Screening of Functional Norepinephrine Transporter Insensitive to Cocaine Inhibition and Generation of Knock-In Mouse

SCREENING OF FUNCTIONAL NOREPINEPHRINE TRANSPORTER INSENSITIVE TO COCAINE INHIBITION AND GENERATION OF KNOCK-IN MOUSE

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of the Ohio State University

Hua Wei, M.S.

*****

The Ohio State University

2009

Dissertation Committee: Approved by Howard Haogang Gu, PhD, Advisor ______Lane Jackson Wallace, PhD Advisor Michael Xi Zhu, PhD Biochemistry Graduate Program James Willam Dewille, PhD

ABSTRACT

This dissertation consists of three parts. The first part explores the possibility of screening a functional but cocaine insensitive norepinephrine transporter and generation of a cocaine insensitive knock-in mouse line, the second part attempts to identify residues in mouse norepinephrine transporter (NET) transmembrane domain 3 (TMD3) that would differentiate norepinephrine and dopamine uptake, while the third part discusses that two extracellular cysteines in dopamine transporter form a disulfide bond, which is vital for the transporter’s function.

Cocaine blocks dopamine transporter (DAT), NET and serotonin transporters

(SERT) in the brain and increases extracellular neurotransmitter concentration in various brain regions. It is not known how each of these contributes to complex cocaine addictive effects. Genetically modified mice with a single one of these transporter removed still prefer cocaine, suggesting that none of them is absolutely required for cocaine rewarding effect. We have generated one unique knock-in mouse line, carrying a cocaine insensitive DAT. This mouse line does not show cocaine preference when given cocaine, which showed that DAT is necessary for cocaine rewarding effects.

However, how NET is involved in cocaine addictive effect is still unknown. Based on the previous study, I performed several round of random mutagenesis around

ii residuesF105 and F150 in transmembrane regions 2 and 3 region. One triple mutation

(F101C-A105G-N153T, mNETCGT) that retains wild type uptake activity for substrates but displays decreased cocaine affinity by 37 fold was found. Interestingly, this mutation also decreases desipramine affinity by 24 fold. These results reveal a number of residues in transmembrane regions 2 and 3 that are important for inhibition by different drugs.

To study the exact role of NET involved in cocaine addiction, a knock-in mouse line carrying the above functional and cocaine insensitive NET was generated by replacing wild type NET with mNETCGT. Feeder cell free ES cells (E14Tg2A) were introduced to generate a unique mouse line. This mouse line will be used to study the role of NET in mediating the addictive action of cocaine and the therapeutic effect of desipramine.

Recent research revealed that NET also plays an important role in the regulation of

DA homeostasis. Hence, delineating residues of NET differentially involved in DA and

NE uptake would provide potential intervention for treatment of drug abuse, depression or other related psychiatric disorders. Our study identified for the first time residues in the TM3 region of mNET that are more critical for NE uptake than DA.

Dopaminergic neurotransmission is terminated by removal of extracellular dopamine via DAT, which belongs to a Na+/Cl- dependant neurotransmitter superfamily.

Information about the structure and function relationship of transporters allows us to better understand the molecular mechanism of these transporters and therapeutic drug

iii design. Cysteine residues in transporters form inter- or intra- molecular disulfide bonds which may be critical for proper protein folding, trafficking, surface expression, stability and uptake function. Replacing two extracellular cysteines with alanine in Drosophila melanogaster DAT (dmDAT) abolished transporter uptake activity and surface expression. It has been proposed that these two cysteines form a disulfide bond. However, there was no evidence for the existence of such a disulfide bond. Thus, Dr. Gu generated one functional dmDAT mutant with all cysteines replaced by other residues except two extracellular loop cysteines (EL2), and this mutant was analyzed for this EL2 disulfide bond function.

DEDICATION

Dedicated to my parents, grandparents, and the rest of my family.

ACKNOWLEDGMENTS

First, I would like to acknowledge my advisor Dr. Howard Gu who has always been supportive, helpful and patient throughout my time in the lab. Without his guidance and support, I would not be able to accomplish my doctoral degree. I am very grateful to

Drs. Lane Jackson Wallace, Michael Xi Zhu, and James Willam DeWille for intellectual supports as well as serving on my committee.

I wish to thank my colleagues, Rong Chen, Michael Tilley, Dawn Han, Erik R.

Hill, Brian O’Neill, Brad Martin and Bart Naughton for their great helpfulness and friendship. Working with them made my research in the lab rather enjoyable.

I am so thankful to faculty members and students at the Ohio State University

Pharmacology Department and Biochemistry Program for their kindness and assistance.

Finally, I would like to thank my family for their love, encouragement and support in my life.

vi VITA

1975………………………………………….……..Born, Jiangxi, P.R.China

1992-1996…………………………………………..B.S. Animal Nutrition China Agricultural University

1998-2001……………………………...... M.S. Biochemistry and Molecular Biology China Agricultural University

2001-present………………………………..…..….Graduate Research Associate the Ohio State University

PUBLICATIONS

Wei H, Hill ER, Gu HH, Functional mutations in mouse norepinephrine transporter reduce sensitivity to cocaine inhibition. neuropharmacology doi:10.1016/j.neuropharm.2008.09.008

Chen R(a), Wei H (a), Hill ER, Chen L, Jiang LY, Han DD, Gu HH, Direct evidence that two cysteines in the dopamine transporter form a disulfide bond. (a) These two authors contribute equally to this manuscript. Mol Cell Biochem. 2007. 298:41-8

Chen R, Tilley MR, Wei H, Zhou F, Zhou FM, Ching S, Quan N, Stephens RL, Hill ER, Nottoli T, Han DD, Gu HH, Abolished cocaine reward in mutant mice with cocaine- insensitive dopamine transporter. Proc Natl Acad Sci USA. 2006, 103:9333-8.

Chen R, Wu X, Wei H, Han DD, Gu HH, Molecular cloning and functional characterization of the dopamine transporter from Eloria noyesi, a caterpillar pest of cocaine-rich cocoa plants, Gene. 2006, 366:152-60.

FIELD OF STUDY

Major Field: Biochemistry Program

vii

TABLE OF CONTENTS

Abstract………………………………………………………………………………...ii

Acknowledgments……………………………………………………………….…….vi

Vita………………………………………………………………………….……...... vii

List of Tables…………………………………………………………………..………xii

List of Figures…………………………………………………………..…….….……xiii

List of Abbreviations………………………………………………….…….…..……..xv

Chapters

1. Introduction…………………………………………………….……….…..……...... 1

1.1Norepinephrine …………………………………………………….………….…..1

1.1.1 The noradrenergic system ……………………………………….…….…….1

1.1.2 Molecular characterization of NET …………………….……….……..…….3

1.1.3 Regulation of NET …………………………………………….……….…....6

1.1.4 Structure-function relationship of NET ………………….………………....12

1.1.5 Norepinephrine and cocaine addiction……………………………………....14

1.2 Figures……………………………………………………………...……….…....18

2. Functional mutations in mouse norepinephrine transporter reduce cocaine inhibition

………………………………………………………………………………………….20

2.1 Abstract…………………………………………………….....…………………..20

2.2 Introduction…………….………………………………………..……..…………21 viii

2.3 Material and method………………………………………………..…………..…23

2.4 Results…………………………………………………………..……...…………26

2.4.1 Specific mutations………………………………...……………………..…..26

2.4.2 First round of random mutagenesis…………………………………...…..…26

2.4.3 Second round of random mutagenesis……………………………………….28

2.4.4 Third round of mutagenesis………………….……………………..……..…29

2.4.5 Characterization of the triple mutant F101C-A105G-N153T………..…..…29

2.5 Discussion……………………...…………………………………………….…...30

2.6 Summary………………………………………………………..…..…………….33

2.7 Tables……………………………………………………….……….……….…...35

2.8 Figures………………………………………………………….……………....…38

3. Cocaine insensitive norepinephrine transporter knock-in mouse model for studying in vivo NET contribution to cocaine addcition………….…………..………………….…42

3.1 Abstract……………………………………………..…….…...…....…..….…….42

3.2 Introduction……………...……………………………………..………..…...... 43

3.3 Methods and results…………………...……………….…..…….……….…....…45

3.3.1 Materials……………………………………………..……………………..45

3.3.2 Preparation of the targeting vector and generation of recombinant ES cells46

3.3.3 ES cell culture…………………………………………………..…………..47

3.3.4 ES cell passage and expansion………………………………...…….....…..47

ix 3.3.5 Target vector DNA preparation...…………………………………………..48

3.3.6 Electroporation and isolation of ES cell lines ………………………...... 48

3.3.7 Picking G418 and ganciclovir resistant colonies and ES cell screening…..49

3.3.8 F0 chimera mice generation…………….…………..……………..……….50

3.3.9 F1 chimera mice germline transmission……….…………….………..…....51

3.3.10 Genomic DNA purification…….………………...……………..…...……51

3.3.11 F2 cre removed mice generation and genotyping..……………………….52

3.4 Discussion and summary…………….…………...…………………………..…....53

3.5 Tables…………………….……………….…………………………………...…..54

3.6 Figures……………………………………………………………………….…….55

4. Residues in the transmembrane III of the norepinephrine transporter affecting dopamine and norepinephrine uptake.…………………………………….…..….…….63

4.1 Abstract………………………………………….………………….…….……...63

4.2 Introduction…………………………………………...…………….……..……..64

4.3 Material and methods……………………………..……………………..……….66

4.4 Results……………………………………………………………………....……70

4.4.1 Screening mutants that showed differential selectivity for NE and DA uptake …………………………………………………………………………..….…..70

4.4.2 Identify and characterize mutants displaying differential sensitivity for DA and NE uptake ……………………………………………..…………….…..……...….70

4.4.3 Effects of mutations on nisoxetine and desipramine inhibition to NET….…71

4.5 Discussion………………………………………………………………....….…..72

4.6 Summary…………………………………………….………………………....…75

4.7 Tables…………………………………………………………….…………….…76

4.8 Figures……………………………………………………………………….……82

5. Direct evidence that two cycteins in the dopamine transporter form a disulfide bond

…………………………………………………………………………………..….…..84

5.1 Abstract……………………………………………………………….…....……84

5.2 Introduction…………………………………..……………………….……...…..85

5.3 Material and methods…………………………………………………….…....…87

5.4 Results and discussion……………………………………………………...….…91

5.4.1 Transport activity and pharmacological profiles of cysteine mutants…...….91

5.4.2 Direct evidence of a disulfide bond between the two EL2 cysteines…….…92

5.5 Summary………………………………………………………………………….95

5.6 Figures……………………………………………….……………………...……96

6. Summary and future work………………………………………….……………....100

List of References………………………………………………………………...…....103

LIST OF TABLES

Table 2.1 Summary of the first, second and third round of random mutagenesis in TMD

2 and 3 of mNET.…………………………………...……………..……..……..…....…35

Table 2.2 Cocaine sensitivity of the wild-type and mutant mNET ………..….….….…36

Table 2.3 Comparison of the drug inhibition IC50 values (µM) for wild-type mNET and mNETCGT...... 37

Table 2.4 Transport kinetics for wild-type mNET and mNETCGT ………………...…...37

Table 3.1 Primers for generating targeting vector ……………………………………...54

Table 4.1 A list of oligonucleotide primers for random mutation ….……………..…...76

Table 4.2 Summary of the residues selected for random mutagenesis in TM3 of mNET and functioning……………………………………………………………………..…...77

Table 4.3 DA and NE uptake by mNET WT and mutants…………………….…….….78

Table 4.4 DA and NE uptake kinetics for mutant NETs……………………………….79

Table 4.5 Inhibition profiles for NET mutants…….……………………………...….…80

Table 4.6 Surface/total expression ratio compared to wild type NET.………………....81

xii

LIST OF FIGURES

Figure 1.1 Major projections and nuclei of the noradrenergic system …….……….…18

Figure 1.2 Organization of mNET gene…………………………………………….….19

Figure 2.1 Two dimensional serpentine schematic of the mNET TM2 and TM3….….38

Figure 2.2 Drug inhibitions of mNETCGT and wild-type mNET……………….………39

Figure 2.3 Transport kinetics of the wild-type and mutant mNET. ……………...... ….40

Figure 2.4 Cell surface expression levels of mNET and mNETCGT. ……………….….….…..….41

