US008940712B2 a2) United States Patent (0) Patent No.: US 8,940,712 B2 Olsonet al. (45) Date of Patent: Jan. 27, 2015
(54) MICRO-RNA FAMILY THAT MODULATES 2310/141 (2013.01); CI2N 2310/315 (2013.01); FIBROSIS AND USES THEREOF C1I2N 2310/321 (2013.01); C12N 2310/346 (2013.01); CI2N 2310/3515 (2013.01); C12N (71) Applicant: The Board of Regents, The University 2320/31 (2013.01); C12N 2330/10 (2013.01) of Texas System,Austin, TX (US) USPC. ecsscssssssseesstvesnssnssresnesvesveecee 514/44 A (72) Inventors: Eric N. Olson, Dallas, TX (US); Eva (58) Field of Classification Search van Rooij, Utrecht (NL) USPC ooceecccccsscsecseeseeseeseeseeseeseesseeeeeeesneseees 514/44 A See application file for complete search history. (73) Assignee: The Board of Regents, The University of Texas System, Austin, TX (US) (56) References Cited (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S. PATENT DOCUMENTS
U.S.C. 154(6)by I day. 7,232,806 B2 6/2007 Tuschlet al. 7,674,617 B2 3/2010 Kimetal. (21) Appl. No.: 13/840,823 2005/0059005 Al 3/2005 Tuschlet al. . 2005/0222399 Al 10/2005 Bentwich (22) Filed: Mar. 15, 2013 2005/0261218 Al 11/2005 Esau etal. 2006/0019286 Al 1/2006 Horvitz et al. (65) Prior Publication Data 2006/0105360 Al 5/2006 Croceet al. 2006/0185027 Al 8/2006 Bartelet al. US 2013/0195891 Al Aug. 1, 2013 2006/0247193 Al 11/2006 Taira etal. 2007/0087335 Al 4/2007 Brahmachari etal. 2007/0092882 Al 4/2007 Wangetal.
2008/0176766 Al 7/2008 Brownetal. (63) Continuation of application No. 12/671,445, filed as 2009/0053718 Al 2/2009 Naguibnevaetal. application No. PCT/US2008/071839 on Jul. 31, sooOaaaoe ‘i eons One "a 2008, now Pat. No. 8,440,636. 2009/0281167 Al 11/2009 Shenad.et&al. . (60) Provisional application No. 61/047,014, filed on Apr. (Continued) 22, 2008, provisional application No. 60/980,303, filed on Oct. 16, 2007, provisional application No. FOREIGN PATENT DOCUMENTS 60/952,917,filed on Jul. 31, 2007. EP 1440981 A2 7/2004 (51) Int. Cl. EP 1627925 Al 2/2006 CI2N 15/11 (2006.01) (Continued) A6I1K 31/713 (2006.01) AOIK 67/027 (2006.01) OTHER PUBLICATIONS A61K 38/22 (2006.01) CI2N 9/16 (2006.01) Cheng et al., “MicroRNAs Are Aberrantly Expressed in CIQN 15/113 (2010.01) Hypertrophic Heart,’ Am. J. Pathol. 170(6):1831-1840 (2007). CI2QN 15/85 (2006.01) (Continued) AG6IK 31/7105 (2006.01) A6I1K 31/712 (2006.01) AG6IK 31/7125 2006.01 AGIK 39/395 (3006 01) Primary Examiner — J. E. Angell AG6IK 45/06 (2006.01) (74) Altorney, Agent, or Firm — Cooley LLP A61K 31/07 (2006.01) A6IK 31/355 (2006.01) A6I1K 31/375 (2006.01) (67) ABSTRACT (52) U.S. Cl. The present invention relates to the identification of a CPC wee A61K 31/713 (2013.01); AOLK 67/0276 microRNA family, designated miR-29a-c, that is a key regu- (2013.01); A6LK 38/2242 (2013.01); C12N lator of fibrosis in cardiac tissue. The inventors show that 9/16 (2013.01); CI2N 15/113 (2013.01); CI2N members of the miR-29 family are down-regulated in the 15/8509 (2013.01); AGLK 31/7105 (2013.01); heart tissue in responseto stress, and are up-regulatedin heart A61LK 31/712 (2013.01); A6LK 31/7125 tissue of mice that are resistant to both stress and fibrosis. (2013.01); A6LK 39/3955 (2013.01); A61K Also provided are methods of modulating expression and 45/06 (2013.01); A61K 31/07 (2013.01); A6LK activity of the miR-29 family of miRNAsas a treatment for 31/355 (2013.01); A6LK 31/375 (2013.01); fibrotic disease, including cardiac hypertrophy, skeletal AOLK 2207/30 (2013.01); AOLK 2217/052 muscle fibrosis other fibrosis related diseases and collagen (2013.01); AOLK 2217/075 (2013.01); AOILK loss-related disease. 2217/15 (2013.01); AOLK 2217/206 (2013.01); AOLK 2227/105 (2013.01); AOLK 2267/0375 (2013.01); CI2N 2310/113 (2013.01); C12N 16 Claims, 25 Drawing Sheets US 8,940,712 B2 Page 2
(56) References Cited WO WO2008/061537 A2 5/2008 Wo WO 2008/116267 Al 10/2008 U.S. PATENT DOCUMENTS Wo WO 2008/147839 Al 12/2008 — Wo WO 2009/012263 A2 1/2009 2009/0286969 Al 11/2009 Esauetal. WO WO 2009/026576 Al 2/2009 2009/0291906 Al 11/2009 Esauetal. WO WO 2009/043353 A2 4/2009 2009/0291907 Al 11/2009 Esauetal. WO WO 2009/058818 A2 5/2009 2009/0293148 Al 11/2009 Renetal. WO WO 2009/062169 A2 5/2009 2009/0317369 Al 12/2009 Hosodaet al. WO WO 2009/111375 A2 9/2009 2009/0326049 Al 12/2009 Aristarkhovetal. WO WO 2009/114681 A2 9/2009 2010/0029003 Al 2/2010 Bartel et al. WO WO 2009/121031 Al 10/2009 2010/0087512 Al 4/2010 Tuschlet al. we we sebseoso SS ot 2010/0087513 Al 4/2010 Tuschletal. 2010/0093837 Al 4/2010 Tuschl etal. WO WO 2010/048585 A2 4/2010 2010/0099748 Al 4/2010 Tuschlet al. OTHER PUBLICATIONS 2010/0113561 Al 5/2010 Tuschlet al. Kim, “International Search Report,” 4 pages, from International FOREIGN PATENT DOCUMENTS Patent Appl. No. PCT/US2008/071839,Korean Intellectual Property Office, Daejon, Republic of Korea (mailed Jan. 6, 2009). EP 1777301 A2 4/2007 Rooij et al., “A signature pattern of stress-responsive microRNAsthat EP 1959012 A2 8/2008 can evoke cardiac hypertrophy and heart failure,” Proc. Natl. Acad. EP 2113567 Al 11/2009 Sci. USA 103(48):18255-18260 (2006). JP 2006-5 19008 8/2006 Tatsuguchiet al., “Expression of MicroRNAsis Dynamically Regu- wi0 Wowuloooas9 AQ iOooos lated During Cardiomyocyte Hypertrophy,” J. Mol. Cell. Cardiol. woWo WO 2005/0139012004/076622 A2 3/20059/2004 Po)pasesQuintana8) altoeCon microictoRNAss fifrom mouse and. dhhuman,” wo wo aN40iio ‘i a8 Lagos-Quintanaet al., “Identification of tissue-specific microRNAs wo WO 2005/047505 A2 5/2005 from mouse,” Current Biology, vol. 12:735-739, 2002. ; wo WO 2005/056797 Al 6/2005 Sempere et al., “Expression profiling of mammalian microRNAs Wo WO 2005/118806 A2 12/2005 uncoversa subset ofbrain-expressed microRNAs with possible roles wo WO 2006/033020 A2 3/2006 in murine and human neuronal differentiation”’ Genome Biology, WO WO 2006/033928 A2 3/2006 vol. 5:R13, 2004. . . — wo WO 2006/081284 A2 8/2006 Mott et al., “miR-29 regulates Mcl-1 protein expression and WO WO 2006/108473 Al 10/2006 apoptosis,” Oncogene, vol. 26: 6133-6 140, 2007. . . WO WO 2006/111512 Al 10/2006 Heet al., “Overexpression of Micro Ribonucleic Acid 29, Highly WO WO 2006/128245 Al 12/2006 Up-Regulated in Diabetic Rats, Leads to Insulin Resistance in 3T3- wo WO 2006/133022 A2 12/2006 L1 Adipocytes,” Molecular Endocrinology, vol. 21: 2785-2794, Wo WO 2006/137941 A2 12/2006 2007. — WO WO 2007/000668 A2 1/2007 Zhaoet al., “Dysregulation of Cardiogenesis, Cardiac Conduction, WO WO 2007/016548 A2 2/2007 and Cell Cycle in Mice Lacking miRNA-1-2,” Cell, vol. 129: 303- — Wo WO 2007/033023 A2 3/2007 317, 2007. WO WO 2007/042899 A2 4/2007 Van Rooij et al., “Dysregulation of microRNAsafter myocardial wo wo sooooags “ ene infarction reveals a role of miR-29 in cardiac fibrosis,” Proc. Natl. Wo WO 2007/081680 A2 7/9007 Acad. Sci, USA, vol. 105: 13027-13032, 2008. wo WO 2007/081720 A2 7/2007 Spindler, Supplementary European Search Report for European Wo WO 2007/081740 A? 7/2007 Application No. 08797006.7, 10 pages, European Patent Office, The WO WO 2007/109236 A2 9/2007 Hague, mailed Aug. 17, 2011. ~~ Wo WO 2007/112754 A2 10/2007 Pekarsky Y. et al., “Tell expression in chronic lymphocytic leukemia WO WO 2008/016924 A2 2/2008 is regulated by miR-29 and miR-181,” Cancer Research, vol. Wo WO 2008/043521 A2 4/2008 66:11590-11593, 2006. U.S. Patent Jan. 27, 2015 Sheet 1 of 25 US 8,940,712 B2
BOSH FeIE1axS2
UOLOS YPOLOO UOLOOTLOLLOOVVW
YOLODLIDLLOOVVUWWOD
RR
RAMRERE
LID
TIO
LLOOVWUTYOOUDO
LLODY
REE
TUT CWO
NAR
non eu;
2
Woo n
DY
REEMA
32
i€
OAWAYY
oynynh
villi
TOO VIO
ED
RONNOOVYYWWOSUpOVeLEAY
OWOVULU
VD VATU VO
£ ov
WULYELOOWOLIOLUDLOOULUL
VV
RED
t
O29
OD
dt
LY
LVLOOVOLILOWO
“Sid
OR
39 ¥
LOO LOOWN
3D DD
el
ARES
G4
5 Y¥
VO
AnnnoSeWSDSS VwwEooNnondh
LIELTTELEE
£9°Se
LOL LAOLOVOLOOVIULLOODSOODDLLLIOOUALODDOVEL
UALOOULYLIODOODIOOELLLOOVONONSOVOL
REED
LINWOOD
EL
> .S
E ®
pnd
DW)
PLE
ane
RE
LODO ¥ n
RENE
OS os
oH
doonmueis BOZ-HyW
ODD
8h
LOST OLLI
RE
RRR
SINVW
LLIOO
RAE
(te
LOOVO
VOR
ES ton
(s
LOND
ar
son
aeRee
OVOL TIOO
ous)
VOL
aI
as)
OHW-° UELUNH
8
NBO
SNOH
bog
338
(Z (T
(€ (@
‘ON
‘ON ‘ON
ON
CI
CI
GI CI
OHS)
OS)
OmS) O8S)
WOO «= «= U.S. Patent Jan. 27, 2015 Sheet 2 of 25 US 8,940,712 B2
=
—— bd £d
cepacia
ee e1
| aanoese
ota
UL
$"Za he
4001
o oOo oO o o oO 8 2 oO a @ Ss wo ity Tr AON xo
e UOISSOIGXS OHIN SABEIOY
o
Ayynoequoy
Teer yseJ
@IOUIODILS
SS
Spee
Ly = Ayynoe1yU0D MOjS
U.S. Patent Jan. 27, 2015 Sheet 3 of 25 US 8,940,712 B2
AqyiyoeRyUED
ET
MOIS
aT
SEE wisipiosAyjodAH
ee Lhe aaWwO.eS
neue > Rr
WV Cac) Ssa.js
wanenes>
AyioRyqUOg
BEL
ise
oren
(Ve pe)
U.S. Patent Jan. 27, 2015 Sheet 4 of 25 US 8,940,712 B2
at
CTU
Ty
Lorene
rgS"O Pr rst
S*t
st
z
Ayuepunge
si
tO
PST
e x4
so se z
goz-yiw
JHIN®
uojsseidxe
SAnEIOy
U.S. Patent Jan. 27, 2015 Sheet 5 of 25 US 8,940,712 B2
ULeS
jeds
jads CLT
ETLLO
aq-wp
d
uOTeUIquUIOSSYy
xo7]
PSJEIPayy-AD
snoBojowop
“DIA
uols|oxg
dq
¢g RT
d ye
xXo7>
(Lh
jeds eds
SPiy Spy
edAyPIlAA SIV 10193/, pexo|y
peyobies
BunebieL U.S. Patent Jan. 27, 2015 Sheet 6 of 25 US 8,940,712 B2
ee
Bele
piesy
ie
jeyeuocay
Pie ed
g
“Did
Rot
mo.
RS
Umi ae U.S. Patent Jan. 27, 2015 Sheet 7 of 25 US 8,940,712 B2
Mi
KO
IR-208 ae)re 2 TENT aES ©
© 6
SECS = i im 7 FIG. re w a SS a a a cS om os = 2 S Den 2 @to] o Esres rr
aa ) rsa
erhS
ca PELE a U.S. Patent Jan. 27, 2015 Sheet 8 of 25 US 8,940,712 B2
Soe
o1uebsues}
itr SLUT
oy are
L CLUS
g0z-wiU UU
ULNSUID}eEy
es
ERE
lee
eRe IELt)
}
L-te
sueBsuel
Roy
E-tots
SRL (ere
|
EL
ete ctoye
uLinsulsje4
TT
Be
cct eae
LPL g: U.S. Patent Jan. 27, 2015 Sheet 9 of 25 US 8,940,712 B2
CSO
+
Om ORO
—
OHIN-g
+
LAA
=
:6-u9
OZ Foe - - _.9z -OL
08
OF OE Re
R
®
$ =
3 m §
SHIN-G
MO[S rere
+
Om
~————
8
OHM-d “DIZ
=-—
+
LM
DHIN-0
= 3SP}
Ro
IgvL
-
OOF 8 - -
OF
02
ad 09 eRe
uoissoidx3 OAnRjaY
Re
esiy are U.S. Patent Jan. 27, 2015 Sheet 10 of 25 US 8,940,712 B2
PELE
Ea
VOISSSIGXS
Mot
rae
6
“SLi
SHING
ERB
CO
Mea
Sonpul
icickoo
heb:
oO}
eg) U.S. Patent Jan. 27, 2015 Sheet 11 of 25 US 8,940,712 B2
O »
eyUdje erste
+}.
jo
LM
UOHBAIOe
— Maye
'
- - - - -
Nid
OOF
0081 OOSI 00eL 009
006 gs
S}USAdId
wmsipiosAyjodAL ithe uoissoidxa SANeIOY
pue
Ot
AyoesUEg ek
e}Oq
“SI sed
t
Jo
cera 3Yui+
UCISSeided
DISUIODILS
aS
PSs = te
ee)
Ayyyoes0D |e
SOASIOA
MOIS
f
yc
Sul Bes
Nd trast) U.S. Patent Jan. 27, 2015 Sheet 12 of 25 US 8,940,712 B2
TAPE
Rol
EStd
eb e=
Lt
°SId Bale
mer
ere
Mee
oNr
ii tote|
U.S. Patent Jan. 27, 2015 Sheet 13 of 25 US 8,940,712 B2
UStl ecar
eke
PLL 80Z-HIW
EET
eel
a
ENC
leh
merece
re
Bem
es
cio
ULC
Borer
PAPE
SOUuedy
ee”
3
J}2398/98HNS
ten
sjosny
10
SLE
| EEE
om
yi
t Br SS81IS BuyeuBbis
sjeubls
jeqUewdojeneg Mets
1YAoe LUE
LT U.S. Patent Jan. 27, 2015 Sheet 14 of 25 US 8,940,712 B2
UIMOID
DeIpAeD jesiBojoujed
€t
“BIE
Jo
jo.UOD WN U.S. Patent Jan. 27, 2015 Sheet 15 of 25 US 8,940,712 B2
SYIlU
pieoy
pe}2]nBel-umogq
s1ydosjiedAy
‘1uebsuesL
ulunausje9
Syl
3u}
aw,
payzjnBes-dp
papueg
Fre)
“SId
aIOBIOUL
CR
oJ0y
TIWLLELO)
Com
unneulsjeo
ad
Pe
Ay
av.
av
PIAA
tence
ULINSUIO[eD
Aq
Aq Aq
te
payeinboy payejnBoy peyeinBey
er
y
puL
| U.S. Patent Jan. 27, 2015 Sheet 16 of 25 US 8,940,712 B2
= 214 % ® miR Pe 2
c= 198a ro¥ microRNAs ° miR ad i ra 195
or miR
SS Downregulated =
® 125b = i] 14C miR
kon microRNAs
fe) FIG.
Y 24 = eg miR oy Upregulated c
RS) 23b 9 { miR Fa
a Z3a 2) 2 miR
=
21 miR a ses
U.S. Patent Jan. 27, 2015 Sheet 17 of 25 US 8,940,712 B2
rN COSC)
uoISSeJdxe
BL avi
vuD
rey]
adAj-plim
ureys
TON
GZ-yhU LzeeMOLELRTAY L el ZT 9°9 Z°0 $0 90 v0 0
r0 0 30 I
Pern
S
Bi
av eys
yuo
‘sa
yds “SA
weys
1M TLE
U.S. Patent Jan. 27, 2015 Sheet 18 of 25 US 8,940,712 B2
Theo
uonejnbesumop 0991
pjos Uwe to]
MOON NANA AAN AN
BPOET-HTu G2cr-A Becrp-atu peli TOL—a 069-e TS€-H £OT-watw LOT-atu SLO-M
667-HTwW 80¢-a ans
SYNuIW Tw tu Tw Tw tw TW
ooce
UMA ot 0 “2 I. a
paleinbaiumog
00g
NDS
UU
eds
2 SoU dg-pee-uta og-ro¢g-Y ¥906-UTU
agZ—-W ces-uTa
YL-38T FL-39T
86-U Bie
Tu
Fa FH yw TW
Ceya |
U.S. Patent Jan. 27, 2015 Sheet 19 of 25 US 8,940,712 B2
6c-Hu
goz-wil ToT
«OM eR
«eu uonenBeidn
OM
Weby ZL
f miro
pjog
ag-pLe-u de-eoe-utu de-czy-atu
Sin
qetz~-aFa qtot-ats
een sT6t-uta OPER ¥92T-U
'q6c-8 ie6z-aTa
‘2BG-uTw Ssag-uTa SST-yTU
“TO9-u ‘saT-aya
qgl-utm
etz-wtw BOT-3Tw Ost-uTu
SoL-UTe og9-aTa poz-eFu stz-ayu ObT~HTU TL9-eTM ez2-utu ZhE~szu 6£1-aTw Ost~aFu 629-8TD
Lt
5L-991
ar-aya tZ~-aTw BL=39T
Bo-8 Cr~39T a6-NTU T-3t0
“OT
yit-poyeinboldy
Ta TU 7a Fu Fw
|
Ad
Nps
Oem
sree
La
Loree |
U.S. Patent Jan. 27, 2015 Sheet 20 of 25 US 8,940,712 B2
_
(6. (61
(oz (gL
:ON (ON
:ON ‘ON
al
Gl
al al
DAS)
Das)
bas) bas)
NNonsvoONnyYYeNnNNnyoovo9VN
NNoNavanyyvaNnNNnYsovoaNN
YNNDDONYYYSNNNWOSvOOWN YNNSsaNvYYONONVIDvONWN
tals)
oi:]
|
[oem
clos
ict
mes
Mee
BL
“STs
em
g
y
1
¢
L
,
z
Bydye aude
Budje
Bye
Lm
Bude
Bude
Bude
‘aj
'}x
‘aj
1}
‘A
‘A
‘|
rade
adh)
adAy
adAy adA} edd} adAy
edAy
‘uabeyoo
‘uaBbeyjoo ‘uebeyoo ‘vebeljoa
'uaheyoo ‘uaieyoo
‘ueGeyoo
Lh
_
UNSE}O
UY U.S. Patent Jan. 27, 2015 Sheet 21 of 25 US 8,940,712 B2
AMTy
yds REPRE
~~ Pl
sua6beyjoo
ol
lex er
O™M iteN | 80c-yiw
6t
“SI
(el
Melt
)oh
LeRoi
eli
Ae UD U.S. Patent Jan. 27, 2015 Sheet 22 of 25 US 8,940,712 B2
A 3’ -UUGUGACUAAAGAAAGUUUACCACGAU-5' miR-29 (SEQ ID NO: 22) COL3Ai UGGUGCUA 8mer
FBN1 UGGUGCUA 8mer uGGuGCUU 7mer-TA UGGUGCUA 8mer ELN1 UGGUGCUA 8mer uGcuEecuUC 7mer-1A AGGUGCUA 7mer-m8s COL1A2 AGGUGCUA 7mer-m8 COL1A1 UGGUGCUA 8mer AGGUGCUA 7mer-m8
Bogota colt a2 colaAt FBN1 ELN1
; 1 o& 70 25 25 20 15 10 NoOaAaaA~ i
SoA WT border remote WT border remote WT border remote WT border remote WTborder remote _ zone zone zone zone zone
col3A1 FBN1
1.2 1.0 ose
0.8 = 0.6 0.4 0.2 9 . ——— miR —~——am miR miR ———a_/i miR miR-29 206 miR-29 206 miR-29 206 miR-29 206 miR-29 206 =
FIG, 20A-D
U.S. Patent Jan. 27, 2015 Sheet 23 of 25 US 8,940,712 B2
1.2
1.0;
0.8;
0.6;
0.4; 0.2:
TGFB: - + - + ~_ + miR-29a miR-29b miR-29c
B WT het KO miR-208
= miR-29
BNP expression
het KO = =
FIG. 21A-B U.S. Patent Jan. 27, 2015 Sheet 24 of 25 US 8,940,712 B2 TOSS TOABISSTATN- SST OUD SUSNSDF SUB Bym' g Tana NS YEOSNEON E sepia ceryumet . OSOOMU ~ Sur MOSSIBE 1 2 zs a * *
ay a aon 4 =. & £
, " snteets S$ WD RE WEISS oes [| ; WOMAN NON game boy
nm q Q-FZE Lyepog MONOW MEMIOKOSUSY fethime L
on 8
BIOS e
as ~ e POSUIEE ES prog ws BGG a aos ao eoe eee 4 t cbf HEN ‘OT R é Z¥LOD § - : W6] es = eigg'ed i FE” TREE
| GZ (6 & A le Wwhas i 4 2-aTNTIWe . -aTU : 4 te L cg 755 + sor. roMNEgEE =
yO eh zug os rag SHURA an er oor ase ‘a wee! oeeg
RR) aL
jeustu HTD a 8 “agen feo Pee
Z * . & Agger we eR ieee EE \
5 a q ¥ al d U.S. Patent Jan. 27, 2015 Sheet 25 of 25 US 8,940,712 B2
miR-29a
1.8 1.6 14
heart 1.2 to expression 0.8 0.6
0.4 compared Relative 0.2 lth heart — flung liver kidney spleen sk muscle intestine
miR-29b
1.6 L] mm 1.4 BB antimiR-29b 4.2 heart
to 0.8 expression 0.6 0.4 compared Relative 0.2 helt a jung liver kidney spleen sk muscle intestine
miR-29c
1.6 Cimm 1.4 Wf antimiR-29b
1.2
heart to 0.8
expression 0.6
0.4 compared Relative 0.2
heart lung liver kidney spleen sk muscle intestine
FIG. 23 US 8,940,712 B2 1 2 MICRO-RNA FAMILY THAT MODULATES inducesstiffness, diastolic dysfunction, and cardiomyocyte FIBROSIS AND USES THEREOF hypertrophy due to the increase in stress and can also lead to arrythmias. CROSS-REFERENCE TO RELATED Cardiac hypertrophyis an adaptive responseofthe heart to APPLICATIONS virtually all forms of cardiac disease, including those arising from hypertension, mechanical load, myocardial infarction, This application is a continuation of U.S. application Ser. cardiac arrhythmias, endocrine disorders, and genetic muta- No. 12/671,445, filed Jan. 29, 2010, whichis a national stage tions in cardiac contractile protein genes. While the hyper- trophic responseis initially a compensatory mechanism that application of International Application No. PCT/US2008/ 10 augments cardiac output, sustained hypertrophy can lead to 071839, filed Jul. 31, 2008, which claims the benefit of U.S. dilated cardiomyopathy (DCM), heart failure, and sudden Provisional Application No. 60/952,917,filed Jul. 31, 2007; death. In the United States, approximately half a million US. Provisional Application No. 60/980,303, filed Oct. 16, individuals are diagnosed with heart failure each year, with a 2007, and U.S. Provisional Application No. 61/047,014,filed mortality rate approaching 50%. The causes andeffects of Apr. 22, 2008, all of which are herein incorporated byrefer- 15 cardiac hypertrophy have been extensively documented, but encein their entireties. the underlying molecular mechanisms have not been eluci- dated. Understanding these mechanismsis a major concern in STATEMENT OF GOVERNMENT SUPPORT the prevention and treatment of cardiac disease and will be crucialas a therapeutic modality in designing new drugsthat This invention was made with grant support undergrantno. 20 specifically target cardiac hypertrophy andcardiac heart fail- HL53351-06 from the NationalInstitutes of Health. The gov- ure. ernmenthas certain rights in the invention. Treatment with pharmacological agents representsthepri- mary mechanism for reducing or eliminating the manifesta- DESCRIPTION OF THE TEXT FILE SUBMITTED tions of heart failure. Diuretics constitute the first line of ELECTRONICALLY 25 treatment for mild-to-moderate heart failure. If diuretics are ineffective, vasodilatory agents, such as angiotensin convert- The contents of the text file submitted electronically here- ing enzyme (ACE) inhibitors(e.g., enalopril and lisinopril) or with are incorporated herein by reference in their entirety: A inotropic agent therapy (i.e., a drug that improves cardiac computer readable format copy ofthe Sequence Listing(file- output by increasing the force ofmyocardial muscle contrac- name: MIRG_005__05US_SeqList_ST25 txt, date 30 tion) may be used. Unfortunately, many of these standard recorded: Mar. 15, 2013, file size 5 kilobytes). therapies have numerous adverse effects and are contraindi- cated in some patients. Thus, the currently used pharmaco- FIELD OF THE INVENTION logical agents have severe shortcomingsin particular patient populations. The availability ofnew,safe and effective agents The present invention relates generally to the fields of 35 would undoubtedly benefit patients who either cannot use the developmental biology and molecular biology. More particu- pharmacological modalities presently available, or who do larly, it concerns gene regulation and cellular physiology in not receive adequate relief from those modalities. fibroblasts by the miR-29 family. This miRNA family plays Cardiac myocytes are normally surroundedbya fine net- an important role in collagen deposition, particularly col- work of collagen fibers. In response to pathological stress, 40 cardiac fibroblasts and extracellular matrix proteins accumu- lagen deposition mediated by fibroblasts. late disproportionately and excessively. Myocardialfibrosis, a characteristic of all forms of pathological hypertrophy, BACKGROUND OF THE INVENTION leads to mechanicalstiffness, which contributes to contractile dysfunction (Abraham et al., 2002). Another hallmark of Heart disease and its manifestations, including coronary 45 pathological hypertrophy andheart failure is the re-activation artery disease, myocardial infarction, congestive heart failure of a set of fetal cardiac genes, including those encodingatrial and cardiac hypertrophy, clearly presents a major health risk natriuretic peptide (ANP), B-type natriuretic peptide (BNP) in the United States today. The cost to diagnose, treat and and fetal isoforms of contractile proteins, such as skeletal support patients suffering from these diseases is well into the a-actin and B-myosin heavy chain (MHC). These genes are billions of dollars. Two particularly severe manifestations of 50 typically repressed post-natally and replaced by the expres- heart disease are myocardial infarction and cardiac hypertro- sion of a set of adult cardiac genes (McKinsey and Olson, phy. With respect to myocardial infarction, typically an acute 2005). The consequencesof fetal gene expression on cardiac thrombocytic coronary occlusion occurs in a coronary artery function and remodeling (e.g., fibrosis) are not completely as a result of atherosclerosis and causes myocardial cell understood. However, the up-regulation of B-MHC, a slow death. Because cardiomyocytes, the heart muscle cells, are 55 ATPase, and down-regulation of a-MHC,a fast contracting terminally differentiated and generally incapableof cell divi- ATPase, in response to stress has been implicated in the sion, they are generally replaced by scar tissue when they die diminution of cardiac function (Bartel, 2004) and BNP is during the course of an acute myocardial infarction. Scar known to play a dominantrole in cardiacfibrosis. tissue is not contractile, fails to contribute to cardiac function, In addition to cardiac fibrosis, there are a numberofdisor- and often plays a detrimentalrole in heart function by expand- 60 ders or conditions that are associated with fibrosis of various ing during cardiac contraction, or by increasing the size and tissues. Congenital hepatic fibrosis, an autosomal recessive effective radius of the ventricle, for example, becoming disease, is a rare genetic disease that affects both the liver and hypertrophic. Althoughinitial collagen depositionis required kidneys. The disease is characterized by liver abnormalities, for infarct healing and to prevent cardiac rupture, the continu- such as hepatomegaly, portal hypertension, and fiber-like ous production of collagen by fibroblasts induces interstitial 65 connective tissue that spreads over and through the liver (he- fibrosis surrounding the myocytes in the infarct borderzone patic fibrosis). Pulmonary fibrosis, or scarring of the lung, and remote myocardium ofthe infracted heart. This fibrosis results from the gradual replacement of normallungair sacs US 8,940,712 B2 3 4 with fibrotic tissue. When the scar forms, the tissue becomes tion of the target sequence, forms the basis for many current thicker, causing an irreversible loss of the tissue’s ability to target prediction models. Although increasingly sophisti- transfer oxygen into the bloodstream. The mostcurrent think- cated computational approachesto predict miRNAsandtheir ing is that the fibrotic process in pulmonary tissue is a reaction targets are becoming available, target prediction remains a (predisposed by genetics) to microscopic injury to the lung. major challenge and requires experimental validation. While the exact cause remains unknown, associations have Ascribing the functions of miRNAsto the regulation of spe- been made with inhaled environmental and occupationalpol- cific mRNAtargets is further complicated by the ability of lutants, cigarette smoking, diseases such as scleroderma, individual miRNAsto base pair with hundreds of potential rheumatoid arthritis, lupus and sarcoidosis, certain medica- high and low affinity mRNA targets and by the targeting of tions and therapeutic radiation. 10 multiple miRNAs to individual mRNAs. Enhanced under- Scleroderma is a chronic disease characterized by exces- standing ofthe functions ofmiRNAswill undoubtedly reveal sive deposits of collagen in the skin or other organs. The regulatory networks that contribute to normal development, localized type of the disease, while disabling, tends not to be differentiation, inter- and intra-cellular communication,cell fatal. The systemic type or systemic sclerosis, which is the cycle, angiogenesis, apoptosis, and manyother cellular pro- generalized type of the disease, can be fatal as a result ofheart, cesses. Recently, the inventors reported a cardiac-specific kidney, lung or intestinal damage. Scleroderma affects the microRNA, miR-208, which is encoded by an intron of the skin, and in moreserious cases it can affect the blood vessels a-myosin heavy chain (MHC) gene, andis required for up- and internal organs. regulation of B-MHCexpression in responseto cardiac stress Skeletal muscle fibrosis is a phenomenon which frequently and for repression of fast skeletal muscle genes in the heart occurs in diseased or damaged muscle. It is characterized by (see co-pending application WO2008/016924, which is the excessive growth of fibrous tissue which usually results herein incorporated by reference in its entirety). The present from the body’s attempt to recover from injury. Fibrosis invention expands on the involvement of microRNAsin the impairs muscle function and causes weakness. The extent of heart as well as othertissues. loss ofmuscle function generally increases with the extent of fibrosis. Victims ofmuscular dystrophies, particularly Becker SUMMARY OF THE INVENTION muscular dystrophy (BMD)and the more severely penetrat- ing allelic manifestation, Duchenne muscular dystrophy The present invention is based on the discovery that the (DMD), frequently suffer from increasing skeletal muscle miR-29 family, which is down-regulated in the heart in fibrosis as the disease progresses. Other afflictions such as response to stress, regulates collagen deposition and the denervation atrophy are known to produce skeletal muscle developmentoffibroses, including cardiac fibrosis. Up-regu- fibrosis, as well as neuromuscular diseases, such as acute lation of miR-29a-c expression or function results in the polyneuritis, poliomyelitis, Werdig/Hoffman disease, amyo- decrease of expression ofcollagen andfibrin genes leading to trophiclateral sclerosis (Lou Gehrig’s Disease), and progres- reduced cardiac fibrosis. Accordingly, the present invention sive bulbar atrophy disease. provides a methodoftreating cardiacfibrosis, cardiac hyper- MicroRNAshave recently been implicated in a numberof 35 trophy, or heart failure in a subject in need thereofcomprising biological processes including regulation of developmental identifying a subject having cardiac fibrosis, cardiac hyper- timing, apoptosis, fat metabolism, and hematopoietic cell trophyor heart failure; and administering to said subject an differentiation among others. MicroRNAs (miRs) are small, agonist ofmiR-29a-c expression or function. In one embodi- non-protein coding RNAsof about18 to about 25 nucleotides ment, the agonist of miR-29a-c is a polynucleotide compris- in length thatare derived from individual miRNA genes, from 40 ing the mature sequence of miR-29a, miR-29b, miR-29c, or introns of protein coding genes, or from poly-cistronic tran- combinations thereof. The agonist of miR-29a-c may be scripts that often encode multiple, closely related miRNAs. administered by parenteral administration (e.g. intravenous See review of Carringtonet al. (2003). MiRsact as repressors or subcutaneous), oral, transdermal, sustained release, con- of target mRNAsby promoting their degradation, when their trolled release, delayed release, suppository, catheter or sub- sequences are perfectly complementary, or by inhibiting 45 lingual administration. In another embodiment, the method translation, when their sequences contain mismatches. further comprises administering to the subject a second miRNAsare transcribed by RNA polymeraseII (pol II) or therapy. The second therapy is selected from the group con- RNA polymeraseIII (pol IIT; see Qi et al. (2006) Cellular & sisting of a beta blocker, an ionotrope, a diuretic, ACE-I, AII Molecular Immunology Vol. 3:411-419) andarise from initial antagonist, BNP, a Ca**-blocker, an endothelin receptor transcripts, termed primary miRNA transcripts (pri-miR- 50 antagonist, and an HDAC inhibitor. NAs), that are generally several thousand bases long. Pri- The present invention also provides a methodofpreventing miRNAsare processed in the nucleus by the RNase Drosha pathologic hypertrophy or heart failure in a subject in need into about 70- to about 100-nucleotide hairpin-shaped pre- thereof comprising identifying a subjectat risk ofdeveloping cursors (pre-miRNAs). Following transport to the cytoplasm, pathologic cardiac hypertrophyorheart failure; and promot- the hairpin pre-miRNAis further processed by Dicer to pro- ing the expression or activity ofmiR-29a-cin cardiac cells of duce a double-stranded miRNA. The mature miRNAstrand is said subject. In one embodiment, the promoting expression or then incorporated into the RNA-induced silencing complex activity of miR-29a-c comprises delivering to the cardiac (RISC), where it associates with its target mRNAs by base- cells an agonist of miR-29a-c or an expression vector encod- pair complementarity. In the relatively rare cases in which a ing miR-29a-c. In another embodiment, the subject at risk miRNA base pairs perfectly with an mRNAtarget, it pro- exhibits one or more risk factors selected from the group motes mRNA degradation. More commonly, miRNAs form consisting of long standing uncontrolled hypertension, imperfect heteroduplexes with target mRNAs, affecting uncorrected valvular disease, chronic angina, recent myocar- either mRNAstability or inhibiting mRNAtranslation. dial infarction, congenital predisposition to heart disease, and The 5' portion of a miRNAspanning bases 2-8, termed the pathological hypertrophy. In another embodiment, the sub- ‘seed’ region, is especially important for target recognition ject at risk has been diagnosed as having a genetic predispo- (Krenz and Robbins, 2004; Kiriazis and Krania, 2000). The sition to cardiac hypertrophy.In still another embodiment,the sequence of the seed, together with phylogenetic conserva- subject at risk has a familial history of cardiac hypertrophy. US 8,940,712 B2 5 6 The present invention also encompassesa transgenic, non- tissue to a second treatment, such as a chemical peel, laser human mammal, the cells ofwhichfail to express a functional treatment, dermaplaning, or dermabrasion. In another miR-29a, miR29b, and/or miR29c. In another embodiment, embodiment, the tissue is in a subject that suffers from the invention provides a transgenic, non-human mammal, the Ehler’s-Danlos syndrome or Vitamin C deficiency. cells ofwhich comprise a miR-29a-c coding region under the control of a heterologous promoter active in the cells of said BRIEF DESCRIPTION OF THE DRAWINGS non-human mammal. The transgenic mammal may be a mouse. The invention maybe better understood by reference to one In one embodiment, the present invention provides a or more of these drawings in combination with the detailed methodoftreating myocardial infarction in a subject in need description of specific embodiments presented herein. thereof comprising promoting expressionor activity ofmiR- FIGS. 1A-B. miR-208 is encoded by the a-MHC gene and 29a-c in cardiac cells of said subject. In another embodiment, is expressed specifically in the heart. (FIG. 1A) miR-208 is the present invention provides a methodofpreventing cardiac encoded within an intron of the a-MHCgene.Asterisks indi- hypertrophy anddilated cardiomyopathy in a subject in need cate sequence conservation (SEQ ID NOS:1-5). (FIG. 1B) thereof comprising promoting expressionor activity ofmiR- Detection of miR-208 transcripts by Northern analysis of 29a-c in cardiac cells of said subject. In another embodiment, adult mousetissues. U6 mRNAservesas a loading control. the present invention provides a method of inhibiting progres- FIGS. 2A-B. Regulation of a- and B-MHC. (FIG. 2A) sion of cardiac hypertrophyin a subject in need thereof com- Regulation of class switch by thyroid hormone and TRE. prising promoting expression or activity of miR-29a-c in (FIG. 2B) Modelfor stress/hypothyroidism in fast-to-slow cardiac cells of said subject. 