphate buffered saline with 0.5% bovine A particular embodimentof the present invention provides serum albumin (BSA; Sigma). Surrounding cumuluscells are transgenic animals that lack one or both functional miR-499 removed with hyaluronidase (1 mg/ml). Pronuclear embryos and/or miR-208b alleles. Also, transgenic animals that are then washed and placed in Earle’s balancedsalt solution express miR-499 and/or miR-208b under the control of an containing 0.5% BSA (EBSS)in a 37.5° C. incubator with a inducible, tissue selective or a constitutive promoter, recom- humidified atmosphere at 5% CO,, 95% air until the time of binant cell lines derived from such animals, and transgenic injection. Embryos can be implanted at the two-cell stage. embryos may be useful in determining the exact role that Randomly cycling adult female miceare paired with vasec- miR-499 or miR-208b plays in the development and differ- tomized males. C57BL/6 or Swiss mice or other comparable entiation ofcardiomyocytes and in the developmentofpatho- strains can be used for this purpose. Recipient females are logic cardiac hypertrophy and heart failure. Furthermore, mated at the same time as donor females. At the time of these transgenic animals may provide an insight into heart embryotransfer, the recipient females are anesthetized with development. The use ofan inducible or repressable miR-499 an intraperitoneal injection of 0.015 ml of 2.5% avertin per and/or miR-208b encoding nucleic acid provides a model for gram of body weight. The oviducts are exposed bya single over- or unregulated expression. Also, transgenic animals that midline dorsal incision. An incision is then made through the are “knocked out” for miR-499 and/or miR-208b, in one or body wall directly over the oviduct. The ovarian bursa is then both alleles, are contemplated. torn with watchmakers forceps. Embryosto be transferred are In a general embodiment, a transgenic animal is produced placed in DPBS (Dulbecco’s phosphate buffered saline) and by the integration of a given transgene into the genome in a in the tip of a transfer pipet (about 10 to 12 embryos). The mannerthat permits the expression of the transgene. Methods pipet tip is inserted into the infundibulum and the embryos for producing transgenic animals are generally described by transferred. After the transfer, the incision is closed by two Wagner and Hoppe (U.S. Pat. No. 4,873,191; incorporated herein by reference), and Brinsteret al. (1985; incorporated sutures. herein by reference). Definitions Typically, a gene flanked by genomic sequencesis trans- As used herein, the term “heart failure” is broadly used to ferred by microinjection into a fertilized egg. The microin- mean any condition that reduces the ability of the heart to jected eggs are implantedinto a host female, and the progeny pumpblood. Asa result, congestion and edema develop in the are screened for the expression of the transgene. Transgenic 40 tissues. Most frequently, heart failure is caused by decreased animals may be produced from the fertilized eggs from a contractility ofthe myocardium,resulting from reduced coro- number of animals including, but not limited to reptiles, nary blood flow; however, many other factors may result in amphibians, birds, mammals, andfish. heart failure, including damage to the heart valves, vitamin DNA clones for microinjection can be prepared by any deficiency, and primary cardiac muscle disease. Though the meansknowninthe art. For example, DNA clones for micro- 45 precise physiological mechanisms of heart failure are not injection can be cleaved with enzymesappropriate for remov- entirely understood, heart failure is generally believed to ing the bacterial plasmid sequences, and the DNA fragments involve disorders in several cardiac autonomic properties, electrophoresed on 1% agarose gels in TBE buffer, using including sympathetic, parasympathetic, and baroreceptor standard techniques. The DNA bandsare visualized by stain- responses. The phrase “manifestations of heart failure” is ing with ethidium bromide, and the band containing the used broadly to encompassall ofthe sequelae associated with expression sequences is excised. The excised band is then heart failure, such as shortness of breath, pitting edema, an placed in dialysis bags containing 0.3 M sodium acetate, pH enlarged tender liver, engorged neck veins, pulmonary rales 7.0. DNA is electroeluted into the dialysis bags, extracted and the like including laboratory findings associated with with a 1:1 phenol:chloroform solution and precipitated by heart failure. two volumesof ethanol. The DNAis redissolved in 1 ml of 55 The term “treatment” or grammatical equivalents encom- low salt buffer (0.2 M NaCl, 20 mM Tris, pH 7.4, and 1 mM passes the improvementand/or reversal of the symptoms of EDTA)andpurified on an Elutip-D™column. The column is heart failure (i.e., the ability of the heart to pump blood). first primed with 3 ml of high salt buffer (1 M NaCl, 20 mM “Improvementin the physiologic function” of the heart may Tris, pH 7.4, and 1 mM EDTA) followed by washing with 5 be assessed using any of the measurements described herein mlof low salt buffer. The DNA solutions are passed through (e.g., measurementof ejectionfraction, fractional shortening, the column three times to bind DNAto the column matrix. left ventricular internal dimension, heart rate, etc.), as well as After one wash with 3 mloflow salt buffer, the DNA is eluted any effect upon the animal’s survival. In use of animal mod- with 0.4 ml high salt buffer and precipitated by two volumes els, the response of treated transgenic animals and untreated of ethanol. DNA concentrations are measured by absorption transgenic animals is compared using any of the assays at 260 nm in a UV spectrophotometer. For microinjection, described herein (in addition, treated and untreated non- DNA concentrations are adjusted to 3 ug/ml in 5 mM Tris, pH transgenic animals may be included as controls). A com- 7.4 and 0.1 mM EDTA. Other methods for purification of pound which causes an improvement in any parameter asso- US 8,962,588 B2 43 44 ciated with heart failure used in the screening methodsofthe april and ramipril. The use of derivatives of known ACE instant invention may thereby be identified as a therapeutic inhibitors is encompassed by the methods of the present compound. invention. Indeed any compound, which functionally behaves Theterm “dilated cardiomyopathy”refers to a type ofheart as an ACE inhibitor, is encompassed by the methods of the failure characterized by the presence of a symmetrically present invention. dilated left ventricle with poor systolic contractile function As used herein, the term “genotypes”refers to the actual and, in addition, frequently involves the right ventricle. genetic make-up of an organism, while “phenotype”refers to The term “compound”refers to any chemicalentity, phar- physical traits displayed by an individual. In addition, the maceutical, drug, and the like that can be used to treat or “phenotype” is the result of selective expression of the prevent a disease, illness, sickness, or disorder of bodily 10 genome(1.e., it is an expression of the cell history and its function. Compounds comprise both known and potential response to the extracellular environment). Indeed, the therapeutic compounds. A compound can be determined to be human genomecontains an estimated 30,000-35,000 genes. therapeutic by screening using the screening methodsof the In eachcell type, only a small (1.e., 10-15%)fraction ofthese present invention. A “known therapeutic compound”refers to genes are expressed. a therapeutic compoundthat has been shown(e.g., through 15 The use of the word “a”or “an” when used in conjunction animal trials or prior experience with administration to with the term “comprising” in the claims and/or the specifi- humans)to be effective in such treatment. In other words, a cation may mean “one,” but it is also consistent with the known therapeutic compoundis not limited to a compound meaning of “one or more,” “at least one,” and “one or more efficacious in the treatmentofheart failure. than one.”It is contemplated that any embodimentdiscussed Asused herein, the term “cardiac hypertrophy”refers to 20 herein can be implemented with respect to any method or the process in which adult cardiac myocytes respondto stress composition of the invention, and vice versa. Furthermore, through hypertrophic growth. Such growth is characterized compositions and kits of the invention can be used to achieve by cell size increases without cell division, assembling of methods of the invention. Throughout this application, the additional sarcomeres within the cell to maximize force gen- term “about” is used to indicate that a value includes the eration, and an activation of a fetal cardiac gene program. 25 standard deviation of error for the device or method being Cardiac hypertrophyis often associated with increased risk of employedto determinethe value. The use of the term “or” in morbidity and mortality, and thus studies aimed at under- the claimsis used to mean “and/or” unless explicitly indicated standing the molecular mechanismsof cardiac hypertrophy to refer to alternatives only or the alternatives are mutually could have a significant impact on humanhealth. exclusive, although the disclosure supports a definition that As used herein, the term “modulate”refers to a change or 30 refers to only alternatives and “and/or.” an alteration in a biological activity. Modulation may be an Asused in this specification and claim(s), the words “com- increase or a decrease in protein activity, a change in kinase prising” (and any form ofcomprising, suchas “comprise” and activity, a change in binding characteristics, or any other “comprises”), “having” (and any form of having, such as changein the biological, functional, or immunological prop- “have” and “has”’), “including” (and any form of including, erties associated with the activity of a protein or other struc- 35 such as “includes” and “include”) or “containing” (and any ture of interest. The term “modulator” refers to any molecule form of containing, such as “contains” and “contain’’) are or compound which is capable of changing oraltering bio- inclusive or open-ended and do not exclude additional, unre- logical activity as described above. cited elements or methodsteps. The term “B-adrenergic receptor antagonist” refers to a Although section headers have been inserted into this chemical compound or entity that is capable of blocking, 40 application to facilitate review, such headers should not be either partially or completely, the beta (B) type of adrenore- construed as a division of embodiments. ceptors (1.e., receptors of the adrenergic system that respond The following examples are included to further illustrate to catecholamines, especially norepinephrine). Some (-adr- various aspects of the invention. It should be appreciated by energic receptor antagonists exhibit a degree of specificity for those of skill in the art that the techniques disclosed in the one receptor subtype (generally 6,); such antagonists are 45 examples which follow represent techniques and/or compo- termed “B,-specific adrenergic receptor antagonists” and sitions discovered by the inventor to function well in the “B,-specific adrenergic receptor antagonists.” The term practice of the invention, and thus can be considered to con- B-adrenergic receptor antagonist” refers to chemical com- stitute preferred modes for its practice. However, those of pounds that are selective and non-selective antagonists. skill in the art should, in light of the present disclosure, Examples of f-adrenergic receptor antagonists include, but 50 appreciate that many changes can be made in the specific are not limited to, acebutolol, atenolol, butoxamine,carteolol, embodiments which are disclosed