Figure 3.1 Targeting vector Generation.……………………………………………..…55

Figure 3. 2 Targeting strategy for correct homologous recombination.……….…..……56

Figure 3.3 Alignment of 129/Ola and C57BL/6 NET genome …………………….….57

Figure 3.4 Part of PCR screening results of ES cell colonies with short arm primers....58

Figure 3.5 F0 129/Ola/C57BL/6 chimera mice.…….……………….....……...... 59

Figure 3.6 PCR screening results of short arm and long arm fragments…….…....…....60

Figure 3.7 Three F1 male mice generated by mating F0 male mice with C57BL/6 female mice…………………………………………………………………………………..…61

Figure 3.8 Seven F2 mice generated by mating #1 F1 male mouse with one sox2-cre female mouse…………………………………………………………………………..61 xiii Figure 3.9 Three out of seven F2 mice showed correct Neo cassette removed bands by

PCR with genotyping primers……………………………………….………….…..…..62

Figure 4.1 Total protein expression …………...... 82

Figure 4.2 Surface protein expression……………………………………..….………..83

Figure 5.1 Saturation uptake by wild type dmDAT and cysteine replacement mutants..96

Figure 5.2 Drug inhibition profiles of wild type dmDAT and cysteine replacement mutants…………………………………………………………..…………….…..…....97

Figure 5.3 Direct evidence of a disulfide bond between the two cysteine residues in the second extracellular loop……………………………………………………...…….….98

Figure 5.4 Effect of DTT treatment on DA uptake activity………….……….…….…..99

xiv

LIST OF ABBREVIATIONS

DAT, dopamine transporter; NET, norepinephrine transporter; SERT, serotonine transporter; DA, dopamine; NE, norepinephrine; NA, Noradrenergic; hNET, human norepinephrine transporter; mNET, mouse norepinephrine transporter; dmDAT, drosophila melanogaster dopamine transporter; LeuTAA, leucine transporter; ES cell, embryonic stem cell; LIF, leukocyte inhibitory factor; TK, thymidine kinase; TMD, transmembrane domain; ADHD, attention-deficit hyperactivity disorder; GPCR, G protein-coupled receptors; PKA, protein kinase A; SYN1A, Syntaxin 1A; DMI, desipramine; MTSEA, N-biotinylaminoethyl Methanethiosulfonate; sulfo-NHS-SS- biotin (Sulfosuccinimidyl-2-(biotinamido)-ethyl-1,3-dithiopropionate; DTT, dithiothreitol; PMA, phorbol esters; AMPH, Amphetamine.

CHAPTER 1

1. INTRODUCTION

1.1 Norepinephrine

1.1.1 The noradrenergic system

The noradrenergic system is responsible for synthesis, storage, and release of the neurotransmitter norepinephrine (NE). Noradrenergic (NA) cell bodies are located predominately in the locus coeruleus (LC) A6 cell group, which project to the hippocampus, brainstem, cerebellum, hypothalamus, thalamus and forebrain and in lateral tegmental area, which arises in a number of nuclei of the pons and medulla, such as the A1 and A2 cell groups, and innervates the hypothalamus, midbrain, and extended amygdala (Figure 1.1) (Moore and Bloom 1979). Noradrenergic neurons project to different brain areas to perform different functions: (1) prefrontal cortex to regulate mood, cognition, working memory and attention (Nutt, Lalies et al. 1997), (2) limbic areas to regulate emotions and anxiety, (3) hippocampus and amygdala to enhance long- term emotional memory consolidation, and (4) hypothalamus to regulate of eating, appetite, and weight (Wellman 2000).

NE is synthesized by a series of enzymatic steps with tyrosine as a precursor and transported into synaptic vesicles by the vesicular monoamine transporters. It performs

1 its action by being released into the synaptic cleft, where it acts on downstream adrenergic receptors, followed by signal termination either by degradation, or uptake by monoamine transporters such as the norepinephrine transporter (NET). Besides NET, the dopamine transporter (DAT) can also uptake NE and both DAT and NET exhibit a lower Km for DA transport than for NE transport (Gu, Wall et al. 1994). NE plays two roles as a stress hormone and as a neurotransmitter. NE is the primary neurotransmitter released by the sympathetic nervous system, which mediates the “fight or flight” reaction: preparing the body for action by affecting cardiovascular function, gastrointestinal motility and secretion, bronchiole dilation, and glucose metabolism.

Within the central nervous system, norepinephrine has been associated with several brain functions, including sleep, alertness, memory, learning, and emotions (Rothman and Baumann 2003, 23-40). NET is a member of a large family of Na+/Cl--dependant transporters and is selectively expressed on NE nerve terminal pre-synapses. NET regulates NE both spatially and temporally (Amara and Kuhar 1993) (Pacholczyk,

Blakely et al. 1991) (Fritz, Jayanthi et al. 1998). NET is also an important target of antidepressants and psycostimulants as these drugs bind to NET and block its reuptake activity, which increases extracellular NE levels (Amara and Kuhar 1993) (Pacholczyk,

Blakely et al. 1991). Classical tricyclic antidepressants, such as desipramine and the newer antidepressant reboxetine, which is a norepinephrine reuptake inhibitor (NRI) used in the treatment of clinical depression, panic disorder, and attention-deficit hyperactivity disorder (ADHD) (Wong, Sonders et al. 2000).

2 The noradrenergic receptors are a class of G protein-coupled receptors

(GPCR).These receptors are divided into three groups: the α1, α2, and β receptors. Each of these groups is composed of three subtypes. The cell type and receptor subtype determines NE’s ultimate cellular effects. NE can stimulate or inhibit neurons and can exert a biphasic effect by acting on a different set of receptors (Smythies 2005). In the past, some confusion has existed in the nomenclature within the α1 and α2 receptor groups. There is, however, consensus now about the terminology of the nine adrenergic receptors: α1A, α1B, α1D, α2A, α2B, α2C, β1, β2, and β3. Although several of these receptors can couple to more than one G-protein, the classic coupling pathways for

α1AR, α2AR, and βAR are via Gq, Gi, and Gs respectively (Gq activation leads to activation of phospholipase C, which increases intracellular inositol 1,4,5-trisphosphate

2+ and Ca concentrations; Gi (Gi activation leads to inhibition of adenylyl cyclase and activation of α2-receptors leads to the inhibition of adenylyl cyclase which results in decreased intracellular cAMP levels; and Gs activation leads to activation of adenylyl cyclase and an increased cAMP level. The signaling pathways of these adrenergic receptors and their cell-type distribution has been extensively studied (Hein 2006).

1.1.2 Molecular characterization of NET

NET transports NE and DA from the synapse back into vesicles for storage, and therefore plays a major role in regulating the function of NE. Pacholczyk and colleagues isolated a complementary DNA clone encoding a human NET (hNET) in 1991

(Pacholczyk, Blakely et al. 1991). The hNET gene is localized at chromosome 16q12.2

3 (Gelernter, Kruger et al. 1993) (Bruss, Kunz et al. 1993). The cDNA sequence predicts a protein of 617 amino acids, with 12-13 highly hydrophobic regions compatible with membrane-spanning domains. Norepinephrine transport activity is sodium-dependent and sensitive to selective NET inhibitors. The predicted protein sequence demonstrated a significant amino-acid identity with the Na+/gamma-aminobutyric acid transporter, which lead to the discovery of a new gene family of neurotransmitter transporter proteins (Pacholczyk, Blakely et al. 1991). The bovine NET (bNET), and rat NET

(rNET) were cloned by different groups (Lingen, Bruss et al. 1994), (Bruss, Kunz et al.

1993). Murine NET (mNET) was cloned by Fritz and coworkers (Fritz, Jayanthi et al.

1998). The mNET gene (Slc6a5) was mapped to murine chromosome 8, one recombinant distal to marker D8Mit15, mNET is also a 617-amino acid protein with 12 putative membrane-spanning regions (Figure1.2) and 94% identity to human NET. The coding exons of the mNET cDNA were found to spread across more than 36 kb of

129/Svj genomic DNA, with exon-intron boundaries bearing consensus gt/ag splice sites

(Fritz, Jayanthi et al. 1998). It was shown that both the NH2 terminus and loops between transmembrane domains (TMD) 2 and 3, 4 and 5, 6 and 7, 8 and 9, and 10 and 11 as well as the COOH terminus were all located intracellularly. There is a large extracellular loop between TMD3 and 4, which is supposed to be important for protein glycosylation, trafficking, and uptake function.

There are two canonical N-linked glycosylation sites at the extracellular loop between TMD3 and TMD4 of mNET (Fritz, Jayanthi et al. 1998). These two glycosylation sites are conserved among the Na+/Cl--dependent transporter family from

4 different species. Site-directed mutagenesis at these glycosylation positions completely abolished NET function, stability, and cell surface targeting, which suggests that glycosylation is critical for NET function (Fritz, Jayanthi et al. 1998).

Also, the addition of a carbohydrate moiety has been shown to dramatically increase

NE uptake (Melikian, McDonald et al. 1994), (Melikian, Ramamoorthy et al. 1996),

(Nguyen and Amara 1996). Glycosylated NET protein is more likely to be on the cell surface than the unglycosylated forms or partially glycosylated forms. Partially glycosylated or unglycosylated forms are retained in the cytoplasm and not directed to the cell surface (Melikian, Ramamoorthy et al. 1996), (Nguyen and Amara 1996). NET surface trafficking is a dynamic process. There is a basal recycling rate of NET from the plasma membrane into endosomal membrane compartments at a rate of approximately

3-5% per minute. Recent studies have identified residues 584–593 (LWERLAYGIT) in the C-termini of these transporters that play a vital role in their constitutive and regulation-dependent endocytosis (Holton, Loder et al. 2005). This region of the NET is conserved amongst Na+/Cl– dependent transporters. Mutations of this sequence blocked the constitutive endocytosis of the transporter (Holton, Loder et al. 2005).

Na+ and Cl- are also two critical ions that are involved in normal NET function.

Kinetic studies revealed that Na+ and Cl- binding to NET are prerequisite for the substrate to bind to the transporter. Following the binding of the substrate, both Na+ and

Cl- are cotransported into the cytoplasm. Na+-K+ ATPase, a key ion pump, provides the energy by maintaining a Na+ concentration gradient across the plasma membrane.

5 Ouabain, a Na+-K+ ATPase inhibitor, significantly inhibited Na+-dependent [3H]NE uptake (Inazu, Takeda et al. 2003).

1.1.3 Regulation of NET

NET is regulated by a number of intracellular signaling proteins, molecules, extracellular neurotransmitters, substrates, and inhibitors, which acting by affecting NET function, expression, or trafficking.

There are a number of phosphorylation sites on NET which regulates NET function but may be cell type specific. In PC12 cells, the short-term (15 minutes) treatment by a protein kinase A (PKA) activator, forskolin, decreased NET activity (Bryan-Lluka,

Paczkowski et al. 2001). The same treatment had no effect on hNET or rNET transfected

SK-N-SH-SY5Y cells or COS-7 cells. Cyclic AMP treatment did not affect [3H]- nisoxetine binding to PC12 cells (Bryan-Lluka, Paczkowski et al. 2001). Forskolin (10-

100µM) inhibited [3H]NE uptake and returned NE accumulation back to basal levels

(Bunn, O'Brien et al. 1992), demonstrating that the PKA signaling pathway regulates NE uptake. Long-term (24 h) exposure to cAMP also caused a decrease in [3H]NE uptake and NET mRNA in PC12 cells, but it had no effect on human or rat NET transfected

SK-N-SH-SY5Y cells. Hence, cAMP induces a cell type-dependent reduction in NET activity after short-term exposure and after long-term exposure it reduces NET protein expression (Bryan-Lluka, Paczkowski et al. 2001).