20 muscle fiber contactility switch. The present invention also contemplates a methodoftreat- FIG. 3. Detection of miR-208 in humanheart. Transcripts ing or preventing a tissue fibrosis in a subject comprising for a-MHC and miR-208 were detected by Northern blot of identifying a subject having orat risk of tissue fibrosis; and cardiac tissue from six normalindividuals andsix individuals increasing the expression and/or activity of miR-29a-c in with idiopathic cardiomyopathy. A close correlation exists skeletal muscle or fibroblast cells of the subject. The tissue betweenthe level ofexpression of a-MHCand pre-miR-208, fibrosis may be cardiacfibrosis, scleroderma, skeletal muscle whereas mature miR-208 expression is maintained after the fibrosis, hepatic fibrosis, kidney fibrosis, pulmonary fibrosis, latter has been down-regulated. or diabetic fibrosis. In some embodiments, increasing the FIGS. 4A-B. Generation of miR-208 mutant mice. (FIG. expression and/or activity of miR-29a-c comprises adminis- 4A) Strategy to generate miR-208 mutant mice by homolo- tering an agonist of miR-29a-c to the subject. An agonist of gous recombination. The pre-miRNA sequence (located miR-29a-c may be a polynucleotide comprising the sequence within intron 29 of the mouse a-MHC gene in most tran- of a mature miR-29a, miR-29b, and/or miR-29c sequence. scripts) was replaced with a neomycin resistance cassette The agonist of miR-29a-c mayalso be an expression vector flanked by loxP sites. The neomycin cassette was removedin encoding miR-29a, miR-29b, and/or miR-29c. In one the mouse germline by breeding heterozygous miceto trans- embodiment, the method further comprises administering a genic mice harboring the CAG-Cre transgene. (FIG. 4B) non-miR-29a-c anti-fibrotic therapy to the subject. Detection of miR-208 transcripts by Northern analysis of Thepresent invention also provides a methodfor identify- hearts from wild-type and miR-208 mutant mice. ing a modulator of miR-29a-c comprising contacting a cell FIG. 5. Western analysis of a-MHC and B-MHCprotein with a candidate compound; assessing miR-29a-c activity or levels in hearts of neonatal mice of the indicated genotypes. expression; and comparingthe activity or expression in step 40 Two mice of each genotype were analyzed. GAPDH was (b) with the activity or expression of miR-29a-c in the detected as a loading control. absence of the candidate compound, wherein a difference FIG. 6. MiR-208~’~ mice show reduced cardiac hypertro- between the measuredactivities or expression of miR-29a-c phyin responseto pressure overload. Histological sections of indicates that the candidate compoundis a modulator ofmiR- hearts of wild-type and miR-208-”- mice stained for Masson 29. The cell may be contacted with the candidate compound 45 trichrome. The absence of miR-208 diminishes hypertrophy in vitro or in vivo. Suitable candidate compounds include and fibrosis seen in wild-type mice subjected to thoracic proteins, peptides, polypeptides, polynucleotides, oligo- aortic banding (TAB) for 21 days. Scale bar equals 2 mm in nucleotides or small molecules. top panel and 20 um for bottom panel. The present invention also encompasses a pharmaceutical FIG. 7. MiR-208~~ mice show reduced cardiac hypertro- composition comprising an agonist or antagonist ofmiR-29a- phy in response to calcineurin activation. Histological sec- c. In some embodiments, the pharmaceutical composition tions of hearts of 6 week-old mice expressing a calcineurin may be formulated for injection or topical administration. transgene (CnA-Tg) and hearts of miR-208--; CnA-Tg The formulation for topical administration may be a gel, stained for Masson trichrome. Absence of miR-208 dimin- cream, lotion, or ointment. ishes hypertrophy and fibrosis seen in CnA-Tg mice. Scale The present invention provides a methodof inducing col- bar=2 mm for top panel, 20 um for bottom panel. lagen deposition in a tissue comprising contacting said tissue FIG. 8. Mir-208-’- mice fail to up-regulate B-MHC in with an antagonist of miR-29a-c. The antagonist may be an response to TAB and calcineurin activation. antagonist ofmiR-29a, miR-29b, or miR-29c. The antagonist FIG. 9. Western analysis of a and B-MHCprotein levels in may be an antagomir of miR-29a-c, an antisense oligonucle- adult wild-type and miR-208 transgenic animals. GAPDH otide that targets a mature miR-29a-c sequence, or an inhibi- wasdetected as a loading control. tory RNA molecule, such as a siRNA or shRNA, that com- FIG. 10. miR-208-" mice fail to up-regulate B-MHC in prises a sequenceidentical to a mature miR-29a-c sequence, response to hypothyroidism with PTU treatment. or a ribozyme or another inhibitory nucleic acid. In one FIG. 11. Schematic diagram of the role of miR-208 in the embodiment, the method further comprises contacting said control of B-MHCexpression. tissue with a second agent. The second agent maybe topical FIG. 12. Schematic diagram of the role of miR-208 in the vitamin A, topical vitamin C, or vitamin E. In another regulation of B-MHCand fast skeletal muscle gene expres- embodiment, the method further comprises subjecting said sion via Thrap1. US 8,940,712 B2 7 8 FIG. 13. Mechanismsofaction of microRNAsduring car- FIGS. 22A-G. miR-29a-c inhibition induces fibrosis in diac hypertrophy. vivo. (FIG. 22A) Chemical structure of anti-miR-29a-c and FIGS. 14A-C. mRNAexpression during cardiac hypertro- mismatch (mm) miR-29a-c. (FIG. 22B) Northern blot analy- phy and remodeling. (FIG. 14A) H&E stained sections of sis showing tissue specific knockdown after 3 days in representative hearts from mice following sham and TAB for 5 response to intravenous injection of 80 mg/kg of either anti- 21 days and from CnA Tg mice. Scale bar equals 2 mm.(FIG. miR-29a-c or mm miR-29a-c or a comparable volume of 14B) Venn diagrams showing numbers of microRNAsthat saline. (FIG. 22C) Real-time PCR analysis of liver extracts changed in expression in each type of heart are shown below. indicate a pronounced increase in collagen expression in (FIG. 14C) Northern blots of microRNAs that change in response to miR-29a-c knockdown, while this effect was expression during hypertrophy. U6 RNA wasdetected as a 10 absent after saline or mm injection. (FIG. 22D) Tissue col- loading control. lection, three weeks after intravenousinjection with 80 mg/kg FIG. 15. miR-29a-c expression is down-regulated in on two consecutive days of either anti-miR-29a-c or mm responseto cardiac stress. Hearts from wild-type mice (WT) and mice with hypertrophy and fibrosis induced by a cal- miR-29a-c oligonucleotide or a comparable volumeofsaline, indicates a severe knockdown ofmiR-29a-cin heart, liver and cineurin transgene (CnA) or TAB are shown ontheleft. The 15 relative level ofexpression ofmiR-29a-c in each type of heart kidney, while miR-29a-c levels in lungs appear unaffected. is shown ontheright. (FIG. 22E) Real-time PCR analysis of heart extracts indicate FIG. 16. Microarray analysis of hearts from miR-208 a increase in cardiac collagen expression in response to miR- knockout mice compared to wild-type. Microarray analysis 29a-c knockdown. (FIG. 22F) Real-time PCR analysis indi- was performed on mRNAisolated from wild-type and miR- 20 cating an increase in miR-29b expression in fibroblasts two 208-null hearts at 6 weeks of age. The most down-regulated days after miR-29b mimic treatment, while miR-29a levels miRNA,next to miR-208, is miR-499. were unchanged and miR-29clevels only slightly increased. FIG. 17. miR-29 family is dramatically up-regulated in (FIG. 22G) miR-29b overexpression in fibroblasts represses miR-208-null hearts. the expression of collagen genes as determined by real-time FIG. 18. miR-29 family targets mRNAs encoding col- 25 PCRanalysis. lagens and other components of the extracellular matrix FIG. 23. Expression ofmiR-29 family membersin various involvedin fibrosis. Based on their high sequence homology, tissues in response to miR-29b knockdown. Knockdown of the miR 29 family consists of 4 members; miR-29a, all miR-29 members in the different tissues indicates that miR29b-1 and -2 and miR-29c. The sequences of the mature miR-29b shows a 50% reduction in the heart in response to miRNAs are shown (SEQ ID NOS:18-20). The mature 30 anti-miR-29b, while miR-29a and -c only show marginal sequences of miR-29b-1 and miR-29b-2 are identical. changes. However, the knockdown of miR-29b in liver and Togetherthis family is directed against many components of kidney in responseto anti-miR-29b is almost complete, while the extracellular matrix involvedin fibrosis. miR-29a and-c also appear to be reduced in these tissues in FIG. 19. Model for the control of cardiac fibrosis by miR- response to anti-miR-29b. 208 and miR-29 family. In the normalheart, miR-208 inhibits 35 the expression of miR-29a-c. In the absence of miR-208, DETAILED DESCRIPTION OF ILLUSTRATIVE miR-29a-c expression is up-regulated, preventing the expres- EMBODIMENTS sion of extracellular matrix andfibrosis in responseto stress. The functions of miR-208, miR-499 and miR-29 are inter- Cardiac and skeletal muscles respondto a variety ofpatho- linked. Loss of miR-208 can be cardioprotective by prevent- 40 physiological stimuli such as workload, thyroid hormonesig- ing expression of miR-499 and up-regulating expression of naling and injury by modulating the expression of myosin miR-29a-c, with consequent blockade tofibrosis. isoforms, which regulate the efficiency of contraction. FIGS. 20A-D. miR-29a-c regulates the expressionofextra- Recently, the inventors reported a_ cardiac-specific cellular matrix proteins. (FIG. 20A) Potential binding sites microRNA, miR-208, which is encoded by an intron of the for miR-29a-c in 3' UTRregionsof key fibrotic genes. (FIG. 45 a-myosin heavy chain (MHC) gene, andis required for up- 20B) Real-time PCR analysis of predicted target genes in regulation of B-MHCexpression in responseto cardiac stress both the borderzone and remote myocardium 3 days after MI, and for repression of fast skeletal muscle genes in the heart showsa decrease in miR-29a-c to correlate to an increase in (see co-pending application WO2008/016924, which is collagens (COLIA1, COL1A2 and COL3A1) andfibrillin herein incorporated by referencein its entirety). (FBN1), while there was no significant change in elastin 50 Here, the inventors extend their earlier work and show that (ELN1). (FIG. 20C) Northern blot analysis on COScells miR-208 also down-regulates a family of related miRNAs, transfected with increasing amounts of the CMV expression miR-29a-c. Because miR-29a-c are expressed ubiquitously, plasmid encoding the miR-29b-1/miR-29a cluster, shows and are involved in regulation of collagen deposition, strate- efficient overexpression of miR-29a-b. The top band corre- gies to upregulate miR-29a-c expression have applications in sponds to the pre-miRNA,while the lower band corresponds 55 the prevention of a variety oftissue fibroses including cardiac to the mature miRNA. (FIG. 20D) Luciferase experiments fibrosis, as well as skeletal muscle,liver, pulmonary, diabetic using the endogenous UTR sequencesofthe predicted target and kidneyfibrosis. Regulation ofmiR-29a-c in cardiaccells, genes, showing miR-29a-cto repress expression of luciferase such as cardiac fibroblasts, can be used to treat or prevent in response to increasing amounts of miR-29a-c while this cardiac hypertrophy or heart failure in a subject. Thus, one decrease was absent when using an unrelated miR, miR-206. 60 aspectofthe invention is agonism ofmiR-29a-c expression or FIGS. 21A-B. miR-29a-c expression responsive to TGFB. activity, optionally in conjunction with inhibiting miR-208. (FIG. 21A) Real-time PCR analysis indicates that all three Agonism may involve introducing exogenous miR-29a-c into miR-29 family members are downregulated in fibroblasts in the heart or other tissues of interest, either directly using response to TGFB. (FIG. 21B) Northern analysis showing naked nucleic acid or a delivery vehicle such as a lipid/ miR-29a-c expression is upregulated in miR-208 mutant ani- 65 liposome/nanoparticle, or through gene expression, for mals which coincides with an increase in BNP expression as example by using adenoviral vectors or other means of determined by real-time PCR. ectopic expression to reduce fibrosis. Activation of the anti- US 8,940,712 B2 9 10 fibrotic function of miR-29a-c through pharmaceutical within the 28” intron of the a-MHCgene,while in mice,it is “small molecules” also is contemplated, as are screens to encoded within the 29” intron. The pre-miRNA encoding identify such compounds. sequences for miR-208 for human, mouse,rat, and canine are The increase in collagen that ensues following repression provided in SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, ofmiR-29a-c expression, for example, following myocardial SEQ ID NO:17, respectively. The mature miR-208 sequence infarction (MI) and other forms of stress, may indicate is provided in SEQ ID NO:5. Like a-MHC, miR-208 is another role for miR-29a-c. One focus of the inventors’ work expressed solely in the heart. (FIG. 1). is cardiac fibrosis, and an examination of a subset of key regulatory genes, namely collagen I, ITI, elastin andfibrillin, Human pre-miR-208 showeda striking increase in both collagens andfibrillin in (SEQ ID NO: 14) response to miR-29a-c downregulation, while there was no aegggegage ttttggcecg ggttatacct gatgctcacg increase in elastin. As such, therapeutically repressing miR- tataagacga gcaaaaagct tgttggtcag a 29a-c to increase collagen deposition presents a unique option for addressing conditions characterized by loss of Mouse pre-miR-208 15 collagen, such as in cosmetic applications and scarring. (SEQ ID NO: 15) MicroRNA 29 (miR-29) is a family of microRNAsthat acegggtgage ttttggcecg ggttatacct gactctcacg consists of 4 known members, miR-29a, b1 and 2 (identical) tataagacga gcaaaaagct tgttggtcag a and c. While miR29b-1 and 29a stem from the sametranscript originating from chromosome 7 in humans and chromosome Rat pre-miR-208 6 in mice, the miRNA cluster containing miR29b-2 and (SEQ ID NO: 16) acegggtgage ttttggcecg ggttatacct gactctcacg miR29¢cis transcribed from chromosome 1 in both species. The mature miRNA sequencesfor each of the human miR-29 tataagacga gcaaaaagct tgttggtcag a family membersislisted below: Canine pre-miR-208 25 (SEQ ID NO: 17) acgeatgage ttttggctcg ggttatacct gatgctcacg hsa-miR-29a (SEQ ID NO: 18) tataagacga gcaaaaagct tgttggtcag a uagcaccaucugaaaucgguua Using the PicTar algorithm for the identification ofmiRNA hsa-miR-29b-1 and b-2 30 targets (Krek et al., 2005), the inventors identified thyroid (SEQ ID NO: 19) uagcaccauuugaaaucaguguu hormonereceptor associated protein 1 (THRAP1) as a pre- dicted target for miR-208. THRAP1 3' UTR sequences from hsa-miR-29¢ human, chimp, mouse, rat, canine, chicken, fugu, and (SEQ ID NO: 20) zebrafish are provided in SEQ ID NO:6, SEQ ID NO:7, SEQ uagcaccauuugaaaucgguua 35 ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, These microRNAsform a family based on their sequence SEQ ID NO:12, and SEQ ID NO:13, respectively. homology (Yuet al; 2006). Since there are only minordiffer- ences between the family members, and the members have a 100% conserved seed region (which helps to define target Human THRAP1 3'UTR (SEQ ID NO: 6) determination), they are very likely to target the same mRNA 40 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg targets (FIG. 18), and lower gene expressionofthese specific target genes. Target determination for the miR-29 family ucuuaauuaa aaaguugcag uaggguuge revealed that the miR-29 family showsa high preference for targeting genes involved in collagen formation as well as Chimp THRAP1 3'UTR (SEQ ID NO: 7) other extracellular matrix proteins, such as elastin (ELN), 45 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg fibrillin 1 (FBN1), collagen type I, al and a2 (COLIAI, COL1A2) collagen type III, a1 (COL3A1), metallopepti- ucuuaauuaa aacguugcag uaggguuge dases, and integrins. In response to pathological stress, car- Mouse THRAP1 3'UTR diac fibroblasts and extracellular matrix proteins accumulate (SEQ ID NO: 8) disproportionately and excessively. Myocardial fibrosis, a 50 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg characteristic of all forms of pathological hypertrophy, leads to mechanical stiffness, which contributes to contractile dys- ucuuaauuaa aacguugcag uaggguuge function (Berk et al., 2007). Since the miR-29 family is down- Rat THRAP1 3'UTR regulated during this remodeling process, this family is likely (SEQ ID NO: 9) to play an active role in the modulation of collagen deposi- uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg tion, and thereby regulate cardiac fibrosis and cardiac con- ucuuaauuaa aacguugcag uaggguuge tractility, which secondarily can induce hypertrophy and pathological remodeling. Canine THRAP1 3'UTR As discussed previously, miR-208 appears to regulate (SEQ ID NO: 10) miR-29 expression as miR-29is significantly up-regulated in uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg the hearts of mice lacking both copies of miR-208 (see ucuuaauuaa aacguugcag uaggguuge Example 1). Thus, modulation of miR-208 can affect the expression of miR-29 as well as the expression of miR-29 Chicken THRAP1 3'UTR target genes. MiR-208 is an intronic miRNAthatis located (SEQ ID NO: 11) uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg within an intron of the a-MHC gene. The precise intron location is dependent on the particular species and specific ucuuaauuaa aacguugcag uaggguuge transcript. For example, in humans, miR-208 is encoded US 8,940,712 B2 11 12 -continued polynucleotide encoding miR-29a-c may encode the pri- mary-microRNA-29a-c sequence (pri-miR-29a-c), the pre- Fugu THRAP1 3'UTR cursor-microRNA-29a-c sequence (pre-miR-229a-c) or the (SEQ ID No: 12) uuccugcuuu aagcaauugg uugaaaauau auguauguaa mature miR-29a-c sequence. In another embodiment, the expression vector comprises a polynucleotide operably uggucuuaau Uuaaaaaaaca aacuaagaca aa linked to a promoter, wherein said polynucleotide comprises
Zebrafish THRAP1 3'UTR the sequence of SEQ ID NO:18. In another embodiment, the (SEQ ID No: 13) expression vector comprises a polynucleotide operably uuccugcuuu aaagcaauug gucuaaaaua uauguaaucg linked to a promoter, wherein said polynucleotide comprises 10 the sequence of SEQ ID NO:19. In still another embodiment, ucuucauuac aaaaacgaac caucaaacg the expression vector comprises a polynucleotide operably The present invention provides a method oftreating car- linked to a promoter, wherein said polynucleotide comprises diac fibrosis, cardiac hypertrophy orheart failure in a subject the sequence of SEQ ID NO:20. The polynucleotide com- in need thereof comprising identifying a subject having car- prising the sequence of SEQ ID NO: 18, SEQ ID NO:19, or 15 diac fibrosis, cardiac hypertrophyor heart failure; and admin- SEQ ID NO:20 maybe about 18 to about 2000 nucleotides in istering to the subject an agonist of miR-29 expression or length, about 70 to about 200 nucleotides in length, about 20 function. The miR-29 agonist may be an agonist ofmiR-29a, to about 50 nucleotides in length, or about 18 to about 25 miR-29b and/or miR-29c. nucleotides in length. In one embodiment, agonists of miR-29a-c may be poly- 20 Throughout this application, the term “expression con- nucleotides comprising the mature miR-29a-c sequence. In struct” is meant to include any type of genetic construct some embodiments, the polynucleotide comprises the containing a nucleic acid coding for a gene product in which sequence of SEQ ID NO: 18, SEQ ID NO:19, or SEQID NO: part or all of the nucleic acid encoding sequenceis capable of 20. In another embodiment, the agonist ofmiR-29a-c may be being transcribed. Generally, the nucleic acid encoding a a polynucleotide comprising the pri-miRNA or pre-miRNA 25 gene productis undertranscriptional control of a promoter. A sequence for miR-29a, miR-29b, and/or miR-29c. The poly- “promoter” refers to a DNA sequence recognized by the nucleotide comprising the mature miR-29a-c, pre-miR-29a- synthetic machinery of the cell, or introduced synthetic c, or pri-miR-29a-c sequence may be single stranded or machinery, required to initiate the specific transcription of a double stranded. The polynucleotides may contain one or gene. more chemical modifications, such as locked nucleic acids, 30 The term promoterwill be usedhere to refer to a group of peptide nucleic acids, sugar modifications, such as 2'-O-alkyl transcriptional control modules that are clustered around the (e.g. 2'-B-methyl, 2'-O-methoxyethyl), 2'-fluoro, and 4' thio initiation site for a RNA polymerase. Muchof the thinking modifications, and backbone modifications, such as one or about how promoters are organized derives from analyses of more phosphorothioate, morpholino, or phosphonocarboxy- several viral promoters, including those for the HSV thymi- late linkages. In one embodiment, the polynucleotide com- 35 dine kinase (tk) and SV40early transcription units. These prising a miR-29a-c sequenceis conjugated to cholesterol. In studies, augmented by more recent work, have shown that another embodiment, the agonist of miR-29a-c may be an promoters are composedofdiscrete functional modules, each agent distinct from miR-29a-c that acts to increase, supple- consisting of approximately 7-20 bp of DNA,and containing ment, or replace the function of miR-29a-c. one or more recognition sites for transcriptional activator or In another embodiment, the agonist of miR-29a-c may be 40 repressorproteins. expressed in vivo from a vector. A “vector” is a composition Atleast one module in each promoter functionsto position of matter which can be used to deliver a nucleic acid of the start site for RNA synthesis. The best known example of interest to the interior ofa cell. Numerous vectors are known this is the TATA box,but in some promoters lacking a TATA in the art including,but notlimitedto,linear polynucleotides, box, such as the promoter for the mammalian terminal deoxy- polynucleotides associated with ionic or amphiphilic com- 45 nucleotidyl transferase gene and the promoter for the SV40 pounds, plasmids, and viruses. Thus, the term “vector” late genes, a discrete element overlying the start site itself includes an autonomously replicating plasmid or a virus. helpsto fix the place of initiation. Examples of viral vectors include, but are not limited to, Additional promoter elements regulate the frequency of adenoviral vectors, adeno-associated virus vectors, retroviral transcriptional initiation. Typically, these are located in the vectors, and the like. An expression construct can be repli- 50 region 30-110 bp upstream ofthestart site, although a number cated in a living cell, or it can be made synthetically. For ofpromoters have recently been shownto contain functional purposes of this application, the terms “expression con- elements downstream of the start site as well. The spacing struct,” “expression vector,’ and “vector,” are used inter- between promoter elements frequently is flexible, so that changeably to demonstrate the application of the invention in promoterfunction is preserved when elements are inverted or a general, illustrative sense, and are not intendedto limit the 55 movedrelative to one another. In the tk promoter,the spacing invention. between promoter elements can be increased to 50 bp apart In one embodiment, an expression vector for expressing before activity begins to decline. Depending on the promoter, miR-29a-c comprises a promoter “operably linked”to a poly- it appears that individual elements can function either co- nucleotide encoding miR-29a, miR-29b, miR-29c, or combi- operatively or independently to activate transcription. nations thereof. In another embodiment, the polynucleotide 60 In other embodiments, the human cytomegalovirus (CMV) may encode the miR-29b-1/miR-29a cluster. In another immediate early gene promoter, the SV40 early promoter, the embodiment, the polynucleotide may encode the miR-29b-2/ Rous sarcomavirus long terminal repeat, rat insulin pro- miR-29c cluster. The phrase “operably linked” or “under moter, RNA pol II promoter, and glyceraldehyde-3-phos- transcriptional control” as used herein meansthat the pro- phate dehydrogenase promoter can be used to obtain high- moteris in the correct location andorientation in relation to a 65 level expression of the polynucleotide of interest. The use of polynucleotide to control the initiation of transcription by other viral or mammalian cellular or bacterial phage promot- RNA polymerase and expression of the polynucleotide. The ers which are well-knownin the art to achieve expression of US 8,940,712 B2 13 14 a polynucleotide of interest is contemplated as well, provided stimulate transcription at a distance; this need notbe true ofa that the levels ofexpression are sufficient for a given purpose. promoter region or its component elements. On the other By employing a promoter with well-knownproperties, the hand, a promoter must have one or more elements that direct level and pattern ofexpression of the polynucleotideof inter- initiation of RNA synthesis at a particular site and in a par- est following transfection or transformation can be opti- ticular orientation, whereas enhancerslack these specificities. mized. Further, selection of a promoter that is regulated in Promoters and enhancers are often overlapping and contigu- response to specific physiologic signals can permit inducible ous, often seeming to have a very similar modular organiza- expression of the gene product. Tables 1 and 2 list several tion. regulatory elements that may be employed, in the context of Below is a list of viral promoters, cellular promoters/en- the present invention, to regulate the expressionofthe gene of hancers and inducible promoters/enhancers that could be interest. This list is not intended to be exhaustive of all the used in combination with the nucleic acid encoding a gene of possible elements involved in the promotion of gene expres- interest in an expression construct (Table 1 and Table 2). sion but, merely, to be exemplary thereof. Additionally, any promoter/enhancer combination (as per the Enhancers are genetic elements that increase transcription Eukaryotic Promoter Data Base EPDB) could also be used to from a promoter located at a distant position on the same 15 drive expression of the gene. Eukaryotic cells can support molecule of DNA. Enhancers are organized muchlike pro- cytoplasmictranscription from certain bacterial promoters if moters. That is, they are composed of many individualele- the appropriate bacterial polymerase is provided, either as ments, each of which binds to one or more transcriptional part of the delivery complex or as an additional genetic proteins. expression construct. In a preferred embodiment, the poly- The basic distinction between enhancers and promoters is 20 nucleotide encoding the miR-29a-c or miR-29a-c antagonist operational. An enhancer region as a whole mustbe able to is operably-linked to a fibroblast specific promoter.