andstill obtain a like or esmolol, labetolol, metoprolol, nadolol, penbutolol, pro- similar result without departing from the spirit and scope of panolol, and timolol. The use of derivatives of known (-adr- the invention. energic receptor antagonists is encompassed by the methods of the present invention. Indeed any compound, which func- 55 EXAMPLES tionally behaves as a B-adrenergic receptor antagonist is encompassed by the methods of the present invention. Encoded within an intron of the a-MHCgene is miR-208 The terms “angiotensin-converting enzyme inhibitor” or (FIG. 1A). Like a-MHC, miR-208 is expressed specifically in “ACEinhibitor”refer to a chemical compoundorentity that the heart with trace expression in the lung (FIG. 1B). miR-208 is capable of inhibiting, either partially or completely, the 60 is processed out of the a-MHC pre-mRNArather than being enzyme involved in the conversion of the relatively inactive transcribed as a separate transcript. Intriguingly, however, angiotensin I to the active angiotensin IJ in the renin-angio- miR-208 displays a remarkably long half-life of at least 14 tensin system. In addition, the ACE inhibitors concomitantly days, and can thereby exert functions even when a-MHC inhibit the degradation of bradykinin, which likely signifi- mRNA expression has been down-regulated. Although cantly enhances the antihypertensive effect ofthe ACE inhibi- 65 genetic deletion ofmiR-208 in micefailed to induce an overt tors. Examples ofACE inhibitors include, but are not limited phenotype, microarray analysis on hearts from wild-type and to, benazepril, captopril, enalopril, fosinopril, lisinopril, qui- miR-208-~ animals at 2 months of age revealed removal of US 8,962,588 B2 45 46 miR-208to result in pronounced expression ofnumerousfast ing or failing hearts were obtained from Gilead Colorado skeletal muscle contractile protein genes, which are normally (Westminster, Colo.). Total RNA wasisolated from mouse, not expressed in the heart. Thus, these results suggest that rat and humancardiac tissue samples using Trizol reagent under normal conditions miR-208 is co-expressed with the (Gibco/BRL). Northern blots to detect microRNAs were per- sole cardiac-specific MHC gene to maintain cardiomyocyte formed as described previously (1). A U6 probe served as a identity by repressing the expression of skeletal muscle genes loading control (U6 forward: 5-GTGCTCGCTTCG- in the heart. GCAGC-3, (SEQ ID NO:28); U6 reverse: 5-AAAATATG- The most remarkable function ofmiR-208 wasrevealed by GAACGCTTCACGAATTTGCG-3 (SEQ ID NO: 29)). To the aberrant response of miR-208 null mice to cardiac stress detect a-MHCexpression, a Northern blot containing 10 ug (van Rooij, Science 2007). In response to pressure overload 10 of RNA from cardiac tissue ofboth adult wild-type and miR- by thoracic aortic constriction or signaling by calcineurin, a 208 mutant animals was probed with a cDNA fragment of calcium/calmodulin-dependent phosphatase that drives a-MHCcovering a part of the 5'UTRregion andfirst exon. pathological remodeling of the heart, miR-208 null mice PTUtreatment. Thyroid hormonedeficiency was induced showedvirtually no hypertrophy of cardiomyocytes or fibro- by feeding animals for the indicated durations with iodine- sis and were unable to up-regulate 8-MHCexpression (FIGS. 15 free chow supplemented with 0.15% PTU purchased from 6-8). In contrast, other stress responsive genes, such as those Harlan Teklad Co. (TD 97061) (Madison, Wis.). encoding ANF and BNP, werestrongly induced in miR-208 Microarray and realtime PCR analysis. Total RNA from mutant animals, demonstrating that miR-208 is dedicated cardiac tissue wasisolated using Trizol (Invitrogen). Microar- specifically to the control of B-MHC expression, which can ray analysis was performed using Mouse Genome 430 2.0 be uncoupled from other facets ofthe cardiac stress response. 20 array (Affymetrix). RT-PCR with random hexamer primers B-MHCexpression is repressed by thyroid hormonesig- (Invitrogen) was performed on RNA samples, after which the naling and is up-regulated in the hypothyroid state (Leung et expression of a subset of genes was analyzed by quantitative al., 2006). miR-208-" animals were also resistant to up- real time PCR using Taqman probes purchased from ABI. regulation of }-MHCexpression following treatment with the Generation ofmiR-208 mutant mice. To generate the miR- T3 inhibitor propylthiouracil (PTU), which induces hypothy- 25 208 targeting vector, a 0.4 kb fragment (5' arm) extending roidism.Intriguingly, however, expression of B-MHCbefore upstream of the miR-208 coding region was digested with birth was normal in miR-208 mutant mice, indicating that SacII and NotI andligated into the pGKneoF2L2dta targeting miR-208is dedicated specifically to the post-natal regulation plasmid upstream of the loxP sites and the Frt-flanked neo- of B-MHCexpression, which coincides with the acquisition mycin cassette. A 3.3 kb fragment (3' arm) was digested with ofthyroid hormone responsiveness ofthe B-MHCgene(FIG. 30 SalI and HindIII and ligated into the vector between the 5). neomycin resistance and Dta negative selection cassettes. A clue to the mechanism of action ofmiR-208 comes from Targeted ES-cells carrying the disruptedallele were identified the resemblance ofmiR-208~~ hearts to hyperthyroid hearts, by Southern blot analysis with 5' and 3' probes. Three miR- both of which display a block to B-MHC expression, up- 208 targeted ES clones wereidentified and used for blastocyst regulation of stress-response genes and protection against 35 injection. The resulting chimeric mice were bred to CS7BL/6 pathological hypertrophy andfibrosis (FIGS. 6-10). The up- to obtain germline transmission of the mutantallele. regulation of fast skeletal muscle genes in miR-208-” hearts Western blotting. Myosin was extracted from cardiactis- (FIGS. 22 and 27) also mimics the induction of fast skeletal sue as described (Morkin, 2000). MHC isoforms were sepa- muscle fibers in the hyperthyroid state (Wei et al., 2005). rated by SDS PAGEandWestern blotting was performed with These findings suggest that miR-208acts, at least in part, 40 mouse monoclonal a-MHC (BA-G5) (ATCC, Rockville, by repressing expression of a common componentofstress- Md.) and mouse monoclonal antimyosin (slow, skeletal response and thyroid hormone signaling pathways in the M8421) (Sigma, Mo.), which is highly specific for B-MHC. heart. Amongthe strongest predicted targets of miR-208 is To detect all striated myosin a pan specific antibody (mouse the thyroid hormone receptor (TR) co-regulator THRAP1, monoclonal 3-48; Accurate Chemical & Scientific Corpora- which can exert positive and negative effects on transcription 45 tion, NY) was used. THRAP1 was detected by immunopre- (Pantoset al., 2006; Yao and Eghbali, 1992; FIG. 12). The TR cipitation from 400 ug of cardiac protein lysate. After pre- acts through a negative thyroid hormoneresponse element clearing the samples for 1 hour at 4° C., the supernatant was (TRE)to repress B-MHCexpression in the adult heart (Zhao incubated overnight at 4° C. with 1 wl rabbit polyclonal anti- etal., 2005). Thus, the increase in THRAP1 expression in the THRAP!I (a kind gift of R. Roeder, Rockefeller University) absence of miR-208 would be predicted to enhance the 50 and 15 ul of protein A beads. The beads were washedthree repressive activity of the TR toward B}-MHCexpression, con- times with lysis buffer and boiled in SDS sample buffer. sistent with the blockade to B-MHCexpression in miR-208~- Immunoprecipitated THRAP!1 protein was resolved by SDS- hearts. However, although THRAP1 appearsto be a bonefide PAGEand analyzed using rabbit polyclonal anti-THRAP1 at target for miR-208 (FIGS. 25 and 26), these data do not a dilution of 1:3000 andanti-rabbit IgG conjugated to horse- exclude the potential involvementof additional targets in the 55 radish peroxidase at a dilution of 1:5000 with detection by regulation of }-MHCexpression. Luminol Reagent (Santa Cruz). Since even a subtle shift towards B-MHCreduces mechani- Histological analysis and RNA In situ hybridization. Tis- cal performance andefficiency of the adult heart, it would be sues used for histology were incubated in Krebs-Henselheit of therapeutic value to exploit miR-208 regulation to prevent solution, fixed in 4% paraformaldehyde, sectioned, and pro- an increase in B-MHCexpression during cardiac disease. The 60 cessed for hematoxylin and eosin (H&E) and Masson’s cardiac specificity and dedication of miR-208 to the cardiac Trichromestaining or in situ hybridization by standard tech- stress response, but not to normalcardiac development, make niques (Krenz and Robbins, 2004). *°S-labeled RNA probes miR-208 (and its down-stream effectors) an attractive thera- were generated using Maxiscript kit (Amersham). Signals peutic target for manipulating B-MHClevels (FIG. 13). were pseudocolored in red using Adobe Photoshop. Materials & Methods 65 Transthoracic echocardiography. Cardiac function and Northern blot analysis. Cardiac tissue samples of left ven- heart dimensions were evaluated by two-dimensional tricles of anonymous humansdiagnosed as having non-fail- echocardiography in conscious mice using a Vingmed Sys- US 8,962,588 B2 47 48 tem (GE Vingmed Ultrasound, Horten, Norway) and a 11.5- real-time PCR analysis for miR-499 (FIG. 16B). In situ MHzlinear array transducer. M-modetracings were used to hybridization using a probe directed against the 3' end of the measure anterior and posterior wall thicknesses at end dias- Myh7b gene, indicated that this myosin was expressed in tole and end systole. Left ventricular (LV) internal diameter heart and somites as early as E10.5 (FIG. 16C). Genetic (LVID) was measuredasthe largest anteroposterior diameter deletion of miR-208 specifically inhibits cardiac expression in either diastole (LVIDd) or systole (LVIDs). The data were of miR-499 while leaving skeletal muscle expression intact analyzed by a single observer blinded to mouse genotype. LV (FIG. 16D). These data indicate that miR-208 is required to fractional shortening (FS) was calculated according to the drive an additional myosin, Myh7b, which gives rise to following formula: FS (%)=[(LVIDd-LVIDs)/LVIDd]x100. related miR-499. In addition, miR-499 is down-regulated Generation oftransgenic mice. A mouse genomic fragment 10 during cardiac hypertrophy (FIG. 17). flanking the miRNA of interest was subclonedinto a cardiac- specific expression plasmid containing the a-MHC and Example 2 human GH poly(A)+ signal (Kiriazis and Kranias, 2000). Genomic DNA was isolated from mouse tail biopsies and MEF2 Regulates miR-499 Expression in Cardiac and analyzed by PCR using primers specific for the human GH 15 Skeletal Muscle poly(A)+ signal. Generation of LacZ and MCKtransgenic mice. To search Within the 5' flanking region of the Myh7 gene,the inven- for cis-regulatory elements responsible for cardiac and skel- tors identified a potential MEF2 consensus sequencethat was etal muscle expression of myh7b/miR-499, 0.8 Kb genomic conservedacross species. This sequence bound MEF?avidly fragments of the mouse myh7b gene were fused to the hsp68 20 in gel mobility shift assays (FIG. 37A), and mutation ofthis basal promoter upstream ofa lacZ reporter gene and tested for sequence abolished both binding (FIG. 37A)and transcrip- expression in FO transgenic mouse embryos. For the genera- tionalactivation of a luciferase reporter by MEF2 (FIG. 37B). tion of transgenic mice, constructs were digested with Sall to The promoter region of the Myh7 gene wasfused to a lacZ remove vector sequences. DNA fragments were purified reporter and transgenic mice were generated. As shown in using a QiaQuick spin column (Qiagen, MD), injected into 25 FIG. 37C,this genomic region was sufficient to direct lacZ, fertilized eggs from B6C3F 1 female mice, and implanted into expression specifically in the heart at E12.5. In the postnatal pseudopregnant ICR mice as previously described (Lien et heart, lacZ staining was observed only in the ventricles, con- al., 1999). Embryos were collected and stained for B-galac- sistent with in situ hybridization (data not shown). Mutation tosidase activity. Transgenic mice that express constitutively of the MEF2 site completely eliminated expression of the active forms of miR-499 underthe control of a muscle-spe- 30 lacZ transgene (FIG. 37C). Northern blot analysis on in vivo cific enhancer from the muscle creatine kinase (MCK) gene mouse models also showed the expression of miR-499 to be are described elsewhere (Nagaet al. (2000) J. Biol. Chem., sensitive to MEF2. Cardiac-specific over-expression of Vol. 275: 4545-4548). Genomic DNA wasisolated from MEF2D resulted in an increase in miR-499 expression, mousetail biopsies and analyzed by PCRusing primers spe- whereas cardiac deletion of both MEF2C and D caused a cific for the human GH poly(A)+ signal. 