There are two potential protein kinase C (PKC) phosphorylation sites in NET.

PKC-activating phorbol esters (PMA) diminished NE transport capacity (Vmax) with

6 little change in NE affinity (Km). It has been shown that PKC and protein phosphatase(s) regulate NET phosphorylation and trafficking (Jayanthi, Samuvel et al. 2004). In SK-N-

SH cells, beta-PMA reduced the number of [3H]nisoxetine binding sites without a change in the Kd to nisoxetine or the total membrane NET density. Cell-surface biotinylation and confocal immunofluorescence experiments also confirmed that PKC reduces cell-surface human NET protein expression (Apparsundaram, Schroeter et al.

1998). Further studies showed that after beta-PMA treatment, there was a reduced NET level in the lipid raft fractions suggesting that cholesterol-rich lipid rafts mediate PKC- triggered NET internalization (Jayanthi, Samuvel et al. 2004). Recently Jayanthi and colleagues showed that Thr-258 and Ser-259 is a PKC-specific phospho-acceptor site and that phosphorylation of this motif is linked to PKC-induced NET internalization

(Jayanthi, Annamalai et al. 2006).

Syntaxin 1A (SYN1A), a presynaptic soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) protein, has been implicated in the regulation of ion channels. SYN1A can bind to the NH2 terminal domain of NET, which reduces its surface trafficking and decreases its activity. Deletion of the NH2 terminal domain both eliminated NET/SYN1A associations and prevented phorbol ester triggered NET down regulation (Sung, Apparsundaram et al. 2003). PKC activation disrupted surface

NET/SYN1A interactions and down regulated NET activity in a syntaxin dependent manner. SYN1A influenced NE transport only in the presence of Ca2+ in brain cortical synaptosomes. Disruption of NET/SYN1A interaction abolished inhibition of NE transport by PKC activator PMA, but had no effect on transport inhibition by the Ca2+

7 modulin kinase (CaMK) inhibitor KN93. Therefore, SYN1A regulation of NET activity likely relies on regulation by PKC signaling, PKC can either positively or negatively modulate NET activity depending on coincident Ca2+ dynamics (Sung and Blakely

2007).

Besides protein kinases, extracellular Ca2+ also plays an important role in NET function. In PC12 cells, pre-incubation with 1 mM Ca2+ induced a significant increase in

3 the Bmax and Kd of [ H]desipramine binding (Uchida, Kiuchi et al. 1998), which was mediated by activation of calmodulin dependent protein kinases and phosphorylation at the NET COOH-terminal domain, probably through activation and translocation of the

NET to the plasma membrane and/or direct phosphorylation of the transporter itself

(Uchida, Kiuchi et al. 1998).

Studies using PC12 cells have shown that NET uptake is dose-dependently reduced as a result of exposure to extracellular NE. This decrease of NE uptake activity was associated with reductions of NE binding and NET protein expression, but no changes in

NET mRNA level, which is likely caused by NE induced oxidative stress (Mao, Qin et al. 2004). Also, Mao and colleagues found that NE decreased glycosylated 80-KDa NET in both membrane and cytosolic fractions and increased unglycosylated 46-KDa NET protein in the cytoplasm. These changes were accompanied by induction of endoplasmic reticulum stress signals (Mao, Iwai et al. 2005). Also, Zhu showed that [3H]nisoxetine binding to NET and NET protein levels were also reduced by exposure of cells to high concentrations of NE, which is consistent to Mao’s result (Zhu, Shamburger et al. 2000),

(Mao, Qin et al. 2004).

8 Therapeutic effects of antidepressants to depression need several weeks of daily treatments. Thus, long term therapeutic effects are more important to these antidepressants. Exposure of HEK-293 cells transfected stably with the hNET cDNA to desipramine (DMI) for 3 days reduced the specific binding of [3H]nisoxetine in membrane homogenates in a concentration-dependent manner. The magnitude of the reductions in [3H]nisoxetine binding to hNET was dependent on the length of time of the exposure to desipramine, reaching 77% after 21 days (Zhu, Blakely et al. 1998).

Desipramine induced reductions of [3H]nisoxetine binding to NET in PC 12 cells require more than 24 h of the drug treatment, and less than 4 h of the drug had no effect to uptake capacity (Ordway, Jia et al. 2005). This NET protein reduction is not due to a reduction of mRNA level and is presumably a consequence of reduction of NET translation or protein degradation (Zhu, Blakely et al. 1998). Incubation of 293-hNET cells with 500 nM DMI for 1 h or 1 day persistently inhibited the uptake of [3H]NE up to

7 days, despite daily repeated washing of cells with drug-free medium. However, the retention and slow diffusion of DMI and nisoxetine from membranes may contribute to their pharmacological and modulatory action on NET (Zhu, Kyle et al. 2004). In vivo studies showed that treatment of rats with 15 mg/kg per day desipramine reduced NET expression in cerebral cortex and hippocampus and reduced the time of immobility in the forced-swim test. The antidepressant-like effect on forced-swim behavior was evident 2 days following discontinuation of DMI treatment when plasma and brain levels of DMI and its major metabolite desmethyldesipramine were not detectable.

Reduced NET expression resulted in decreased in vitro NE uptake, and increased in vivo

9 noradrenergic neurotransmission (Zhao, Baros et al. 2008). Thus, the down regulation of

NET by DMI is accompanied by a reduction of NE uptake. Three to 6 weeks of desipramine treatment by osmotic minipumps in rats decreased [3H]nisoxetine binding sites as well as [3H]NE uptake in hippocampus and cortex. However, NET messenger

RNA levels in the locus coeruleus were unchanged by the DMI treatment (Benmansour,

Altamirano et al. 2004).

Cocaine is also a NET inhibitor. A number of studies using different treatments have investigated the effects of cocaine on NET. In 293hNET cells, exposure of intact

3 cells to cocaine for 3 days did not significantly affect the Bmax or Kd of [ H]nisoxetine binding to NET in membrane homogenates, nor did it alter levels of NET immunoreactivity or NET mRNA (Zhu, Shamburger et al. 2000). Recent evidence suggests that chronic cocaine usage can induce changes in the noradrenergic system. In monkeys, self-administration of cocaine can up-regulate the NET in the bed nucleus of the stria terminalis (BNST) - a key position to influence the integration of motivational and visceral functions - as well as other areas related to drug addiction, such as amygdala, entorhinal cortex, and hippocampus (Macey, Smith et al. 2003), (Beveridge,

Smith et al. 2005). However, NET mRNA in the locus coeruleus remained unaltered under chronic cocaine self-administration conditions in rats (Arroyo, Baker et al. 2000).

Belej and coworkers reported that repeated cocaine administration to rats did not produce a major effect on [3H]nisoxetine binding to brain NET (Belej, Manji et al.

1996). These findings suggest that human NA system has a more important role in cocaine effects compared to rodents.

10 Amphetamine (AMPH) is not only a NET inhibitor and phycostimulant but also a

NET substrate that can induce neurotransmitter release. AMPH works through releasing intracellular Ca2+ and activating protein kinases to reverse transporter activity. Unlike cocaine, which show equivalent affinities for DAT and NET, AMPH is most potent at inhibiting hNET (Ki = 0.07 µM) compared to hDAT (Ki = 0.64 µM) and hSERT (Ki =

38 µM) (Han and Gu 2006). Fleckenstein and colleagues showed that one single dose of

AMPH administration rapidly and reversibly decreased DAT and SERT Vmax in vivo

(Fleckenstein, Haughey et al. 1999). In HEK-293 cells transfected with human NET cDNA, incubation of cells with AMPH significantly reduced [3H]nisoxetine binding and levels of NET immunoreactivity in a time-dependent manner, although NET mRNA levels appeared to be unaffected (Zhu, Shamburger et al. 2000). Exposures to cocaine or

AMPH resulted in significant reductions of [3H]NE uptake, and the magnitude of the reduction induced by AMPH was much greater than that by cocaine (Zhu, Shamburger et al. 2000). Most recently, Dipace and colleagues showed that in hNET- catecholaminergic cell lines, AMPH activation of CAMKII stabilizes a hNET/SYN1A complex and causes a slow and small reduction of surface hNET with a modest increase in hNET/SYN1A associations at the plasma membrane. This hNET/SYN1A complex rapidly redistributes upon AMPH treatment (Dipace, Sung et al. 2007) and the NH2- terminus negatively regulates this response. A deletion hNET28-47 caused more rapid and extensive AMPH-induced transporter redistribution (Dipace, Sung et al. 2007).

11 1.1.4 Structure-function relationship of NET

NET is a member of the 12 TMD neurotransmitter sodium symporter (NSS) family.

Mutations in different regions influence NET surface trafficking, inhibitor binding, substrate uptake, and even protein expression. Thus, clarifying NET’s structure and function relationship can provide necessary information for rational drug design of novel medications for drug abuse and psychiatric disorders.

Studies using chimeric transporters and site-directed mutagenesis identified domains and residues involved in substrate and antagonist binding to these transporter proteins. For example, mouse DAT-NET chimeras indicate that residues in TMD2 and

TMD3 of mouse DAT are more important for uptake of DA than NE, whereas residues in TMD1, TMD2, and TMD3 of mNET are more involved in desipramine and nisoxetine recognition than DA recognition (Buck and Amara 1995). Additionally, residues in TMD3 of mouse SERT are important in substrate and inhibitor binding

(Chen, Sachpatzidis et al. 1997) (Henry, Field et al. 2006) (Chen and Rudnick 2000).

The recent publication of the crystal structure of a bacterial leucine transporter

(LeuTAA), a member of Na+/Cl--dependent symporter superfamily, indicates that a conserved tyrosine in the central TM3 region is likely to have direct involvement in substrate binding (Yamashita, Singh et al. 2005).

No direct contacts between a substrate or inhibitor and a specific amino acid residue side chain of a plasma membrane monoamine transporter protein have been established.

Site-directed mutagenesis provids a powerful tool to reveal the structure functions relationships of these transporters. Replacement of glutamate (E) residue 113 in TMD2

12 with alanine (A) or aspartic acid (D) resulted in reduced cell surface expression, reduced nisoxetine affinity at E113A, eliminated norepinephrine uptake and altered cocaine and desipramine affinities in all mutants. Thus, a 1-carbon shorter side chain at this position somehow profoundly disturbs substrate binding (Surratt, Ukairo et al. 2005). Recently, our lab showed that, a triple mutant mouse DAT (L104V, F105C and A109V) at TMD2 retained over 50% uptake activity, but was 69-fold less sensitive to cocaine inhibition when compared with the wild-type mouse DAT (Chen, Han et al. 2005). This is likely due to a perturbed interaction of TMD2 with TMD6 according to the LeuT crystal structure (Yamashita, Singh et al. 2005), which would affect ligand and cocaine binding indirectly (Sen, Shi et al. 2005).

Hahn and colleagues reported that a polymorphism in hNET-A457P in TMD9 found in orthostatic intolerance patients, contributed to elevated heart rate, disrupted NET biosynthesis, surface trafficking and uptake activity, exerted a dominant negative effect on wild type hNET uptake activity, and disrupted NE homeostasis and cardiovascular function (Hahn, Robertson et al. 2003). This indicates an important contribution of

TMD9 to substrate binding and protein translocation (Hahn, Robertson et al. 2003).

Hahn and coworkers also examined additional amino acid variants and found that hNET

A369P was defective in glycosylation, surface expression and transport activity. F528C showed increased transport activity, insensitivity to PKC mediated internalization and decreased potency for tricyclic antidepressant desipramine (Hahn, Mazei-Robison et al.