TABLE 1
Promoter and/or Enhancer
Promoter/Enhancer References
Immunoglobulin Heavy Chain Banerji et al., 1983; Gilles et al., 1983; Grossched| et al., 1985; Atchinsonet al., 1986, 1987; Imler et al., 1987; Weinbergeret al., 1984; Kiledjian et al., 1988; Porton et al.; 1990 Immunoglobulin Light Chain Queenet al., 1983; Picard et al., 1984 T-Cell Receptor Luriaet al., 1987; Winoto et al., 1989; Redondo et al.; 1990 HLA DQ aand/or DQ 6 Sullivan et al., 1987 §-Interferon Goodbournet al., 1986; Fujita et al., 1987; Goodbourn etal., 1988 Interleukin-2 Greeneet al., 1989 Interleukin-2 Receptor Greeneet al., 1989; Lin et al., 1990 MHCClass II 5 Kochet al., 1989 MHCClass II HLA-DRa Sherman etal., 1989 f-Actin Kawamotoet al., 1988; Ng etal.; 1989 Muscle Creatine Kinase (MCK) Jaynes et al., 1988; Horlick et al., 1989; Johnson et al., 1989 Prealbumin (Transthyretin) Costaet al., 1988 Elastase I Ornitz et al., 1987 Metallothionein (MTII) Karin et al., 1987; Culottaet al., 1989 Collagenase Pinkert et al., 1987; Angel et al., 1987a Albumin Pinkert et al., 1987; Troncheet al., 1989, 1990 a-Fetoprotein Godboutet al., 1988; Campereet al., 1989 t-Globin Bodineet al., 1987; Perez-Stableet al., 1990 6-Globin Trudel etal., 1987 c-fos Cohenet al., 1987 c-HA-ras Triesman, 1986; Deschampset al., 1985 Insulin Edlundet al., 1985 Neural Cell Adhesion Molecule Hirshet al., 1990 (NCAM) q,-Antitrypain Latimeret al., 1990 H2B (TH2B) Histone Hwanget al., 1990 Mouseand/or Type I Collagen Ripe et al., 1989 Glucose-Regulated Proteins Changet al., 1989 (GRP94 and GRP78) Rat Growth Hormone Larsenet al., 1986 Human Serum Amyloid A (SAA) Edbrookeetal., 1989 Troponin I (TN I) Yutzey et al., 1989 Platelet-Derived Growth Factor Pechet al., 1989 (PDGF) Duchenne Muscular Dystrophy Klamutet al., 1990 Sv40 Banerji et al., 1981; Moreauet al., 1981; Sleigh et al., 1985; Firak et al., 1986; Herr et al., 1986; Imbraet al., 1986; Kadeschet al., 1986; Wang et al., 1986; Ondeket al., 1987; Kuhlet al., 1987; Schaffner et al., 1988 US 8,940,712 B2 15 16 TABLE1-continued
Promoter and/or Enhancer
Promotetr/Enhancer References
Polyoma Swartzendruberet al., 1975; Vasseuret al., 1980; Katinkaet al., 1980, 1981; Tyndell et al., 1981; Dandolo et al., 1983; de Villiers et al., 1984; Hen et al., 1986; Satake et al., 1988; Campbell and/or Villarreal, 1988 Retroviruses Kriegler et al., 1982, 1983; Levinson et al., 1982; Kriegler et al., 1983, 1984a, b, 1988; Boszeet al., 1986; Miksicek et al., 1986; Celanderet al., 1987; Thiesen et al., 1988; Celanderet al., 1988; Choi et al., 1988; Reisman et al., 1989 Papilloma Virus Campoet al., 1983; Lusky et al., 1983; Spandidos and/or Wilkie, 1983; Spalholz et al., 1985; Lusky et al., 1986; Cripe et al., 1987; Gloss et al., 1987; Hirochika et al., 1987; Stephenset al., 1987 Hepatitis B Virus Bulla et al., 1986; Jameelet al., 1986; Shauletal., 1987; Spandauet al., 1988; Vannice et al., 1988 Human Immunodeficiency Virus Muesinget al., 1987; Hauberet al., 1988; Jakobovits et al., 1988; Feng et al., 1988; Takebe et al., 1988; Rosen etal., 1988; Berkhoutet al., 1989; Laspia et al., 1989; Sharp etal., 1989; Braddocketal., 1989 Cytomegalovirus (CMV) Weberet al., 1984; Boshart et al., 1985; Foecking et al., 1986 Gibbon Ape Leukemia Virus Holbrooketal., 1987; Quinn et al., 1989
TABLE 2 employed such as human growth hormone and SV40 poly-
adenylation signals. Also contemplated as an elementof the Inducible Element: 30 expression cassette is a terminator. These elements can serve Element Inducer References to enhance message levels and to minimize read through from
the cassette into other sequences. MT II Phorbol Ester Palmiteret al., 1982; In certain embodimentsof the invention, the cells contain- —_ (TFA) Haslinger et al., 1985; Heavy metals Searle et al., 1985; Stuart ing nucleic acid constructs of the present invention may be et al., 1985; Imagawa 35 identified in vitro or in vivo by including a marker in the et al., 1987, Karin et al., expression construct. Such markers would confer an identi- 1987; Angelet al., 1987b; McNeall et al., 1989 fiable changeto the cell permitting easy identificationof cells MMTV (mouse mammary Glucocotr- Huanget al., 1981; Lee containing the expression construct. Usually the inclusion of tumorvirus) ticoids et al., 1981; Majors etal., a drug selection markeraids in cloning andin the selection of 1983; Chandleret al., 40 transformants, for example, genes that confer resistance to 1983; Ponta et al., 1985; Sakaiet al., 1988 neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and §-Interferon poly(@lx Tavernieret al., 1983 histidinol are useful selectable markers. Alternatively, poly(re) enzymes such as herpes simplex virus thymidine kinase (tk) Adenovirus 5 E2 EIA Imperiale et al., 1984 or chloramphenicol acetyltransferase (CAT) may be Collagenase Phorbol Ester Angelet al., 1987a (TPA) 45 employed. Immunologic markers also can be employed. The Stromelysin Phorbol Ester Angelet al., 1987b selectable marker employedis not believed to be important, (TPA) so long as it is capable of being expressed simultaneously SV40 Phorbol Ester Angelet al., 1987b with the nucleic acid encoding a gene product. Further (TPA) Murine MX Gene Interferon, Hug et al., 1988 examples of selectable markers are well known to one of skill Newcastle 50 in the art. Disease Virus There are a numberof ways in which expression vectors GRP78 Gene A23187 Resendezet al., 1988 may introduced into cells. In certain embodiments of the a-2-Macroglobulin IL-6 Kunzet al., 1989 Vimentin Serum Rittling et al., 1989 invention, the expression construct comprises a virus or engi- MHCClass I Gene H-2xb Interferon Blanar et al., 1989 neered construct derived from a viral genome. Theability of HSP70 ELA, SV40 Tayloret al., 1989, 1990a, 55 certain viruses to enter cells via receptor-mediated endocyto- Large T 1990b sis, to integrate into host cell genomeandexpressviral genes Antigen Proliferin Phorbol Ester- Mordacq et al., 1989 stably andefficiently have made them attractive candidates TPA for the transfer offoreign genes into mammaliancells (Ridge- Tumor Necrosis Factor PMA Henselet al., 1989 way, 1988; Nicolas and Rubenstein, 1988; Baichwal and Thyroid Stimulating Thyroid Chatterjee et al., 1989 60 Sugden, 1986; Temin, 1986). Hormone a@ Gene Hormone Oneofthe preferred methodsfor in vivo delivery involves
the use of an adenovirus expression vector. “Adenovirus WhereacDNaAinsert is employed, one will typically desire expression vector” is meant to include those constructs con- to include a polyadenylation signal to effect proper polyade- taining adenovirus sequencessufficient to (a) support pack- nylation of the gene transcript. The nature of the polyadeny- 65 aging ofthe construct and(b) to express a polynucleotide that lation signal is not believed to be crucial to the successful has been cloned therein. The expression vector comprises a practice of the invention, and any such sequence may be genetically engineered form of adenovirus. Knowledge ofthe US 8,940,712 B2 17 18 genetic organization of adenovirus, a 36 kB, linear, double- presentat the 5' and 3' ends ofthe viral genome.These contain stranded DNA virus, allows substitution of large pieces of strong promoter and enhancer sequences and are also adenoviral DNA with foreign sequences up to 7 kB (Grun- required for integration in the host cell genome (Coffin, haus and Horwitz, 1992). In contrast to retrovirus, the aden- 1990). oviral infection of host cells does not result in chromosomal In order to construct a retroviral vector, a nucleic acid integration because adenoviral DNAcan replicate in an epi- encoding a geneofinterestis insertedinto the viral genome in somal manner without potential genotoxicity. Also, adenovi- the place of certain viral sequences to produce a virusthatis ruses are structurally stable, and no genomerearrangement replication-defective. In order to produce virions, a packag- has been detected after extensive amplification. Adenovirus ing cell line containing the gag,pol, and env genes but without can infect virtually all epithelial cells regardless of their cell the LTR and packaging components is constructed (Mann et cycle stage. al., 1983). When a recombinant plasmid containing a cDNA, Adenovirusis particularly suitable for use as a gene trans- together with the retroviral LTR and packaging sequencesis fer vector because of its mid-sized genome, ease of manipu- lation, high titer, wide target cell range and high infectivity. introduced into this cell line (by calctum phosphate precipi- Both ends of the viral genome contain 100-200 base pair tation for example), the packaging sequence allows the RNA inverted repeats (ITRs), which are cis elements necessary for transcript of the recombinant plasmid to be packaged into viral DNA replication and packaging. viral particles, which are then secreted into the culture media Other than the requirement that the adenovirus vector be (Nicolas and Rubinstein, 1988; Temin, 1986; Mann etal., replication defective, or at least conditionally defective, the 1983). The media containing the recombinantretrovirusesis nature of the adenovirus vector1s not believed to be crucial to then collected, optionally concentrated, and used for gene the successful practice of the invention. The adenovirus may transfer. Retroviral vectors are able to infect a broad variety of be of any of the 42 different known serotypes or subgroups cell types. However, integration and stable expression require A-F. Adenovirus type 5 of subgroup C is the preferred starting the division of host cells (Paskindet al., 1975). material in order to obtain the conditional replication-defec- Other viral vectors may be employed as expression con- tive adenovirus vector for use in the present invention. This is 25 structs in the present invention. Vectors derived from viruses because Adenovirus type 5 is a human adenovirus about such as vaccinia virus (Ridgeway, 1988; Baichwal and Sug- which a great deal of biochemical and genetic information is den, 1986; Coupar et al., 1988) adeno-associated virus (AAV) known, andit has historically been used for most construc- (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat tions employing adenovirus as a vector. and Muzycska, 1984) and herpesviruses may be employed. Asstated above,the typical vector according to the present They offer several attractive features for various mammalian invention is replication defective and will not have an aden- cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sug- ovirus E1 region. Thus, it will be most convenient to intro- den, 1986; Couparet al., 1988; Horwichetal., 1990). duce the polynucleotide encoding the geneofinterest at the In order to affect expression of sense or antisense gene position from which the El-coding sequences have been removed. However, the position of insertion of the construct constructs, the expression construct must be delivered into a within the adenovirus sequencesis not critical to the inven- cell. This delivery may be accomplishedin vitro, as in labo- tion. The polynucleotide encoding the gene of interest may ratory procedures for transformingcells lines, or in vivo or ex also beinserted in lieu of the deleted E3 region in E3 replace- vivo, as in the treatment of certain disease states. One mecha- mentvectors, as described by Karlsson et al. (1986), or in the nism for delivery is via viral infection where the expression E4 region where a helper cell line or helper virus comple- 40 construct is encapsidated in an infectious viral particle. ments the E4 defect. Several non-viral methods for the transfer of expression Adenovirus vectors have been used in eukaryotic gene constructs into cultured mammalian cells also are contem- expression (Levrero et al., 1991; Gomez-Foix et al., 1992) plated by the present invention. These include calcium phos- and vaccine development (Grunhausand Horwitz, 1992; Gra- phate precipitation (Graham and Van Der Eb, 1973; Chen and ham and Prevec, 1991). Recently, animal studies suggested 45 Okayama, 1987; Rippeet al., 1990) DEAE-dextran (Gopal, that recombinant adenovirus could be used for gene therapy 1985), electroporation (Tur-Kasp a et al., 1986; Potter et al., (Stratford-Perricaudet and Perricaudet, 1991; Stratford-Per- 1984), direct microinjection (Harland and Weintraub, 1985), ricaudetet al., 1990; Rich et al., 1993). Studies in adminis- DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et tering recombinant adenovirus to different tissues include al., 1979) and lipofectamine-DNA complexes,cell sonication trachea instillation (Rosenfeld et al., 1991; Rosenfeld et al., (Fechheimer et al., 1987), gene bombardment using high 1992), muscle injection (Ragotet al., 1993), peripheral intra- velocity microprojectiles (Yang et al., 1990), and receptor- venous injections (Herz and Gerard, 1993) and stereotactic mediated transfection (Wu and Wu, 1987; Wu and Wu,1988). inoculation into the brain (Le Gal La Salle et al., 1993). Someofthese techniques may be successfully adapted for in Retroviral vectors are also suitable for expressing the poly- Vivo or ex Vivo use. nucleotides of the invention in cells. The retroviruses are a 55 Once the expression construct has been delivered into the group of single-stranded RNA viruses characterized by an cell the nucleic acid encoding the gene of interest may be ability to convert their RNA to double-stranded DNA in positioned and expressedatdifferent sites. In certain embodi- infected cells by a process of reverse-transcription (Coffin, ments, the nucleic acid encoding the gene may be stably 1990). The resulting DNAthenstably integrates into cellular integrated into the genomeofthe cell. This integration may be chromosomes as a provirus and directs synthesis of viral in the cognate location and orientation via homologous proteins. The integration results in the retention of the viral recombination (gene replacement)or it may be integrated in gene sequencesin the recipient cell and its descendants. The a random, non-specific location (gene augmentation). In yet retroviral genomecontainsthree genes, gag, pol, and env that further embodiments, the nucleic acid may be stably main- code for capsid proteins, polymerase enzyme, and envelope tained in the cell as a separate, episomal segment of DNA. components, respectively. A sequence found upstream from Such nucleic acid segments or “episomes” encode sequences the gag gene contains a signal for packaging of the genome sufficient to permit maintenance andreplication independent into virions. Two long terminal repeat (LTR) sequences are of or in synchronization with the host cell cycle. How the US 8,940,712 B2 19 20 expression constructis delivered to a cell and where in the cell Where a bacterial promoter is employed in the DNA con- the nucleic acid remains is dependent on the type of expres- struct, it also will be desirable to include within the liposome sion construct employed. an appropriate bacterial polymerase. In yet another embodimentofthe invention, the expression Other expression constructs which can be employed to construct may simply consist of naked recombinant DNA or deliver a nucleic acid encoding a particular geneinto cells are plasmids. Transfer of the construct may be performed by any receptor-mediated delivery vehicles. These take advantage of of the methods mentioned above which physically or chemi- the selective uptake ofmacromolecules by receptor-mediated cally permeabilize the cell membrane. This is particularly endocytosis in almostall eukaryotic cells. Because of thecell applicable for transfer in vitro but it may be applied to in vivo type-specific distribution of various receptors, the delivery use as well. Dubensky et al. (1984) successfully injected 10 can be highly specific (Wu and Wu, 1993). polyomavirus DNAin the form ofcalcium phosphate precipi- Receptor-mediated gene targeting vehicles generally con- tates into liver and spleen of adult and newborn mice demon- sist of two components: a cell receptor-specific ligand and a strating active viral replication and acute infection. Ben- venisty and Neshif (1986) also demonstrated that direct DNA-binding agent. Several ligands have been used for receptor-mediated gene transfer. The most extensively char- intraperitoneal injection of calctum phosphate-precipitated 15 plasmids results in expression of the transfected genes. It is acterized ligands are asialoorosomucoid (ASOR) (Wu and envisioned that DNA encoding a geneof interest may also be Wu, 1987) and transferrin (Wagneret al., 1990). Recently, a transferred in a similar manner in vivo and express the gene synthetic neoglycoprotein, which recognizes the same recep- product. tor as ASOR,has been used as a gene delivery vehicle (Ferkol In still another embodimentof the invention for transfer- 20 et al., 1993; Perales et al., 1994) and epidermal growth factor ring anaked DNA expression construct into cells may involve (EGF)hasalso been used to deliver genes to squamous car- particle bombardment. This method depends onthe ability to cinoma cells (Myers, EPO 0273085). accelerate DNA-coated microprojectiles to a high velocity In other embodiments, the delivery vehicle may comprise a allowing them to pierce cell membranesandenter cells with- ligand and a liposome. For example, Nicolau et al. (1987) out killing them (Klein et al., 1987). Several devices for 25 employed lactosyl-ceramide, a galactose-terminal asialgan- accelerating small particles have been developed. One such glioside, incorporated into liposomes and observed an device relies on a high voltage discharge to generate an elec- increase in the uptake of the insulin gene by hepatocytes. trical current, which in turn provides the motive force (Yang Thus, it is feasible that a nucleic acid encoding a particular et al., 1990). The microprojectiles used have consisted of gene also maybespecifically delivered into a cell type by any biologically inert substances such as tungsten or gold beads. 30 number of receptor-ligand systems with or without lipo- Selected organs includingthe liver, skin, and muscle tissue somes. For example, epidermal growth factor (EGF) may be of rats and mice have been bombarded in vivo (Yanget al., used as the receptor for mediated delivery of a nucleic acid 1990; Zelenin et al., 1991). This may require surgical expo- into cells that exhibit upregulation ofEGF receptor. Mannose sure of the tissueor cells, to eliminate any intervening tissue can be usedto target the mannosereceptoron liver cells. Also, between the gun andthe target organ, i.e., ex vivo treatment. 35 antibodies to CD5 (CLL), CD22 dymphoma), CD25 (T-cell Again, DNA encodinga particular gene maybe delivered via leukemia) and MAA (melanoma) can similarly be used as this methodandstill be incorporatedby the present invention. targeting moieties. In a further embodiment of the invention, the expression Ina particular example, the oligonucleotide may be admin- construct may be entrapped in a liposome. Liposomes are istered in combination with a cationic lipid. Examples of vesicular structures characterized by a phospholipid bilayer 40 cationic lipids include, but are not limited to, lipofectin, membraneand an inner aqueous medium. Multilamellarlipo- DOTMA, DOPE, and DOTAP. The publication of somes have multiple lipid layers separated by aqueous WO/0071096, which is specifically incorporated by refer- medium. They form spontaneously when phospholipids are ence, describes different formulations, such as a DOTAP: suspended in an excess of aqueous solution. The lipid com- cholesterol or cholesterol derivative formulation that can ponents undergo self-rearrangement before the formation of 45 effectively be used for gene therapy. Other disclosures also closed structures and entrap water and dissolved solutes discuss different lipid or liposomal formulations including between the lipid bilayers (Ghosh and Bachhawat, 1991). nanoparticles and methods of administration; these include, Also contemplated are lipofectamine-DNA complexes. butare not limited to, U.S. Patent Publication 20030203865, Liposome-mediated nucleic acid delivery and expression 20020150626, 20030032615, and 20040048787, which are of foreign DNAin vitro has been very successful. Wongetal., 50 specifically incorporated by reference to the extent they dis- (1980) demonstrated the feasibility of liposome-mediated close formulations and other related aspects ofadministration delivery and expression of foreign DNA in cultured chick and delivery of nucleic acids. Methods used for forming embryo, HeLa and hepatoma cells. Nicolau et al., (1987) particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877, accomplished successful liposome-mediated gene transfer in 302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972, rats after intravenous injection. 55 900, which are incorporated by reference for those aspects. In certain embodimentsofthe invention,the liposome may In certain embodiments, gene transfer may more easily be be complexed with a hemagglutinating virus (HVJ). This has performed under ex vivo conditions. Ex vivo gene therapy been shownto facilitate fusion with the cell membrane and refers to the isolation of cells from an animal, the delivery of promote cell entry of liposome-encapsulated DNA (Kaneda a nucleic acid into the cells in vitro, and then the return of the et al., 1989). In other embodiments, the liposome may be 60 modified cells back into an animal. This may involve the complexed or employed in conjunction with nuclear non- surgical removalof tissue/organs from an animalorthe pri- histone chromosomalproteins (HMG-1) (Kato et al., 1991). mary culture of cells andtissues. In yet further embodiments, the liposome may be complexed In some embodiments of the invention, it is desirable to or employed in conjunction with both HVJ and HMG-1. In inhibit the expression or activity of miR-29a-c to increase that such expression constructs have been successfully 65 collagen deposition. For example, in one embodiment, the employed in transfer and expression of nucleic acid in vitro invention provides a method of inducing collagen deposition and in vivo, then they are applicable for the present invention. in a tissue comprising contacting said tissue with an antago- US 8,940,712 B2 21 22 nist of miR-29a-c. The antagonist or inhibitor of miR-29a-c dent degradation mechanisms of RNAtargets. Other modifi- function may be directed at miR-29a, miR-29b and/or at cationsof antisense oligonucleotides to enhancestability and miR-29¢c. improve efficacy, such as those described in U.S. Pat. No. The function of miRNAs may be inhibited by the admin- 6,838,283, which is herein incorporated by reference in its istration of antagomirs. Initially described by Kriitzfeldt and entirety, are knownin the art and are suitable for use in the colleagues (Kriitzfeldt et al., 2005), “antagomirs”are single- methods of the invention. Preferable antisense oligonucle- stranded, chemically-modified ribonucleotides that are at otides useful for inhibiting the activity of microRNAsare least partially complementary to the miRNA sequence. about 19 to about 25 nucleotides in length. Antisense oligo- Antagomirs may comprise one or more modified nucleotides, nucleotides may comprise a sequencethatis at least partially such as 2'-O-methyl-sugar modifications. In some embodi- 10 complementary to a mature miRNA sequence,e.g. at least ments, antagomirs comprise only modified nucleotides. about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% Antagomirs may also comprise one or more phosphorothio- complementary to a mature miRNA sequence. In some ate linkages resulting in a partial or full phosphorothioate backbone. To facilitate in vivo delivery and stability, the embodiments,the antisense oligonucleotide may be substan- tially complementary to a mature miRNA sequence,thatis at antagomir maybelinked to a cholesterol moiety at its 3' end. 15 Antagomirs suitable for inhibiting miRNAs may be about 15 least about 95%, 96%, 97%, 98%, or 99% complementary to to about 50 nucleotides in length, more preferably about 18 to a target polynucleotide sequence. In one embodiment, the about 30 nucleotides in length, and most preferably about 20 antisense oligonucleotide comprises a sequencethat is 100% to about 25 nucleotides in length.