35 decrease in miR-499 expression (FIG. 37D). Direct binding Plasmids andtransfection assays. A 305 bp genomicfrag- ofMEF2to the promoter ofMyh7bis required for the expres- ment encompassing the miR-208 coding region was ampli- sion of Myh7b and miR-499 in vivo. fied by PCR and ligated into pCMV6. A 1 kb fragment The MEF2 site is juxtaposed to a conserved E-box encompassing the entire murine THRAP1-UTR was PCR- sequence (CANNTG), which serves as a binding site for amplified and ligated into an HA-tagged pCMV6expression 40 members of the MyoD family of bHLH proteins that drive construct and the firefly luciferase (flue) reporter construct skeletal muscle gene expression with MEF2. Indeed, MyoD (pMIR-REPORT™, Ambion). A mutation of the UCGU- together with the ubiquitous bHLH protein E12 bound the CUUA miR-208 seed binding sequence was constructed E-box from the promoter. Mutation of this sequence pre- through PCR-based mutagenesis. vented expression of the lacZ transgene in skeletal muscle, 45 but did not affect expression in the heart. Example 1 Example 3 miR-208 is Required for Expression of miR-499 Identification of Targets for miR-499 To further explore the mechanism of action of miR-208 in 50 the heart, the inventors defined the microRNA expression Given the sequence homology between miR-208 and miR- patterns in hearts from wild type and miR-208 null mice by 499 and the inventors’ previous data demonstrating that microarray analysis. Among several microRNAsthat were genetic disruption of miR-208 lead to a strong induction of up- and down-regulated in mutant hearts, the inventors dis- specifically fast skeletal muscle genes and repression of covered that miR-499 was highly abundantin normalhearts, 55 B-MHCin the heart, it is likely that miR-499 has a compa- but was not expressed above background levels in miR-208 rable function in skeletal muscle and could act as a dominant mutants. These findings were confirmed by Northern blot regulator of fiber type. Expression of miR-499 andits host (FIG. 14). Analysis of the genomic location of the miR-499 transcript are regulated by the myogenic transcription factor gene showedit to be contained within the 20intron of the MEF2,a positive regulator of slow fiber gene expression and Myh7b gene, a homolog of the a-MHC gene (FIG. 15). 60 muscle endurance. The inventors suggest that the fiber type miR-208 appears to regulate Myh7b and thereby miR-499 regulation of miR-499 is likely to be dependent on target expression at the level of transcription since RT-PCR for genes of miR-499 involvedin fiber type regulation. myh7b indicates that the mRNA of the host gene is dose- MiR-208 is highly homologous to miR-499 and, the dependently abrogated in the absence of miR-208 (FIG.14). remarkable fact that both microRNAsare encodedby introns The Myh7b geneis conservedin vertebrates and is expressed 65 of Mhe genes, suggests that they share common regulatory solely in the heart and slow skeletal muscle(e.g. soleus) (FIG. mechanisms. Since miRNAs negatively influence gene 16A). This expression pattern for miR-499 was confirmed by expression in a sequence specific manner, the high degree of US 8,962,588 B2 49 50 homologypredisposes miR-208 and miR-499 to exert com- mature miR-208b sequencediffers by 3 bases as compared to parable functions due to overlap in target genes. The inventors miR-208, but has an identical seed region. The homology have identified transcriptional regulators of MHC expression between the two miRNAsandtheir host genes may have been that appear to serve as targets of miR-499. They have also the result of a genomic duplication that gave rise to a-MHC shown that miR-499 expression is controlled by miR-208 in (myh6) and B-MHC (FIG. 29). Northern blot analysis was the heart, such that knockdown of miR-208 eliminates miR- conducted to examine the expression pattern ofmiR-208b. At 499 expression. baseline, miR-208b shows a comparable expression pattern Since the inventors’ previous data demonstrated that as its host gene (8-MHC), namely expression is predomi- genetic disruption of miR-208 leads to strong induction of nantly observed in the soleus, a slow skeletal muscle, while specifically fast skeletal muscle genesin the heart, it is likely little expression is observed in the heart andthe fast skeletal that miR-499 has a comparable function in skeletal muscle muscle types (FIG. 30A). and could act as a dominant regulator of fiber type. In line Post-natally, T3 signaling induces a-MHCtranscription with this hypothesis, promoter analysis ofthis transcript indi- cates that the expression ofmiR-499 andits host transcript are via a positive T3 response element (TRE), whereas a negative regulated by the myogenic transcription factor MEF2, a cen- TREin the promoterof the B-MHC gene mediates transcrip- tral regulator of skeletal muscle fiber type and slow fiber gene tional repression (Ojamaaet al. (2000) Endocrinology, Vol. expression. The inventors have shown that MEF2 activity 141: 2139-2144). To test the expression of miR-208, miR- promotes muscle endurance and prevents muscle fatigue fol- 208b, and miR-499 (i.e. myomiRs) in response to myosin lowing prolonged exercise, and suggest that these actions of regulation, rats were fed PTU-containing chow for 2 weeks to MEF2are dependent, at least in part, on the direct activation block T3 signaling, and subsequently supplemented PTU- of miR-499 expression (FIG. 18) 20 treated rats with T3 to reverse the PTU effect. PTU, as These data indicate that the MEF2-regulated expression of expected, induced a decline in a-MHCand an increase in the Myh7b geneadditionally induces the expression ofa slow B-MHCin response to PTU, which could be reversed by T3 muscle and cardiac specific miRNA, miR-499, which down- (FIG. 30B). Although to a lesser extent, the expression of regulates the expression of the fast skeletal muscle gene pro- myh7b followed the expression pattern of B-MHC; induced gram. Further, these data provide evidence for miR-499 as a expression in response to PTU,and diminished expression in central regulator of skeletal muscle fiber type (FIG. 19). response to PTU together with T3 (FIG. 30B). Northern blot mRNA-499 is predicted to target THRAP1, PURbeta and analysis indicates that miR-208b and miR-499 precisely fol- GDF8 (aka myostatin), genes that are known to be crucial lowedthe expression pattern of B-MHC and myh7b,respec- regulators of myosin expression and muscle fiber type, and tively (FIG. 31). This increase appeared to be dose-dependent are likely to be the effectors of miR-499 functionality in since longer exposure to PTU increased miR-208b expres- myofiber identity (FIG. 20). THRAP1 waspreviously iden- sion over time (FIG.32). tified to be targeted by miR-208 and regulates thyroid recep- tor signaling (van Roojj et al., 2007). Adult skeletal muscle As a- and B-MHCare counterbalanced in the heart, the retains the capability of transcriptional reprogramming. This expression ofmiR-208/miR-208bis likely maintainedatrela- attribute is readily observable in the non-weight-bearing tively constant levels. While B-MHC in mice is the dominant (NWB)soleus muscle, which undergoes a slow-to-fast fiber MHCgene expressed during embryogenesis andshortly after type transition concurrent with decreased beta-myosin heavy birth, a-MHCtakes over during adulthood. Since the inven- chain (BMyHC) gene expression. This decrease in MyHC tors’ previous data indicated that miR-208 in the adult heart gene expression under NWBconditions is mediated by inter- was required for miR-499 expression, the inventors tested actions between Sp3, Pura, and Pur proteins. These data whether miR-208b can substitute for miR-208. Northern demonstrate that Pur proteins collaborate with Sp3 to regulate 40 analysis for the myomiRsat pl, p6 and in adult heart indi- a transcriptional program that enables muscle cells to cated that in the absence of miR-208, miR-499 remains remodel their phenotype (Ji et al., 2007). Since miR-499 expressed while miR-208b is present (FIG. 30C). To test directly targets PUR, the fiber type regulation might be whether miR-208b also responds to myosin switching in a mediated by targeting ofPURB. An additional target involved comparable way as B-MHC, both wild-type and miR-208 in muscle regulation is myostatin. Myostatin is a transform- 45 mutant animals were treated with PTU.In response to PTU, ing growth factor-6 family member that acts as a negative a-MHCexpression was severely repressed, which resulted in regulator of skeletal muscle growth. In mice, genetic disrup- aloss ofpre-miRNA-208 (indicated by asterisks) in wild-type tion of the myostatin gene leads to a marked increase in body animals. As expected, miR-499 was completely absentin the weight and muscle mass. Similarly, pharmacological inter- miR-208 mutant animals and only slightly induced in ference with myostatin in vivo in mdx knockout miceresults response to PTU in wild-type animals. However, miR-208b, in a functional improvement of the dystrophic phenotype like B-MHC, wasstrongly induced by PTU, while in the (Tanget al., 2007). Consequently, myostatin is an important absence of miR-208, this induction was only minor (FIG. therapeutic target for treatment of diseases associated with 30D). Together, these results suggest that the myomiRs muscle wasting. Manipulating the functionality of miR-499 located within the myosin genes regulate the expression lev- to regulate muscle specific fiber types could have far reaching els of the myosin genes and therefore the miRNAsthey har- implications for clinical pathologies, like muscular dystro- bor. phy. In addition, these results suggest that strategies to Previously the inventors showedthat cardiac specific dele- enhance slow fiber gene expression by elevating miR-499 tion ofmiR-208 inhibited the induction of B-MHCexpression expression will augmentinsulin sensitivity, endurance and by stress stimuli (FIG. 8). Although 6-MHC expression is other salutary aspects of the slow fiber gene program. 60 very low at baseline, Northern blotting for miR-208b showed a dose-dependent decrease in miR-208b expression corre- Example 4 sponding to the removalof one or both miR-208alleles (FIG. 33A). However, transgenic overexpression of miR-208, MiR-208 is Counterbalanced by miR-208b which has been shownto induce B-MHCexpression (FIG. 9), 65 induced miR-208b expression (FIG. 33B). These data imply Located within the B-MHC (a.k.a. myh7) gene is miR- that although miR-208 appears to be the upstream regulator of 208b, which is co-expressed with its host-gene (FIG. 28). The the effect on cardiac B-MHCexpression, pathological cardiac US 8,962,588 B2 51 52 remodeling mayalso be due to the regulation ofmiR-499 and both heart and skeletal muscle, thereby generating a knock- miR-208b (FIGS. 33C and 34). down for both miRNAs(FIG.36).