2005). This research revealed that these key regions of NET contribute to transporter biosynthesis, activity, and regulation (Hahn, Mazei-Robison et al. 2005). However,

13 studies with hNET variants in panic disorder patients did not show significant association with panic disorder (Sand, Mori et al. 2002) and 1287A/G exonic polymorphism failed to support the association between this polymorphism with obsessive-compulsive disorder (Miguita, Cordeiro et al. 2006). Neither the polymorphism in hNET promoter and 5’-UTR showed association with the overall diagnosis of panic disorder (Lee, Hohoff et al. 2005). However, in panic disorder subgroups without agoraphobia, two polymorphisms were found to be associated to this disease (Lee, Hohoff et al. 2005). Recently, an A/T polymorphism at -3081bp upstream of the transcription initiation site of the hNET gene were found to significantly decrease promoter function compared with the A allele by promoter-reporter assay, and clinical studies showed that patients with ADHD were more likely to have a T allele variant, suggesting that anomalous transcription factor based repression of NET may increase risk for the development of attention-deficit hyperactivity disorder and other neuropsychiatric diseases (Kim, Hahn et al. 2006).

1.1.5 Norepinephrine and cocaine addiction

In humans, cocaine increases heart rate and respiration, body temperature, reduces appetite, as well as increases performance on some cognitive and motor tasks (Fischman and Schuster 1982). Cocaine produces its powerful effects by inhibiting monoamine transporters including DAT, NET, and SERT and increasing extracellular monoamines concentration. Cocaine inhibits all three monoamine transporters from human and mouse with similar potencies (Han and Gu 2006). An abundance of evidence is

14 consistent with the notion that cocaine inhibition of DAT and subsequent elevation of extracellular DA plays the major role in mediating cocaine effects (Kuhar, Ritz et al.

1991), (Wise and Bozarth 1987). However, DAT knockout mice still self-administer cocaine and display cocaine conditioned place preferences (Rocha, Fumagalli et al.

1998), (Sora, Wichems et al. 1998). Also, it has been demonstrated that NAcc DA level was increased in DAT knockout mice after exposure to cocaine (Carboni, Spielewoy et al. 2001). These studies show that DAT is not required for the rewarding effect of cocaine in certain circumstances and inactivation of NET and/or SERT by cocaine may contribute to cocaine effects in these mice (Carboni, Spielewoy et al. 2001), (Mateo,

Budygin et al. 2004).

In transporter knockout mice, NET clears DA in the prefrontal cortex, where DAT is scarce, which is also true of the caudate, nucleus accumbens (Moron, Brockington et al.

2002) (Carboni, Spielewoy et al. 2001), and the BNST (Miles, Mundorf et al. 2002).

Furthermore, NET inhibition increases extracellular DA levels in the nucleus accumbens, striatum, and prefrontal cortex (Carboni E 2006). These results indicate that psychostimulant-induced increases in extracellular DA in PFC are mediated predominantly by NET instead of DAT and NET may play an important role in the regulation of DA homeostasis in other brain areas. Additionally, NET knockout mice are supersensitive to the psychostimulants cocaine and AMPH (Xu, Gainetdinov et al.

2000), suggesting that NET plays a role in drug addiction. Antidepressants have significantly higher affinities for NET (nM range) than for DAT (µM range).

Accordingly, identifying residues in NET differentially involved in DA and NE uptake

15 would provide critical information for potential treatments of drug abuse, depression and other related psychiatric disorders.

In NET knockout mice, extracellular basal NE levels were significantly increased compared to wild-type mice. Their behaviors are similar to antidepressant-treated wild- type mice and showed hypersensitivity to cocaine or AMPH, and these changes were accompanied with altered expression level of D2/D3. These results showed that altered

NET expression significantly modulated midbrain dopaminergic function and also provided compelling evidence that NE is critical for phsycostimulant-induced locomotor activity and sensitization (Xu, Gainetdinov et al. 2000).

It has been shown that administration of the α1AR antagonist prazosin, either systematically or directly into prefrontal cortex, decreased cocaine-induced locomotion and sensitization (Auclair, Drouin et al. 2004) (Drouin, Blanc et al. 2002), and cocaine- induced reinstatement (Zhang and Kosten 2005). Also, α1bAR knockout mice showed dramatically decreased cocaine, morphine, and AMPH induced locomotor activity and behavioral sensitization (Drouin, Darracq et al. 2002). These studies indicated a critical role of α1b-adrenergic receptors and noradrenergic transmission in drug addiction.

Furthermore, blockade of α2AR autoreceptors with yohimbine or RS-79948 reinstates cocaine seeking and characteristic stress response in squirrel monkeys (Lee,

Tiefenbacher et al. 2004), and activating α2AR autoreceptors with clonidine or guanabenz decreases foot shock-induced but not cocaine induced reinstatement of cocaine seeking (Erb, Hitchcott et al. 2000). These studies suggest that NE system is

16 critical for cocaine locomotion, sensitization, and reinstatement but through different receptors and pathways.

Dopamine β-hydroxylase knockout (Dbh -/-) mice, which lack NE completely from birth, are hypersensitive to the locomotor, rewarding, and aversive effects of cocaine and

AMPH (Weinshenker, Miller et al. 2002), (Schank, Ventura et al. 2006), and these mice showed an increased density of D1 and D2A receptors in NAc and caudate putamen

(CPu) (Schank, Ventura et al. 2006). These results also showed that NE is important for

DA neuron activity and DA transmission.

Since adaptations in DAT knockout mice may alter the reward circuitry, our lab generated a knock-in mouse line with a functional, but cocaine insensitive, DAT mutant.

Cocaine no longer produces reward in these mice, suggesting that DAT inhibition is required in mice with a functional DAT (Chen, Tilley et al. 2006). However, it is not known whether DAT inhibition is sufficient for cocaine reward and it is not clear how

NET and SERT contribute to the complex cocaine effects. Some studies have shown that the NE system and NET also play critical roles in producing cocaine effects (Ventura,

Morrone et al. 2007). Since NET knockout mice may also have some adaptive changes resulting in different cocaine responses from those in normal mice, we plan to generate a knock-in mouse line with a cocaine insensitive NET to study the contribution of NET to cocaine effects.

1.2 Figures

Figure 1.1 Major projections and nuclei of the noradrenergic system.

Noradrenergic neurons in LC project to brain areas including the cortex, amygdala, hippocampus, hypothalamus, brainstem nuclei and spinal cord (Moore and Bloom 1979) (Foote et al., 1983). Amygdala also receives dense noradrenergic innervation from the ventrolateral medulla (Roder and Ciriello, 1993) and caudal medulla (Myers and Rinaman, 2002).

Figure 1.2 Organization of mNET gene.

A: map of the mNET and positions of all coding exons numbered 1-14. Beneath the genomic map is a schematic structure of the NET cDNA with the TMDs indicated by the white boxes numbered 1-12 and a black box noting the 5’ untranslated region. B: topological model of the mNET protein showing the exon boundaries (arrows) within the coding sequence. Numbers indicate the amino acid residues at the beginning of each exon (Fritz, Jayanthi et al. 1998).

CHAPTER 2

FUNCTIONAL MUTATIONS IN MOUSE NOREPINEPHRINE TRANSPORTER REDUCE COCAINE INHIBITION

2.1 Abstract

The transporters of dopamine, norepinephrine and serotonin are molecular targets of cocaine, AMPH, and therapeutic antidepressants. The residues involved in binding these drugs are unknown. We have performed several rounds of random and site- directed mutagenesis in the mouse norepinephrine transporter and screened for mutants with altered sensitivity to cocaine inhibition of substrate uptake. We have identified a triple mutation that retains close to wild-type transport function but displays a 37-fold decrease in cocaine sensitivity and 24-fold decrease in desipramine sensitivity. In contrast, the mutant's sensitivities to AMPH, methamphetamine, and methylphenidate are only slightly changed. Our data revealed critical residues contributing to the potent uptake inhibitions by these important drugs. Furthermore, this drug-resistant triple mutant can be used to generate a unique knock-in mouse line to study the role of NET in the addictive effects of cocaine and the therapeutic effects of desipramine.

20 2.2 Introduction

Cocaine addiction is a devastating social and health problem. Cocaine addiction continues to be an important public health problem with over 2 million users in the US alone. Cocaine produces its powerful effects primarily by binding to and inhibiting the functions of three important proteins, the dopamine (DA) transporters (DAT), norepinephrine (NE) transporters (NET), and serotonin transporters (SERT) (Amara and

Kuhar 1993). These transporters clear neurotransmitters from the synapses and surrounding areas by the reuptake and recycling of the monoamines. Therefore, they play crucial roles in regulating the monoamine neurotransmissions which involve many important brain functions (Rothman and Baumann 2003). Cocaine inhibition of these transporters results in prolonged elevation of the three monoamines in various brain regions. It is not very clear how each of these transporters contribute to the complex effects of cocaine. Genetically modified mice with each of these transporter genes singularly deleted still exhibited the rewarding effects of cocaine, suggesting that no single transporter is required for cocaine reward in these knockout mice (Rocha,

Fumagalli et al. 1998) (Sora, Wichems et al. 1998), (Xu, Gainetdinov et al. 2000).

However, the knockout mice showed profound adaptive changes in response to the absence of important gene products during development, which made it difficult to interpret data from these mice. Therefore, we generated a knock-in mouse line with a functional, but cocaine resistant, DAT mutant (Chen, Tilley et al. 2006). Cocaine no longer produced reward in these mice, demonstrating that cocaine inhibition of a functional DAT is required for its rewarding property in mice. However, it is not known

21 whether DAT inhibition is sufficient for cocaine reward or how cocaine actions on NET and SERT contribute to its rewarding effects. In this study, we sought to identify residues in NET that are critical for potent cocaine inhibition and to engineer a NET mutant that retains transport function but with substantially reduced cocaine inhibition.

In 2005, the crystal structure of a leucine transporter from an Aquifex aeolicus bacterium (LeuTaa) was solved (Yamashita, Singh et al. 2005). LeuTaa belongs to the

Na+- and Cl--dependent neurotransmitter transporter family including NET, DAT, and

SERT. However, the solved crystal structure likely represents one of many conformations of a transport cycle. Furthermore, LeuTaa and the neurotransmitter transporters only share 25% conserved residues and, most importantly, cocaine does not bind to LeuTaa. It remains unclear how cocaine inhibits the monoamine transporters and which residues are involved. Previously, we reported the identification of residues important for cocaine inhibition of DAT and SERT by comparing transporters from mouse and from insects (Gu, Wu et al. 2006), (Wu and Gu 2003). We then generated a mutant of mDAT with triple mutations in the TMD2 that is functional but 69-fold less sensitive to cocaine inhibition than wild-type (WT) mDAT (Chen, Han et al. 2005). In this study, we made similar mutations in TMD2 of mNET and performed several rounds of random and site-specific mutagenesis in TMD2 and TMD3. We identified several residues important for cocaine inhibition and engineered a mutant mNET that retains near WT transport function but is 37-fold less sensitive to cocaine inhibition and 24-fold less sensitive to desipramine inhibition.

22 2.3 Materials and method

2.3.1 Materials

The WT mNET cDNA was described previously (Han and Gu 2006). [3H]-DA (28

Ci/mmol) was purchased from PerkinElmer (Boston, MA). [3H]-NE (38Ci/mmol) was purchased from GE Healthcare (Piscataway, NJ). Dopamine, norepinephrine, nisoxetine, and desipramine were from Sigma-Aldridge (St. Louis, MO). Oligonucleotide primers were synthesized by commercial DNA synthesis services (Integrated DNA Technologies,

Coralville, IA and Sigma-Genosys, St. Louis, MO).

2.3.2 Site-directed random mutagenesis

Mutagenic primers utilizing codon SNN (S: G or C; N: A, T, C, or G) were used in

PCR reactions to introduce random mutations to all 20 amino acids at the specific residues of mNET. Standard techniques of molecular biology were used. Selected mutant clones were sequenced to determine the exact mutations.