“Partially complementary” complementary to a mature miRNA sequence. refers to a sequence that is at least about 75%, 80%, 85%, 20 In another embodimentofthe invention, the antagonist of 90%, 95%, 96%, 97%, 98%, or 99% complementary to a miR-29a-c is a chemically-modified antisense oligonucle- target polynucleotide sequence. The antagomirs may be at otide. The chemically-modified antisense oligonucleotide least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or may comprise a sequencethatis at least partially complemen- 99% complementary to a mature miRNA sequence. In some tary to the mature miRNA sequence ofmiR-29a, miR-29b, or embodiments, the antagomir may be substantially comple- 25 miR-29c. In yet another embodiment, the chemically-modi- mentary to a mature miRNA sequence, that is at least about fied antisense oligonucleotide comprises a sequence thatis at 95%, 96%, 97%, 98%, or 99% complementary to a target least partially complementary to the sequence ofSEQ ID NO: polynucleotide sequence. In other embodiments, the antago- 18, SEQ ID NO:19, or SEQ ID NO:20.In another embodi- mirs are 100% complementary to the mature miRNA ment, the chemically-modified antisense oligonucleotide sequence. 30 comprises a sequencethat is 100% complementary to SEQ ID In one embodiment, the antagonist of miR-29a-c is an NO: 18, SEQ ID NO: 19, or SEQ ID NO:20. antagomir. The antagomir may comprise a sequence thatis at Antisense oligonucleotides may comprise a sequence that least partially complementary to the mature miRNA is substantially complementary to a precursor miRNA sequence of miR-29a, miR-29b, or miR-29c. In another sequence (pre-miRNA) for miR-29a-c. In some embodi- embodiment, the antagomir comprises a sequencethat is at 35 ments, the antisense oligonucleotide comprises a sequence least partially complementary to the sequence of SEQ ID NO: that is substantially complementary to a sequence located 18, SEQ ID NO:19, or SEQ ID NO:20.In another embodi- outside the stem-loop region of the pre-miR-29a, pre-miR- ment, the antagomir comprises a sequence that is 100% 29b, or pre-miR-29¢ sequence. complementary to SEQ ID NO: 18, SEQ ID NO: 19, or SEQ Anotherapproachfor inhibiting the function ofmiR-29a-c ID NO:20. 40 is administering an inhibitory RNA molecule havingat least Inhibition ofmicroRNA function may also be achieved by partial sequenceidentity to the mature miR-29a, miR-29b and administering antisense oligonucleotides targeting the miR-29c¢ sequences. The inhibitory RNA molecule may be a mature miR-29a, miR-29b or miR-29c sequences. Theanti- double-stranded, small interfering RNA (siRNA) or a short sense oligonucleotides maybe ribonucleotides or deoxyribo- hairpin RNA molecule (shRNA) comprising a stem-loop nucleotides. Preferably, the antisense oligonucleotides have 45 structure. The double-stranded regionsof the inhibitory RNA at least one chemical modification. Antisense oligonucle- molecule may comprise a sequence thatis at least partially otides may be comprised of one or more “locked nucleic identical, e.g. about 75%, 80%, 85%, 90%, 95%, 96%, 97%, acids”. “Locked nucleic acids” (LNAs) are modified ribo- 98%, or 99% identical, to the mature miRNA sequence. In nucleotides that contain an extra bridge betweenthe 2' and 4' some embodiments, the double-stranded regions of the carbons of the ribose sugar moiety resulting in a “locked” 50 inhibitory RNA comprise a sequencethat is at least substan- conformation that confers enhanced thermalstability to oli- tially identical to the mature miRNA sequence. “Substan- gonucleotides containing the LNAs. Alternatively, the anti- tially identical” refers to a sequencethat is about 95%, 96%, sense oligonucleotides may comprise peptide nucleic acids 97%, 98%, or 99% identical to a target polynucleotide (PNAs), which contain a peptide-based backbonerather than sequence. In other embodiments, the double-stranded regions a sugar-phosphate backbone. Other chemical modifications 55 ofthe inhibitory RNA molecule may be 100% identical to the that the antisense oligonucleotides may contain include, but target miRNA sequence. are not limited to, sugar modifications, such as 2'-O-alkyl In one embodiment, an antagonist of miR-29a-c is an (e.g. 2'-O-methyl, 2'-O-methoxyethyl), 2'-fluoro, and 4' thio inhibitory RNA molecule comprising a double-stranded modifications, and backbone modifications, such as one or region, wherein the double-stranded region comprises a more phosphorothioate, morpholino, or phosphonocarboxy- 60 sequence having 100% identity to the mature miR-29a (SEQ late linkages (see, for example, U.S. Pat. Nos. 6,693,187 and ID NO:18), miR-29b (SEQ ID NO:19), or miR-29c (SEQ ID 7,067,641, which are herein incorporated by reference in their NO: 20) sequence. In some embodiments, antagonists of entireties). In some embodiments, suitable antisense oligo- miR-29a-c are inhibitory RNA molecules which comprise a nucleotides are 2'-O-methoxyethy] “gapmers” which contain double-stranded region, wherein said double-stranded region 2'-O-methoxyethyl-modified ribonucleotides on both 5' and 65 comprises a sequenceofat least about 75%, 80%, 85%, 90%, 3' ends with at least ten deoxyribonucleotides in the center. 95%, 96%, 97%, 98%, or 99% identity to the mature miR- These “gapmers”are capable of triggering RNase H-depen- 29a, miR-29b, or miR-29¢ sequence. US 8,940,712 B2 23 24 In another embodiment, an inhibitory RNA molecule may tricular wall stress, decreased wall tension, increased quality bearibozyme. A ribozymeis a catalytic RNA that hydrolyzes of life, and decreased disease related morbidity or mortality. phosphodiester bonds ofRNA molecules. The ribozyme may In addition, use ofagonists ofmiR-29a-c may prevent cardiac be designedto target one or more of miR-29a, miR-29b, and hypertrophy and its associated symptomsfrom arising either miR-29¢ resulting in their hydrolysis. directly or indirectly. In certain embodiments, expression vectors are employed In another embodiment, there is provided a method of to express an antagonist ofmiR-29a-c (e.g., antagomirs, anti- preventing pathologic hypertrophy or heart failure in a sub- sense oligonucleotides, and inhibitory RNA molecules). In ject in need thereofcomprising identifying a subject at risk of one embodiment, an expression vector for expressing an developing pathologic cardiac hypertrophy or heart failure; antagonist of miR-29a-c comprises a promoter operably and promoting the expression or activity of miR-29a-c in linked to a polynucleotide encoding an antisense oligonucle- cardiac cells of the subject. Cardiac cells include cardiac otide, wherein the sequenceof the expressed antisense oligo- myocytes, fibroblasts, smooth muscle cells, endothelialcells, nucleotide is at least partially complementary to the mature and any other cell type normally foundin cardiac tissue. The miR-29a, miR-29b, or miR-29c sequence. In yet another miR-29a-c agonist may be an agonist of miR-29a, miR-29b embodiment, an expression vector for expressing an inhibitor and/or miR-29c. The subjectat risk may exhibit one or more of miR-29a-c comprises one or more promoters operably of a list of risk factors comprising cardiac fibrosis, low linked to a polynucleotide encoding a shRNA or siRNA, expression of miR-29, long-standing uncontrolled hyperten- wherein the expressed shRNA or siRNA comprises a sion, uncorrected valvular disease, chronic angina, recent sequencethatis identical, partially identical, or substantially myocardial infarction, congenital predisposition to heart dis- identical to the mature miR-29a, miR-29b, or miR-29c 20 ease and/or pathological hypertrophy, and/or may be diag- sequence.“Partially identical” refers to a sequence thatis at nosed as having a genetic predisposition to cardiac hypertro- least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or phy, and/or may have a familial history of cardiac 99% identicalto a target polynucleotide sequence. “Substan- hypertrophy. tially identical”refers to a sequencethatis at least about 95%, In another embodiment, there is provided a method of 96%, 97%, 98%, or 99% identical to a target polynucleotide 25 treating myocardial infarction in a subject in need thereof sequence. comprising promoting expression or activity ofmiR-29a-c in Current medical managementof cardiac hypertrophyin the cardiac cells of the subject. In another embodiment, the setting of a cardiovascular disorder includesthe use ofat least invention provides a method of preventing cardiac hypertro- twotypes of drugsinhibitors ofthe renin-angiotensin system, phy and dilated cardiomyopathy in a subject in need thereof and B-adrenergic blocking agents (Bristow, 1999). Therapeu- comprising promoting expression or activity ofmiR-29a-c in tic agents to treat pathologic hypertrophy in the setting of cardiac cells of the subject. In another embodiment, the heart failure include angiotensin IT converting enzyme (ACE) invention provides a methodof inhibiting progression of car- inhibitors and B-adrenergic receptor blocking agents (Eich- diac hypertrophy in a subject in need thereof comprising horn and Bristow, 1996). Other pharmaceutical agents that promoting expression or activity of miR-29a-c in cardiac have been disclosed for treatment of cardiac hypertrophy cells of the subject. Another embodiment is a method of include angiotensin II receptor antagonists (U.S. Pat. No. increasing exercise tolerance in a subject with heart failure or 5,604,251) and neuropeptide Y antagonists (WO 98/33791). cardiac hypertrophy comprising promoting expression or Despite currently available pharmaceutical compounds,pre- activity of miR-29a-c in cardiac cells of the subject. Another vention and treatmentofcardiac hypertrophy, and subsequent embodiment is a method of reducing hospitalization in a heart failure, continue to present a therapeutic challenge. 40 subject with heart failure or cardiac hypertrophy comprising Non-pharmacological treatment is primarily used as an promoting expression or activity of miR-29a-c in cardiac adjunct to pharmacological treatment. One means of non- cells of the subject. In some embodiments, the invention pharmacological treatment involves reducing the sodium in provides methodsfor improving quality oflife and decreasing the diet. In addition, non-pharmacological treatment also morbidity or mortality in a subject with heart failure or car- entails the elimination of certain precipitating drugs, includ- 45 diac hypertrophy comprising promoting expression oractiv- ing negative inotropic agents (e.g., certain calcium channel ity of miR-29a-c in cardiac cells of the subject. blockers and antiarrhythmic drugs like disopyramide), car- Treatment regimens would vary depending on the clinical diotoxins (e.g., amphetamines), and plasma volume expand- situation. However, long-term maintenance would appearto ers (e.g., nonsteroidal anti-inflammatory agents and gluco- be appropriate in most circumstances. It also may be desirable corticoids). 50 to treat hypertrophy with agonists of miR-29a-c intermit- The present invention provides a method oftreating car- tently, such as within a brief window during disease progres- diac fibrosis, cardiac hypertrophy orheart failure in a subject sion. in need thereof comprising identifying a subject having car- In addition, the miR-29 family is involvedin the regulation diac fibrosis, cardiac hypertrophyor heart failure; and admin- of cardiac fibrosis. Since this miR family is enriched in fibro- istering to the subject an agonist of miR-29 expression or blasts compared to myocytes,itis likely that myocytes secrete function. Preferably, administration of a miR-29 agonist a factor, possibly BNP, which upregulates the miR-29 family results in the improvement of one or more symptoms of in fibroblast cells and thus protects against the development pathologic cardiac fibrosis, hypertrophyor heart failure in the of cardiac fibrosis. This factor is very high in miR-208 KO subject, or in the delay in the transition from cardiac hyper- mice, which correlates with the upregulation of miR-29a-c trophyto heart failure. The one or more improved symptoms and repression of fibrosis. miR-29a-c levels are elevated in maybe increased exercise capacity, increased cardiac ejec- normal heart disease, which is likely a protective effect to tion volume, decreased left ventricular end diastolic pressure, limit collagen deposition. Thus, the particular use of miR- decreased pulmonary capillary wedge pressure, increased 29a-c and agonists thereof in repressing cardiac fibrosis and cardiac output, or cardiac index, lowered pulmonary artery collagen deposition in cardiac tissues is contemplated. A pressures, decreasedleft ventricular end systolic and diastolic comparable mechanism forthe activation of the miR-29 fam- dimensions, decreased cardiac fibrosis, decreased collagen ily may be applicable in skeletal muscle fibrosis as well. deposition in cardiac muscle, decreased left and right ven- miR-29a-c regulates the expression of a numberofextracel- US 8,940,712 B2 25 26 lular matrix genes, suchas fibrillin 1 (FBN1),collagen type I, or diabetic fibrosis. In some embodiments, increasing the al (COL1A1), collagen type I a2 (COL1A2), and collagen expression and/or activity of miR-29a-c comprises adminis- type II, al (COL3A1) (see Example 4). Accordingly, the tering an agonist of miR-29a-c to the subject. In other present invention also provides methodsof regulating one or embodiments, increasing the expression and/or activity of more extracellular matrix genes in a cell. miR-29a-c comprises administering to the subject an expres- In one embodiment, the method comprises contacting the sion vector that encodes miR-29a-c. In another embodiment, cell with an agonist of miR-29 a-c. In another embodiment, the method further comprises administering to the subject a the method comprises contacting the cell with an antagonist non-miR-29a-c fibrotic therapy. of miR-29a-c. In still another embodiment, the one or more The present invention encompasses methods of treating extracellular matrix genes include fibrillin 1 (FBN1), col- 10 tissue fibrosis associated with one or more conditions or lagen type I, a1 (COL1A1), collagen type I a2 (COL1A2), disorders in a subject in needthereof. In one embodiment, the and collagen type HI, a1 (COL3A1). In some embodiments, method comprises administering to the subject an agonist of the one or more extracellular matrix genes are upregulated miR-29a-c. In another embodiment, the method comprises following contact ofthe cell with an antagonist ofmiR-29a-c. administering to the subject an expression vector that encodes In other embodiments, the one or more extracellular matrix 15 miR-29a-c. The one or more conditions or disorders associ- genes are downregulated following contact of the cell with an ated with tissue fibrosis may include, but are not limited to, agonist of miR-29a-c. congenital hepatic fibrosis (CHF); renal tubulointerstitial The inventors have demonstrated that miR-29a-c expres- fibrosis; pulmonary fibrosis associated with an autoimmune sion was decreased in cardiac fibroblasts exposed to TGF6, disorder (e.g. rheumatoid arthritis, lupus and sarcoidosis); suggesting that the decrease in miR-29a-c following myocar- 20 interstitial fibrosis associated with diabetic cardiomyopathy; dial infarction might be TGFB-regulated (Example 5). Inter- skeletal musclefibrosis associated with muscular dystrophies estingly, natriuretic peptides like B-type natriuretic peptide (e.g. Becker muscular dystrophy and Duchenne muscular (BNP) have been shown to inhibit TGFB-regulated gene dystrophy), denervation atrophies, and neuromuscular dis- expression related to fibrosis and myofibroblast conversion eases (e.g. acute polyneuritis, poliomyelitis, Werdig/Hoff- (Kapoun et al., 2004). In this regard, the inventors reported 25 man disease, amyotrophic lateral sclerosis, and progressive previously that mice lacking the cardiac-specific miRNA bulbar atrophy disease). miR-208 were resistant to cardiac fibrosis and remodeling The present invention also contemplates methodsoftreat- and exhibited increased expression of BNP at baseline (van ing pathologies/deficiencies that are characterized by the Rooij et al., 2007). Since BNP is known to antagonize the loss, lack, or underproduction of collagen. Using an antago- effects of TGF, the inventors suggest that the increased 30 nist ofmiR-29a-c, the expression ofcollagen can be increased levels of BNP in these mice might enhancethe expression of to replace missing collagen or supplementexisting collagen miR-29a-c. Indeed, a dose-dependent increase in miR-29a-c wherethere is a need. Thus, the present invention provides a expression was observed upon removal of miR-208, which method of inducing collagen deposition in a tissue compris- coincided with an increasing expression level of BNP (Ex- ing contacting said tissue with an antagonist of miR-29a-c. ample 5). These data indicate that TGFB induces the expres- 35 The antagonist may be directed at miR-29a, miR-29b and/or sion of collagen related genes in fibroblasts at least partly at miR-29c. In one embodiment, the antagonist comprises a through decreasing the level of miR-29a-c, which can be sequence that is complementary to SEQ ID NO: 18. In inhibited by BNP secreted by cardiomyocytes. Thus, the another embodiment, the antagonist comprises a sequence present invention provides a methodofincreasing miR-29a-c that is complementary to SEQ ID NO:19. In another embodi- expression and/or activity in a subject by administering at 40 ment, the antagonist comprises a sequence that is comple- least one TGF inhibitor. TGFB inhibitors may includeanti- mentary to SEQ ID NO:20. The antagonist may be an antago- TGFf antibodies, TGF antisense molecules, and small mol- mir of miR-29a-c, an antisense oligonucleotidethat targets a ecules that inhibit TGF activity as described in U.S. Pat. No. mature miR-29a-c sequence,or an inhibitory RNA molecule, 6,509,318, which is herein incorporated by reference in its such as a siRNA or a shRNA,that comprises a sequence entirety. TGF6 inhibitors may also be used in conjunction 45 identical to a mature miR-29a-c sequence, a ribozymeor any with miR-29a-c agonists as a combination therapy to treat other inhibitory nucleic acid. The antagonist may be linked or cardiac fibrosis, cardiac hypertrophy, or heart failure in a conjugated to agents that facilitate the entry of the antagonist subject. TGFB inhibitors may also be co-administered with into cells or tissues. Various conditions and disorders in which miR-29a-c agonists to treat or prevent tissue fibrosis in a an increase in collagen deposition would be beneficial and subject. 50 can be treated by administering an antagonist of miR-29a-c In addition to playing an important role in controlling include, but are not limited to, Ehlers-Danlos syndrome fibrosis in the heart, the ubiquitous expression of the miR-29 (EDS); Vitamin C deficiency (a.k.a scurvy); aging of the skin family suggests that it also may playa role in other fibrotic (e.g. natural aging and photoaging due to sun damage); and indications, such as those involving the kidney, liver and stretch marks(striae). lungs. Fibrosis is also observed secondary to diabetes. Type 1 55 Ehlers-Danlos syndrome (EDS)is a group of rare genetic and type 2 diabetic patients are at increasedrisk of cardiomy- disorders affecting humans and domestic animals caused by a opathy. Cardiomyopathyin diabetes is associated with a clus- defect in collagen synthesis. Depending on the individual ter of features, including decreased diastolic compliance, mutation, the severity of the disease can vary from mild to interstitial fibrosis, and myocyte hypertrophy. life-threatening. Mutations in the ADAMTS2, COL1AI1, Thepresent invention also provides a methodoftreating or 60 COL1A2, COL3A1, COL5A1, COL5A2, PLOD1 and preventing a tissue fibrosis in a subject. In one embodiment, TNXB genes cause EDS. Mutations in these genes usually the method comprises identifying a subject havingorat risk alter the structure, production, or processing of collagen or of tissue fibrosis; and increasing the expression and/oractiv- proteins that interact with collagen. A defect in collagen can ity of miR-29a-c in skeletal muscle or fibroblast cells of the weaken connective tissue in the skin, bones, blood vessels, subject. In another embodiment, the tissue fibrosis is cardiac 65 and organs, resulting in the features of the disorder. Thus, fibrosis, scleroderma (localized or systemic), skeletal muscle collagen deposition induced by miR-29a-c antagonists of the fibrosis, hepatic fibrosis, kidney fibrosis, pulmonary fibrosis, invention would act to replenish the level of normal collagen US 8,940,712 B2 27 28 in EDSpatients and alleviate symptomsof the disease. Simi- Asdescribedin detail above, inhibition ofmiR-29a-c leads larly, administration of an antagonist of miR-29a-c would to an increase in collagen deposition and the formation of benefit subjects suffering from vitamin C deficiency or fibrotic tissue. Accordingly, the present invention provides a scurvy. Vitamin C deficiency is a disease that results from methodfor increasing fibrotic tissue formation in the wall of insufficient intake ofvitamin C, which is required for normal a vessel comprising delivering an antagonist ofmiR-29a-c to collagen synthesis in humans. one or more soft plaque sites in the vessel wall, wherein the Collagen deposition in tissues resulting from the adminis- soft plaque is convertedto fibrotic tissue following delivery of tration of an antagonist ofmiR-29a-c would also be useful in the antagonist ofmiR-29a-c. Soft plaques can be identified by various cosmetic applications. Effects of aging of the skin methods knowninthe art, including, but not limited to, intra- produced by natural aging processes or photodamageresult- 10 vascular ultrasound and computed tomography (Saharaetal. ing from over-exposure to the sun could be reduced by admin- (2004) European Heart Journal, Vol. 25: 2026-2033; Budhoff istering to a subject in need thereof a miR-29a-c antagonist. (2006) J. Am. Coll. Cardiol., Vol. 48: 319-321; Hausleiter et Administration of miR-29a-c antagonists may also facilitate al. (2006) J. Am. Coll. Cardiol., Vol. 48: 312-318). Any ofthe the disappearanceof stretch marks. Stretch marks are a form miR-29a-c antagonists describedherein are suitable for use in 15 of scarring on theskinthat are causedbytearing ofthe dermis. the method. Stretch marksare the result of the rapid stretching of the skin The miR-29a-c antagonist may delivered to the one or associated with rapid growth (commonin puberty) or weight more soft plaque sites by direct injection or by using a cath- gain (e.g., pregnancy). eter or a device that isolates the coronary circulation. In one Thetissue to which the inventive methods may be applied 20 embodiment, the miR-29a-c antagonist is deliveredto the one includefacial tissue, such a foreheadtissue, a lip, a cheek, a or more soft plaque sites by a medical device used in vascular chin, an eyebrow,an eyelid, underthe eye, or near the mouth, surgery, such as a stent or balloon. The miR-29 antagonist handtissue, neck tissue, arm tissue, leg tissue, stomach tissue may be coated on a metalstent to form a drug-eluting stent. A or breast tissue. In some embodiments, the tissue may com- drug-eluting stent is a scaffold that holds open narrowed or prise a wound,a skin graft, scar tissue, wrinkles, lax skin, sun 25 diseased arteries and releases a compoundto prevent cellular damage, chemical damage, heat damage, cold damage, and/ proliferation and/or inflammation. miR-29a-c antagonists or stretch marks. may be applied to a metal stent imbeddedin a thin polymerfor Tn another embodimentof the invention, the contacting of release ofthe miR-29a-c over time. Methodsofcoating stents the tissue with the miR-29a-c antagonist comprises injection with therapeutic compoundsare knownin theart. See, e.g., into said tissue, injection into vasculature that feeds said 30 US. Pat. No. 7,144,422; U.S. Pat. No. 7,055,237; and WO tissue, or topical application. The topical application may be 2004/004602, which are here incorporated by reference in an ointment, cream, gel, salve, or balm. In another embodi- their entireties. In some embodiments, the miR-29a-c may be ment, the method further comprises use of a pressure bandage used in combination with other anti-restenosis compoundsto or dressing. The antagonist of miR-29a-c may be contacted produce a formulation for incorporation into drug-eluting with said tissue more than once. In some embodiments, the 35 stents and balloons. Suitable compoundsfor use in combina- antagonistis contacted with said tissue 2, 3, 4, 5, 6, 7, 8, 9, 10, tion with the antagonists of miR-29a-c include, but are not 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 times. In limited to, paclitaxel, rapamycin (sirolimus), tacrolimus, other embodiments, the antagonist is contacted with said zotarolimus, everolimus, docetaxel, pimecrolimus, and tissue over 2, 3, 4, 5, or 6 days, 1, 2, 3, or 4 weeks, 1, 2, 3, 4, derivatives thereof. 5, 6, 7, 8, 9, or 11 months, or 1, 2,3, 3, 4, 5, 6, 7, 8, 9, 10, 15, 40 The presentinvention also contemplates methodsfor scav- 20, or 25 years. enging or clearing a miR-29a-c agonist following treatment. In still another embodiment, the method further comprises In one embodiment, the method comprises overexpression of contacting said tissue with a second agent. The second agent bindingsite regions for miR-29a-c in fibroblasts using a fibro- may include, but is not limited to, topical vitamin A, topical blast specific promoter. The binding site regions preferably vitamin C, or vitamin E. In another embodiment, the method 45 contain a sequenceof the seed region for miR-29a-c. In some further comprises subjecting said tissue to a second treatment. embodiments, the binding site may contain a sequence from The second treatment may comprise a chemical peel, laser the 3'UTR of one or more targets of miR-29a-c, such as treatment, dermaplaning, or dermabrasion. In another COL1A1, COL1A2, COL1A3 and/or FBN1. In another embodiment, the tissue is in a subject that suffers from embodiment, a miR-29a-c antagonist may be administered Ehler’s-Danlos syndromeor Vitamin C deficiency. 