Example 5 Example 6

MiR-208 and miR-499 Repress the Fast Skeletal Control of Myh7b/miR-499 by miR-208 Muscle Phenotype In the heart, miR-208is the upstream regulator ofa system The up-regulation of fast skeletal muscle genes in hearts of responsible for maintaining cardiomyocyte identity by miR-208 null mice, combined with the slow fiber-specific repressing fast skeletal gene expression and, in addition, con- expression of miR-499 suggested that these miRNAs may tributes to pathological remodeling in response to stress. function to repress the expression of fast skeletal muscle miR-208 doesso, at least in part, by regulating the expression genes. To address this issue, transgenic mice were generated of an additional miRNA, miR-499, which is located within that expressed miR-499 in fast skeletal muscle under control the myosin gene myh7b. Although miR-208is absent in skel- of the MCK promoter and enhancer. Multiple stable trans- etal muscle, a closely related miR, miR-208b, is expressed in genic lines were obtained that expressed miR-499 in fast slow skeletal muscle from the S-MHCtranscript. fibers (FIG. 38A). Compared to cardiac expression, these transgenic animals efficiently overexpressed miR-499 in Based on the restricted expression of miR-499 to slow soleus andfast skeletal muscle types (FIG. 38B). Analysis of skeletal muscle fibers, miR-208b may induce miR-499 to fiber type-specific gene expression showed that fast fibers repress the fast fiber gene program in slow skeletal muscles. were transformed toward a slow myofiber phenotype by the However, our data indicate that miR-499 is required for forced expression of miR-499, Gene expression analysis in B-MHC expression, which would generate a feed-forward all five muscle types in both wild-type and miR-499 trans- loop in which B-MHC,through activation of miR-208b and genic animals indicated that miR-499 is sufficient to drive miR-499, stimulates its own expression. B-MHCexpression in soleus, TA and EDL, while miR-499 It is remarkable that a 50% reduction in miR-208 expres- repressesthefast skeletal troponin I and T in heart, soleus and sion in hearts of miR-208+/- miceresults in a corresponding EDL (FIG. 38C). Fast muscle fibers of these transgenic ani- decrease in Myh7b/miR-499 expression and the absence of mals werereadily identifiable by their deep red color, indica- miR-208 completely eliminates expression of Myh7b/miR- tive of high levels of myoglobin expression and vasculariza- 499. The sensitivity of Myh7b/miR-499to the level of miR- tion. Similarly, metachromatic ATPase staining of 208 expression suggests that the target(s) of miR-208 are histological sections showed a dramatic increase in slow precisely regulated, which is exceptional since miRNAsusu- myofiber gene expression in fast fibers (EDL) of the trans- ally are thought of as fine-tuners of gene expression rather genic mice (FIG. 38D). than on-off switches. To determine whetherthe loss of miR-499 in the miR-208 The inventors previously determined THRAP1, a thyroid knockout animals was in series or in parallel with the regula- hormonereceptor co-regulator, to be a target ofmiR-208. Due tion of B-MHCand the fast skeletal genes, miR-499 was to the significant overlap in seed sequence between miR-208 transgenically overexpressed in the miR-208 null back- and miR-499, these miRNAs may have overlappingtargets. ground. Northern blot analysis and realtime PCR for B-MHC Thus, miR-499 may regulate THRAP1 and thereby control indicates that PTU potently induces }-MHC and miR-208b in B-MHC and fast skeletal gene expression. In addition to wild-type (WT) animals but not in miR-208 mutant animals 40 THRAP!1, Sox6, a memberofthe Sox family of transcription (KO). However, re-introduction of miR-499 by transgenic factors, might also contribute to the phenotype. Sox6, which overexpression abolishes this repressive effect on B-MHC in is highly expressed in skeletal muscle and known to nega- the absence ofmiR-208 (FIG. 38E). Also, the induced expres- tively regulate 6-MHC expression in cardiac and skeletal sion of fast skeletal troponins in the absence of miR-208 is muscle, contains multiple conserved miR-499 bindingsites repressed in the presence of the miR-499 transgene (FIG. 45 in its 3' UTR andrepresentsa likely mediatorofthe effects of 38F). These data indicate that miR-499 is sufficient to drive a miR-499 on muscle gene expression. slow skeletal fiber phenotype andis responsibleforthe effects on B-MHCandfast skeletal genes in the miR-208 mutant Example 7 animals. Since miR-208b is expressed in slow skeletal muscle,it is Regulation of Cardiac Remodeling by miR-208 and very likely that it regulates fiber type identity in skeletal miR-499 muscles either directly or through regulation of miR-499. Previous data showed that cardiac removal of miR-208 (a The most remarkable function ofmiR-208 wasrevealed by cardiac family member of miR-208b) resulted in a cardiac the aberrant response of miR-208 null mice to cardiac stress inhibition of miR-499 and an upregulation of fast skeletal 55 (von Rooij et al. (2007) Science, Vol. 316: 575-579). In muscle genes (FIGS. 22 and 27). Removal ofmiR-208b from response to pressure overload by thoracic aortic constriction skeletal muscle will likely inhibit miR-499 expression and or signaling by calcineurin, miR-208 null mice showed vir- produce an expression of fast skeletal muscle genes, thereby tually no hypertrophy or fibrosis and were unable to up- inducing a fiber type shift from slow towards fast. To inves- regulate BMHCexpression. In contrast, other stress respon- tigate the functional implications ofmiR-208b in moredetail, sive genes, such as those encoding ANF and BNP, were a targeting strategy was designed to very precisely remove strongly induced in miR-208 mutant animals, demonstrating miR-208b from the mouse genome (FIG.35). An additional that miR-208 is dedicated specifically to the control of approach to scavenge both miR-499 and miR-208b mayalso B-MHCexpression, which can be uncoupled from otherfac- be undertaken. Skeletal muscle specific overexpression of ets of the cardiac stress response. Since the inventors’ data binding site regions for both miR-499 and miR-208b using a indicate that miR-499 is responsible for some of the gene skeletal and heart muscle specific promoter (muscle creatine regulatory effects seen in the miR-208 mutant animals, miR- kinase (MCK)) should scavenge miR-208b and miR-499 in 499 mutant animals may also be resistant to pathological US 8,962,588 B2 53 54 remodeling of the heart, like miR-208 mutant animals. The Atchison and Perry, Ce//, 48:121, 1987. absence of both miR-208 and miR-499 may be induce the Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed.), protective effect. Plenum Press, NY, 117-148, 1986. Asalpha- and beta-MHCare counterbalancedin the heart, Baldwin and Haddad, J. Appl. Physiol., 90:345-357, 2001. the expression of miR-208/miR-208b is likely maintained at Banerji et al., Ce//, 27(2 Pt 1):299-308, 1981. relatively constant levels. However, while alpha-MHCis the Banerji et al., Ce//, 33(3):729-740, 1983. dominant MHCisoform in mice and beta-MHC dominates in Barneset al., J. Biol. Chem., 272(17):11510-11517, 1997. humans,the relative expression ofmiR-208 versus miR-208b Bartel, Ce//, 116:281-297, 2004. differs accordingly in mice versus humans. Since miR-208is Benvenisty and Neshif, Proc. Natl. Acad. Sci. USA, 83(24): required for cardiac beta-MHC expression in response to 10 9551-9555, 1986. stress and hypothyroidism in mice, miR-208b may play an Berkhoutet al., Ce//, 59:273-282, 1989. importantrole in the human shift towards beta-MHC during Bhavsar et al., Genomics, 35(1):11-23, 1996. heart disease. Nonetheless, these data indicate that there must Blanar et al., EMBO J, 8:1139, 1989. exist an intimate form of cross-talk between these miRNAs Bodine and Ley, EMBO J., 6:2997, 1987. and the myosin genes. Manipulating the functionality ofmiR- 15 Boshart et al., Cell, 41:521, 1985. 