2.2.3 Functional analysis

Transient transfection and uptake assays were performed as described (Gu et al.,

2006; Wu and Gu, 2003). Briefly, the mNET and mutants cDNA were subcloned into the bluescript vector SKii+ (Strategene, La Holla, CA) which was under the control of a

T7 promoter. HeLa cells (American Type Culture Collection, Rockville, MD) were infected with recombinant vTF-7 vaccinia virus which carries the T7 polymerase gene, and transiently transfected with the plasmid bearing mNET or mutants cDNA using

23 Lipofectin (Life Technologies, Gaithersburg, MD). To determine IC50 values, 90-100% confluence cells were incubated in Phosphate Buffered Saline with 1mM CaCl2 and

3 3 0.1mM MgCl2 (pH 8.0) (PBS/Ca/Mg) containing 40nM [ H]NE or [ H]DA in the presence of different concentrations of inhibitor. To determine Km and Vmax values, cells were incubated in PBS/Ca/Mg buffer containing 100 nM [3H]NE or [3H]DA in the presence of increasing concentrations of unlabeled (0.1-10 µM) NE or DA for 10 min at

22°C. Reactions were terminated by two successive washes with PBS/Ca/Mg. The amounts of [3H]NE or [3H]DA accumulated in the cells were quantitated by liquid- scintillation counting (Topcount; Packard Instrument Company, Meriden, CT). All experiments were performed in triplicate. Mock-transfected cells were used as controls and radioactivity associated with these cells was considered the background and subtracted from the total uptake. Km, Vmax, and IC50 values were calculated by non-linear regression analysis of the data using Prism 3 (GraphPad Software, SanDiego, CA).

2.3.4 Cell Surface Biotinylation

Two hemagglutinin (HA) tags (YPYDVPDYAYPYDVPDYA) were fused to the 5’ end of WT and each mutant NET. Fusion proteins were tested for uptake activity as described above and for expression by immunoblotting with an anti-HA antibody

(H9658, Sigma-Aldridge). The procedure for detecting cell surface protein was similar to that previously described (Gu, Ahn et al. 1996). Briefly, cells were plated in six-well plates at full confluence and transfected with WT or mutant mNET cDNA constructs as described above. After washing with 2 mL of cold PBS/Ca/Mg, cells were treated with

24 1.5 mg/mL sulfo-NHS-SS-biotin (Sulfosuccinimidyl-2-(biotinamido)-ethyl-1,3- dithiopropionate, Pierce, Rockford, IL) in PBS/Ca/Mg (pH 8.0) for 20 min at 4ºC. The biotinylation process was further repeated with a fresh addition of sulfo-NHS-SS-biotin in PBS/Ca/Mg at pH 8.5. Free sulfo-NHS-biotin was removed by washing twice with

4ºC 0.1 mM glycine in 1 mL PBS/Ca/Mg. The reaction was further quenched by incubation with 0.1 mM glycine for 30 min at 4ºC and cells were then washed twice with PBS/Ca/Mg. Cells were dissolved in the lysate buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 1.0 mM EDTA, 0.1% sodium dodecyl sulfate (SDS), 1.0% Triton X-100,

1.0% sodium deoxycholate) containing Complete Protease Inhibitor Cocktail (Roche

Applied Science, Indianapolis, IN). Cell debris was removed by sedimentation at

15,000xg for 30 min. A fraction of the cleared whole cell lysate was saved for the analysis of the total amount of NET. The biotinylated proteins from the remaining lysate

(750 µL) were recovered by adding 150 µL of 50% slurry of avidin-agarose beads

(Pierce Biotechnology, Rockford, IL) to the cell lysates and were incubated overnight with gentle agitation at 4°C. After three washes with the lysis buffer, the proteins bound to the beads were eluted in 100 µL Laemmli sample buffer containing 100 mM dithiothreitol (DTT). The total cell lysates and eluted surface proteins were separated by

SDS– polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes

(Bio- Rad, Hercules, CA). The membranes were then probed with mouse monoclonal anti-HA antibody (H9658, Sigma-Aldridge) with a 1:2000 dilution in a PBS / 0.05%

Tween-20 / 10% low fat milk blocking buffer. The blot was washed with the blocking buffer and then incubated with the secondary anti-mouse IgG, peroxidase-conjugated

25 whole antibody (Santa Cruz Biotechnology, Santa Cruz, CA) with a 1:2000 dilution in the blocking buffer and then visualized by Enhanced Chemiluminescence (32106, Pierce

Biotechnology). The densities of the protein bands were determined using ImageJ 1.38X

(NIH, Bethesda, MD).

2.3.5 Statistical Analysis

Student’s t-tests were performed to assess the significance of the difference between the WT mNET and the mutants.

2.4 Results

2.4.1 Specific mutations

We have previously reported that single mutation F105C and triple mutation L104V-

F105C-A109V in mDAT increased cocaine IC50 by 15-fold and 69-fold (Chen, Han et al. 2005), (Wu and Gu 2003). Since mDAT and mNET are highly homologous, residues involved in cocaine inhibition on the two transporters are likely to be similar. Therefore, we first made these corresponding mutants in mNET, F101C and L100V-F101C-

A105V. However, these two mutants only exhibited modest decrease in cocaine sensitivity, with 4.5- and 8.4-fold increase in IC50 values (Table 2.2).

2.4.2 First round of random mutagenesis

Because these specific mutations in mNET did not alter cocaine sensitivity sufficiently, we employed random mutagenesis to screen for mutants with greater

26 changes in cocaine inhibition. In addition to F105C in TMD2, it was reported that mutation F154A in DAT TMD3 decreased cocaine sensitivity by 10-fold compared to the WT DAT (Lin and Uhl 2002). It would be likely that the corresponding residuse in mNET, F101 and F150, contribute to cocaine inhibition. Therefore, our first round of random mutagenesis was aimed at point mutations at these two residues and residues in close proximity (residues 97-106 in TMD2 and residues 146-154 in TMD3), based on the α -helix model and sequence alignment with LeuTaa (Figure 2.1).

Degenerative primers encoding all 20 amino acids at a particular residue were used in PCR to generate a small library of random mutants at each targeted position in mNET. Individual mutant clones were transiently transfected into cultured Hela cells grown in 96-well plates and screened for functional transport and for decreased sensitivity to cocaine inhibition using WT mNET as control for both measurements.

Uptake activities in the presence and absence of 1µM cocaine were determined and the ratios of the two were used as estimates of the cocaine sensitivities for the mutant clones. The results are shown in Table 2.1 along with the residues mutated, the percent of the screened clones that retained greater than 50% uptake activity, and the number of clones that displayed decreased or increased cocaine sensitivity. Approximately 96 clones were screened for most mutant residue constructs.

The results in Table 2.1 suggest that significant portions of random mutations at

P97 in TM2, Y151 and N153 in TM3 were tolerated and some of them displayed decreased sensitivity to cocaine inhibition. Clones with desired properties were sequenced to determine the exact mutations. We found that mutating P97 to Alanine or

27 Serine increased the cocaine IC50 values by 11- or 7-fold, respectively, and mutating

N153 to Threonine increased the IC50 by 10-fold compared to WT mNET (Table 2.2).

These mutants also retained significant uptake activity. Therefore, we focused on the two single mutants N153T and P97A and used them as the base for further mutagenesis.

Interestingly, mutation A105C did not decrease cocaine sensitivity but appeared to increase uptake activity (Table 2.2) by decreasing the Km value (data not shown).

2.4.3 Second round of random mutagenesis

The second round of mutagenesis was to introduce random mutations at a residue in close proximity to N153T or P97A. Double mutations with N153T and a random mutation at G149, Y152, S154, I156, and A157 were relatively well tolerated, but none of the double mutations further decreased cocaine sensitivity. Double mutations in TM2 containing P97A were not tolerated (data not shown). Next we generated double mutants combining one mutation in TMD2 and another in TMD3 of mNET. A large number of such double mutants were screened. We identified a number of clones that displayed significant further reductions in cocaine sensitivity. When N153T was combined with mutations in TM2, A105L, F101S, or F101M, transporter activity was comparable to the

N153T single mutant, but cocaine IC50 values increased by 30, 40, 25-fold respectively.

The double mutant F101C-N153T had a cocaine IC50 value that was 76-fold higher than that of WT mNET, but the substrate uptake activity further decreased to 35% of the WT mNET (Table 2.2).

28 2.4.4 Third round of random mutagenesis

The observation that mutation A105C had enhanced uptake suggested the possibility that mutations at certain residues may improve the functional property of

F101C-N153T while retaining cocaine insensitivity. Therefore, we made triple mutations having F101C-N153T and a random mutation at a third residue in TMD2 or

TMD3. Most of the triple mutants with the third mutation in TMD3 did not improve transport function. In contrast, more than 50% of triple mutants F101C-N153T-L100X

(the third mutation in TMD2) showed improved transport function to greater than 50% of the WT mNET. Surprisingly, these mutants did not retain the cocaine insensitivity of

F101C-N153T. Finally, we identified a triple mutant F101C-A105G-N153T that retained 76% uptake activity but was much less sensitive to cocaine with an IC50 value

37-fold higher than that for WT mNET (Table 2.2).

2.4.5 Characterization of the triple mutant F101C-A105G-N153T

The triple mutant F101C-A105G-N153T (mNETCGT) was further analyzed for its sensitivities to other drugs. Figure 2 shows the results of representative experiments comparing mNET and mNETCGT in uptake inhibition by the psychostimulants cocaine and methylphenidate (Ritalin), the NET substrates AMPH and methamphetamine, and the NET selective inhibitors desipramine and nisoxetine. The IC50 values indicated that the triple mutation did not change substantially the transporter’s sensitivity to methylphenidate, AMPH, and methamphetamine inhibition but increased the IC50 values for cocaine, desipramine, and nisoxetine by 37-, 24-, and 8-fold, respectively. The transport kinetics for mNET and mNETCGT were determined with NE and DA as 29 substrates because in certain brain regions, and/or under certain circumstances, DA could be cleared by NET. Figure 2.3 shows the results of representative experiments.

The Km values of NE uptake were not significantly different (p > 0.05, t-test). While the

Vmax value for mNETCGT appeared to be lower than mNET, the difference did not reach the criterion of statistical significance (p > 0.05, t-test). When DA was used as substrate, the Km value for mNETCGT (408 nM) was significantly larger than that for mNET (277 nM, p < 0.05, t-test). However, the differences between the Vmax values were not significant.

To determine whether the triple mutation altered transporter expression pattern, we measured cell surface expression of mNETCGT and mNET using the membrane impermeable biotinylation reagents. Figure 2.4 shows a representative western blot for mNET and mNETCGT. Similar banding patterns were observed between the wild-type mNET and mNETCGT, with a well defined band at 65 kDa and broad bands around 120 kDa, consistent with results from other investigators (Dipace, Sung et al. 2007) . There were no significant differences between the two constructs for either the total transporter expression or the cell surface transporter expression (p > 0.05, t-test).

2.5 Discussion

Cocaine binds and inhibits all three monoamine transporters, DAT, NET, and SERT, from human and mouse with similar potencies (Han and Gu 2006). An abundance of evidence is consistent with the notion that cocaine inhibition of DAT and subsequent elevation of extracellular DA plays the major role in mediating cocaine effects (Kuhar,

30 Ritz et al. 1991), (Wise and Bozarth 1987). However, DAT knockout mice still self- administer cocaine and display cocaine conditioned place preferences (Rocha, Fumagalli et al. 1998), (Sora, Wichems et al. 1998). These studies suggested that DAT might not be required for the rewarding effect of cocaine in certain circumstances. Since adaptations and/or compensation in DAT knockout mice may alter the reward circuitry, our lab generated a knock-in mouse line with a functional, but cocaine resistant, DAT mutant. Cocaine no longer produces reward in these mice, suggesting that DAT inhibition is required for the rewarding effect of cocaine in mice with a functional DAT

(Chen, Tilley et al. 2006). However, it is not known whether DAT inhibition is sufficient for cocaine reward and it is not clear how NET and SERT contribute to the complex cocaine effects. Some studies have shown that the NE system and NET also play critical roles in producing cocaine effects (Ventura, Morrone et al. 2007). Since NET knockout mice may also have adaptive changes resulting in different cocaine responses from those in normal mice, we plan to generate a knock-in mouse line with a cocaine resistant NET to study the contribution of NET to cocaine effects. Despite intensive studies, the residues critical for potent cocaine inhibition remains unknown.