50 after a miR-29a-c agonist to attenuate or stop the function of The present invention also contemplates the use of miR- the microRNA.In another embodiment,the present invention 29a-c antagonistsas profibrotic agents to convert soft plaques provides a method for scavenging or clearing miR-29a-c in the vasculature into fibrotic tissue to prevent myocardial antagonists following treatment. The method may comprise infarction. Soft plaques are a build-up of lipids containing overexpressing bindingsites for the miR-20a-c antagonists in predominantly cholesterol that lie underneath the endothelial 55 fibroblasts or other tissue in which a miR-29a-c antagonist lining of the arterial wall. Recently, it was recognized that was administered. these soft plaquesare proneto rupture resulting in the forma- Combined Therapy tion of a blood clot, which can potentially block blood flow In another embodiment, it is envisionedto use an agonist of through the artery and cause a heart attack (i.e. myocardial miR-29a-c in combination with other therapeutic modalities infarction). Itis these soft plaquesthatare often responsible in 60 for treating cardiac hypertrophy,heart failure and myocardial causing a healthy subject with no symptomsto suffer a seem- infarction. Thus, one may also provide to the subject more ingly unexpected heart attack.After a soft plaque ruptures, the “standard” pharmaceutical cardiac therapies in combination vessel wall heals and the soft plaque becomesa hard plaque, with the miR-29a-c agonist. Examples of other therapies whichrarely cause further problems. Thus, strategies for con- include, without limitation, so-called “beta blockers,” anti- verting soft plaquesinto fibrotic tissue would preventthe soft 65 hypertensives, cardiotonics, anti-thrombotics, vasodilators, plaques from rupturing and possibly inducing a myocardial hormone antagonists, iontropes, diuretics, endothelin recep- infarction. tor antagonists, calcium channel blockers, phosphodiesterase US 8,940,712 B2 29 30 inhibitors, ACE inhibitors, angiotensin type 2 antagonists and In certain embodiments, administration of an agent that cytokine blockers/inhibitors, and HDAC inhibitors. lowers the concentration of one of more blood lipids and/or Combinations maybe achieved by contacting cardiac cells lipoproteins, known herein as an “antihyperlipoproteinemic,” with a single composition or pharmacological formulation may be combined with a cardiovascular therapy according to that includes an agonist of miR-29a-c and a standard phar- the present invention, particularly in treatment of atherscle- maceutical agent, or by contacting the cell with two distinct rosis and thickenings or blockages of vascular tissues. In compositions or formulations, at the same time, wherein one certain embodiments, an antihyperlipoproteinemic agent composition includes an agonist of miR-29a-c and the other may comprise an aryloxyalkanoic/fibric acid derivative, a includesthe standard pharmaceutical agent. Alternatively, the resin/bile acid sequesterant, a HMG CoAreductase inhibitor, therapy using an agonist ofmiR-29a-c mayprecedeor follow 10 a nicotinic acid derivative, a thyroid hormoneor thyroid hor- administration ofthe other agent(s) by intervals ranging from moneanalog, a miscellaneous agent or a combination thereof. minutes to weeks. In embodiments where the standard phar- Non-limiting examples of aryloxyalkanoic/fibric acid maceutical agent and miR-29a-c agonist are applied sepa- derivatives include beclobrate, enzafibrate, binifibrate, rately to the cell, one would generally ensure that a significant ciprofibrate, clinofibrate, clofibrate (atromide-S), clofibric 15 period of time did not expire between the time of each deliv- acid, etofibrate, fenofibrate, gemfibrozil (lobid), nicofibrate, ery, such that the pharmaceutical agent and miR-29a-c ago- pirifibrate, ronifibrate, simfibrate and theofibrate. nist wouldstill be able to exert an advantageously combined Non-limiting examples of resins/bile acid sequesterants effect on the cell. In such instances, it is contemplated that one include cholestyramine (cholybar, questran), colestipol would typically contact the cell with both modalities within 20 (colestid) and polidexide. about 12-24 hours of each other and, morepreferably, within Non-limiting examples of HMG CoAreductase inhibitors about 6-12 hours ofeach other, with a delay time ofonly about include lovastatin (mevacor), pravastatin (pravochol) or sim- 12 hours being mostpreferred. In somesituations, it may be vastatin (zocor). desirable to extend the timeperiodfor treatmentsignificantly, Non-limiting examples of nicotinic acid derivatives however, where several days (2, 3, 4, 5, 6 or 7) to several 25 include nicotinate, acepimox, niceritrol, nicoclonate, nico- weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective mol and oxiniacic acid. administrations. Non-limiting examples of thyroid hormonesand analogs It also is conceivable that more than one administration of thereof include etoroxate, thyropropic acid and thyroxine. either an agonist of miR-29a-c, or the other pharmaceutical Non-limiting examples of miscellaneous antihyperlipo- agent will be desired. In this regard, various combinations 30 proteinemics include acifran, azacosterol, benfluorex, (f-ben- may be employed. By wayofillustration, where the agonist of zalbutyramide, carnitine, chondroitin sulfate, clomestrone, miR-29a-c is “A” and the other agent is “B,” the following detaxtran, dextran sulfate sodium, 5,8,11,14,17-eicosapen- permutations based on 3 and 4 total administrations are exem- taenoic acid, eritadenine, furazabol, meglutol, melinamide, plary: mytatrienediol, ornithine, y-oryzanol, pantethine, pentaeryth- 35 ritol tetraacetate, a-phenylbutyramide, pirozadil, probucol
(lorelco), B-sitosterol, sultosilic acid-piperazine salt, tiad- A/B/A B/A/B B/B/A A/A/B B/A/A. A/B/B B/B/B/A B/B/A/B-~ A/A/B/B-A/B/A/B-A/B/B/A_B/B/A/A enol, triparanol and xenbucin. Non-limiting examples of an B/A/B/A_ B/A/A/B-B/B/B/A- A/A/A/B-OB/A/A/AA/B/AJA antiarteriosclerotic include pyridinol carbamate. A/A/B/A_ A/B/B/B__B/A/B/B B/B/A/B | 40 In certain embodiments, administration of an agent that aids in the removal or prevention of blood clots may be Other combinationsare likewise contemplated. combined with administration of a modulator, particularly in Pharmacological therapeutic agents and methods of treatment of athersclerosis and vasculature (e.g., arterial) administration, dosages, etc., are well knownto thoseof skill blockages. Non-limiting examples of antithrombotic and/or in the art (see for example, the “Physicians Desk Reference”, 45 fibrinolytic agents include anticoagulants, anticoagulant Klaassen’s “The Pharmacological Basis of Therapeutics”, antagonists, antiplatelet agents, thrombolytic agents, throm- “Remington’s Pharmaceutical Sciences”, and “The Merck bolytic agent antagonists or combinationsthereof. Index, Eleventh Edition”, incorporated herein by reference in In certain embodiments, antithrombotic agents that can be relevant parts), and may be combined with the invention in administered orally, such as, for example, aspirin and wafarin light of the disclosures herein. Somevariation in dosage will 50 (coumadin), are preferred. necessarily occur depending on the condition of the subject Non-limiting examples of anticoagulants include aceno- being treated. The person responsible for administration will, coumarol, ancrod, anisindione, bromindione, clorindione, in any event, determine the appropriate dose for the individual coumetarol, cyclocumarol, dextran sulfate sodium, dicuma- subject, and such individual determinations are within the rol, diphenadione, ethyl biscoumacetate, ethylidene dicou- skill of those of ordinary skill in the art. 55 marol, fiuindione, heparin, hirudin, lyapolate sodium, Non-limiting examples of a pharmacological therapeutic oxazidione, pentosan polysulfate, phenindione, phenprocou- agent that may be used in the present invention include an mon, phosvitin, picotamide, tioclomarol and warfarin. antihyperlipoproteinemic agent, an antiarteriosclerotic agent, Non-limiting examples of antiplatelet agents include aspi- an antithrombotic/fibrinolytic agent, a blood coagulant, an rin, a dextran, dipyridamole (persantin), heparin, sulfinpyra- antiarrhythmic agent, an antihypertensive agent, a vasopres- 60 none(anturane) andticlopidine(ticlid). sor, a treatment agent for congestive heart failure, an antiangi- Non-limiting examples ofthrombolytic agents includetis- nal agent, an antibacterial agent or a combination thereof. sue plaminogenactivator (activase), plasmin, pro-urokinase, In addition, it should be noted that any ofthe following may urokinase (abbokinase) streptokinase (streptase), anistre- be used to develop newsets of cardiac therapy target genes as plase/APSAC (eminase). 6-blockers were used in the present examples (see below). 65 In certain embodiments wherein a subject is suffering from While it is expected that many of these genes may overlap, a hemorrhageor an increased likelihood ofhemorrhaging, an new genetargets likely can be developed. agent that may enhance blood coagulation may be used. Non- US 8,940,712 B2 31 32 limiting examples of a blood coagulation promoting agents mide, lidocaine, lorajmine, lorcamide, meobentine, include thrombolytic agent antagonists and anticoagulant moricizine, pirmenol, prajmaline, propafenone, pyrinoline, antagonists. quinidine polygalacturonate, quinidine sulfate and viquidil. Non-limiting examples of anticoagulant antagonists Non-limiting examples of antihypertensive agents include include protamine and vitamine K1. sympatholytic, alpha/beta blockers, alpha blockers, anti-an- Non-limiting examples of thrombolytic agent antagonists giotensin II agents, beta blockers, calctum channel blockers, include amiocaproic acid (amicar) and tranexamic acid (am- vasodilators and miscellaneous antihypertensives. stat). Non-limiting examples of antithrombotics include Non-limiting examples of an a-blocker, also known as an anagrelide, argatroban, cilstazol, daltroban, defibrotide, a-adrenergic blocker or an a-adrenergic antagonist, include enoxaparin, fraxiparine, indobufen, lamoparan, ozagrel, amosulalol, arotinolol, dapiprazole, doxazosin, ergoloid picotamide, plafibride, tedelparin,ticlopidine andtriflusal. mesylates, fenspiride, indoramin, labetalol, nicergoline, pra- Non-limiting examples of antiarrhythmic agents include zosin, terazosin, tolazoline, trimazosin and yohimbine. In Class I antiarrhythmic agents (sodium channel blockers), Class II antiarrhythmic agents (beta-adrenergic blockers), certain embodiments, an alpha blocker may comprise a Class III antiarrhythmic agents (repolarization prolonging quinazoline derivative. Non-limiting examples of quinazo- drugs), Class IV antiarrhythmic agents (calcium channel line derivatives include alfuzosin, bunazosin, doxazosin,pra- blockers) and miscellaneous antiarrhythmic agents. zosin, terazosin and trimazosin. Non-limiting examples of sodium channel blockers In certain embodiments, an antihypertensive agent is both include Class IA, Class IB and Class IC antiarrhythmic an a- and p-adrenergic antagonist. Non-limiting examples of agents. Non-limiting examples of Class IA antiarrhythmic 20 an alpha/beta blocker comprise labetalol (normodyne, tran- agents include disppyramide (norpace), procainamide (pron- date). estyl) and quinidine (quinidex). Non-limiting examples of Non-limiting examples of anti-angiotensin I] agents Class IB antiarrhythmic agents include lidocaine (xylocalne), include angiotensin converting enzymeinhibitors and angio- tocamide (tonocard) and mexiletine (mexitil). Non-limiting tensin II receptor antagonists. Non-limiting examples of examples of Class IC antiarrhythmic agents include encam- angiotensin converting enzyme inhibitors (ACE inhibitors) ide (enkaid) and flecamide (tambocor). include alacepril, enalapril (vasotec), captopril, cilazapril, Non-limiting examplesofa B-blocker, otherwise known as delapril, enalaprilat, fosinopril, listnopril, moveltopril, perin- a B-adrenergic blocker, a B-adrenergic antagonistor a Class IT dopril, quinapril and ramipril. Non-limiting examples of an antiarrhythmic agent, include acebutolol(sectral), alprenolol, angiotensin II receptor blocker, also knownas an angiotensin amosulalol, arotinolol, atenolol, befunolol, betaxolol, bevan- 30 II receptor antagonist, anANG receptorblocker or anANG-II tolol, bisoprolol, bopindolol, bucumolol, bufetolol, bufuralol, type-1 receptor blocker (ARBS), include angiocandesartan, bunitrolol, bupranolol, butidrine hydrochloride, butofilolol, eprosartan, irbesartan, losartan and valsartan. carazolol, carteolol, carvedilol, celiprolol, cetamolol, clo- Non-limiting examples of a sympatholytic include a cen- ranolol, dilevalol, epanolol, esmolol (brevibloc), indenolol, trally acting sympatholytic or a peripherially acting sym- labetalol, levobunolol, mepindolol, metipranolol, meto- 35 patholytic. Non-limiting examples of a centrally acting sym- prolol, moprolol, nadolol, nadoxolol, nifenalol, nipradilol, patholytic, also known as an central nervous system (CNS) oxprenolol, penbutolol, pindolol, practolol, pronethalol, pro- sympatholytic, include clonidine (catapres), guanabenz panolol (inderal), sotalol (betapace), sulfinalol, talinolol, ter- (wytensin) guanfacine (tenex) and methyldopa (aldomet). tatolol, timolol, toliprolol and xibinolol. In certain embodi- Non-limiting examples of a peripherally acting sym- ments, the beta blocker comprises an aryloxypropanolamine 40 patholytic include a ganglion blocking agent, an adrenergic derivative. Non-limiting examples of aryloxypropanolamine neuron blocking agent, a B-adrenergic blocking agent or a derivatives include acebutolol, alprenolol, arotinolol, alpha] -adrenergic blocking agent. Non-limiting examples of atenolol, betaxolol, bevantolol, bisoprolol, bopindolol, buni- a ganglion blocking agent include mecamylamine(inversine) trolol, butofilolol, carazolol, carteolol, carvedilol, celiprolol, and trimethaphan (arfonad). Non-limiting examples of an cetamolol, epanolol, indenolol, mepindolol, metipranolol, 45 adrenergic neuron blocking agent include guanethidine(is- metoprolol, moprolol, nadolol, nipradilol, oxprenolol, penb- melin) and reserpine (serpasil). Non-limiting examples of a utolol, pindolol, propanolol, talinolol, tertatolol, timolol and B-adrenergic blocker include acenitolol (sectral), atenolol toliprolol. (tenormin), betaxolol (kerlone), carteolol (cartrol), labetalol Non-limiting examples of an agent that prolong repolar- (normodyne,trandate), metoprolol (lopressor), nadanol(cor- ization, also known as a Class III antiarrhythmic agent, gard), penbutolo] (levatol), pindolol (visken), propranolol include amiodarone (cordarone) and sotalol (betapace). (inderal) and timolol (blocadren). Non-limiting examples of Non-limiting examples of a calcium channel blocker, oth- alpha] -adrenergic blocker include prazosin (minipress), dox- erwise knownas a Class IV antiarrhythmic agent, include an azocin (cardura) and terazosin (hytrin). arylalkylamine (e.g., bepridile, diltiazem, fendiline, gallo- In certain embodiments a cardiovasculator therapeutic pamil, prenylamine, terodiline, verapamil), a dihydropyri- agent may comprise vasodilator (e.g., a cerebral vasodilator, a dine derivative (felodipine, isradipine, nicardipine, nife- a coronary vasodilator or a peripheral vasodilator). In certain dipine, nimodipine, nisoldipine, nitrendipine) a piperazinde preferred embodiments, a vasodilator comprises a coronary derivative (e.g., cinnarizine, flunarizine, lidoflazine) or a vasodilator. Non-limiting examples of a coronary vasodilator micellaneous calctum channel blocker such as bencyclane, include amotriphene, bendazol, benfurodil hemisuccinate, etafenone, magnesium, mibefradil or perhexyline. In certain benziodarone, chloracizine, chromonar, clobenfurol, cloni- embodiments a calcium channel blocker comprises a long- trate, dilazep, dipyridamole, droprenilamine, efloxate, eryth- acting dihydropyridine (nifedipine-type) calcium antagonist. rityl tetranitrane, etafenone, fendiline, floredil, ganglefene, Non-limiting examples of miscellaneous antiarrhythmic herestrol bis($-diethylaminoethy] ether), hexobendine,itra- agents include adenosine (adenocard), digoxin (lanoxin), min tosylate, khellin, lidoflanine, mannitol hexanitrane, acecamide, ajmaline, amoproxan, aprindine, bretylium tosy- medibazine, nicorglycerin, pentaerythritol tetranitrate, pen- late, bunaftine, butobendine, capobenic acid, cifenline, dis- trinitrol, perhexyline, pimethylline, trapidil, tricromyl, tri- opyranide, hydroquinidine, indecamide, ipatropium bro- metazidine, troInitrate phosphate and visnadine. US 8,940,712 B2 33 34 In certain embodiments, a vasodilator may comprise a tensin amide, dimetofrine, dopamine, etifelmin, etilefrin, chronic therapy vasodilator or a hypertensive emergency gepefrine, metaraminol, midodrine, norepinephrine, vasodilator. Non-limiting examples of a chronic therapy pholedrine and synephrine. vasodilator include hydralazine (apresoline) and minoxidil Non-limiting examples of agents for the treatment of con- (oniten). Non-limiting examples of a hypertensive emer- gestive heart failure include anti-angiotensin II agents, after- gency vasodilator include nitroprusside (nipride), diazoxide load-preload reduction treatment, diuretics and inotropic (hyperstat IV), hydralazine (apresoline), minoxidil (loniten) agents. and verapamil. In certain embodiments, an animal subject that can not Non-limiting examples of miscellaneous antihyperten- tolerate an angiotensin antagonist may be treated with a com- sives include ajmaline, y-aminobutyric acid, bufeniode, cicle- 10 bination therapy. Such therapy may combine administration tainine, ciclosidomine, a cryptenamine tannate, fenoldopam, of hydralazine (apresoline) and isosorbide dinitrate (isordil, flosequinan, ketanserin, mebutamate, mecamylamine, meth- sorbitrate). yldopa, methyl 4-pyridyl ketone thiosemicarbazone, muzolimine, pargyline, pempidine, pinacidil, piperoxan, pri- Non-limiting examples of a diuretic include a thiazide or benzothiadiazine derivative (e.g., althiazide, bendroflumet- maperone, a protoveratrine, raubasine, rescimetol, ril- 15 menidene, saralasin, sodium nitrorusside, ticrynafen, tri- hazide, benzthiazide, benzylhydrochlorothiazide, buthiazide, methaphan camsylate, tyrosinase and urapidil. chlorothiazide, chlorothiazide, chlorthalidone, cyclopenthi- Incertain embodiments, an antihypertensive may comprise azide, epithiazide, ethiazide, ethiazide, fenquizone, hydro- an arylethanolamine derivative, a benzothiadiazine deriva- chlorothiazide, hydroflumethiazide, methyclothiazide, meti- tive, a N-carboxyalkyl(peptide/lactam) derivative, a dihydro- 20 crane, metolazone, paraflutizide, polythizide, pyridine derivative, a guanidine derivative, a hydrazines/ph- tetrachloromethiazide, trichlormethiazide), an organomercu- thalazine, an imidazole derivative, a quanternary ammonium rial (e.g., chlormerodrin, meralluride, mercamphamide, mer- compound,a reserpine derivative or a suflonamidederivative. captomerin sodium, mercumallylic acid, mercumatilin Non-limiting examples of arylethanolamine derivatives dodium, mercurouschloride, mersaly]), a pteridine(e.g., fur- include amosulalol, bufuralol, dilevalol, labetalol, proneth- 25 therene, triamterene), purines (e.g., acefylline, 7-morpholi- alol, sotalol and sulfinalol. nomethyltheophylline, pamobrom, protheobromine, theo- Non-limiting examples of benzothiadiazine derivatives bromine), steroids including aldosterone antagonists (e.g., include althizide, bendroflumethiazide, benzthiazide, ben- canrenone,oleandrin, spironolactone), a sulfonamide deriva- zylhydrochlorothiazide, buthiazide, chlorothiazide, chlortha- tive (e.g., acetazolamide, ambuside, azosemide, bumetanide, lidone, cyclopenthiazide, cyclothiazide, diazoxide, epithiaz- 30 butazolamide, chloraminophenamide, clofenamide, clopam- ide, ethiazide, fenquizone, hydrochlorothizide, ide, clorexolone, diphenylmethane-4,4'-disulfonamide, dis- hydroflumethizide, methyclothiazide, meticrane, metola- ulfamide, ethoxzolamide, furosemide, indapamide, mefru- zone, paraflutizide, polythizide, tetrachlormethiazide and side, methazolamide, piretanide, quinethazone, torasemide, trichlormethiazide. tripamide, xipamide), a uracil (e.g., aminometradine, ami- Non-limiting examples of N-carboxyalkyl(peptide/lac- 35 sometradine), a potassium sparing antagonist (e.g., tam) derivatives include alacepril, captopril, cilazapril, dela- amiloride, triamterene) or a miscellaneous diuretic such as pril, enalapril, enalaprilat, fosinopril, lisinopril, moveltipril, aminozine, arbutin, chlorazanil, ethacrynic acid, etozolin, perindopril, quinapril and ramipril. hydracarbazine, isosorbide, mannitol, metochalcone, Non-limiting examples of dihydropyridine derivatives muzolimine, perhexyline, ticrnafen and urea. include amlodipine, felodipine, isradipine, nicardipine, nife- 40 Non-limiting examples of a positive inotropic agent, also dipine, nilvadipine, nisoldipine and nitrendipine. known as a cardiotonic, include acefylline, an acetyldigi- Non-limiting examples of guanidine derivatives include toxin, 2-amino-4-picoline, aminone, benfurodil hemisucci- bethanidine, debrisoquin, guanabenz, guanacline, guanadrel, nate, bucladesine, cerberosine, camphotamide, convalla- guanazodine, guanethidine, guanfacine, guanochlor, guan- toxin, cymarin, denopamine,deslanoside, digitalin, digitalis, oxabenz and guanoxan. 45 digitoxin, digoxin, dobutamine, dopamine, dopexamine, Non-limiting examples ofhydrazines/phthalazines include enoximone, erythrophleine, fenalcomine, gitalin, gitoxin, budralazine, cadralazine, dihydralazine, endralazine, hydra- glycocyamine, heptaminol, hydrastinine, ibopamine,a lana- carbazine, hydralazine, pheniprazine, pildralazine and to toside, metamivam, milrinone, nerifolin, oleandrin, ouabain, dralazine. oxyfedrine, prenalterol, proscillaridine, resibufogenin, scil- Non-limiting examples of imidazole derivatives include 50 laren, scillarenin, strphanthin, sulmazole, theobromine and clonidine, lofexidine, phentolamine, tiamenidine andtoloni- xamoterol. dine. In particular embodiments, an intropic agent is a cardiac Non-limiting examples of quanternary ammonium com- glycoside, a beta-adrenergic agonist or a phosphodiesterase pounds include azamethonium bromide, chlorisondamine inhibitor. Non-limiting examples of a cardiac glycoside chloride, hexamethonium, pentacynium bis(methylsulfate), 55 includes digoxin (lanoxin) and digitoxin (crystodigin). Non- pentamethonium bromide, pentolinium tartrate, phenactro- limiting examples ofa B-adrenergic agonistinclude albuterol, pinium chloride and trimethidinium methosulfate. bambuterol, bitolterol, carbuterol, clenbuterol, clorprenaline, Non-limiting examples of reserpine derivatives include denopamine, dioxethedrine, dobutamine (dobutrex), dopam- bietaserpine, deserpidine, rescinnamine, reserpine and syros- ine (intropin), dopexamine, ephedrine, etafedrine, ethylnore- ingopine. 60 pinephrine, fenoterol, formoterol, hexoprenaline, ibopamine, Non-limiting examples of sulfonamide derivatives include isoetharine, isoproterenol, mabuterol, metaproterenol, meth- ambuside, clopamide, furosemide, indapamide, quineth- oxyphenamine, oxyfedrine, pirbuterol, procaterol, protoky- azone,tripamide and xipamide. lol, reproterol, rimiterol, ritodrine, soterenol, terbutaline, tre- Vasopressors generally are used to increase blood pressure toquinol, tulobuterol and xamoterol. Non-limiting examples during shock, which may occur during a surgical procedure. 65 of a phosphodiesterase inhibitor include aminone(inocor). Non-limiting examples of a vasopressor, also known as an Antianginal agents may comprise organonitrates, calctum antihypotensive, include amezinium methyl] sulfate, angio- channel blockers, beta blockers and combinations thereof. US 8,940,712 B2 35 36 Non-limiting examples of organonitrates, also known as delivery vehicle in vivo is a liposome(1.e., an artificial mem- nitrovasodilators, include nitroglycerin (nitro-bid,nitrostat), brane vesicle). The preparation and use of such systemsis isosorbide dinitrate (isordil, sorbitrate) and amy]nitrate (as- well known in the art. Exemplary formulations are also dis- pirol, vaporole). closed in U.S. Pat. No. 5,981,505; U.S. Pat. No. 6,217,900; Endothelin (ET) is a 21-aminoacid peptide that has potent US. Pat. No. 6,383,512; U.S. Pat. No. 5,783,565; U.S. Pat. physiologic and pathophysiologic effects that appear to be No. 7,202,227; U.S. Pat. No. 6,379,965; U.S. Pat. No. 6,127, involved in the developmentofheart failure. The effects ofET 170; U.S. Pat. No. 5,837,533; U.S. Pat. No. 6,747,014; and are mediated through interaction with two classes of cell WO003/093449, which are herein incorporated by reference in surface receptors. The type A receptor (ET-A)is associated their entireties. with vasoconstriction and cell growth while the type B recep- One will generally desire to employ appropriate salts and tor (ET-B) is associated with endothelial-cell mediated buffers to render delivery vehicles stable and allow for uptake vasodilation and with the release of other neurohormones, by target cells. Buffers also will be employed when recom- such as aldosterone. Pharmacologic agents that can inhibit either the production of ET orits ability to stimulate relevant binant cells are introduced into a subject. Aqueous composi- cells are known in the art. Inhibiting the production of ET tions ofthe present invention comprise an effective amount of involvesthe use ofagents that block an enzyme termed endot- the delivery vehicle comprising the inhibitor polynucleotides helin-converting enzymethat is involved in the processing of or miRNApolynucleotide sequences(e.g. liposomesor other the active peptide from its precursor. Inhibiting the ability of complexes or expression vectors) or cells, dissolved or dis- ETto stimulate cells involves the use of agents that block the persed in a pharmaceutically acceptable carrier or aqueous interaction ofET withits receptors. Non-limiting examples of 20 medium. The phrases “pharmaceutically acceptable” or endothelin receptor antagonists (ERA) include Bosentan, “pharmacologically acceptable” refers to molecular entities Enrasentan, Ambrisentan, Darusentan, Tezosentan, Atrasen- and compositions that do not produce adverse, allergic, or tan, Avosentan, Clazosentan, Edonentan, sitaxsentan, TBC other untoward reactions when administered to an animal or 3711, BQ 123, and BQ 788. a human.As used herein, “pharmaceutically acceptable car- In certain embodiments, the secondary therapeutic agent rier” includes solvents, buffers, solutions, dispersion media, may comprise a surgery of some type, which includes, for coatings, antibacterial and antifungal agents, isotonic and example, preventative, diagnostic or staging, curative and absorption delaying agents and the like acceptable for use in palliative surgery. Surgery, and in particular a curative sur- formulating pharmaceuticals, such as pharmaceuticals suit- gery, may be used in conjunction with other therapies, such as able for administration to humans. The use of such media and the present invention and one or more other agents. 30 agents for pharmaceutically active substances is well known Such surgical therapeutic agents for vascular and cardio- in the art. Except insofar as any conventional media or agent vascular diseases and disorders are well known to those of is incompatible with the active ingredients of the present skill in the art, and may comprise, but are not limited to, invention, its use in therapeutic compositions is contem- performing surgery on an organism, providing a cardiovas- plated. Supplementary active ingredients also can be incor- cular mechanical prostheses, angioplasty, coronary artery 35 porated into the compositions, provided they do not inactivate reperfusion, catheter ablation, providing an implantable car- the vectors or cells of the compositions. dioverter defibrillator to the subject, mechanical circulatory The active compositions of the present invention may support or a combination thereof. Non-limiting examples ofa include classic pharmaceutical preparations. Administration mechanical circulatory support that may be used in the ofthese compositions accordingto the present invention may present invention comprise an intra-aortic balloon counter- 40 be via any common route so long as the target tissue is pulsation, left ventricular assist device or combination available via that route. This includesoral, nasal, or buccal. thereof. Alternatively, administration may be by intradermal, subcu- Drug Formulations and Routes forAdministration to Subjects taneous, intramuscular, intraperitoneal or intravenousinjec- The present invention also provides a pharmaceutical com- tion, or by direct injection into cardiac tissue. Pharmaceutical position comprising an agonist or antagonist of miR-29a-c. 45 compositions comprising miRNA antagonists or expression The agonist may be an expression vector comprising a nucleic constructs comprising miRNA sequences mayalso be admin- acid segment encoding miR-29a-c,or a polynucleotide com- istered by catheter systems or systems that isolate coronary prising a mature miR-29a-c sequenceor an effective portion circulation for delivering therapeutic agents to the heart. Vari- thereof. The agonist may be comprised in a lipid delivery ous catheter systems for delivering therapeutic agents to the vehicle. The antagonist may be a polynucleotide that hybrid- heart and coronary vasculature are known in the art. Some izes to miR-29a-c or a target thereof. non-limiting examples of catheter-based delivery methods or Whereclinical applications are contemplated, pharmaceu- coronary isolation methods suitable for use in the present tical compositions will be prepared in a form appropriate for invention are disclosed in U.S. Pat. No. 6,416,510; U.S. Pat. the intended application. Generally, this will entail preparing No. 6,716,196; U.S. Pat. No. 6,953,466, WO 2005/082440, compositions that are essentially free of pyrogens, as well as 55 WO 2006/089340, U.S. Patent Publication No. 2007/ other impurities that could be harmful to humansor animals. 