208b to regulate muscle specific fiber types can have far Bosze et al., EMBO J.,, 5(7):1615-1623, 1986. reaching implicationsfor clinical pathologies, like muscular Braddock et al., Ce//, 58:269, 1989. dystrophy. In addition, these results suggest that strategies to Brenneckeet al., Ce//, 113:25-36, 2003. enhance slow fiber gene expression by elevating miR-208b Brinsteret al., Proc. Natl. Acad. Sci. USA, 82(13):4438-4442, expression will augmentinsulin sensitivity, endurance and 20 1985. other salutary aspects of the slow fiber gene program. Bristow, Cardiology, 92:3-6, 1999. Bulla and Siddiqui, J. Virol., 62:1437, 1986. Sie se ae Calin et al., Proc. Natl. Acd. Sci. USA, 99:15524-15529, 2002. All publications, patents and patent applications discussed 25 Campbell and Villarreal, Mo/. Cell. Biol., 8:1993, 1988. and cited herein are incorporated herein by reference in their Campere and Tilghman, Genes and Dev., 3:537, 1989. entireties. All ofthe compositions and methodsdisclosed and Campoet al., Nature, 303:77, 1983. claimed herein can be made and executed without undue Carrington et al. Science, 301(5631):336-338, 2003. experimentation in light of the present disclosure. While the Celander and Haseltine, J. Virology, 61:269, 1987. compositions and methods of this invention have been 30 Celanderet al., J. Virology, 62:1314, 1988. described in terms ofpreferred embodiments,it will be appar- Chandleret al., Cell, 33:489, 1983. ent to those of skill in the art that variations maybe applied to Chang and Karin, Nature, 410(6824):37-40, 2001. the compositions and methods, and in the steps or in the Chang etal., Biochim. Biophys. Acta, 1092(2):153-160, 1991. sequence of steps of the methods described herein without Changet al., Mol. Cell. Biol., 9:2153, 1989. departing from the concept, spirit and scope of the invention. 35 Changet al., Nature, 430(7001):785-789, 2004. Morespecifically, it will be apparentthat certain agents which Chatterjeeet al., Proc. Natl. Acad. Sci. USA, 86:9114, 1989. are both chemically and physiologically related may be sub- Chen and Okayama, Mol. Cell. Biol., 7(8):2745-2752, 1987. stituted for the agents described herein while the same or Chenetal., Science, 303(5654):83-86, 2004. similar results would be achieved.All such similar substitutes Choiet al., Cell, 53:519, 1988. and modifications apparent to those skilled in the art are 40 Coffin, In: Virology, Fields et al. (Eds.), Raven Press, NY, deemed to be within the spirit, scope and concept of the 1437-1500, 1990. invention as defined by the appended claims. Cohenet al., J. Cell. Physiol., 5:75, 1987. Costa et al., Mol. Cell. Biol., 8:81, 1988. References Couchet al., Am. Rev. Resp. Dis., 88:394-403, 1963. 45 Couparet al., Gene, 68:1-10, 1988. The following references, to the extent that they provide Cripe et al., EMBO J, 6:3745, 1987. exemplary procedural or other details supplementary to those Culotta and Hamer, Mol. Cell. Biol., 9:1376, 1989. set forth herein, are specifically incorporated herein byrefer- Dandoloet al., J Virology, 47:55-64, 1983. ence. De Villiers et al., Nature, 312(5991):242-246, 1984. US. Pat. No. 4,873,191 50 Deschampsetal., Science, 230:1174-1177, 1985. US. Pat. No. 5,604,251 Dubensky et al., Proc. Natl. Acad. Sci. USA, 81:7529-7533, US. Pat. No. 5,844,107 1984. US. Pat. No. 5,877,302 Durandet al., Ann. Med., 27:311-317, 1995. US. Pat. No. 5,972,900 Edbrookeet al., Mol. Cell. Biol., 9:1908, 1989. . Pat. No. 5,972,901 55 Edgerton and Roy, J. Appl. Physiol., 89:1224-1231, 2000. . Pat. No. 6,008,336 Edlundet al., Science, 230:912-916, 1985. . Pat. No. 6,077,835 Eichhorn and Bristow, Circulation, 94:2285-2296, 1996. . Pat. No. 6,200,801 EPO 0273085 . Publn. 20020150626 Fatkin et al., J. Clin. Invest., 106:1351-1359, 2000. . Publn. 20030032615 60 Fechheimer, et al., Proc Natl. Acad. Sci. USA, 84:8463-8467, . Publn. 20030203865 1987. USS. Publn. 20040048787 Feng and Holland, Nature, 334:6178, 1988. Abraham etal., Mol. Med., 8:750-760, 2002. Ferkolet al., FASEB J, 7:1081-1091, 1993. Ambros, Cell, 113(6):673-676, 2003. Firak and Subramanian, Mol. Cell. Biol., 6:3667, 1986. Angel et al., Cell, 49:729, 1987b. 65 Fitts et al., J Appl. Physiol., 89:823-839, 2000. Angel et al., Mol. Cell. Biol., 7:2256, 1987a. Foecking and Hofstetter, Gene, 45(1):101-105, 1986. Atchison and Perry, Ce//, 46:253, 1986. Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979. US 8,962,588 B2 55 56 Franzet al., Cardioscience, 5(4):235-43, 1994. Katinkaet al., Nature, 290:720, 1981. Friedmanet al., Genes Devel., 3:1314, 1989. Kato et al, J. Biol. Chem., 266:3361-3364, 1991. Fujita et al., Ced/, 49:357, 1987. Kawamotoet al., Mol. Cell. Biol., 8:267, 1988. Ghosh and Bachhawat,In: Liver Diseases, Targeted Diagno- Kelly et al., . Cell Biol., 129(2):383-396, 1995. sis and Therapy Using Specific Receptors andLigands, Wu Kiledjian et al., Mol. Cell. Biol., 8:145, 1988. et al. (Eds.), Marcel Dekker, NY, 87-104, 1991. Kimuraet al., Dev. Growth Differ. 39(3):257-265, 1997. Ghosh-Choudhury et al., EMBO J, 6:1733-1739, 1987. Kiriazis and Kranias, Annu. Rev. Physiol., 62:321-351, 2000. Gilles et al., Cell, 33:717, 1983. Klamutet al., Mol. Cell. Biol., 10:193, 1990. Gloss et al., EMBO J, 6:3735, 1987. Klein et al., Nature, 327:70-73, 1987. Godboutet al., Mol. Cell. Biol., 8:1169, 1988. 10 Kochet al., Mol. Cell. Biol., 9:303, 1989. Gomez-Foix et al., J. Biol. Chem., 267:25129-25134, 1992. Kreket al., Nature Genetics, 37:495-500, 2005. Goodbourn and Maniatis, Proc. Natl. Acad. Sci. USA, Krenz and Robbins, J Am. Coll. Cardiol., 44:2390-2397, 85:1447, 1988. Goodbournet al., Cell, 45:601, 1986. 2004. Kriegler and Botchan, In: Eukaryotic Viral Vectors, Glazman Gopal, Mol. Cell. Biol., 5:1188-1190, 1985. 15 Gopal-Srivastavaet al., J. Mol. Cell. Biol. 15(12):7081-7090, (Ed.), Cold Spring Harbor: Cold Spring Harbor Labora- 1995. tory, NY, 1982. Graham andPrevec, In: Methods in MolecularBiology: Gene Kriegler and Botchan, Mol. Cell. Biol., 3:325, 1983a. Transfer and Expression Protocol, Murray (Ed.), Humana Kriegler et al., Cell, 38:483, 1984. Press, Clifton, N.J., 7:109-128, 1991. 20 Kriegler et al., Ce//, 53:45, 1988. Graham and Van Der Eb, Virology, 52:456-467, 1973. Kriegler et al., In: Gene Expression, Alan Liss (Ed.), Hamer Grahametal., J. Gen. Virl., 36(1):59-74, 1977. and Rosenberg, New York, 1983b. Greeneet al., Immunology Today, 10:272, 1989 Kriitzfeldt et al., Nature, 438:685-689, 2005. Grishoket al., Ce//, 106:23-34, 2001. Kuhlet al., Ce//, 50:1057, 1987. Grossched] and Baltimore, Ce//, 41:885, 1985. 25 Kunz et al., Nucl. Acids Res., 17:1121, 1989. Grunhaus and Horwitz, Seminar in Virology, 3:237-252, Lagos-Quintanaet al., Science, 294(5543):853-858, 2001. 1992. LaPointeet al., Hypertension 273 Pt 2):715-22, 1996. Harland and Weintraub, J. Cell Biol., 101(3):1094-1099, LaPointeet al., J. Biol. Chem., 263(19):9075-8, 1988. 1985. Larsenet al., Proc Natl. Acad. Sci. USA., 83:8283, 1986. Haslinger and Karin, Proc. Natl. Acad. Sci. USA, 82:8572, 30 Laspiaet al., Ce//, 59:283, 1989. 1985. Latimeret al., Mol. Cell. Biol., 10:760, 1990. Hauber and Cullen, J. Virology, 62:673, 1988. Lau et al., Science, 294(5543):858-862, 2001. Henet al., Nature, 321:249, 1986. Le Gal La Salle et al., Science, 259:988-990, 1993. Hensel etal., Lymphokine Res., 8:347, 1989. Lee and Ambros, Science, 294(5543):862-864, 2001. Hermonat and Muzycska, Proc. Natl. Acad. Sci. USA, 35 Lee et al., Nature, 294:228, 1981. 