Previously, we reported that single mutation F105C and triple mutation

L104VF105C-A109V in mDAT TM2 increase cocaine IC50 by 15-fold and 69-fold respectively. In this study, we made the corresponding mutations in mNET which displayed 4.5-fold and 8.4-fold increase in cocaine IC50 values (Table 2.2) respectively.

This result suggests that cocaine binding sites in DAT and NET are similar, but not exactly the same. It is possible that different mutations at these residues may result in

31 mutants with increased cocaine resistance. We screened for such random mutants and were unsuccessful. As shown in Table 2.1, at least some fractions of random mutants at all selected residues, except Y152, retained 50% or higher transport function, suggesting that changes at these positions can be tolerated, but Y152 is critical for transport function. It has been shown that Y108 in LeuTaa, the corresponding residue of mNET

Y152 in mNET, is at the presumed substrate binding site, which explains why Y152 is critical. Table 2.1 also shows that random mutations at residues I104, A105, L106,

Y107 and G149 had high percentage of clones with high uptake activity, indicating that these positions do not require specific residues to maintain transport functions. In contrast, very few random mutants showed altered cocaine sensitivity except those at

P97 and N153, suggesting that changes at most of the residues have little effect on cocaine inhibition and P97 and N153 may be involved in cocaine binding directly or indirectly. It is worth noting that random mutations, P98X produced five mutants with cocaine sensitivity increased nearly 3-fold. In addition, more than 50% of triple mutants F101C-N153T-L100X (the third mutation in TM2) showed improved transport function to over 50% of the WT mNET. Surprisingly, these mutants did not retain the cocaine insensitivity of F101C-N153T. In other words, the additional mutations at L100 increased cocaine sensitivity of L101C-N153T and enhanced transport function. Further studies with computer models are needed to reveal how L100 affects both cocaine inhibition and substrate uptake.

Double mutations within TM2 or TM3 did not result in mutants with further decrease in cocaine sensitivity; but, combined TM2 and TM3 double mutations did,

32 suggesting that changes on both TM2 and TM3 have additive effects. Another interesting observation is that some mutations at A105 exhibited a decreased Km when compared to WT mNET (data not shown) and thus enhanced transport function. The single mutant A105C appeared to increase substrate uptake activity while A105G in the triple mutation mNETCGT rescued the partial loss of transport function by the mutations of F101C and N153T.

The triple mutant L104V-F105C-A109V in mDAT was generated for cocaine resistance but it is also insensitive to methylphenidate, which suggests that these mutations affect uptake inhibition by the two psychostimulants in a similar fashion.

However, triple mutation F101C-A105G-N153T in mNET reduced sensitivity to cocaine but only slightly to methylphenidate. As shown in Figure 2.2, this triple mutation did not change the IC50 values for AMPH and methamphetamine. This is expected because the two drugs are analogs of mNET substrates, NE and DA, and because we screened and selected mutants that retained transport function.

2.6 Summary

In summary, we have performed several rounds of random mutagenesis in mNET and screened for mutants that have decreased cocaine sensitivity while retaining transport function. We identified a triple mutant, F101C-A105G-N153T, containing two mutations in TM2 and one mutation in TM3. This mutant retained close to WT transport function but displayed a 37-fold decrease in cocaine sensitivity and 24-fold decrease in desipramine sensitivity. In contrast, the mutant’s sensitivities to AMPH, methamphetamine, and methylphenidate are only slightly changed. Our data reveal a 33 number of residues that are important for potent cocaine inhibition. Furthermore, this triple mutant can be used to generate a unique knock-in mouse line to study the role of

NET in the addictive effects of cocaine and the therapeutic effect of desipramine.

2.7 Tables

Decreased cocaine Increased cocaine mNET mutants % active sensitivityb sensitivity P97Xa 52 17 0 Y98X 13 0 5 L100X 19 0 0 F101X 14 0 0 I104X 53 0 0 A105X 48 0 0 L146X 75 0 0 Y147X 67 0 0 V148X 16 0 0 G149X 52 1 1 F150X 32 1 0 Y151X 37 9 0 Y152X 0 0 0 N153X 34 35 0 S154X 25 0 1

Table 2.1 Summary of the first round of random mutagenesis in TMD 2 and 3 of mNET. amNET mutants with residue 97 changed from P to any of the 20 amino acids. Other mutants were named in the same manner. bmNET residues randomly mutated and screened for their cocaine sensitivity by different substrates. R=1-C/(C+Ki), R: ratio of transporter activity with and without cocaine inhibition. C: cocaine concentration used for screening. Ki: roughly estimated Ki. To narrow the screening scope, we artificially define mutants as cocaine insensitive as their rough Ki are more than 3 times of wild type and retain at least half transporter activity.

Constructs Cocaine IC50: µM NE uptake (% WT) mNET 0.31±0.02a 100%b N153T 3.22±0.12 49% P97A 3.4±0.31 65% L100V-F101C-A105V 2.6±0.35 65% F101C 1.4±0.05 73% A105C 0.41±0.1 110% F101C-N153T 23.7±3.6 35% F101C-A105G-N153T 12.95±1.24 76%

Table 2.2 Cocaine sensitivity of the wild-type and mutant mNET. a Hela cells were transiently transfected with the wild-type and mutant mNET constructs. NE uptake activities were measured in the presence of different concentrations of cocaine as described in Figure 2 and the IC50 values of cocaine inhibition of NE uptake were determined with the software Prism 3.b Uptake activities of the mNET mutants were measured in assay buffer containing 200nM NE ([3H] labeled and unlabeled) and are presented as relative to that of WT mNET (100%).

36 Drugs mNET mNETCGT Fold change cocaine 0.346±0.02 12.88±0.87* 37 methylphenadate 0.14±0.02 0.3±0.02* 2 amphetamine 0.11±0.011 0.21±0.02* 2 methylamphetamine 0.021±0.001 0.040±0.003* 2 desipramine 0.029±0.001 0.71±0.07* 24 nisoxetine 0.011±0.001 0.084±0.007* 8

Table 2.3 Comparison of the drug inhibition IC50 values (µM) for wild-type mNET and mNETCGT.

The data represent the mean±S.E.M. * significantly different from the value for wild type mNET, p<0.05 by Student’s t-test, n=3-6.

NE as substrate DA as substrate V (pmol/min/mg V (pmol/min/mg max K (nM) max K (nM) protein) m protein) m mNET 9.1±1.9 809.6±79.4 4.9±1.1 277.7±44.7

mNETCGT 7.5±1.5 717.5±58.4 7.5±2.2 408.8±24.9*

Table 2.4 Transport kinetics for wild-type mNET and mNETCGT.

The values in the table are means±SEM. *Significantly different from the values for wild-type mNET, p<0.05 by Student’s t-test, n=3-5

2.8 Figures

Figure 2.1 Two dimensional serpentine schematic of the mNET TM2 and TM3.

The TMD segments are based on sequence alignment with the LeuTaa crystal structure and its alignment with the Na+/Cl- coupled transport proteins. The F101C-A105G- N153T positions of the cocaine-insensitive mNET mutant are highlighted with a larger font and bold.

Figure 2.2 Drug inhibitions of mNETCGT and wild-type mNET.

Hela cells were transiently transfected with the wild-type and mutant mNET cDNAs and incubated in a buffer containing 40 nM [3H]NE and each of 6 different drugs at concentrations indicated by the horizontal axis. The uptake activities are presented as fractional activities relative to those in the absence of drugs. Data are expressed as relative substrate uptake in the absence of drugs. Each data point is expressed as mean ± SEM (n=3-6). The experimental data were fitted using non-linear regression analysis. The 6 drugs tested are: A) Cocaine; B) Methylphenidate (Ritalin); C) AMPH; D) Methamphetamine; E) Nisoxetine; and F) Desiprimine.

Figure 2.3 Transport kinetics of the wild-type and mutant mNET.

HeLa cells were transfected with the mNET and mNETCGT cDNAs. Transport activities were measured in assay buffers containing 100 nM [3H]NE or [3H] DA and increasing concentrations of unlabeled NE (A) or DA (B). Transport rate (pmol/min/mg protein) was plotted vs. total NE or DA concentration. Each data point is expressed as mean ± SEM (n=3)

Figure 2.4 Cell surface expression levels of mNET and mNETCGT.

Intact cells transiently transfected with the mNET and mNETCGT cDNAs were incubated with a membrane impermeable biotinylation reagent. The cells were then lysed and the biotinylated proteins were purified with avidin-agarose beads. The proteins were analyzed with Western blot. The first two lanes are whole cell lysates from cells transfected with mNETCGT and mNET cDNAs, respectively, with the same amount of proteins loaded. The last two lanes are biotinylated proteins purified from the same amount of cell lysates transfected with mNETCGT and mNET. Molecular mass markers are indicated at the right of the blot.

CHAPTER 3

COCAINE INSENSITIVE NOREPINEPHRINE TRANSPORTER KNOCK-IN MOUSE MODEL FOR STUDYING IN VIVO NET CONTRIBUTION TO COCAINE ADDICTION

3.1 Abstract

Cocaine addiction is a devastating social problem. Cocaine elicits its powerful addictive effects by binding and blocking three monoamine transporters: DAT, NET, and SERT. Previous studies using a single one of these transporters knockout mice suggested that none of them is absolutely necessary for cocaine addiction. However, developmental adaptations due to the long-term loss of an important transporter could hamper the interpretation of these studies. Our functional cocaine-insensitive DAT knock-in mice showed no cocaine preference, demonstrating that DAT is necessary for cocaine addiction. However, how NET contributes to cocaine effects is still unclear, so it is very important to generate a cocaine insensitive NET knock-in mouse line to study how NET contributes to cocaine’s effects. In chapter 2, we have identified several residues important for cocaine inhibition of NET and engineered a triple mutant with substantially reduced sensitivity to cocaine inhibition but nearly normal substrates uptake activity, which is an excellent candidate to generate a cocaine insensitive NET knock-in mouse line. In this chapter, I set out to generate a knock-in mouse line expressing this triple mutant using a feeder-cell free embryonic stem cell system. 42 This unique cocaine-insensitive mNET mouse line (mNETCI) will be used to study how cocaine works on the noradrenergic system and how NET contributes to cocaine addiction. Also, this mouse model can also be used to study the therapeutic effect of desipramine.

3.2 Introduction

The norepinephrine transporter belongs to a family of Na+/Cl- dependent transporters that also include transporters for dopamine (DA), serotonin, leucine, glycine, and GABA. These intrinsic membrane transporters contain 12 putative transmembrane domains (TMDs) with intracellular amino and carboxyl termini. NET plays a key role in regulation of noradrenergic neurotransmission by reuptake of norepinephrine (NE) into presynaptic terminals and thus maintaining noradrenergic homeostasis. NET is a major target of antidepressants and psychostimulants such as cocaine and AMPH. Although inhibition of DA uptake and subsequent DA activation of

DA receptors are established mechanisms mediating cocaine’s abuse effects, there is evidence that NE uptake and NE activation of NE receptors can play important roles in cocaine’s behavioral effects in rats and mice (Drouin, Blanc et al. 2002) (Drouin,

Darracq et al. 2002). To investigate how the noradrenergic system contributes to cocaine addiction, NET knockout mice were generated and treated with cocaine. Results shown that disruption of the NET gene in vivo prolonged the clearance of NE and elevated extracellular NE level. Furthermore, the NET-deficient (NET-/-) animals behaved like antidepressant-treated wild-type mice. Mutants were hyper-responsive to locomotor

43 stimulation by cocaine or AMPH and these responses were accompanied by dopamine

D2/D3 receptor super-sensitivity (Xu, Gainetdinov et al. 2000). Also, selective norepinephrine depletion in the mouse medial prefrontal cortex abolished food, cocaine, and lithium chloride induced the release of NE in that region, as well as the release of

DA by nucleus accumbens and impaired the place conditioning induced by both lithium chloride (aversion) and food or cocaine (preference). This is the evidence that prefrontal cortical norepinephrine transmission is necessary for motivational salience attribution to both reward- and aversion-related stimuli through modulation of dopamine in nucleus accumbens, a brain area involved in all motivated behaviors (Ventura, Morrone et al.