0203445, U.S. Patent Publication No. 2006/0148742, and Colloidal dispersion systems, such as macromolecule U.S. Patent Publication No. 2007/0060907, which are all complexes, nanocapsules, microspheres, beads, and lipid- herein incorporated by reference in their entireties. Such based systems including oil-in-water emulsions, micelles, compositions would normally be administered as pharmaceu- mixed micelles, and liposomes, may be used as delivery tically acceptable compositions, as described supra. vehicles for the oligonucleotide inhibitors (e.g. antagonists) The active compounds mayalso be administered parenter- of microRNA function or constructs expressing particular ally or intraperitoneally. By wayofillustration, solutions of microRNAs. Commercially available fat emulsions that are the active compounds as free base or pharmacologically suitable for delivering the nucleic acids of the invention to acceptable salts can be prepared in water suitably mixed with cardiac and skeletal muscle tissues include Intralipid®, Lipo- a surfactant, such as hydroxypropylcellulose. Dispersions syn®, Liposyn® II, Liposyn® III, Nutrilipid, and other simi- can also be preparedin glycerol, liquid polyethylene glycols, lar lipid emulsions. A preferred colloidal system for use as a and mixtures thereofandin oils. Under ordinary conditions of US 8,940,712 B2 37 38 storage and use, these preparations generally contain a pre- tion, pages 1035-1038 and 1570-1580). Some variation in servative to prevent the growth of microorganisms. dosage will necessarily occur depending on the condition of The pharmaceutical forms suitable for injectable use or the subject being treated. The person responsible for admin- catheter delivery include, for example, sterile aqueous solu- istration will, in any event, determine the appropriate dose for tionsor dispersions andsterile powders for the extemporane- the individual subject. Moreover, for human administration, ous preparation ofsterile injectable solutions or dispersions. preparations should meetsterility, pyrogenicity, general Generally, these preparationsare sterile and fluid to the extent safety and purity standards as required by FDA Office of that easy injectability exists. Preparations should be stable Biologics standards. under the conditions of manufacture and storage and should Cosmetic formulations for increasing collagen deposition be preserved against the contaminating action ofmicroorgan- in tissues may comprise atleast one antagonist ofmiR-29a-c. isms, such as bacteria and fungi. Appropriate solvents or The antagonist may be an antagonist of miR-29a, miR-29b, dispersion media may contain, for example, water, ethanol, miR-29c, or combinations thereof. In some embodiments, the polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, antagonist ofmiR-29a-c is an antagomir. The antagonist may and vegetable oils. The properfluidity can be maintained, for be linked or conjugatedto agents that facilitate the entry ofthe example, by the use of a coating, such as lecithin, by the antagonist into cell or tissues. Such agents may include cell maintenance of the required particle size in the case of dis- internalization transporters, such as antennapedia, TAT, persion and by the use of surfactants. The prevention of the Buforin I, Transportan, model amphipathic peptide, K-FGF, action of microorganisms can be brought about by various Ku70, Prion, pVEC, Pep-1, SynBl, SynB3, SynB5, Pep-7, antibacterial an antifungal agents, for example, parabens, HN-1, Bis-Guanidinium-Spermidine-Cholesterol, Bis- _ chlorobutanol, phenol, sorbic acid, thimerosal, and the like. Guanidinium-Tren-Cholesterol, and polyarginine. The agent In manycases,it will be preferable to include isotonic agents, maybe linked to the miR-29a-c antagonist at its amino or for example, sugars or sodium chloride. Prolonged absorp- carboxy terminus. In one embodiment, the agentis linked to tion of the injectable compositions can be brought about by the antagonist by a sequencethat is cleaved uponentry to the the use in the compositions ofagents delaying absorption, for 25 cell. Such sequencestypically comprise consensus sequences example, aluminum monostearate and gelatin. for proteases as are known in theart. Sterile injectable solutions may be prepared by incorporat- The cosmetic compositions can be formulated into all ing the active compounds in an appropriate amount into a types of vehicles. Non-limiting examples of suitable vehicles solvent along with any other ingredients (for example as include emulsions (e.g., water-in-oil, water-in-oil-in-water, enumerated above) as desired, followed byfiltered steriliza- oil-in-water, oil-in-water-in-oil, oil-in-water-in-silicone _ tion. Generally, dispersions are prepared by incorporating the emulsions), creams, lotions, solutions (both aqueous and various sterilized active ingredients into a sterile vehicle hydro-alcoholic), anhydrous bases (such as lipsticks and which containsthe basic dispersion medium andthe desired powders), gels, and ointments or by other method or any other ingredients, e.g., as enumerated above. In the case of combination of the forgoing as would be known to one of sterile powders for the preparation of sterile injectable solu- 35 tions, the preferred methods of preparation include vacuum- ordinary skill in the art (Remington’s, 1990). Variations and drying and freeze-drying techniques which yield a powder of other appropriate vehicles will be apparent to the skilled the active ingredient(s) plus any additional desired ingredient artisan and are appropriate for use in the present invention. In from a previously sterile-filtered solution thereof. certain embodiments, the concentrations and combinations of The compositions of the present invention generally may 40 the ingredients are selected in such a way that the combina- be formulated in a neutral or salt form. Pharmaceutically- tions are chemically compatible and do not form complexes acceptable salts include, for example, acid addition salts which precipitate from the finished product. (formed with the free amino groups ofthe protein) derived It is also contemplated that aromatic skin-active ingredi- from inorganic acids (e.g., hydrochloric or phosphoric acids, ents and additional ingredients identified throughout this or from organic acids (e.g., acetic, oxalic, tartaric, mandelic, 45 specification can be encapsulated for delivery to a target area and thelike. Salts formed withthe free carboxyl groups ofthe such as skin. Non-limiting examples of encapsulation tech- protein can also be derived from inorganic bases (e.g., niques include the use of liposomes, vesicles, and/or nano- sodium, potassium, ammonium,calcium, or ferric hydrox- particles (e.g., biodegradable and non-biodegradable colloi- ides) or from organic bases(e.g., isopropylamine, trimethy- dal particles comprising polymeric materials in which the lamine,histidine, procaine andthe like. 50 ingredient is trapped, encapsulated, and/or absorbed—ex- Uponformulation, solutions are preferably administered in amples include nanospheres and nanocapsules) that can be a manner compatible with the dosage formulation and in such used as delivery vehicles to deliver such ingredients to skin amountas is therapeutically effective. The formulations may (see, e.g., U.S. Pat. No. 6,387,398; U.S. Pat. No. 6,203,802; easily be administered in a variety of dosage forms such as USS. Pat. No. 5,411,744; and Kreuter 1998, which are herein injectable solutions, drug release capsules and the like. For 55 incorporated by reference in their entireties). parenteral administration in an aqueous solution, for Also contemplated are pharmaceutically-acceptable or example, the solution generally is suitably buffered and the pharmacologically-acceptable compositions. The phrase liquid diluentfirst rendered isotonic for example with suffi- “pharmaceutically-acceptable” or “pharmacologically-ac- cient saline or glucose. Such aqueoussolutions may be used, ceptable” includes compositions that do not produce an aller- for example, for intravenous, intramuscular, subcutaneous 60 gic or similar untoward reaction when administered to a and intraperitoneal administration. Preferably, sterile aque- human. Typically, such compositions are prepared either as ous media are employed as is knownto thoseof skill in theart, topical compositions, liquid solutions or suspensions, solid particularly in light of the present disclosure. By way of formssuitable for solutionin, or suspension in, liquid prior to illustration, a single dose maybe dissolved in 1 ml of isotonic use can also be prepared. Routes of administration can vary NaC]solution and either added to 1000 ml ofhypodermocly- 65 with the location and nature of the condition to be treated, and sis fluid or injected at the proposedsite of infusion, (see for include, e.g., topical, inhalation, intradermal, transdermal, example, “Remington’s Pharmaceutical Sciences” 15th Edi- parenteral, intravenous, intramuscular, intranasal, subcutane- US 8,940,712 B2 39 40 ous, percutaneous, intratracheal, intraperitoneal, intratu- anti-cancer actives, scabicides, pediculicides, antineoplas- moral, perfusion, lavage, direct injection, and oral adminis- tics, antiperspirants, antipruritics, antipsoriatic agents, anti- tration and formulation. seborrheic agents, biologically active proteins and peptides, The compositions of the present invention can be incorpo- burn treatment agents, cauterizing agents, depigmenting rated into products. Non-limiting examples of products agents, depilatories, diaper rash treatment agents, enzymes, include cosmetic products, food-based products, pharmaceu- hair growth stimulants, hair growth retardants including tical products, etc. By way of example only, non-limiting DFMOandits salts and analogs, hemostatics, kerotolytics, cosmetic products include sunscreen products, sunless skin canker sore treatment agents, cold sore treatment agents, tanning products, hair products, fingernail products, moistur- dental and periodontal treatment agents, photosensitizing izing creams, skin benefit creams andlotions, softeners, day actives, skin protectant/barrier agents, steroids including hor- lotions, gels, ointments, foundations, night creams, lipsticks, monesand corticosteroids, sunburn treatment agents, sun- mascaras, eyeshadows, eyeliners, cheek colors, cleansers, screens, transdermal actives, nasal actives, vaginal actives, toners, masks, or other known cosmetic products or applica- wart treatment agents, wound treatment agents, woundheal- tions. Additionally, the cosmetic products can be formulated ing agents, etc. as leave-on or rinse-off products. 15 Any of the compositions described herein may be com- Compositions of the present invention can include addi- prised in a kit. In a non-limiting example, an individual tional ingredients. Non-limiting examples of additional miRNAis includedin a kit. The kit may further include water ingredients include cosmetic ingredients (both active and and hybridization bufferto facilitate hybridization of the two non-active) and pharmaceutical ingredients (both active and strands of the miRNAs. In some embodiments, the kit may non-active). The CTFA International Cosmetic Ingredient include one or more oligonucleotides for inhibiting the func- Dictionary and Handbook (2004) describes a wide variety of tion of a target miRNA.The kit may also include one or more non-limiting cosmetic ingredients that can be used in the transfection reagent(s) to facilitate delivery of the miRNA or context ofthe present invention. Examplesofthese ingredient miRNAantagoniststo cells. classes include: fragrances (artificial and natural), dyes and The components of the kits may be packaged either in color ingredients (e.g., Blue 1, Blue 1 Lake, Red 40,titanium 25 aqueous media or in lyophilized form. The container means dioxide, D&C blue no. 4, D&C green no. 5, D&C orange no. of the kits will generally include at least one vial, test tube, 4, D&C red no. 17, D&C red no. 33, D&C violet no. 2, D&C flask, bottle, syringe or other container means, into which a yellow no. 10, and D&C yellow no. 11), adsorbents, emulsi- componentmaybeplaced, and preferably, suitably aliquoted. fiers, stabilizers, lubricants, solvents, moisturizers (includ- Where there is more than one componentin the kit (labeling ing, e.g., emollients, humectants, film formers, occlusive reagent and label may be packagedtogether), the kit also will agents, and agents that affect the natural moisturization generally contain a second, thirdor other additional container mechanisms of the skin), water-repellants, UV absorbers into which the additional components may be separately (physical and chemical absorbers such as paraminobenzoic placed. However, various combinations of components may acid (“PABA”) and corresponding PABA derivatives, tita- be comprised in a vial. The kits of the present invention also nium dioxide, zinc oxide, etc.), essential oils, vitamins(e.g., 35 will typically include a means for containing the nucleic A, B, C, D, E, and K), trace metals (e.g., zinc, calctum and acids, and any other reagent containers in close confinement selenium), anti-irritants (e.g., steroids and non-steroidal anti- for commercial sale. Such containers may include injection or inflammatories), botanical extracts (e.g., aloe vera, chamo- blow-moldedplastic containers into which the desired vials mile, cucumber extract, ginkgo biloba, ginseng, and rose- are retained. mary), anti-microbial agents, antioxidants (e.g., BHT and 40 When the componentsofthe kit are provided in one and/or tocopherol), chelating agents (e.g., disodium EDTA andtet- moreliquid solutions, the liquid solution is an aqueous solu- rasodium EDTA), preservatives (e.g., methylparaben and tion, with a sterile aqueous solution being particularly pre- propylparaben), pH adjusters (e.g., sodium hydroxide and ferred. citric acid), absorbents (e.g., aluminum starch octenylsucci- However, the components of the kit may be provided as nate, kaolin, corn starch, oat starch, cyclodextrin, talc, and 45 dried powder(s). When reagents and/or componentsare pro- zeolite), skin bleaching and lightening agents (e.g., hydro- vided as a dry powder, the powdercan be reconstituted by the quinone andniacinamidelactate), humectants(e.g., glycerin, addition of a suitable solvent.It is envisioned that the solvent propyleneglycol, butylene glycol, pentylene glycol, sorbitol, mayalso be provided in another container means. urea, and manitol), exfoliants (e.g., alpha-hydroxyacids, and The container means will generally include at least one beta-hydroxyacids such as lactic acid, glycolic acid,and sali- vial, test tube, flask, bottle, syringe and/or other container cylic acid; andsalts thereof) waterproofing agents (e.g., mag- means, into which the nucleic acid formulations are placed, nesium/aluminum hydroxide stearate), skin conditioning preferably, suitably allocated. The kits may also comprise a agents (e.g., aloe extracts, allantoin, bisabolol, ceramides, second container meansfor containing a sterile, pharmaceu- dimethicone, hyaluronic acid, and dipotassium glycyr- tically acceptable buffer and/or other diluent. rhizate), thickening agents (e.g., substances which that can Thekits ofthe present invention will also typically include increase the viscosity of a composition such as carboxylic a means for containing the vials in close confinement for acid polymers, crosslinked polyacrylate polymers, polyacry- commercial sale, such as, e.g., injection and/or blow-molded lamide polymers, polysaccharides, and gums), and silicone plastic containers into which the desired vials are retained. containing compounds(e.g., silicone oils and polyorganosi- Such kits may also include components that preserve or loxanes). 60 maintain the miRNA or miRNAinhibitory oligonucleotides Pharmaceutical ingredients are also contemplated as being or that protect against their degradation. Such components useful with the emulsion compositions of the present inven- may be RNAse-free or protect against RNAses. Such kits tion. Non-limiting examples of pharmaceutical ingredients generally will comprise,in suitable means, distinct containers include anti-acne agents, agents used to treat rosacea, anal- for each individual reagentor solution. gesics, anesthetics, anorectals, antihistamines, anti-inflam- A kit will also include instructions for employing the kit matory agents including non-steroidal anti-inflammatory components as well the use of any other reagent not included drugs, antibiotics, antifungals, antivirals, antimicrobials, in the kit. Instructions may include variations that can be US 8,940,712 B2 41 42 implemented. A kit may also include utensils or devices for and expression in cells. Various cell lines, including those administering the miRNA agonist or antagonist by various derived from skeletal muscle cells, can be utilized for such administration routes, such as parenteral or catheter admin- screening assays, including cells specifically engineered for istration. this purpose. Primary cardiac cells also may be used, as can Tt is contemplated that such reagents are embodiments of the H9C2cell line. kits ofthe invention. Such kits, however, are not limited to the In vivo assays involve the use of various animal models of particular items identified above and may include any reagent heart disease, musculoskeletal disease, fibrosis, or collagen- used for the manipulation or characterization of miRNA. loss including transgenic animals, that have been engineered Methodsfor Identifying Modulators to have specific defects, or carry markers that can be used to The present invention further comprises methodsfor iden- 10 measure the ability of a candidate substance to reach and tifying agonists ofmiR-29a-c that are useful in the prevention affect different cells within the organism. Dueto their size, or treatmentor reversal of cardiac fibrosis, cardiac hypertro- ease of handling, and information on their physiology and phy or heart failure. These assays may comprise random genetic make-up, mice are a preferred embodiment, espe- screening of large libraries of candidate compounds; alterna- cially for transgenics. However, other animals are suitable as tively, the assays may be used to focusonparticularclasses of well, including rats, rabbits, hamsters, guinea pigs, gerbils, compounds selected with an eye towardsstructural attributes woodchucks, cats, dogs, sheep, goats, pigs, cows, horses and that are believed to make them more likely to promote the monkeys (including chimps, gibbons and baboons). Assays expression and/or function of miR-29a-c. for inhibitors may be conducted using an animal model To identify a modulator of miR-29a-c, one generally will derived from any of these species. determine the function of a miR-29a-c in the presence and 20 Treatment ofanimals with test compoundswill involve the absenceof the candidate compound. For example, a method administration of the compound, in an appropriate form, to generally comprises: the animal. Administration will be by any route that could be (a) providing a candidate compound; utilized for clinical purposes. Determining the effectiveness (b) admixing the candidate compound with a miR-29; of a compound in vivo may involve a variety of different (c) measuring miR-29a-c activity; and 25 criteria, including but notlimited to alteration ofhypertrophic (d) comparing the activity in step (c) with the activity of signaling pathways and physical symptoms of hypertrophy. miR-29a-c in the absence of the candidate compound, Also, measuring toxicity and dose responses can be per- wherein a difference between the measuredactivities of formed in animals in a more meaningful fashion than in in miR-29a-c indicates that the candidate compound is, vitro or in cyto assays. indeed, a modulator of miR-29a-c. 30 Transgenic Animals Assays also may be conductedin isolated cells, organs, or in A particular embodimentofthe present invention provides living organisms. transgenic animals that lack one or both functionalalleles of Tt will, of course, be understood that all the screening miR-29a, miR-29b, and/or miR-29c. Also, transgenic ani- methods of the present invention are useful in themselves mals that express miR-29a-c underthe control of an induc- notwithstandingthe fact that effective candidates may not be 35 ible, tissue selective or a constitutive promoter, recombinant found. cell lines derived from such animals, and transgenic embryos The invention provides methods for screening for such may be useful in determining the exact role that miR-29a-c candidates, not solely methodsoffinding them. plays in the control of fibrosis and in the development of As used herein the term “candidate compound”refers to pathologic cardiac hypertrophy and heart failure. Further- any molecule that may potentially modulate fibrosis- or col- 40 more, these transgenic animals may provide an insight into lagen-regulating aspects of miR-29a-c. One will typically heart development. The use of an inducible or repressable acquire, from various commercial sources, molecular librar- miR-29a-c encoding nucleic acid provides a model for over- ies that are believed to meet the basiccriteria for useful drugs or unregulated expression. Also, transgenic animals that are in an effort to “brute force”the identification of useful com- “knocked out” for miR-29a-c, in one or both alleles, are pounds. Screening of such libraries, including combinatori- 45 contemplated. Also, transgenic animals that are “knocked ally-generated libraries (e.g., antagomirlibraries), is a rapid out” for miR-29a-c, in one or both alleles for one or both and efficient way to screen a large numberofrelated (and clusters, are contemplated. unrelated) compounds for activity. Combinatorial In a general embodiment, a transgenic animalis produced approachesalso lend themselves to rapid evolution of poten- by the integration of a given transgene into the genomein a tial drugs by the creation of second, third, and fourth genera- 50 mannerthat permits the expression of the transgene. Methods tion compounds modeled on active, but otherwise undesir- for producing transgenic animals are generally described by able compounds. Wagner and Hoppe(U.S. Pat. No. 4,873,191; incorporated A quick, inexpensive and easy assay to run is an in vitro herein by reference), and Brinsteret al. (1985; incorporated assay. Such assays generally use isolated molecules, can be herein by reference). run quickly and in large numbers, thereby increasing the 55 Typically, a gene flanked by genomic sequencesis trans- amountof information obtainable in a short period of time. A ferred by microinjection into a fertilized egg. The microin- variety ofvessels may be usedto run the assays, including test jected eggs are implantedinto a host female, and the progeny tubes, plates, dishes and other surfaces such as dipsticks or are screened for the expression of the transgene. Transgenic beads. animals may be produced from the fertilized eggs from a A technique for high throughput screening of compounds 60 number of animals including, but not limited to reptiles, is described in WO 84/03564, which1s herein incorporated by amphibians, birds, mammals, and fish. reference in its entirety. Large numbers of small antagomir DNA clones for microinjection can be prepared by any compounds may be synthesized on a solid substrate, such as means knowninthe art. For example, DNA clones for micro- plastic pins or some other surface. Such molecules can be injection can be cleaved with enzymesappropriate for remov- rapidly screening for their ability to inhibit miR-29a-c. 65 ing the bacterial plasmid sequences, and the DNA fragments The present invention also contemplates the screening of electrophoresed on 1% agarose gels in TBE buffer, using compounds for their ability to modulate miR-29a-c activity standard techniques. The DNAbandsare visualized by stain- US 8,940,712 B2 43 44 ing with ethidium bromide, and the band containing the used broadly to encompassall ofthe sequelae associated with expression sequences is excised. The excised band is then heart failure, such as shortness of breath, pitting edema, an placed in dialysis bags containing 0.3 M sodium acetate, pH enlarged tender liver, engorged neck veins, pulmonary rales 7.0. DNA is electroeluted into the dialysis bags, extracted and the like including laboratory findings associated with with a 1:1 phenol:chloroform solution and precipitated by heart failure. two volumesof ethanol. The DNAis redissolved in 1 ml of The term “treatment” or grammatical equivalents encom- low salt buffer (0.2 M NaCl, 20 mM Tris, pH 7.4, and 1 mM passes the improvementand/or reversal of the symptoms of EDTA)andpurified on an Elutip-D™column. The column is heart failure (i.e., the ability of the heart to pump blood). first primed with 3 ml of high salt buffer (1 M NaCl, 20 mM “Improvementin the physiologic function” of the heart may Tris, pH 7.4, and 1 mM EDTA) followed by washing with 5 10 be assessed using any of the measurements described herein mlof low salt buffer. The DNA solutions are passed through (e.g., measurementof ejectionfraction, fractional shortening, the column three times to bind DNAto the column matrix. left ventricular internal dimension, heart rate, etc.), as well as After one wash with 3 mloflow salt buffer, the DNA is eluted any effect upon the animal’s survival. In use of animal mod- with 0.4 ml high salt buffer and precipitated by two volumes els, the response of treated transgenic animals and untreated of ethanol. DNA concentrations are measured by absorption 15 transgenic animals is compared using any of the assays at 260 nm in a UV spectrophotometer. For microinjection, described herein (in addition, treated and untreated non- DNA concentrations are adjusted to 3 ug/ml in 5 mM Tris, pH transgenic animals may be included as controls). A com- 7.4 and 0.1 mM EDTA. Other methods for purification of pound which causes an improvement in any parameter asso- DNA for microinjection are described in in Palmiter et al. ciated with heart failure used in the screening methodsof the (1982); and in Sambrooket al. (2001). 