81:6466-6470, 1984. Lee et al., Nucleic Acids Res., 12:4191-206, 1984. Herr and Clarke, Ce//, 45:461, 1986. Leunget al., Proc. Natl. Acad. Sci. USA, 48:18125-18130, Hersdorffer et al., DNA Cell Biol., 9:713-723, 1990. 2006. Herz and Gerard, Proc. Natl. Acad. Sci. USA, 90:2812-2816, Levinsonet al., Nature, 295:79, 1982. 1993. 40 Levrero et al., Gene, 101:195-202, 1991. Hirochikaet al., J Virol, 61:2599, 1987. Lin et al., Mol. Cell. Biol., 10:850, 1990. Hirschet al., Mol. Cell. Biol., 10:1959, 1990. Loweset al., . Clin. Invest., 100:2315-2324, 1997. Holbrooket al., Virology, 157:211, 1987. Luria et al., EMBO J, 6:3307, 1987. Horlick and Benfield, Mol. Cell. Biol., 9:2396, 1989. Lusky and Botchan, Proc. Natl. Acad. Sci. USA, 83:3609, Horwichet al. J Virol, 64:642-650, 1990. 45 1986. Huanget al., Ce//, 27:245, 1981. Lusky et al., Mo/. Cell. Biol., 3:1108, 1983. Huget al., Mol. Cell. Biol., 8:3065, 1988. Macejak and Sarnow, Nature, 353:90-94, 1991. Hutvagneret al., PLoS Biol., 2(4):E98, 2004. Majors and Varmus, Proc. Natl. Acad. Sci. USA, 80:5866, Hwanget al., Mol. Cell. Biol., 10:585, 1990. 1983. Imagawaet al., Ce//, 51:251, 1987. 50 Mann etal., Ce//, 33:153-159, 1983. Imbra and Karin, Nature, 323:555, 1986. Markowitz et al., J. Virol., 62:1120-1124, 1988. Imleret al., Mol. Cell. Biol., 7:2558, 1987. McKinsey and Olson, J. Clin. Invest., 115:538-546, 2005. Imperiale and Nevins, Mol. Cell. Biol., 4:875, 1984. McNeall et al., Gene, 76:81, 1989. Ito and Roeder, Trends Endocrinol. Metab., 12:127-134, Meister and Tuschl, Nature, 431:343-9, 2004. 2001. 55 Miksiceket al., Cell, 46:203, 1986. Jakobovits et al., Mol. Cell. Biol., 8:2555, 1988. Miyata et al., Circ. Res., 86:386-390, 2000. Jameel and Siddiqui, Mo/. Cell. Biol., 6:710, 1986. Mordacq and Linzer, Genes and Dev., 3:760, 1989. Jayneset al., Mol. Cell. Biol., 8:62, 1988. Moreauetal., Nucl. Acids Res., 9:6047, 1981. Ji et al., Mol. Cell. Biol. 27(4):1531-43, 2006. Morkin, Microsc. Res. Tech., 50:522-531, 2000. Johnsonet al., Mol. Cell. Biol., 9:3393, 1989. 60 Mosset al., Biol. Chem., 271(49):31688-31694, 1996. Jones and Shenk, Ce//, 13:181-188, 1978. Muesinget al., Ce//, 48:691, 1987. Kadesch and Berg, Mol. Cell. Biol., 6:2593, 1986. Nakaoetal., J. Clin. Invest., 100:2362-2370, 1997. Kanedaet al., Science, 243:375-378, 1989. Nayaet al., J Biol Chem, 275(7):4545-4548, 2000. Karin et al., Mol. Cell. Biol., 7:606, 1987. Nget al., Nuc. Acids Res., 17:601, 1989. Karin et al., Mol. Cell. Biol., 7:606, 1987. 65 Nicolas and Rubinstein, In: Vectors: A survey of molecular Karlsson et al., EMBO J., 5:2377-2385, 1986. cloning vectors and their uses, Rodriguez and Denhardt Katinkaet al., Ce//, 20:393, 1980. (Eds), Stoneham: Butterworth, 494-513, 1988. US 8,962,588 B2 57 58 Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, Spandidos and Wilkie, EMBO J. 2:1193, 1983. 1982. Stephens and Hentschel, Biochem. J., 248:1, 1987. Nicolau et al., Methods Enzymol., 149:157-176, 1987. Stratford-Perricaudet and Perricaudet, In: Human Gene Ondeket al., EMBO J, 6:1017, 1987. Transfer, Eds, Cohen-Haguenauer and Boiron, John Ornitz et al., Mol. Cell. Biol., 7:3466, 1987. Libbey Eurotext, France, 51-61, 1991. Stratford-Perricaudet et al., Hum. Gene. Ther, 1:241-256, Palmiteret al., Nature, 300:611, 1982. 1990. Pantos et al., Horm. Metab. Res., 38:308-313, 2006. Stuart et al., Nature, 317:828, 1985. Paskindet al., Virology, 67:242-248, 1975. Sullivan and Peterlin, Mol. Cell. Biol., 7:3315, 1987. Pasquinelli and Ruvkun, Ann. Rev. Cell Dev. Biol., 18:495- Swartzendruber and Lehman, / Cell. Physiology, 85:179, 10 513, 2002. 1975. PCT Appin. WO 0071096 Takebe et al., Mol. Cell. Biol., 8:466, 1988. PCT Appln. WO 98/33791 Tang et al., Muscle Nerve, 36(3), 342-8, 2007. Pechet al., Mol. Cell. Biol., 9:396, 1989. Tavernieret al., Nature, 301:634, 1983. Pelletier and Sonenberg, Nature, 334(6180):320-325, 1988. Taylor and Kingston, Mol. Cell. Biol., 10:165, 1990a. 15 Perales et al., Proc. Natl. Acad. Sci. USA, 91:4086-4090, Taylor and Kingston, Mol. Cell. Biol., 10:176, 1990b. 1994, Taylor et al., J Biol, Chem., 264:15160, 1989. Perez-Stable and Constantini, Mo/. Cell. Biol., 10:1116, Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum 1990. Press, 149-188, 1986. Physicians Desk Reference The Merck Index, Eleventh Edition 20 Picard and Schaffner, Nature, 307:83, 1984. Thiesenet al., J. Virology, 62:614, 1988. Pinkert et al., Genes and Dev., 1:268, 1987. Top et al., J. Infect. Dis., 124:155-160, 1971. Ponta et al., Proc. Natl. Acad. Sci. USA, 82:1020, 1985. Treisman, Cell, 46(4):567-174, 1986 Porton et al., Mol. Cell. Biol., 10:1076, 1990. Troncheet al., Mol. Biol. Med., 7:173, 1990. Potter et al., Proc. Natl. Acad. Sci. USA, 81:7161-7165, 1984. Troncheet al., Mol. Cell. Biol., 9(11):4759-4766, 1989. Queen and Baltimore, Ce//, 35:741, 1983. 25 Trudel and Constantini, Genes and Dev., 6:954, 1987. Quinn et al., Mol. Cell. Biol., 9:4713, 1989. Tsika et al., Am. J. Physiol. Cell Physiol., 283:C1761-C1775, Racheret al., Biotechnology Techniques, 9:169-174, 1995. 2002. Ragotet al., Nature, 361:647-650, 1993. Tur-Kaspaet al., Mol. Cell. Biol., 6:716-718, 1986. Redondoet al., Science, 247:1225, 1990. Tyndell et al., Nuc. Acids. Res., 9:6231, 1981. Reisman and Rotter, Mol. Cell. Biol., 9:3571, 1989. van Rooij et al., Proc. Natl. Acad. Sci. USA, 103(48):18255- Remington’s Pharmaceutical Sciences, 15” ed., pages 1035- 18260, 2006. 1038 and 1570-1580, Mack Publishing Company, Easton, van Rooij et al. Science 316(5824):575-9. 2007. Pa., 1980. Vannice and Levinson, J. Virology, 62:1305, 1988. Renan, Radiother. Oncol., 19:197-218, 1990. Varmuset al., Ce//, 25:23-36, 1981. 35 ResendezJr. et al., Mo/. Cell. Biol., 8:4579, 1988. Vasseuret al., Proc Natl. Acad. Sci. USA, 77:1068, 1980. Rich et al., Hum. Gene Ther. 4:461-476, 1993. Wagneret al., Proc. Natl. Acad. Sci. USA 87(9):3410-3414, Ridgeway, In: Vectors: A Survey ofMolecular Cloning Vec- 1990. tors and Their Uses, Rodriguez et al. (Eds.), Stoneham: Wang, and Calame, Ce//, 47:241, 1986. Butterworth, 467-492, 1988. Weberet al., Cell, 36:983, 1984. 40 Ripe et al., Mol. Cell. Biol., 9:2224, 1989. Weiet al., J. Endocrinol. Invest., 28:8-11, 2005. Rippe, et al., Mol. Cell. Biol., 10:689-695, 1990. Weinbergeret al. Mol. Cell. Biol., 8:988, 1984. Rittling et al., Nuc. Acids Res., 17:1619, 1989. Winoto and Baltimore, Cel/, 59:649, 1989. Rosenet al., Ce//, 41:813, 1988. Wonget al., Gene, 10:87-94, 1980. Rosenfeldet al., Science, 252:431-434, 1991. Wuand Wu, Adv. Drug Delivery Rev., 12:159-167, 1993. 45 Rosenfeld, et al., Ce//, 68:143-155, 1992. Wuand Wu,Biochemistry, 27: 887-892, 1988. Rouxet al., Proc. Natl. Acad. Sci. USA, 86:9079-9083, 1989. Wu and Wu, / Biol. Chem., 262:4429-4432, 1987. Sakai et al., Genes and Dev., 2:1144, 1988. Xu et al., Curr, Biol., 13:790-795, 2003. Sambrook and Russell, Molecular Cloning: A Laboratory Yamauchi-Takihara, et. al., Proc. Natl. Acad. Sci. USA, Manual 3’ Ed., Cold Spring Harbor Laboratory Press, 86(10):3504-3508, 1989. 2001. Yang and Russell, Proc. Natl. Acad. Sci. USA, 87:4144-4148, Satake et al., J. Virology, 62:970, 1988. 1990. Schaffneret al., 4 Mol. Biol., 201:81, 1988. Yao and Eghbali, Circ. Res., 71:831-839, 1992. Searle et al., Mol. Cell. Biol., 5:1480, 1985. Younget al., In: Handbook ofApplied Therapeutics, 7.1-7.12 Sharp and Marciniak, Ce//, 59:229, 1989. and 9.1-9.10, 1989. 55 Shaul and Ben-Levy, EMBO J., 6:1913, 1987. Yutzey et al. Mol. Cell. Biol., 9:1397, 1989. Sherman etal., Mol. Cell. Biol., 9:50, 1989. Zelenin et al., FEBS Lett., 287(1-2):118-120, 1991. Sleigh and Lockett, J EMBO, 4:3831, 1985. Zeng et al., Mol. Cell., 9(6):1327-33, 2002. Spalholz et al., Ce//, 42:183, 1985. Zhaoet al., Nature, 436:214-220, 2005. Spandau and Lee, J. Virology, 62:427, 1988. Ziober and Kramer, J. Bio. Chem., 271(37):22915-22, 1996.