2007). However, developmental adaptations due to the long-term loss of an important transporter (NET Knockout mice) could hamper the interpretation of these studies as selective prefrontal NE depletion by neurotoxin may interfere with the function of other brain regions. The side effects and normal NET function in other unaffected brain areas may make it hard to evaluate how the whole brain noradrenergic system contributes to cocaine addiction. Therefore, it is necessary to generate a cocaine insensitive NET knock-in mouse to study the role of NET in cocaine reward.

To generate a cocaine insensitive NET knock-in mouse line, we needed to generate a mNET mutant that keeps close to wild type transport activity as well as large cocaine

IC50. After extensive random mutagenesis screening and specific mutagenesis, we found a good candidate mutant mNETCGT (Wei, Hill et al. 2008) and we decided to use this triple mutant to generate a knock-in mouse line.

44 The mNET gene (Slc6a5) was mapped to murine chromosome 8. The predicted major open reading frame of the mNET cDNA encodes a 617-amino acid protein with

12 putative membrane-spanning regions and 94% identity to hNET. The coding exons of the mNET cDNA were found to spread across >36 kb of 129/Svj genomic DNA, with exon-intron boundaries bearing consensus gt/ag splice sites (Fritz, Jayanthi et al. 1998).

Cloning, mapping and sequencing of mouse NET gene made it possible to design different primers and later a targeting vector for knock-in mouse line generation.

Feeder-independent ES cells, E14Tg2A, were derived from either the 129Ola or

129SvEv strain of mice (Nichols, Evans et al. 1990). These cells are cultured on gelatinised plates in the presence of leukocyte inhibitory factor (LIF), grow quickly and easy to maintain, which make it very convenient to handle. Therefore, we decided to use this ES cells to develop a knock-in mice line.

3.3 Methods and results

3.3.1 Materials

Feeder-independent E14Tg2A.4 subclone ES cell lines we used were developed from the 129/Ola strain of mice by baygenomics, UC Davis (Nichols, Evans et al. 1990).

Oligonucleotide primers were synthesized by commercial DNA synthesis services

(Integrated DNA Technologies, Coralville, IA and Sigma-Genosys, St. Louis, MO).

45 3.2.2 Preparation of the targeting vector and generation of recombinant ES cells

To generate a cocaine-insensitive mNET knock-in (mNETCI) mouse line, we generated a targeting vector as shown in Figure 3.1 replacing wild type F101-A105 in

TMD2 and N153 in TMD3 with 101C-105G and 153T (Wei, Hill et al. 2008). Two knock-in backbone vectors, pMC1-TK, which contains a HSV-TK expression cassette, and pNeo-loxP, which contains Neo expression cassette, were used to generate the targeting vector. The short and long arms were amplified by PCR using 129/Ola and

C57BL/6 mouse embryonic stem cell genomic DNA as templates and with the following primers sets (Table 3.1). While designing primers, we found an unreported partial TM3 duplicate in 129/Ola mouse genome, but not in C57BL/6 mouse line genome (Figure

3.3). In order to make the knock-in mouse line as close to C57BL/6 background as possible and to increase homologous recombination effeciency, we designed two extra set of primers and performed PCR using C57BL/6 mouse genomic DNA as template to exclude this region in the targeting vector. (TPN10fd:5’

TTAATGCCAAGTTAAGGACAGAGGAC 3’ and TPN11revs: 5’

TTGGGAAATGGGAGATTATAGTAGG 3’). This PCR product with C57BL/6 DNA as template was extended with another short PCR product which includes one mutation

N153T in TM3. The extended PCR product was furthre extended again with a longer

PCR product with TPN10fd, TPN 8c as primers to get a final long arm PCR product. In order to increase correct homologue recombination rate, we placed neomycin gene between TMD2 and TMD3 regions, and thymidine kinase (TK) gene upstream of TMD2

(Figure 3.1A1 and 3.1A2). PCR amplifications were performed for 40 cycles of 45

46 seconds at 94ºC, 2 minutes at 55ºC, and 5 minutes at 68ºC to obtain the long arm fragment. PCR amplifications were performed for 40 cycles of 40 seconds at 94ºC, 2 minutes at 51ºC, and 5 minutes at 72ºC to generate the short arm fragment. PCR products were subcloned into pMC1-TK and pNEO-LoxP respectively, and sequenced.

Before electroporation of 129/Ola ES cell, the final targeting vector pTK-S-N-L (pTK- short-Neo-long) was verified correct by sequencing using different primers.

3.3.3 ES cell culture

Feeder-independent E14Tg2A.4 subclone ES cell lines were developed from the

129/Ola mice by baygenomics, UC Davis (Nichols, Evans et al. 1990). Parental cell lines (E14Tg2A) were cultured on gelatinized tissue culture dishes in ES cell medium containing LIF according to the recommended protocol (Nichols, Evans et al. 1990).

3.3.4 ES cell passage and expansion

To keep ES cells healthy, we routinely passaged ES cells every 2 days, and changed medium on alternate days. To expand ES cells for electroporation, which requires a total of 1 × 108 cells, we seeded 3 × 106 cells into a gelatinized 75 cm2 flask with 30 ml of medium and added 20 ml medium on the following day. Once the cells reached confluence, we trypsinized the cells and added 5 × 106 cells to each of three 175 cm2 gelatinized flasks containing 50 ml of medium to expand ES cells. The following day, we added an additional 30 ml of medium into each of these flasks.

47 3.3.5 Targeting vector DNA preparation

450 µg of targeting vector DNA was linearized overnight at 37°C with Xho1 restriction enzyme (0.5 U/µg) in a final volume of 1.5 ml and precipitated the DNA with two volumes of absolute ethanol on ice for 5 minutes. Next we span down the DNA in a microcentrifuge and washed the pellet three times with 70% ethanol. After that, we resuspended the DNA in 0.1 ml sterile PBS and vortexed occasionally over a period of 4 h to dissolve DNA. After that, we measured the final DNA concentration again to make sure we have enough DNA for electroporation.

3.3.6 Electroporation and isolation of ES cell lines

When ES cells were cultured to be approximately 80% confluent on the day of electroporation, we changed the medium 3 h before the cells were harvested. After 3 h, we trypsinized three 175 cm2 flasks (5 ml of trypsin/flask) in incubator, and combined all ES cells in a 50 ml sterile centrifuge tube. We pelleted cells for 5 minutes at 1200 rpm and resuspended them in 20 ml PBS. After counting, repelleting, and resuspending the cells at a concentration of 1 × 108 cells/0.7 ml of PBS, we added 0.7 ml of cells to the tube containing 0.1 ml of linearized vector DNA, quickly mixed them with a 1 ml plastic pipette and transferred all immediately to a 0.4 cm electroporation cuvette. With the BioRad GenePulser XCell unit, we used the Time Constant Protocol at a setting of

0.2 msec and 800 volts. After cells recovered in the cuvette for 20 minutes at room temperature, we transfered them to 200 ml of ES cell medium and plated 10 ml (5 × 106 cells) onto each of 20 gelatinized 10 cm diameter tissue-culture petri dishes. The following day, we changed medium with medium containing 125 mg/ml Geneticin and 48 0.5 µg/ml ganciclovir. Eight to ten days after electroporation, the colonies were about 1 mm in diameter and ready to be picked.

3.3.7 Picking G418 and ganciclovir resistant colonies, replica-plating and screening

On the day of picking colonies, we counted and circled good shape colonies on the bottom of each dish with a marker pen and gelatinized several 48-well plates. Next, we aspirated culture medium and added 10 ml of room temperature PBS to each dish. Using a pipetman and sterile plugged tips, we brok up the ES cell colonies, collected them in

50 µl of PBS, and transfered the cell clumps to a 48-well plate and repeated until all the wells contain cells. After that, we added 50 µl of a 2× trypsin solution into each well to disperse the cells into small clumps and added 1 ml of medium to each well. The following day, we replaced with 0.5 ml of medium. When the cells approach confluence, we trypsinized cells with 100 µl of 2× trypsin for 2-4 minutes and then added 1 ml of medium into each well. Using a Pipetteman and sterile plugged tips, we transfered 0.4 ml to two sets of gelatinized 48-well plates (replica plates for genomic DNA purification and PCR screening) and 0.2 ml to a third set of gelatinzed 48-well plates (master plate for expanding cell lines). Then, we added 1 ml of medium to each well of the master plate.

When ES colonies have all regrown, we removed media from each well, added

0.4mL freezing media to each well of master plates, and transfered to -80°C to freeze for long term storage. Confluent cells in replica plates were harvested by trypsinization, each clone’s genomic DNA was isolated by commercial DNA purification kit

49 (FlexiGene, Qiagen). PCR screenings were performed on all these ES cell clones with different short arm genotyping primers first. After identifying PCR positive colonies, we performed long arm PCR on these positive colonies with different long arm genotyping primers. For short arm: the primers set is: TPN1a:

GATACAAATGTGCAGTCCTTTCTCC, TPD7:

CTGCTAAAGCGCATGCTCCAGAC. PCR amplifications were performed for 45 cycles of 30 seconds at 94ºC, 2 minutes at 63ºC, and 2.5 minutes at 72ºC. For long arm: the primer set is: TPD8h TATTAGGAGAAGGATGAGGAACAAGG, TPN8a:

AGTCCTCGTTTCCCTGCCTCTCAC. PCR amplifications were performed for 45 cycles of 30 seconds at 94ºC, 2 minutes at 66ºC, and 7 minutes at 72ºC.

After PCR screening of all picked colonies, three out of 400 screened ES colonies were identified as ES cells carrying correct TMD2 and TMD3 mutations, in which both long arm and short arm DNA fragments were detected by the PCR and sequenced

(Figure 3.1B). These three targeted ES cell clones were injected into blastocysts to generate chimeric mice in west campus.

3.3.8 F0 chimera mice generation

Three positive ES cell lines are thawed and passed for several days in ES cell medium in the absence of G418 and ganciclovir. On the day of injection, the medium was changed several hours before harvesting the cells. A confluent 25 cm2 flask was trypsinized for 3-4 minutes and diluted into 9 ml of cold ES cell medium without LIF.

Next, we centrifuged and resuspended the cells in 0.8 ml of ES cell medium (without

50 LIF) in a sterile 1.5 ml screw-top microcentrifuge tube. Before they are added to the injection chamber, cells were kept on ice to prevent clumping. Blastocysts were flushed from pregnant C57BL/6 females (West campus mouse core facility) and collected into a

CO2-independent medium (Gibco-BRL) containing 10% FBS. Positive ES cell colonies were injected into C57BL/6 blastocysts by Dr. Xin-an Pu and Dr. Akihira Otoshi. After about 25 days, 3 out of 14 pups are chimera mice as judged by fur color (Figure 3.5).

3.3.9 F1 chimera mice germline transmission

As shown at Figure 3.5, we successfully generated 3 F0 chimera mice, one female and two male. After mating these three mice with C56BL/6 mice, all pups of the female chimera failed to show germline transmission, 6 pups (3 male, 3 female) of one male chimera mouse were all germline transmitted judged by white fur color on their bodies.