20 instant invention may thereby be identified as a therapeutic In an exemplary microinjection procedure, female mice six compound. weeksofage are inducedto superovulate with a 5 IU injection The term “dilated cardiomyopathy”refers to a type ofheart (0.1 cc, ip) of pregnant mare serum gonadotropin (PMSG; failure characterized by the presence of a symmetrically Sigma) followed 48 hourslater by a 5 IU injection (0.1 cc, ip) dilated left ventricle with poor systolic contractile function ofhuman chorionic gonadotropin (hCG; Sigma). Females are 25 and, in addition, frequently involves the right ventricle. placed with males immediately after hCG injection. Twenty- The term “compound”refers to any chemical entity, phar- one hours after hCG injection, the mated females are sacri- maceutical, drug, and the like that can be used to treat or ficed by C02 asphyxiation or cervical dislocation and prevent a disease, illness, sickness, or disorder of bodily embryos are recovered from excised oviducts and placed in function. Compounds comprise both known and potential Dulbecco’s phosphate buffered saline with 0.5% bovine 30 therapeutic compounds. A compound can be determinedto be serum albumin (BSA; Sigma). Surrounding cumuluscells are therapeutic by screening using the screening methods of the removed with hyaluronidase (1 mg/ml). Pronuclear embryos present invention. A “known therapeutic compound”refersto are then washed and placed in Earle’s balancedsalt solution a therapeutic compoundthat has been shown(e.g., through containing 0.5% BSA (EBSS) in a 37.5° C. incubator with a animal trials or prior experience with administration to humidified atmosphere at 5% CO,, 95% air until the time of 35 humans)to be effective in such treatment. In other words, a injection. Embryos can be implanted at the two-cell stage. known therapeutic compoundis not limited to a compound Randomly cycling adult female miceare paired with vasec- efficacious in the treatmentofheart failure. tomized males. C57BL/6 or Swiss mice or other comparable As used herein, the term “cardiac hypertrophy”refers to strains can be used for this purpose. Recipient females are the process in which adult cardiac myocytes respondto stress mated at the same time as donor females. At the time of 40 through hypertrophic growth. Such growth is characterized embryotransfer, the recipient females are anesthetized with by cell size increases without cell division, assembling of an intraperitoneal injection of 0.015 ml of 2.5% avertin per additional sarcomeres within the cell to maximize force gen- gram of body weight. The oviducts are exposed bya single eration, and an activation of a fetal cardiac gene program. midline dorsal incision. An incision is then made through the Cardiac hypertrophyis often associated with increased risk of body wall directly over the oviduct. The ovarian bursa is then 45 morbidity and mortality, and thus studies aimed at under- torn with watchmakers forceps. Embryosto be transferred are standing the molecular mechanismsof cardiac hypertrophy placed in DPBS (Dulbecco’s phosphate buffered saline) and could have a significant impact on human health. in the tip of a transfer pipet (about 10 to 12 embryos). The As used herein, the term “modulate” refers to a change or pipet tip is inserted into the infundibulum and the embryos an alteration in a biological activity. Modulation may be an transferred. After the transfer, the incision is closed by two 50 increase or a decrease in protein activity, a change in kinase sutures. activity, a change in binding characteristics, or any other changein the biological, functional, or immunological prop- DEFINITIONS erties associated with the activity of a protein or other struc- ture of interest. The term “modulator” refers to any molecule As used herein, the term “heart failure” is broadly used to 55 or compound which is capable of changing oraltering bio- mean any condition that reduces the ability of the heart to logical activity as described above. pumpblood. As a result, congestion and edema develop in the The term “f-adrenergic receptor antagonist” refers to a tissues. Most frequently, heart failure is caused by decreased chemical compound or entity that is capable of blocking, contractility ofthe myocardium,resulting from reduced coro- either partially or completely, the beta (B) type of adrenore- nary blood flow; however, many other factors may result in 60 ceptors (1.e., receptors of the adrenergic system that respond heart failure, including damage to the heart valves, vitamin to catecholamines, especially norepinephrine). Some (-adr- deficiency, and primary cardiac muscle disease. Though the energic receptor antagonists exhibit a degree of specificity for precise physiological mechanisms of heart failure are not one receptor subtype (generally (6,); such antagonists are entirely understood, heart failure is generally believed to termed “B,-specific adrenergic receptor antagonists” and involve disorders in several cardiac autonomic properties, 65 “B.,-specific adrenergic receptor antagonists.” The term including sympathetic, parasympathetic, and baroreceptor B-adrenergic receptor antagonist” refers to chemical com- responses. The phrase “manifestations of heart failure” is pounds that are selective and non-selective antagonists. US 8,940,712 B2 45 46 Examples of f-adrenergic receptor antagonists include, but practice of the invention, and thus can be considered to con- are not limited to, acebutolol, atenolol, butoxamine,carteolol, stitute preferred modes for its practice. However, those of esmolol, labetolol, metoprolol, nadolol, penbutolol, pro- skill in the art should, in light of the present disclosure, panolol, and timolol. The use of derivatives of known (-adr- appreciate that many changes can be made in the specific energic receptor antagonists is encompassed by the methods embodiments which are disclosed andstill obtain a like or of the present invention. Indeed any compound, which func- similar result without departing from the spirit and scope of tionally behaves as a B-adrenergic receptor antagonist is the invention. encompassed by the methods of the present invention. The terms “angiotensin-converting enzyme inhibitor” or EXAMPLES “ACEinhibitor”refer to a chemical compoundorentity that 10 is capable of inhibiting, either partially or completely, the Encoded within an intron of the a-MHCgene is miR-208 enzyme involved in the conversion of the relatively inactive (FIG. 1A). Like a-MHC, miR-208 is expressed specifically in angiotensin I to the active angiotensin IJ in the renin-angio- the heart with trace expression in the lung (FIG. 1B). miR-208 tensin system. In addition, the ACE inhibitors concomitantly is processed out of the a-MHC pre-mRNArather than being inhibit the degradation of bradykinin, which likely signifi- 15 transcribed as a separate transcript. Intriguingly, however, cantly enhances the antihypertensive effect ofthe ACE inhibi- miR-208 displays a remarkably long half-life of at least 14 tors. Examples ofACE inhibitors include, but are not limited days, and can thereby exert functions even when a-MHC to, benazepril, captopril, enalopril, fosinopril, lisinopril, qui- mRNA expression has been down-regulated. Although april and ramipril. The use of derivatives of known ACE genetic deletion ofmiR-208 in micefailed to induce an overt inhibitors is encompassed by the methods of the present 20 phenotype, microarray analysis on hearts from wild-type and invention. Indeed any compound, which functionally behaves miR-208~~ animals at 2 months of age revealed removal of as an ACE inhibitor, is encompassed by the methods of the miR-208to result in pronounced expression ofnumerousfast present invention. skeletal muscle contractile protein genes, which are normally As used herein, the term “genotypes”refers to the actual not expressed in the heart. Thus, these results suggest that genetic make-up of an organism, while “phenotype”refers to 25 under normal conditions miR-208 is co-expressed with the physical traits displayed by an individual. In addition, the sole cardiac-specific MHC geneto maintain cardiomyocyte “phenotype” is the result of selective expression of the identity by repressing the expression of skeletal muscle genes genome(1.e., it is an expression of the cell history and its in the heart. response to the extracellular environment). Indeed, the The most remarkable function ofmiR-208 wasrevealed by human genomecontains an estimated 30,000-35,000 genes. 30 the aberrant response of miR-208-null miceto cardiac stress In each cell type, only a small (1.e., 10-15%)fraction ofthese (van Rooijj et al., 2007). In response to pressure overload by genes are expressed. thoracic aortic constriction or signaling by calcineurin,a cal- The use of the word “a”or “an” when used in conjunction cium/calmodulin-dependent phosphatase that drives patho- with the term “comprising” in the claims and/or the specifi- logical remodeling of the heart, miR-208-null mice showed cation may mean “one,” but it is also consistent with the 35 virtually no hypertrophy of cardiomyocytes or fibrosis and meaning of “one or more,” “at least one,” and “one or more were unable to up-regulate B-MHCexpression (FIGS. 6-8). than one.” In contrast, other stress responsive genes, such as those It is contemplated that any embodiment discussed herein encoding ANF and BNP, werestrongly induced in miR-208 can be implemented with respect to any method or composi- mutant animals, demonstrating that miR-208 is dedicated tion of the invention, and vice versa. Furthermore, composi- 40 specifically to the control of B-MHC expression, which can tions andkits ofthe invention can be used to achieve methods be uncoupled from other facets ofthe cardiac stress response. of the invention. B-MHCexpression is repressed by thyroid hormonesig- Throughout this application, the term “about” is used to naling and is up-regulated in the hypothyroid state (Leung et indicate that a value includes the standard deviation of error al., 2006). miR-208-" animals were also resistant to up- for the device or method being employed to determine the 45 regulation of }-MHCexpression following treatment with the value. T3 inhibitor propylthiouracil (PTU), which induces hypothy- The use of the term “or” in the claims is used to mean roidism.Intriguingly, however, expression of B-MHCbefore “and/or” unless explicitly indicated to refer to alternatives birth was normal in miR-208 mutant mice, indicating that only or the alternatives are mutually exclusive, although the miR-208is dedicated specifically to the post-natal regulation disclosure supports a definition that refers to only alternatives 50 of B-MHCexpression, which coincides with the acquisition and “and/or.” ofthyroid hormone responsivenessof the B-MHCgene(FIG. Asusedin this specification and claim(s), the words “com- 5). prising” (and any form ofcomprising, such as “comprise” and A clue to the mechanism of action ofmiR-208 comes from “comprises”), “having” (and any form of having, such as the resemblance ofmiR-208~~ hearts to hyperthyroidhearts, “have” and “has”), “including” (and any form of including, 55 both of which display a block to B-MHC expression, up- such as “includes” and “include”) or “containing” (and any regulation of stress-response genes and protection against form of containing, such as “contains” and “contain’’) are pathological hypertrophy andfibrosis (FIGS. 6-10). The up- inclusive or open-ended and do not exclude additional, unre- regulation of fast skeletal muscle genes in miR-208-”- hearts cited elements or methodsteps. also mimics the induction of fast skeletal muscle fibers in the Although section headers have been inserted into this 60 hyperthyroid state (Weiet al., 2005). application to facilitate review, such headers should not be These findings suggest that miR-208 acts, at least in part, construed as a division of embodiments. by repressing expression of a common componentofstress- The following examples are includedto further illustrate response and thyroid hormone signaling pathways in the various aspects of the invention. It should be appreciated by heart. Amongthe strongest predicted targets of miR-208 is those of skill in the art that the techniques disclosed in the 65 the thyroid hormone receptor (TR) co-regulator THRAP1, examples which follow represent techniques and/or compo- which can exert positive and negative effects on transcription sitions discovered by the inventor to function well in the (Pantos et al., 2006; Yao and Eghbali, 1992; FIG. 12). The TR US 8,940,712 B2 47 48 acts through a negative thyroid hormoneresponse element and usedfor blastocyst injection. The resulting chimeric mice (TRE)to repress B-MHCexpression in the adult heart (Zhao were bred to C57BL/6to obtain germline transmission of the etal., 2005). Thus, the increase in THRAP1 expression in the mutantallele. absence of miR-208 would be predicted to enhance the Generation of Transgenic Mice. repressive activity of the TR toward B-MHCexpression, con- A mouse genomic fragmentflanking the miRNA of interest sistent with the blockade to B-MHCexpression in miR-208-~ was subcloned into a cardiac-specific expression plasmid hearts. However, although THRAP1 appearsto be a bonefide containing the a-MHCand human GH poly(A)+ signal (Kiri- target for miR-208, these data do not exclude the potential azis and Kranias, 2000). Genomic DNA wasisolated from mousetail biopsies and analyzed by PCRusing primers spe- involvementof additional targets in the regulation of B-MHC 10 cific for the human GH poly(A)+ signal. expression. Western Blotting. Since even a subtle shift towards B-MHCreduces mechani- Myosin was extracted from cardiac tissue as described cal performance andefficiency of the adult heart, it would be (Morkin, 2000). MHC isoforms were separated by SDS of therapeutic value to exploit miR-208 regulation to prevent PAGE and Western blotting was performed with mouse an increase in B-MHCexpression during cardiac disease. The 15 monoclonal a-MHC (BA-G5) (ATCC, Rockville, Md.) and cardiac specificity and dedication of miR-208 to the cardiac mouse monoclonal antimyosin (slow, skeletal M8421) stress response, but not to normalcardiac development, make (Sigma, Mo.), which is highly specific for B-MHC.To detect miR-208 (and its down-stream effectors) an attractive thera- all striated myosin a pan specific antibody (mouse mono- peutic target for manipulating B-MHClevels (FIG. 13). clonal 3-48; Accurate Chemical & Scientific Corporation, Materials and Methods 20 NY) was used. THRAP1 was detected by immunoprecipita- Northern Blot Analysis. tion from 400 pg of cardiac protein lysate. After pre-clearing Cardiac tissue samples of left ventricles of anonymous the samples for 1 hour at 4° C., the supernatant was incubated humans diagnosed as having non-failing or failing hearts overnightat 4° C. with 1 wl rabbit polyclonal anti-THRAP1 (a were obtained from Gilead Colo. (Westminster, Colo.). Car- kind gift of R. Roeder, Rockefeller University) and 15 ul of diac tissue samples of border zone regions of anonymous 25 protein A beads. The beads were washedthree times with humansdiagnosedas having suffered a myocardialinfarction lysis buffer and boiled in SDS sample buffer. Immunoprecipi- were obtained. Total RNA wasisolated from cells, mouse,rat tated THRAP1 protein was resolved by SDS-PAGEand ana- and human cardiac tissue samples or isolated myocytes by lyzed using rabbit polyclonal anti-THRAP!1at a dilution of using Trizol reagent (Gibco/BRL). Equal loading was con- 1:3000 andanti-rabbit IgG conjugated to horseradish peroxi- firmed by staining Northern gels with ethidium bromide. 30 dase at a dilution of 1:5000 with detection by Luminol Northern blots to detect microRNAs were performed as Reagent (Santa Cruz). described previously (van rooij et al., 2006). A U6 probe Histological Analysis and RNA In Situ Hybridization. served as a loading control. To detect a-MHC expression, a Tissues used for histology were incubated in Krebs- Northern blot containing 10 ug ofRNA from cardiac tissue of Henselheit solution, fixed in 4% paraformaldehyde, sec- both adult wild-type and miR-208 mutant animals was 35 tioned, and processed for hematoxylin and eosin (H&E) and probed with a cDNA fragment of a-MHCcovering a part of Masson’s Trichromestaining or in situ hybridization by stan- the 5'UTRregion andfirst exon. dard techniques (Krenz and Robbins, 2004). *°S-labeled PTU Treatment. RNA probes were generated using Maxiscript kit (Amer- Thyroid hormonedeficiency was induced by feeding ani- sham). Signals were pseudocolored in red using Adobe Pho- mals for the indicated durations with iodine-free chow 40 toshop. supplemented with 0.15% PTU purchased from Harlan Tek- Transthoracic Echocardiography. lad Co. (TD 97061) (Madison, Wis.). Cardiac function and heart dimensions were evaluated by Microarray and Real-Time PCR Analysis. two-dimensional echocardiography in conscious mice using Total RNA from cardiac tissue was isolated using Trizol a Vingmed System (GE Vingmed Ultrasound, Horten, Nor- (Invitrogen). Microarray analysis was performed using 45 way) and a 11.5-MHzlinear array transducer. M-modetrac- Mouse Genome 430 2.0 array (Affymetrix). To detect the ings were used to measure anterior and posterior wall thick- level of miRNA, RT-PCR was performed using the Taqman nesses at end diastole and endsystole. Left ventricular (LV) MicroRNA reverse Transcriptase kit (Applied Biosystems, internal diameter (LVID) was measuredasthe largest antero- ABI) according to the manufacturer’s recommendations. posterior diameter in either diastole (LVIDd) or systole Five ng of RNA wasused to generate cDNA with a miRNA 50 (LVIDs). The data were analyzed by a single observer blinded specific primer, after which a miRNAspecific Taqman probe to mouse genotype. LV fractional shortening (FS) was calcu- served to detect the expression level ofthe miRNAofinterest. lated according to the following formula: FS (%)=[(LVIDd- Following RT-PCR with random hexamerprimers (Invitro- LVIDs)/LVIDd]x100. gen) on RNA samples, the expression ofa subset ofgenes was Plasmids and Transfection Assays. analyzed by either PCR or quantitative real time PCR using 55 A 305 bp genomic fragment encompassing the miR-208 Taqman probes purchased from ABI. coding region was amplified by PCR and ligated into Generation of miR-208 Mutant Mice. pCMV6. A 1 kb fragment encompassing the entire murine To generate the miR-208 targeting vector, a 0.4 kb frag- THRAP1-UTR was PCR-amplified and ligated into an HA- ment (5' arm) extending upstream of the miR-208 coding tagged pCMV6expression construct andthefirefly luciferase region was digested with SaclI and Notl and ligated into the 60 (f-luc) reporter construct (pMIR-REPORT™, Ambion). A pGKneoF2L2dta targeting plasmid upstream of the loxPsites mutation of the UCGUCUUA miR-208 seed binding and the Frt-flanked neomycin cassette. A 3.3 kb fragment (3' sequence was constructed through PCR-based mutagenesis. arm) was digested with SalI and HindIII andligated into the Cell Culture, Transfection and Luciferase Assays. vector between the neomycin resistance and Dta negative A 1793-bp genomic fragment encompassing miR-29b-1 selection cassettes. Targeted ES-cells carrying the disrupted 65 and miR-29a coding region was amplified by PCR andligated allele were identified by Southern blot analysis with 5' and 3' into pCMV6. Genomic fragments of the murine 3'UTR probes. Three miR-208 targeted ES clones were identified encompassing the miR-29a-c binding site(s) were PCR-am- US 8,940,712 B2 49 50 plified and ligated into the firefly luciferase (f-luc) reporter erated controls, and CnA Tg mice showedincreased expres- construct (pMIR-REPORT™, Ambion). COS cells were sion of 33 miRNAs compared with non-transgenic littermate transfected with Fugene 6 (Stratagene) according to manu- controls, of which 21 were up-regulated in both models. facturer’s instructions. The total amount ofDNA per well was Similarly, TAB and CnA-induced hypertrophy were accom- kept constant by adding the corresponding amountof expres- panied by reduced expression of 15 and 14 miRNAs,respec- sion vector without a cDNAinsert. 48 hours after transfec- tively, of which 7 miRNAs were down-regulated in common tion, cell extracts were assayed for luciferase expression (FIG. 14B). Northern analysis ofthese miRNAs (unpublished using the luciferase assay kit (Promega). Relative promoter data) and previous microarray analyses (Baradet al., 2004; activities are expressed as luminescence relative units nor- Sempereet al., 2004; Shingara et al., 2005; Liu et al., 2004) malized for $-galactosidase expression in the cell extracts. 10 indicate that they are expressed in a wide range of tissues. Cardiac fibroblasts (CFs) were isolated as described pre- Based on their relative expression levels, conservation of viously (Simpson and Savion, 1982). Briefly, hearts were human, rat and mouse sequences, and levels of expression excised from anesthetized neonatal 1-2 day-old Sprague- during hypertrophy, the inventors focused on 11 up- and 5 Dawley rats (Harlan Sprague Dawley, Indianapolis, Ind.), down-regulated miRNAs(FIG. 14C). minced, and digested with pancreatin 0.1%. Cells were plated Northern blot analysis of cardiac RNA from WT and CnA on primaria plates for 2 h, and the medium which contained Tg animals confirmed an increased expression of miRs-21, the cardiomyocyte fraction of the digested tissue was -23, -24, -125b, -195, -199a, and -214, and decreased expres- removed. Cardiac fibroblasts attached andproliferated much sion ofmiRs-29,-93, -150 and -181b (FIG. 14C and FIG.15). morerapidly than cardiac myocytes; this produced virtually Collectively, these data indicate that distinct miRNAs are pure fibroblast cultures after the first passage, which was 20 regulated during cardiac hypertrophy, suggesting the possi- confirmed by repeated differential plating and microscopic bility that they function as modulators of this process. evaluation. Cells were detached with 0.05% trypsin for pas- saging, and culture studies were performedat passages 2 to 4. Example 2 Cells were grown in high glucose (4.5 gm/It) Dulbecco’s modified Eagle’s medium (DMEM) containing 10% heat- 25 Discovery of the miR-29 Family as Down-Stream inactivated FBS andantibiotics (Penicillin and streptomy- Targets for Regulation by miR-208 cin). Myofibroblast differentiation was induced by changing the medium to low serum (2% FBS) with L-ascorbic acid (10 The inventors performed a miRNA microarray on hearts ug/ul) and administration of 10 ng/ml TGF£1 for 48 hours. from wild-type and miR-208-null micein an effort to identify In Vivo miR-29b Silencing by Anti-miR Treatment. 30 downstream miRNAsthat might mediate the actions ofmiR- Chemically modified antisense oligonucleotides compros- 208 (FIG. 16). They discovered that multiple members of the ing a sequence complementary to miR-29b (anti-miR-29b) miR-29 family were up-regulated in miR-208-null mice were used to inhibit miR-29b expression. All bases were (FIG. 17). Target prediction indicated that miR-29 family 2'-OMe modified, the first two and last four bases contained a members targeted mRNAsencoding multiple collagens and phosphorothioate internucleoside bond andthe 3' end of the 35 other componentsofthe extracellular matrix (FIG. 18). Thus, oligonucleotides was conjugated to cholesterol. Eight week- the up-regulation of miR-29 family members in miR-208- old C57BL/6 male mice received either anti-miR-29b (AsAs- null mice is likely to account for the blockto fibrosis seen in CACUGAUUUCAAAUGGUsGsCsUsAs-Cholesterol) or these animals (FIG. 19). mismatch miR-29b (AsAsAACUGAUGUCACAUGGUSG- The discovery that miR-29a-c is down-regulated in the sAsUsAs-Cholesterol) at a dose of 80 mg/kg body weight or 40 diseased heart and targets mRNAs encoding collagens and a comparable volume ofsaline through tail vein injection. extracellular matrix proteins suggests that strategies to Tissues were collected either 3 days or 3 weeksafter treat- enhance expression of miR-29a-c or its association withtar- ment. get mRNAscan have beneficial effects on the heart in the settings of pathological cardiac remodeling and fibrosis. Example 1 45 Moreover, elevation of miR-29a-c expression or function maypreventfibrosis associated with many diseases in tissues Regulation of Cardiac Hypertrophy and Heart such as skeletal muscle, liver, lung, kidney and others. In Failure by Stress-Responsive miRNAs addition, the discovery that miR-208 represses miR-29a-c expression, and that loss of miR-208 upregulates miR-29a-c In light of their involvement in modulating cellular pheno- 50 expression, indicates that miR-29a-c is a downstream media- types, the inventors hypothesized that miRNAs mayplay a tor of the actions of miR-208 onthe heart. role in regulating the response of the heart to cardiacstress, which is knownto result in transcriptional and translational Example 3 changes in gene expression. To investigate the potential involvement of miRNAs in cardiac hypertrophy, they per- 55 MiR-29a-c Regulates the Expression of Fibrotic formed a side-by-side miRNA microarray analysis in 2 estab- Genes lished mouse models of cardiac hypertrophy, using a microar- ray that represented 186 different miRNAs (Babak etal., To begin to define the possible functions for miR-29a-c in 2004). Mice that were subjected to thoracic aortic banding the heart following MI, the inventors made use of computa- (TAB), which induces hypertrophy by increased afterload on 60 tional predictionsto identify possible miR-29a-c targets. The the heart (Hill et al., 2000), were compared to sham operated Targetscan prediction website indicated an unexpectedly high animals. In a second model, transgenic mice expressing acti- numberof fibrosis-related mRNAs encoding collagens, met- vated calcineurin (CnA)in the heart, which results ina severe, allopeptidases, and integrins as possible targets for miR- well-characterized form of hypertrophy (Molkentin et al., 29a-c (word-wide web at targetscan.org). To determine 1998), were compared to wild-type littermates (FIG. 14A). 