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 39

<210> SEQ ID NO 1 US 8,962,588 B2 59 60 -continued

<211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 1 tgacgggega gettttggcee cgggttatac ctgatgetca cgtataagac gagcaaaaag 60 ettgttggte a 71

<210> SEQ ID NO 2 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Mus sp.

<400> SEQUENCE: 2 tgacgggtga gettttggce cgggttatac ctgactctca cgtataagac gagcaaaaag 60 ettgttggte a 71

<210> SEQ ID NO 3 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rattus sp.

<400> SEQUENCE: 3 tgacgggtga gettttggce cgggttatac ctgactctca cgtataagac gagcaaaaag 60 ettgttggte a 71

<210> SEQ ID NO 4 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Canis sp.

<400> SEQUENCE: 4 tgacgeatga gcettttggct cgggttatac ctgatgetca cgtataagac gagcaaaaag 60 ettgttggte a 71

<210> SEQ ID NO 5 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: Mature miR-208 sequence

<400> SEQUENCE: 5 auaagacgag caaaaagecuu gu 22

<210> SEQ ID NO 6 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 6

uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aaaguugcag 60 uaggguuge 69

<210> SEQ ID NO 7 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Pan sp.

<400> SEQUENCE: 7

uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 US 8,962,588 B2 61 62 -continued

uaggguuge 69

<210> SEQ ID NO 8 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Mus sp.

<400> SEQUENCE: 8 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aagcuugcag 60 uaggguuge 69

<210> SEQ ID NO 9 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Rattus sp.

<400> SEQUENCE: 9 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69

<210> SEQ ID NO 10 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Canis sp.

<400> SEQUENCE: 10

uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69

<210> SEQ ID NO 11 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Gallus sp.

<400> SEQUENCE: 11 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69

<210> SEQ ID NO 12 <211> LENGTH: 72 <212> TYPE: RNA <213> ORGANISM: Takifugu

<400> SEQUENCE: 12 uuccugcuuu aagcaauugg uugaaaauau auguauguaa uggucuuaau uaaaaaaaca 60 aacuaagaca aa 72

<210> SEQ ID NO 13 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Danio sp.

<400> SEQUENCE: 13 uuccugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuucauuac aaaaacgaac 60 caucaaacg 69

<210> SEQ ID NO 14 <211> LENGTH: 71 <212> TYPE: DNA US 8,962,588 B2 63 64 -continued

<213> ORGANISM: Homo sapiens

<400> SEQUENCE: 14 acgggegage ttttggeccg ggttatacct gatgctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71

<210> SEQ ID NO 15 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Mus sp.

<400> SEQUENCE: 15 acgggtgage ttttggceccg ggttatacct gactctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71

<210> SEQ ID NO 16 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rattus sp.

<400> SEQUENCE: 16 acgggtgage ttttggceccg ggttatacct gactctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71

<210> SEQ ID NO 17 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Canis sp.

<400> SEQUENCE: 17 acgcatgage ttttggctcg ggttatacct gatgctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71

<210> SEQ ID NO 18 <211> LENGTH: 76 <212> TYPE: DNA <213> ORGANISM: Mus sp.

<400> SEQUENCE: 18 tecctgtgte ttgggtggge agctgttaag acttgcagtg atgtttaget cctctgcatg 60 tgaacatcac agcaag 76

<210> SEQ ID NO 19 <211> LENGTH: 74 <212> TYPE: DNA <213> ORGANISM: Rattus sp.

<400> SEQUENCE: 19 tecetgtctt gggtgggcag ctgttaagac ttgcagtgat gtttagetce tctccatgtg 60 aacatcacag caag 74

<210> SEQ ID NO 20 <211> LENGTH: 76 <212> TYPE: DNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 20 cecetgtgee ttgggeggge ggctgttaag acttgcagtg atgtttaact cctctccacg 60 tgaacatcac agcaag 76 US 8,962,588 B2 65 66 -continued

<210> SEQ ID NO 21 <211> LENGTH: 76 <212> TYPE: DNA <213> ORGANISM: Canis sp.

<400> SEQUENCE: 21 cecttgcace ctgggeggge ggecgttaag acttgcagtg atgtttaact cctctccacg 60 tgaacatcac agcaag 76

<210> SEQ ID NO 22 <211> LENGTH: 76 <212> TYPE: DNA <213> ORGANISM: Monodelphis sp.

<400> SEQUENCE: 22 cecetgecte ceeggeggge agetgttaag acttgcagtg atgtttaatt cttctctatg 60 tgaacatcac aacaag 76

<210> SEQ ID NO 23 <211> LENGTH: 62 <212> TYPE: DNA <213> ORGANISM: Gallus sp.

<400> SEQUENCE: 23 ggageggeag ttaagacttg tagtgatgtt tagataatgt attacatgga catcacttta 60 ag 62

<210> SEQ ID NO 24 <211> LENGTH: 68 <212> TYPE: DNA <213> ORGANISM: Xenopus tropicalis

<400> SEQUENCE: 24 gtcttagega ggcagttaag acttgcagtg atgtttagtt aaaatctttt catgaacatc 60 actttaag 68

<210> SEQ ID NO 25 <211> LENGTH: 79 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: Pre-miR-499 sequence

<400> SEQUENCE: 25 gggugggeag cuguuaagac uugcagugau guuuagcuce ucugcaugug aacaucacag 60 caagucugug cugcugecu 79

<210> SEQ ID NO 26 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-499 sequence

<400> SEQUENCE: 26 uuaagacuug cagugauguu u 21

<210> SEQ ID NO 27 <211> LENGTH: 22 <212> TYPE: RNA US 8,962,588 B2 67 68 -continued

<213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208b sequence

<400> SEQUENCE: 27 auaagacgaa caaaagguuu gu 22

<210> SEQ ID NO 28 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: U6 forward primer

<400> SEQUENCE: 28 gtgetegett cggcage 17

<210> SEQ ID NO 29 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: U6 reverse primer

<400> SEQUENCE: 29 aaaatatgga acgcttcacg aatttgceg 28

<210> SEQ ID NO 30 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Homo sapiens

<400> SEQUENCE: 30 tttctgatce gaatataaga cgaacaaaag gtttgtctga ggg 43

<210> SEQ ID NO 31 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Mus sp.

<400> SEQUENCE: 31 tttctgatce gaatataaga cgaacaaaag gtttgtctga ggg 43

<210> SEQ ID NO 32 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Rattus sp.

<400> SEQUENCE: 32 tttctgatce gaatataaga cgaacaaaag gtttgtctga ggg 43

<210> SEQ ID NO 33 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Canis sp.

<400> SEQUENCE: 33 tttctgatcc gaatataaga cgaacaaaag gtttgtctga ggg 43

<210> SEQ ID NO 34 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Monodelphis sp.

<400> SEQUENCE: 34 US 8,962,588 B2 69 70 -continued

ttttggatct gaatataaga cgaacaaaag gtttgtctgt gtg 43

<210> SEQ ID NO 35 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Xenopus tropicalis

<400> SEQUENCE: 35 ttttctgttg ttgtataaga cgagcataaa gcttgtttgt tag 43

<210> SEQ ID NO 36 <211> LENGTH: 77 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: Pre miR-208b sequence

<400> SEQUENCE: 36 ccucucaggg aagcuuuuug cucgcguuau guuucucauc cgaauauaag acgaacaaaa 60 gguuugucug agggcug 77

<210> SEQ ID NO 37 <211> LENGTH: 71 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: Pre miR-208 sequence

<400> SEQUENCE: 37 ugacgggega gcuuuuggee cggguuauac cugaugcuca cguauaagac gagcaaaaag 60 cuuguugguc a 71

<210> SEQ ID NO 38 <211> LENGTH: 24 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208 sequence

<400> SEQUENCE: 38 auaagacgag caaaaageuu guuu 24

<210> SEQ ID NO 39 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-499 sequence

<400> SEQUENCE: 39 uuaagacuug cagugauguu uaa 23

The invention claimedis: prising a sequencethatis at least 85% complementary to 1. A methodfor treating pathologic cardiac hypertrophy, amiR-208 or miR-208b sequenceoverthe entire length heart failure, or myocardial infarction in a subject in need of the antisense oligonucleotide, wherein the expression thereof comprising administering to the subject: 60 or activity of miR-499 and miR-208 or miR-208b is inhibited in the heart cells of the subject following a miR-499 inhibitor, wherein the miR-499 inhibitor is an administration of the miR-499 inhibitor and the miR- antisense oligonucleotide comprising a sequencethatis 208/miR-208b inhibitor. at least 85% complementary to amiR-499 sequence over 2. The methodofclaim 1, wherein the miR-499 inhibitoris the entire length of the antisense oligonucleotide; and 65 anantisense oligonucleotide comprising a sequencethat is at a miR-208/miR-208b inhibitor, wherein the miR-208/ least 95% complementary to SEQ ID NO:26 overthe entire miR-208b inhibitoris an antisense oligonucleotide com- length of the antisense oligonucleotide. US 8,962,588 B2 71 72 3. The method ofclaim 1, wherein the miR-499inhibitoris administering to the subject a miR-499 inhibitor, wherein an antisense oligonucleotide comprising a sequence that is the miR-499 inhibitor is an antisense oligonucleotide 100% complementary to SEQ ID NO: 26 over the entire comprising a sequencethatis at least 85% complemen- length of the antisense oligonucleotide. tary to amiR-499 sequenceoverthe entire length of the 4. The methodof claim 1, wherein the miR-208/miR-208b antisense oligonucleotide; and inhibitor is an antisense oligonucleotide comprising a administering to the subject a miR-208/miR-208b inhibi- sequencethatis at least 95% complementary to SEQ ID NO: tor, wherein the miR-208/miR-208b inhibitor is an anti- 5 or SEQ ID NO:27 over the entire length of the antisense sense oligonucleotide comprising a sequence that is at oligonucleotide. least 85% complementary to a miR-208 or miR-208b 5. The methodof claim 1, wherein the miR-208/miR-208b 10 sequence over the entire length of the antisense oligo- inhibitor is an antisense oligonucleotide comprising a nucleotide, wherein the expression or activity of miR- sequencethat is 100% complementary to SEQ ID NO: 5 or 499 and miR-208 or miR-208b is inhibited in the heart SEQ ID NO:27 over the entire length of the antisense oligo- nucleotide. cells of the subject following administration ofthe miR- 499 inhibitor and the miR-208/miR-208b inhibitor. 6. The methodof claim 1, wherein the miR-208/miR-208b 15 inhibitor is an antisense oligonucleotide comprising a 21. The method of claim 20, wherein the subject identified sequencethat is at least 95% complementary to a pre-miR- as being at risk exhibits one or morerisk factors selected from 208 sequence over the entire length of the antisense oligo- the group consisting of long standing uncontrolled hyperten- nucleotide. sion, uncorrected valvular disease, chronic angina, recent 7. The method of claim 6, wherein the pre-miR-208 20 myocardial infarction, or congenital predisposition to heart sequence is SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: disease. 16, or SEQ ID NO:17. 22. The method of claim 20, wherein the subject identified 8. The method of claim 1, wherein the miR-208/miR-208b as being at risk has been diagnosed as having a genetic pre- inhibitor is an antisense oligonucleotide comprising a disposition to cardiac hypertrophy. sequencethat is at least 95% complementary to a pre-miR- 25 23. The method of claim 20, wherein the subject identified 208b sequence. as being at risk has a familial history of cardiac hypertrophy. 9. The method of claim 8, wherein the pre-miR-208b 24. The method ofclaim 20, wherein the miR-499 inhibitor sequence is SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: is an antisense oligonucleotide comprising a sequencethatis 32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ at least 95% complementary to SEQ ID NO:26 overthe entire ID NO:36. 30 length of the antisense oligonucleotide. 10. The method of claim 1, wherein the miR-499 inhibitor 25. The method ofclaim 20, wherein the miR-499 inhibitor is an antisense oligonucleotide comprising a sequencethatis is an antisense oligonucleotide comprising a sequencethatis at least 95% complementary to a pre-miR-499 sequence. 100% complementary to SEQ ID NO: 26 over the entire 11. The method of claim 10, wherein the pre-miR-499 length of the antisense oligonucleotide. sequence is SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 35 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO:23, or SEQ 26. The method of claim 20, wherein the miR-208/miR- ID NO:24. 208b inhibitor is an antisense oligonucleotide comprising a 12. The method of claim 1, wherein the miR-499 inhibitor sequencethatis at least 95% complementary to SEQ ID NO: and/or the miR-208/miR-208b inhibitor is about 15 to about 5 or SEQ ID NO:27 over the entire length of the antisense 50 nucleotides in length. 40 oligonucleotide. 13. The method of claim 1, wherein the miR-499 inhibitor 27. The method of claim 20, wherein the miR-208/miR- and/or the miR-208/miR-208b inhibitor is about 19 to about 208b inhibitor is an antisense oligonucleotide comprising a 25 nucleotides in length. sequence that is 100% complementary to SEQ ID NO: 5 or 14. The method of claim 1, wherein the miR-499 inhibitor SEQ ID NO:27 over the entire length of the antisense oligo- and/or the miR-208/miR-208b inhibitor comprises at least 45 nucleotide. one chemical modification. 28. The method of claim 20, wherein the miR-208/miR- 15. The method of claim 14, wherein the chemical modi- 208b inhibitor is an antisense oligonucleotide comprising a fication is a sugar and/or backbone modification. sequence that is at least 95% complementary to a pre-miR- 16. The method of claim 15, wherein the sugar modifica- 208 sequence over the entire length of the antisense oligo- tion is a modification selected from the group consisting of 50 nucleotide. 2'-O-alkyl, 2'-O-methyl, 2'-O-methoxyethyl, 2'-fluoro, and a 29. The method of claim 28, wherein the pre-miR-208 locked nucleic acid. sequence is SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17. The method of claim 15, wherein the backbone modi- 16, or SEQ ID NO:17. fication is a phosphorothioate linkage. 30. The method of claim 20, wherein the miR-208/miR- 18. The method of claim 1, wherein the miR-499 inhibitor 55 and/or the miR-208/miR-208b inhibitor is conjugated to cho- 208b inhibitor is an antisense oligonucleotide comprising a lesterol. sequence that is at least 95% complementary to a pre-miR- 19. The method of claim 1, wherein the miR-499 inhibitor 208b sequence over the entire length of the antisense oligo- and/or the miR-208/miR-208b inhibitor is administered by nucleotide. intradermal, subcutaneous, intramuscular, intraperitoneal, 60 31. The method of claim 30, wherein the pre-miR-208b intravenous, oral, transdermal, sustained release, controlled sequence is SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: release, delayed release, suppository, catheter, or sublingual 32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ administration or direct injection into cardiac tissue. ID NO:36. 20. A method of preventing pathologic cardiac hypertro- 32. The method ofclaim 20, wherein the miR-499 inhibitor phyor heart failure in a subject identified as being atrisk of is an antisense oligonucleotide comprising a sequencethatis developing pathologic cardiac hypertrophy or heart failure at least 95% complementary to a pre-miR-499 sequence over comprising: the entire length of the antisense oligonucleotide. US 8,962,588 B2 73 74 33. The method of claim 32, wherein the pre-miR-499 sequence is SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO:23, or SEQ ID NO:24. 34. The method ofclaim 20, wherein the miR-499 inhibitor and/or the miR-208/miR-208b inhibitor is about 15 to about 50 nucleotides in length. 35. The method ofclaim 20, wherein the miR-499 inhibitor and/or the miR-208/miR-208b inhibitor is about 19 to about 25 nucleotides in length. 10 36. The methodof claim 20, wherein the miR-499inhibitor and/or the miR-208b /miR-208b inhibitor comprises at least one chemical modification. 37. The method of claim 36, wherein the chemical modi- fication is a sugar and/or backbone modification. 15 38. The methodof claim 37, wherein the sugar modifica- tion is a modification selected from the group consisting of 2'-O-alkyl, 2'-O-methyl, 2'-O-methoxyethyl, 2'-fluoro, and a locked nucleic acid. 39. The method of claim 37, wherein the backbone modi- fication is a phosphorothioate linkage. 40. The method ofclaim 20, wherein the miR-499 inhibitor and/or the miR-208/miR-208b inhibitor is conjugated to cho- lesterol. 41. The method ofclaim 20, wherein the miR-499 inhibitor 25 and/or the miR-208/miR-208b inhibitor is administered by intradermal, subcutaneous, intramuscular, intraperitoneal, intravenous, oral, transdermal, sustained release, controlled release, delayed release, suppository, catheter, or sublingual administration or direct injection into cardiac tissue. 30

*****