65 whether the downregulation of miR-29a-c might regulate RNAisolated from hearts of mice subjected to TAB showed cardiac fibrosis, the inventors focused on predicted targets increased expression of 27 miRNAs compared to sham-op- implicated in ECM productionin heart. Elastin (ELN),fibril- US 8,940,712 B2 51 52 lin 1 (FBN1), collagen type I, al and a2 (COLIAI, oligonucleotide containing a four-base mismatch (mm miR- COL1A2) and collagen type I, al (COL3A1) all contain 29b) as a negative control (FIG. 22A). Three days after a one or more conserved potential seed sequences for miR- single tail vein injection of anti-miR-29b (80 mg/kg), the 29a-c (FIG. 20A). inventors observed a dramatic diminution ofmiR-29b expres- Because miRNAs down-regulate the steady state levels, as sion in all tissues examined (FIG. 22B). In contrast, a com- well as the translation, of their target mRNAs,the inventors parable dose of the mm miR-29b antisense oligonucleotide analyzed the expression of predicted miR-29a-c mRNAtar- had no effect on the expression level ofmiR-29b compared to gets. Real-time RI-PCR analysis of these key regulatory the saline control. Knockdown by anti-miR-29b appeared to genesfor cardiac fibrosis in cardiac samples 3 days after MI be specific to the mature miRNA, since the level of pre- indicated that the specific downregulation ofmiR-29a-c in the miRNA remained comparable between anti-miR and mm infarcted region correlates with the increase in expression of treated animals. While the knockdownin theliver and kidney COL1A1, COL1A2, COL3A1, and FBN1. In contrast, ELN appeared to be complete, a low level of miR-29b remained appeared unchangedin the border zone, and even showed an detectable in the heart and lung (FIG. 22B). increase in the remote myocardium (FIG. 20B). Since the other miR-29 members share high sequence Using a CMV-driven expression plasmid, the inventors homology with miR-29b, the expression ofmiR-29a and-c in overexpressed miR-29b-1 and miR-29a in COScells (FIG. responseto anti-miR-29b wasalso examined. While signifi- a 20C) with luciferase expression plasmids containing the cant knockdownin liver and kidney (especially for miR-29c), 3'-UTRs of the predicted miR-29a-c targets. Increasing was detected, cardiac expression did not appear to change amounts of CMV-driven miR-29b-1/miR-29a resulted in a (FIG. 23). Real-time PCR analysis indicated that miR-29b dose-dependent decrease in luciferase activity, while compa- knockdown was sufficient to induce the expression of col- rable amounts ofmiR-206, as a control, had no effect (FIGS. lagen genes in the liver specifically, while this effect was 20C-D), substantiating these mRNAsas targets for repression absent in the mismatch controls (FIG. 22C). by miR-29a-c. To enhancecardiac knockdown of miR-29b,the inventors injected 80 mg/kg of oligonucleotide intravenously on two Example 4 25 consecutive days and collected material 3 weeks later. North- ern analysis indicated complete knockdown of miR-29b in Regulation of miR-29a-c in Cardiac Fibroblasts kidney and liver in responseto anti-miR-29b comparedto the expression level seen after mm miR-29b injection. Cardiac Cardiac fibrosis is a major aspect ofthe remodeling process levels of miR-29b were also dramatically reduced, while the typically seen in the failing heart. The proliferation of fibro- expression of miR-29b in lung appeared unaffected by anti- blasts and increased deposition of ECM componentsresults miR-29b (FIG. 22D). Collagen expression in the heart was in myocardial stiffness and diastolic dysfunction. Transform- increased in response to miR-29b inhibition (FIG. 22E). ing growth factor B (TGFB) has been shownto play a domi- Taken together, these data indicate that miR-29b functionsas nantrole in the production and deposition of collagens in the a negative regulator of collagen gene expression in vivo and heart and induces a transformation of fibroblasts into myofi- thereby influences collagen deposition and fibrosis in the broblasts (Border and Noble, 1994). Real-time PCR analysis heart and liver. on cardiac fibroblasts exposed to TGFB revealed a decrease in miR-29a-c expression, suggesting that the decrease in miR- Example 6 29a-c following MI might be TGFB-regulated (FIG. 21A). Interestingly, natriuretic peptides like B-type natriuretic pep- 40 Down-Regulation of Collagen Expression with a tide (BNP) have been shownto inhibit TGFB-regulated gene miR-29a-c Mimic expression related to fibrosis and myofibroblast conversion (Kapoun et al., 2004). In this regard, the inventors reported To determine whether overexpression of miR-29a-c was previously that mice lacking the cardiac-specific miRNA capable of reducing collagen expression, the inventors miR-208 were resistant to cardiac fibrosis and remodeling 45 exposed fibroblasts to a miR-29b mimic. The level of miR- and exhibited increased expression of BNP at baseline (van 29b expressionin fibroblasts cultures increased by as much as Rooij et al., 2007). Since BNP is known to antagonize the 400-fold after 3 days of exposure to miR-29b mimic (FIG. effects of TGF, the inventors speculated that the increased 22F). miR-29a expression was unaffected and miR-29c levels of BNP in these mice might enhancethe expression of expression was increased only slightly by miR-29b mimic miR-29a-c. Indeed, Northern analysis showed a dose-depen- (FIG. 22F). Real-time PCRanalysis indicatedthatthe expres- dent increase in miR-29a-c expression upon removal ofmiR- sion of collagen genes was diminished in response to miR- 208, which coincided with an increasing expression level of 29b mimic (FIG. 22G). However, the magnitude of the BNP(FIG. 21B). These data indicate that TGF6 induces the decrease in collagen expression was modest comparedto the expression of collagen related genes in fibroblasts at least increase in expression ofmiR-29b,indicating that miR-29a-c partly through decreasing the level of miR-29a-c, which can 55 levels are not the sole determinant of collagen levels. be inhibited by BNPsecreted by cardiomyocytes. All publications, patents and patent applications discussed and cited herein are incorporated herein by reference in their Example 5 entireties. All ofthe compositions and methods disclosed and claimed herein can be made and executed without undue In Vivo Knockdown of miR-29a-c Induces Fibrosis experimentation in light of the present disclosure. While the and Expression of Collagen Genes compositions and methods of this invention have been described in termsofpreferred embodiments,it will be appar- To further explore the potential role of miR-29a-c as a ent to those of skill in the art that variations may be applied to negative regulator of collagen expression, the inventors the compositions and methods, and in the steps or in the knocked down miR-29b in vivo using cholesterol-modified sequence of steps of the methods described herein without oligonucleotides complementary to the mature miRNA departing from the concept, spirit and scope of the invention. sequence of miR-29b (anti-miR-29b) andeither saline or an Morespecifically, it will be apparentthat certain agents which US 8,940,712 B2 53 54 are both chemically and physiologically related may be sub- Chang etal., Biochim. Biophys. Acta, 1092(2):153-160, 1991. stituted for the agents described herein while the same or Changet al., Mol. Cell. Biol., 9:2153, 1989. similar results would be achieved.All such similar substitutes Changet al., Nature, 430(7001):785-789, 2004. and modifications apparent to those skilled in the art are Chatterjee et al., Proc. Natl. Acad. Sci. USA, 86:9114, 1989. deemed to be within the spirit, scope and concept of the Chen and Okayama, Mol. Cell. Biol., 7(8):2745-2752, 1987. invention as defined by the appended claims. Chenet al., Science, 303(5654):83-86, 2004. Choiet al., Cell, 53:519, 1988. REFERENCES Coffin, In: Virology, Fields et al. (Eds.), Raven Press, NY, 1437-1500, 1990. The following references, to the extent that they provide 10 Cohenet al., J. Cell. Physiol., 5:75, 1987. exemplary procedural or other details supplementary to those Costa et al., Mol. Cell. Biol., 8:81, 1988. set forth herein, are specifically incorporated herein byrefer- Couchet al., Am. Rev. Resp. Dis., 88:394-403, 1963. ence. Couparet al., Gene, 68:1-10, 1988. US. Pat. No. 4,873,191 Cripe et al., EMBO J, 6:3745, 1987. US. Pat. No. 5,604,251 15 Culotta and Hamer, Mol. Cell. Biol., 9:1376, 1989. US. Pat. No. 5,844,107 Dandoloet al., J Virology, 47:55-64, 1983. US. Pat. No. 5,877,302 DeVilliers et al., Nature, 312(5991):242-246, 1984. US. Pat. No. 5,972,900 Deschampsetal., Science, 230:1174-1177, 1985. US. Pat. No. 5,972,901 Dubensky et al., Proc. Natl. Acad. Sci. USA, 81:7529-7533, US. Pat. No. 6,008,336 20 1984. US. Pat. No. 6,077,835 Durandet al., Ann. Med., 27:311-317, 1995. US. Pat. No. 6,200,801 Edbrookeet al., Mol. Cell. Biol., 9:1908, 1989. US. Publn. 20020150626 Edgerton and Roy, J. Appl. Physiol., 89:1224-1231, 2000. US. Publn. 20030032615 Edlundet al., Science, 230:912-916, 1985. USS. Publn. 20030203865 25 Eichhorn and Bristow, Circulation, 94:2285-2296, 1996. USS. Publn. 20040048787 EPO 0273085 Abraham etal., Mol. Med., 8:750-760, 2002. Fatkin et al., J. Clin. Invest., 106(11):1351-1359, 2000. Ambros, Cell, 113(6):673-676, 2003. Fechheimer, et al., Proc Natl. Acad. Sci. USA, 84:8463-8467, Angel et al., Cell, 49:729, 1987b. 1987. Angel et al., Mol. Cell. Biol., 7:2256, 1987a. 30 Feng and Holland, Nature, 334:6178, 1988. Atchison and Perry, Ce//, 46:253, 1986. Ferkolet al., FASEB J., 7:1081-1091, 1993. Atchison and Perry, Ce//, 48:121, 1987. Firak and Subramanian, Mol. Cell. Biol., 6:3667, 1986. Babaket al., RNA 10:1813-1819, 2004. Foecking and Hofstetter, Gene, 45(1):101-105, 1986. Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed.), Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979. Plenum Press, NY, 117-148, 1986. 35 Franzet al., Cardioscience, 5(4):235-43, 1994. Banerji et al., Ce//, 27(2 Pt 1):299-308, 1981. Freyet al., Circulation 109:1580-1589, 2004. Banerji et al., Ce//, 33(3):729-740, 1983. Friedmanet al., Genes Devel., 3:1314, 1989. Barad et al., Genome Res. 14:2486-2494, 1997. Fujita et al., Ced/, 49:357, 1987. Barneset al., J. Biol. Chem., 272(17):11510-11517, 1997. Ghosh and Bachhawat,In: Liver Diseases, Targeted Diagno- Bartel, Ce//, 116:281-297, 2004. 40 sis and Therapy Using Specific Receptors andLigands, Wu Benvenisty and Neshif, Proc. Natl. Acad. Sci. USA, 83(24): et al. (Eds.), Marcel Dekker, NY, 87-104, 1991. 9551-9555, 1986. Ghosh-Choudhury et al., EMBO J, 6:1733-1739, 1987. Berket al., J. Clin. Invest. 117:568-575, 2007. Gilles et al., Cell, 33:717, 1983. Berkhoutet al., Ce//, 59:273-282, 1989. Gloss et al., EMBO J,, 6:3735, 1987. Bhaysar et al., Genomics, 35(1):11-23, 1996. 45 Godboutet al., Mol. Cell. Biol., 8:1169, 1988. Blanar et al., EMBO J, 8:1139, 1989. Gomez-Foix et al., J. Biol. Chem., 267:25129-25134, 1992. Bodine and Ley, EMBO J., 6:2997, 1987. Goodbourn and Maniatis, Proc. Natl. Acad. Sci. USA, Border and Noble, NV. Engl. J. Med., 331:1286-1292, 1994. 85:1447, 1988. Boshart et al., Cell, 41:521, 1985. Goodbournet al., Cell, 45:601, 1986. Bosze et al., EMBO J, 5(7):1615-1623, 1986. 50 Gopal, Mol. Cell. Biol., 5:1188-1190, 1985. Braddocket al., Ce//, 58:269, 1989. Gopal-Srivastavaet al., J. Mol. Cell. Biol. 15(12):7081-7090, Brenneckeet al., Ce//, 113:25-36, 2003. 1995, Brinster et al., Proc. Natl. Acad. Sci. USA, 82(13):4438-4442, Graham and Prevec, In: Methods in Molecular Biology: Gene 1985. Transfer and Expression Protocol, Murray (Ed.), Humana Bristow, Cardiology, 92:3-6, 1999. 55 Press, Clifton, N.J., 7:109-128, 1991. Bulla and Siddiqui, J. Virol., 62:1437, 1986. Graham and Van Der Eb, Virology, 52:456-467, 1973. Calin et al., Proc. Natl. Acd. Sci. USA, 99:15524-15529, Graham etal., J. Gen. Virl., 36(1):59-74, 1977. 2002. Greeneet al., Immunology Today, 10:272, 1989 Campbell and Villarreal, Mo/. Cell. Biol., 8:1993, 1988. Grishoket al., Cell, 106:23-34, 2001. Campere and Tilghman, Genes and Dev., 3:537, 1989. 60 Grossched] and Baltimore, Ce//, 41:885, 1985. Campoet al., Nature, 303:77, 1983. Grunhaus and Horwitz, Seminar in Virology, 3:237-252, Care et al., Nat. Med. 13:613-618, 2007. 1992. Carrington et al. Science, 301(5631):336-338, 2003. Harland and Weintraub, J. Cell Biol., 101(3):1094-1099, Celander and Haseltine, J. Virology, 61:269, 1987. 1985. Celanderet al., J. Virology, 62:1314, 1988. 65 Haslinger and Karin, Proc. Natl. Acad. Sci. USA, 82:8572, Chandleret al., Cell, 33:489, 1983. 1985. Chang and Karin, Nature, 410(6824):37-40, 2001. Hauber and Cullen, J. Virology, 62:673, 1988. US 8,940,712 B2 55 56 Heineke and Molkentin, Nat. Rev. Mol. Cell. Biol. 7:589-600, LaPointeet al., Hypertension 273 Pt 2):715-22, 1996. 2006. LaPointeet al., J. Biol. Chem., 263(19):9075-8, 1988. Henet al., Nature, 321:249, 1986. Larsenet al., Proc Natl. Acad. Sci. USA., 83:8283, 1986. Hensel etal., Lymphokine Res., 8:347, 1989. Laspiaet al., Ce//, 59:283, 1989. Hermonat and Muzycska, Proc. Natl. Acad. Sci. USA, Latimeret al., Mol. Cell. Biol., 10:760, 1990. 81:6466-6470, 1984. Lau et al., Science, 294(5543):858-862, 2001. Herr and Clarke, Ce//, 45:461, 1986. Le Gal La Salle et al., Science, 259:988-990, 1993. Hersdorffer et al., DNA Cell Biol., 9:713-723, 1990. Lee and Ambros, Science, 294(5543):862-864, 2001. Herz and Gerard, Proc. Natl. Acad. Sci. USA, 90:2812-2816, Lee et al., Nature, 294:228, 1981. 1993, 10 Leunget al., Proc. Natl. Acad. Sci. USA, 48:18125-18130, Hill et al., Circulation, 101:2863-2869, 2000. 2006. Hirochikaet al., J Virol, 61:2599, 1987. Levinsonet al., Nature, 295:79, 1982. Hirschet al., Mol. Cell. Biol., 10:1959, 1990. Levrero et al., Gene, 101:195-202, 1991. Holbrooket al., Virology, 157:211, 1987. Lin et al., Mol. Cell. Biol., 10:850, 1990. Horlick and Benfield, Mol. Cell. Biol., 9:2396, 1989. 15 Liu et al., Proc Natl Acad Sci USA 101:9740-9744, 2004. Horwichet al. J Virol, 64:642-650, 1990. Loweset al., J. Clin. Invest., 100(9):2315-2324, 1997. Huanget al., Ce//, 27:245, 1981. Luria et al., EMBO J, 6:3307, 1987. Huget al., Mol. Cell. Biol., 8:3065, 1988. Lusky and Botchan, Proc. Natl. Acad. Sci. USA, 83:3609, Hutvagneret al., PLoS Biol., 2(4):E98, 2004. 1986. Hwanget al., Mol. Cell. Biol., 10:585, 1990. 20 Lusky et al., Mo/. Cell. Biol., 3:1108, 1983. Imagawaet al., Ce//, 51:251, 1987. Macejak and Samow, Nature, 353:90-94, 1991. Imbra and Karin, Nature, 323:555, 1986. Majors and Varmus, Proc. Natl. Acad. Sci. USA, 80:5866, Imleret al., Mol. Cell. Biol., 7:2558, 1987. 1983. Imperiale and Nevins, Mol. Cell. Biol., 4:875, 1984. Mann etal., Ce//, 33:153-159, 1983. Ito and Roeder, Trends Endocrinol. Metab., 12:127-134, 25 Markowitz et al., J. Virol., 62:1120-1124, 1988. 2001. McKinseyand Olson, J. Clin. Invest., 115(3):538-546, 2005. Jakobovits et al., Mol. Cell. Biol., 8:2555, 1988. McNeall et al., Gene, 76:81, 1989. Jameel and Siddiqui, Mo/. Cell. Biol., 6:710, 1986. Meister and Tuschl, Nature, 431:343-9, 2004. Jayneset al., Mol. Cell. Biol., 8:62, 1988. Miksiceket al., Cell, 46:203, 1986. Johnsonet al., Mol. Cell. Biol., 9:3393, 1989. 30 Miyata et al., Circ. Res., 86(4):386-390, 2000. Jones and Shenk, Ce//, 13:181-188, 1978. Molkentin et al., Ce// 93:215-228, 1998. Kadesch and Berg, Mol. Cell. Biol., 6:2593, 1986. Mordacq and Linzer, Genes and Dev., 3:760, 1989. Kanedaet al., Science, 243:375-378, 1989. Moreauetal., Nucl. Acids Res., 9:6047, 1981. Kapounet al., Circ. Res., 94:453-461, 2004. Morkin, Microsc. Res. Tech., 50:522-531, 2000. Karin et al., Mol. Cell. Biol., 7:606, 1987. 35 Mosset al., Biol. Chem., 271(49):31688-31694, 1996. Karin et al., Mol. Cell. Biol., 7:606, 1987. Muesinget al., Ce//, 48:691, 1987. Karlsson et al., EMBO J., 5:2377-2385, 1986. Nakaoetal., Clin. Invest., 100(9):2362-2370, 1997. Katinkaet al., Ce//, 20:393, 1980. Nget al., Nuc. Acids Res., 17:601, 1989. Katinkaet al., Nature, 290:720, 1981. Nicolas and Rubinstein, In: Vectors: A survey of molecular Kato et al, J. Biol. Chem., 266:3361-3364, 1991. 40 cloning vectors and their uses, Rodriguez and Denhardt Kawamotoet al., Mol. Cell. Biol., 8:267, 1988. (Eds), Stoneham: Butterworth, 494-513, 1988. Kelly et al., . Cell Biol., 129(2):383-396, 1995. Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, Kiledjian et al., Mol. Cell. Biol., 8:145, 1988. 1982. Kimuraet al., Dev. Growth Differ. 39(3):257-265, 1997. Nicolau et al., Methods Enzymol., 149:157-176, 1987. Kinugawaet al., Circ. Res., 89:591-598, 2001. 45 Ondeket al., EMBO J, 6:1017, 1987. Kinugawaet al., J. Clin. Endocrinol. Metab., 86:5089-5090, Ornitz et al., Mol. Cell. Biol., 7:3466, 1987. 2001. Palmiteret al., Nature, 300:611, 1982. Kiriazis and Kranias, Annu. Rev. Physiol., 62:321-351, 2000. Pantos et al., Horm. Metab. Res., 38:308-313, 2006. Klaassen’s The Pharmacological Basis of Therapeutics Paskindet al., Virology, 67:242-248, 1975. Klamutet al., Mol. Cell. Biol., 10:193, 1990. 50 Pasquinelli and Ruvkun, Ann. Rev. Cell Dev. Biol., 18:495- Klein et al., Nature, 327:70-73, 1987. 513, 2002. Kochet al., Mol. Cell. Biol., 9:303, 1989. PCT Appin. WO 0071096 Kreket al., Nature Genetics, 37:495-500, 2005. PCT Appin. WO 84/03564 Krenz and Robbins, J. Am. Coll. Cardiol., 44:2390-2397, PCT Appln. WO 98/33791 2004. 55 Pechet al., Mol. Cell. Biol., 9:396, 1989. Kriegler and Botchan, In: Eukarvotic Viral Vectors, Gluzman Pelletier and Sonenberg, Nature, 334(6180):320-325, 1988. (Ed.), Cold Spring Harbor: Cold Spring Harbor Labora- Perales et al., Proc. Natl. Acad. Sci. USA, 91:4086-4090, tory, NY, 1982. 1994. Kriegler and Botchan, Mol. Cell. Biol., 3:325, 1983a. Perez-Stable and Constantini, Mo/. Cell. Biol., 10:1116, Kriegler et al., Ce//, 38:483, 1984. 60 1990. Kriegler et al., Ce//, 53:45, 1988. Physicians Desk Reference Kriegler et al., In: Gene Expression, Alan Liss (Ed.), Hamer Picard and Schaffner, Nature, 307:83, 1984. and Rosenberg, New York, 1983b. Pinkert et al., Genes and Dev., 1:268, 1987. Kriitzfeldt et al., Nature, 438:685-689, 2005. Ponta et al., Proc. Natl. Acad. Sci. USA, 82:1020, 1985. Kuhl et al., Ce//, 50:1057, 1987. 65 Porton et al., Mol. Cell. Biol., 10:1076, 1990. Kunz et al., Nucl. Acids Res., 17:1121, 1989. Potter et al., Proc. Natl. Acad. Sci. USA, 81:7161-7165, 1984. Lagos-Quintanaet al., Science, 294(5543):853-858, 2001. Queen and Baltimore, Ce//, 35:741, 1983. US 8,940,712 B2 57 58 Quinn et al., Mol. Cell. Biol., 9:4713, 1989. Tavernieret al., Nature, 301:634, 1983. Racheret al., Biotechnology Techniques, 9:169-174, 1995. Taylor and Kingston, Mol. Cell. Biol., 10:165, 1990a. Ragotet al., Nature, 361:647-650, 1993. Taylor and Kingston, Mol. Cell. Biol., 10:176, 1990b. Redondoet al., Science, 247:1225, 1990. Taylor et al., J Biol, Chem., 264:15160, 1989. Reisman and Rotter, Mol. Cell. Biol., 9:3571, 1989. Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Remington’s Pharmaceutical Sciences, 15” ed., pages 1035- Press, 149-188, 1986. 1038 and 1570-1580, Mack Publishing Company, Easton, The Merck Index, Eleventh Edition Pa., 1980. Thiesenet al., J. Virology, 62:614, 1988. Renan, Radiother. Oncol., 19:197-218, 1990. Top et al., J. Infect. Dis., 124:155-160, 1971. ResendezJr. et al., Mo/. Cell. Biol., 8:4579, 1988. 10 Treisman, Cell, 46(4):567-174, 1986 Rich et al., Hum. Gene Ther. 4:461-476, 1993. Troncheet al., Mol. Biol. Med., 7:173, 1990. Ridgeway, In: Vectors: A Survey ofMolecular Cloning Vec- Troncheet al., Mol. Cell. Biol., 9(11):4759-4766, 1989. tors and Their Uses, Rodriguez et al. (Eds.), Stoneham: Trudel and Constantini, Genes and Dev., 6:954, 1987. Butterworth, 467-492, 1988. Tur-Kaspaet al., Mol. Cell. Biol., 6:716-718, 1986. Ripe et al., Mol. Cell. Biol., 9:2224, 1989. 15 Tyndell et al., Nuc. Acids. Res., 9:6231, 1981. Rippe, et al., Mol. Cell. Biol., 10:689-695, 1990. van Rooij et al., Proc. Natl. Acad. Sci. USA, 103(48):18255- Rittling et al., Nuc. Acids Res., 17:1619, 1989. 18260, 2006. Rosenet al., Ce//, 41:813, 1988. van Rooij et al., Science 316(5824):575-579. 2007 Rosenfeldet al., Science, 252:431-434, 1991. Vannice and Levinson, J. Virology, 62:1305, 1988. Rosenfeld, et al., Ce//, 68:143-155, 1992. 20 Varmuset al., Ce//, 25:23-36, 1981. Rouxet al., Proc. Natl. Acad. Sci. USA, 86:9079-9083, 1989. Vasseuret al., Proc Natl. Acad. Sci. USA, 77:1068, 1980. Sakai et al., Genes and Dev., 2:1144, 1988. Wagneret al., Proc. Natl. Acad. Sci. USA 87(9):3410-3414, Sambrook and Russell, Molecular Cloning: A Laboratory 1990. Manual 3” Ed., Cold Spring Harbor Laboratory Press, Wang, and Calame, Ce//, 47:241, 1986. 2001. 25 Weberet al., Cell, 36:983, 1984. Satake et al., J. Virology, 62:970, 1988. Weiet al., J. Endocrinol. Invest., 28:8-11, 2005. Schaffneret al., 4 Mol. Biol., 201:81, 1988. Weinbergeret al. Mol. Cell. Biol., 8:988, 1984. Searle et al., Mol. Cell. Biol., 5:1480, 1985. Winoto and Baltimore, Cel/, 59:649, 1989. Sempereet al., Genome Biol 5:R13, 2004. Wonget al., Gene, 10:87-94, 1980. Sharp and Marciniak, Ce//, 59:229, 1989. 30 Wuand Wu, Adv. Drug Delivery Rev., 12:159-167, 1993. Shaul and Ben-Levy, EMBO J., 6:1913, 1987. Wuand Wu,Biochemistry, 27: 887-892, 1988. Sherman etal., Mol. Cell. Biol., 9:50, 1989. Wu and Wu, / Biol. Chem., 262:4429-4432, 1987. Shingaraet al., RNA 11:1461-1470, 2005. Xu et al., Curr, Biol., 13:790-795, 2003. Simpson and Savion, Circ. Res., 50:101-116, 1982. Yamauchi-Takihara et. al., Proc. Natl. Acad. Sci. USA, Sleigh and Lockett, J EMBO, 4:3831, 1985. 35 86(10):3504-3508, 1989. Spalholz et al., Ce//, 42:183, 1985. Yang and Russell, Proc. Natl. Acad. Sci. USA, 87:4144-4148, Spandau and Lee, J. Virology, 62:427, 1988. 1990. Spandidos and Wilkie, EMBO J., 2:1193, 1983. Yanget al., Nat. Med. 13:486-491, 2007. Stephens and Hentschel, Biochem. J, 248:1, 1987. Yao and Eghbali, Circ. Res. 71:831-839, 1992. Stratford-Perricaudet and Perricaudet, In: Human Gene 40 Younget al., In: Handbook ofApplied Therapeutics, 7.1-7.12 Transfer, Eds, Cohen-Haguenauer and Boiron, John and 9.1-9.10, 1989. Libbey Eurotext, France, 51-61, 1991. Yu et al., Biochem. Biophys. Res. Commun. 349(1):59-68. Stratford-Perricaudet et al., Hum. Gene. Ther, 1:241-256, Epub Aug. 11, 2006. 1990. Yutzey et al. Mol. Cell. Biol., 9:1397, 1989. Stuart et al., Nature, 317:828, 1985. 45 Zelenin et al., FEBS Lett., 287(1-2):118-120, 1991. Sullivan and Peterlin, Mol. Cell. Biol., 7:3315, 1987. Zeng et al., Mol. Cell., 9(6):1327-33, 2002. Swartzendruber and Lehman, / Cell. Physiology, 85:179, Zhaoet al., Proc. Natl. Acad. Sci. USA, 102(13):4890-4895, 1975. 2005. Takebe et al., Mol. Cell. Biol., 8:466, 1988. Ziober and Kramer, J. Bio. Chem., 271(37):22915-22, 1996
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 22
<210> SEQ ID NO 1 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 1
tgacgggega gettttggee cgggttatac ctgatgctca cgtataagac gagcaaaaag 60
cttgttggtc a 71
<210> SEQ ID NO 2 <211> LENGTH: 71 US 8,940,712 B2 59 60 -continued
<212> TYPE: DNA <213> ORGANISM: Mus sp.
<400> SEQUENCE: 2 tgacgggtga gettttggce cgggttatac ctgactctca cgtataagac gagcaaaaag 60 ettgttggte a 71
<210> SEQ ID NO 3 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rattus sp.
<400> SEQUENCE: 3 tgacgggtga gettttggce cgggttatac ctgactctca cgtataagac gagcaaaaag 60 ettgttggte a 71
<210> SEQ ID NO 4 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Canis sp.
<400> SEQUENCE: 4 tgacgeatga gcettttggct cgggttatac ctgatgetca cgtataagac gagcaaaaag 60 ettgttggte a 71
<210> SEQ ID NO 5 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: miR-208 sequence
<400> SEQUENCE: 5 auaagacgag caaaaagecuu gu 22
<210> SEQ ID NO 6 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 6
uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aaaguugcag 60 uaggguuge 69
<210> SEQ ID NO 7 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Pan sp.
<400> SEQUENCE: 7
uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69
<210> SEQ ID NO 8 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Mus sp.
<400> SEQUENCE: 8
uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 US 8,940,712 B2 61 62 -continued
uaggguuge 69
<210> SEQ ID NO 9 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Rattus sp.
<400> SEQUENCE: 9 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69
<210> SEQ ID NO 10 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Canis sp.
<400> SEQUENCE: 10 uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69
<210> SEQ ID NO 11 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Gallus sp.
<400> SEQUENCE: 11
uucuugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuuaauuaa aacguugcag 60 uaggguuge 69
<210> SEQ ID NO 12 <211> LENGTH: 72 <212> TYPE: RNA <213> ORGANISM: Takifugu
<400> SEQUENCE: 12 uuccugcuuu aagcaauugg uugaaaauau auguauguaa uggucuuaau uaaaaaaaca 60 aacuaagaca aa 72
<210> SEQ ID NO 13 <211> LENGTH: 69 <212> TYPE: RNA <213> ORGANISM: Danio sp.
<400> SEQUENCE: 13 uuccugcuuu aaagcaauug gucuaaaaua uauguaaucg ucuucauuac aaaaacgaac 60 caucaaacg 69
<210> SEQ ID NO 14 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 14 acegggegage ttttggeccg ggttatacct gatgetcacg tataagacga gcaaaaaget 60 tgttggtcag a 71
<210> SEQ ID NO 15 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Mus sp. US 8,940,712 B2 63 64 -continued
<400> SEQUENCE: 15 acgggtgage ttttggceccg ggttatacct gactctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71
<210> SEQ ID NO 16 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Rattus sp.
<400> SEQUENCE: 16 acgggtgage ttttggceccg ggttatacct gactctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71
<210> SEQ ID NO 17 <211> LENGTH: 71 <212> TYPE: DNA <213> ORGANISM: Canis sp.
<400> SEQUENCE: 17 acgcatgage ttttggctcg ggttatacct gatgctcacg tataagacga gcaaaaaget 60 tgttggtcag a 71
<210> SEQ ID NO 18 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 18 uagcaccauc ugaaaucggu ua 22
<210> SEQ ID NO 19 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 19 uagcaccauu ugaaaucagu guu 23
<210> SEQ ID NO 20 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens
<400> SEQUENCE: 20 uagcaccauu ugaaaucggu ua 22
<210> SEQ ID NO 21 <211> LENGTH: 71 <212> TYPE: RNA <213> ORGANISM: Unknown <220> FEATURE: <223> OTHER INFORMATION: Pre miR-208 sequence
<400> SEQUENCE: 21 ugacgggega gcuuuuggee cggguuauac cugaugcuca cguauaagac gagcaaaaag 60 cuuguugguc a 71
<210> SEQ ID NO 22 <211> LENGTH: 27 <212> TYPE: RNA US 8,940,712 B2 65 66 -continued
<213> ORGANISM: Homo sapiens
<400> SEQUENCE: 22 uageaccauu ugaaagaaau caguguu 27
The invention claimedis: 7. The method of claim 1, wherein the antisense oligo-
1. A method of increasing expression ofone or more extra- m 2 nucleotide comprises a sequencethat is substantially comple- cellular matrix genes in a subject in need thereof comprising mentary to a pre-miR-29a, pre-miR-29b, or pre-miR-29¢ administeringto the fibroblast cells ofthe subject an antisense sequence. oligonucleotide comprising a sequence that is at least par- 8. The method of claim 1, wherein the antisense oligo- tially complementary to a miR-29a, miR-29b, and/or miR- nucleotide is about 15 to about 50 nucleotides in length. 29c sequence, wherein the expression of one or more extra- 15 cellular matrix genes in the fibroblast cells of the subject is 9. The method of claim 1, wherein the antisense oligo- increased following administration of the antisense oligo- nucleotide is about 19 to about 25 nucleotides in length. nucleotide. 10. The method of claim 1, wherein the antisense oligo- 2. The method of claim 1, wherein one or more extracel- nucleotide comprises at least one sugar and/or backbone lular matrix genes is elastin (ELN), fibrillin 1 (FBN1), col- 20 modification. lagen type I al (COL1AL), collagen type I a2 (COL1A2), collagen type HI al (COL3A1), collagen type IV a4 11. The method of claim 10, wherein the sugar modifica- (COL4A4), collagen type V a3 (COL5A3), collagen type XI tion is a modification selected from the group consisting of al (COL11A1), collagen type V al (COL5SA1), or collagen 2'-O-alkyl, 2'-O-methy], 2'-O-methoxyethyl, 2'-fluoro, and a type IV a5 (COL4AS). locked nucleic acid. 25 3. The method of claim 1, wherein the antisense oligo- 12. The method of claim 10, wherein the backbone modi- nucleotide comprises a sequence that is at least partially fication is a phosphorothioate linkage. complementary to SEQ ID NO: 18, SEQ ID NO: 19, and/or 13. The method of claim 1, wherein the antisense oligo- SEQ ID NO:20. nucleotide is conjugated to cholesterolat its 3' terminus. 4. The method of claim 3, wherein the antisense oligo- nucleotide comprises a sequencethatis at least 85% comple- 30 14. The method of claim 1, wherein the antisense oligo- mentary to SEQ ID NO: 18, SEQ ID NO:19, and/or SEQ ID nucleotide is administered by oral, intradermal, intramuscu- NO:20. lar, intravenous, subcutaneous, topical, or intraperitoneal 5. The method of claim 3, wherein the antisense oligo- administration. nucleotide comprises a sequencethat is at least 95% comple- 15. The method of claim 1, wherein the subject has dam- 35 mentary to SEQ ID NO: 18, SEQ ID NO:19, and/or SEQ ID aged skintissue. NO:20. 16. The method of claim 15, wherein the damaged skin 6. The method of claim 3, wherein the antisense oligo- nucleotide comprises a sequence that is 100% complemen- tissue comprises a wound, a scar, wrinkles, stretch marks, sun damage, chemical damage, heat damage,or cold damage. tary to SEQ ID NO:18, SEQ ID NO:19, and/or SEQ ID NO: 20. *****