3.3.10 Genomic DNA purification

Genomic DNA of these F1 mice (3 male, 3 female) were isolated by routine DNA isolation kit. PCR reactions were performed to verify correct homologous recombination. Primers used were:

TPN1c: AAAACCATGGATGATCTCAGTCTTGCAGCAACA, TPD7b:

CACTTGTGTAGCGCCAAGTGC. TPD7b is annealed to Neo/Loxp sequence for genotyping. TPN1c is annealed to intron sequence between TM1 and TM2. PCR amplifications were performed for 45 cycles of 10 seconds at 98ºC, 1 minutes at 55ºC, and 2 minutes at 72ºC. For long arm genotyping: the primer set is TPD8g:

51 GACAATAGCAGGCAACAACTTCGTA, which is annealed to Neo/Loxp sequence for genotyping, and TPN11revs: TTGGGAAATGGGAGATTATAGTAGG, which is annealed to intron sequence between TMD3 and TMD4 (Table 3.1). PCR amplifications were performed for 10 touchdown cycles of 30 seconds at 94ºC, 2 minutes at 58 ºC-

53ºC, and 7 minutes at 72ºC, then into 40 cycles of 30 seconds at 94ºC, 2 minutes at 55

ºC, 7 minutes at 72ºC. PCR and later sequencing results showed that one of three male mice is correct (Figure 3.7).

3.3.11 F2 cre removed mice generation and genotyping

PCR results of about 15 more F1 mice revealed a total of 4 male offsprings that are positive (Figure 3.7). Next, we obtained 2 female sox2-cre mice from Dr. Gustavo

Leone’s lab in Comprehensive Cancer Center, OSU. Sox2-cre mice express Cre recombinase under the control of the mouse SRY-box containing gene 2 promoter. After about one month of pregnancy, 7 F2 pups were born recently from one female sox2-cre mouse and they will be PCR screened by PCR to verify the removal of the neo cassette

(Figure 3.8). Next, 7 F2 mice genomic DNA were isolated by commercial kit. PCR were performed with TPN3cgt as forward primer which carries two mutations and

TPD5a as reverse primer (Table 3.1). TPD5a is a reverse primer located outside of second loxp side and not in long arm. TPD5a sequence is:

TGATGGATATCTGCAGAATTCGG. PCR results showed that three of seven F2 mice are Neo cassette removed (Figure 3.9).

3.4 Discussion and summary

We showed that it is possible to generate a cocaine insensitive NET knock-in mouse line with a feeder-cell free ES system. The reason we chosed the F101C-A105G-N153T mutant is that this triple mutant shows close to wild type substrates uptake activity and is

37 fold resistant to cocaine inhibition, although we have some more cocaine insensitive mutants. Previously, our cocaine insensitive DAT knock-in mouse showed a higher basal DA level in nucleus accumbens than wild type which suggests that the higher Km of mutant DAT might result in a reduced uptake rate at low DA concentrations. The higher basal extracellular DA concentration (Chen, Tilley et al. 2006), and the higher basal DA level in these mutant mice may contribute to the significantly higher basal locomotor activity than wild type mice (Chen, Tilley et al. 2006). Also, NET knockout mice showed higher extracellular NE level, abnormal D2/D3 receptor sensitivity, and supersensitivity to psychostimulants (Xu, Gainetdinov et al. 2000). All of these made it necessary to generate a mouseline that expresses a cocaine insensitive NET but with close to wild type substrates uptake activity. Another interesting finding is our results showed that the in vivo Ki of mutant DAT is larger than that determined by in vitro tests

(Chen, Han et al. 2005), (Chen, Tilley et al. 2006). This may also be true of our mutant

NET, which also made us focus more on maintaining wild type uptake activity instead of only on high Ki for cocaine. Right now, we already got 7 F2 pups and later, we will backcross them to C57BL/6 and generate homozygous knock-in mice.

3.4 Tables

Primer Sequence Function TPN1a GATACAAATGTGCAGTCCTTTCTCC genotyping TPN1b TCCTTTCTCCTGCTCTCCACCCTT genotyping TPN1c AAAACCATGGATGATCTCAGTCTTGCAGCAACA Nco1 TPN2cgt CCCACCAATGATCAGGCACAGCGTGTATGGAATCAGGAAG Bcl1 TPN3cgt ACACGCTGTGCCTGATCATTGGTGGGATGCCTCTGTTTTACATGG Bcl1 TPN4 AATTAAGCTTACAGCAGTCCTAGCTGTTGGGT Hind3 TPN5 ATATGCGGCCGCTACCATTCTCCATCCCCTAGAC Not1 TPN6 AGAGTGACCAGGCGATGATCACAGTGTAGTAAAAGCCGACATAGAGG Bcl1 TPN7a ACACTGTGATCATCGCCTGGTCACTCTACTACCTC Bcl1 TPN7b ACACTGTGATCATCGCCTGGTCACTCTACTACCTCTTTG Bcl1 TPN8a AGTCCTCGTTTCCCTGCCTCTCAC genotyping TPN8b GCCTCTCACTAGCTCTCTTAAATCCA genotyping TPD5a TGATGGATATCTGCAGAATTCGG genotyping TPN8c TTTTCTCGAGGCCTAACCTCAGACTGATGTGAC Xho1 TPN8d TTTTCTCGAGACACATCGGTCTAACCTTGTCACTC Xho1 TPN9 fd: TTTAAGAAGCCAAACTAAGAATGTGGGTGA Delete partial exon TPN9 revs: TTCCACAAGCTCCCATTCACCCACATTCT Delete partial exon TPN11revs: TTGGGAAATGGGAGATTATAGTAGG Delete partial exon TPN11fd: TAACCCTCTCTGCACTCTTGAAATC Delete partial exon

Table 3.1 Primers for generating targeting vector. The final vector has three mutations on TMD2 and TMD3. Underline indicates enzyme sites.

54 3.5 Figures

Figure 3.1 Targeting vector generation. Primers coding 2 mutations in TMD2 and 1 in TMD3 were designed and subcloned into two different vectors. After sequencing verification, a final 15kb targeting vector-pTK-S-N-L were generated by subcloning the long arm PCR product and Neo cassette into pMC-TK-SHORT vector, which contains the short arm. TK: Thymidine kinase, Neo: neomycin gene, S arm: short arm, L arm: long arm. 55

Figure 3. 2 Targeting strategy for correct homologous recombination.

To obtain a correct recombinant, homologous recombination reactions are expected to happen between TK gene and the Exon2 region, and between Exon3 and Exon4 regions. G418 and the pro-drug ganciclovir are positive and negative selection drugs respectively, to promote the growth of correct ES clones.

129wt CTGTTTGGTCCTGAAGCTGCTCTTCCTTCTACCCTGTGCTGAGGGCTCCCATCCTGGGGA 1544 C57wt CTGTCTGGTCCTGAAGCTGCTCTTCCTTCTACCCTGTGCTGAGGGCTCCCATACTGGGGG 1557 ***** ************************************************************** ******** 129wt ATCATCTTATGAATGAGGCTCTGACAATTTGCTCCGGAAAAAAGAGAGGTACAGGAGTGT 1604 C57wt GTC------1560 ** exon3 begins 129wt GCAGTGGCTAGAGCCTACTTCTGGGATTCAGTGGTGGTAGGGGGACAGCTCTGAGCCTGG 1664 C57wt ------

129wt GTCTGGGAAAGCCTGACCTCTTTGTCCCCACATAGGAGTGGGCTATGCTGTGATCCTCAT 1724 C57wt ------

129wt TGCCCTCTATGTCGGCTTTTACTACAATGTCATCATCGCCTGGTCACTCTACTACCTCTT 1784 C57wt ------

129wt TGCATCCTTCACCTTGAACCTGCCCTGGGAGCCGGGGGGAGGGGCGGAGGCAGAGCAGAT 1844 C57wt ------GGGGGGGGGGGAGGCAGAGCAGAT 1584 exon3 ends ** ****** **********************

Figure 3.3 Alignment of 129/Ola and C57BL/6 NET genome.

Genome sequence alignment revealed a previously unreported extra partial TMD3 region in 129/Ola mouse line. Identical nucleic acids are marked with an asterisk (*). Gaps, indicated by hyphen (-), indicates the extra partial TMD3 in 129/Ola mouse line.

Figure 3.4 Part of PCR screening results of ES cell colonies with short arm primers. Short arm primers (TPN1a/TPD7) and long arm primers (TPD8h/TPN8a) were selected to screen ES clones, the PCR product showed correct size. Later sequencing results confirmed the correct mutations and enzyme sites.

Figure 3.5 F0 129/Ola/C57BL/6 chimera mice.

Three F0 129/Ola/C57BL/6 chimera mice (2 male, 1 female) generated by C57BL/6 blastocyst injection of positive 129/Ola ES cell colonies and PCR sequenced with genotyping primers (TPN1c/TPD7). White fur color on the mice body shows that 129/Ola ES cells were integrated and differenciated into different tissues.

Figure 3.6 PCR screening results of short arm and long arm fragments by primers TPN1c, TPD7b and TPD8g, TPN11rev.

Only one of the six DNA samples from the F1 mice showed correct band (#1), which is about 2.2kb for the short arm band. The long arm PCR product also showed a correct band, which is about 2.2kb for the mouse. Other F1 mice did not show any band, which suggest that they did not obtain germline transmission.

Figure 3.7 Three male F1 mice generated by mating F0 male mice with C57BL/6 female mice. One of these three mice (#1) showed correct mutations on mNET both TMD2 and TMD3 by PCR sequencing of genomic DNA PCR products with genotyping primers.

Figure 3.8 Seven F2 mice generated by mating #1 F1 male mouse with one sox2-cre female mouse. 61

Figure 3.9 Three out of seven F2 mice showed correct Neo cassette removed bands by PCR with genotyping primers.

CHAPTER 4

RESIDUES IN THE TRANSMEMBRANE DOMAIN III OF THE NOREPINEPHRINE TRANSPORTER AFFECTING DOPAMINE AND NOREPINEPHRINE UPTAKE

4.1 Abstract

Norepinephrine transporter (NET) uptakes both norepinephrine (NE) and dopamine

(DA) and terminates their neurotransmission. Cross-species substitutions and site- directed mutagenesis have identified domains and residues importantly involved in substrate and antagonist binding to transporters. A study of mouse DAT-NET chimeras indicated that the TMD2 and TMD3 regions of mouse DAT (mDAT) are more important for uptake of DA than NE. However, the residues of NET differentially involved in DA and NE binding and uptake remains unclear. Random mutations in the

TMD3 of mouse NET were performed to find out residues important for DA or NE uptake by screening and comparing their untake activities. Data shown that single mutations V148T, G149A, F150V, Y151M, Y152F, N153H, and V154I in NET TMD3 had a more impact on NE uptake than DA uptake. Also, V148T, G149A, Y151M and

V154I contributed to the interaction of desipramine and nisoxetine. All mutants showed reduced cell-surface expression. These analyses provided important information for

63 identifying important structural determinants of NET involved in the binding of substrates and inhibitors.

4.2 Introduction

The norepinephrine transporter (NET) belongs to a family of Na+/Cl- dependent transporters that also includes the transporters for dopamine (DA), serotonin, leucine, glycine, and GABA. These intrinsic membrane transporters contain 12 putative TMDs with intracellular amino and carboxyl termini. NET plays a key role in regulation of noradrenergic neurotransmission by reuptake of NE into presynaptic terminals and thus maintaining noradrenergic homeostasis. NET is also a major target of antidepressants and psychostimulants such as cocaine and AMPH.

Interestingly, NET transports DA with a higher affinity and velocity than transporting NE (Gu, Wall et al. 1994). It has been shown that DA is cleared through

NET in the prefrontal cortex (Moron, Brockington et al. 2002) and the nucleus accumbens (Carboni, Spielewoy et al. 2001) in DAT knockout mice. Furthermore, drug blockade of NET increases extracellular DA levels in the nucleus accumbens, striatum, and prefrontal cortex in rats (Carboni E 2006). Therefore, NET also plays an important role in the regulation of DA homeostasis. Additionally, NET knockout mice are supersensitive to psychostimulants such as cocaine and AMPH (Xu, Gainetdinov et al.

2000), suggesting a role of NET in drug addiction. Unlike cocaine and AMPH showing equivalent affinities for DAT and NET, antidepressants have significantly higher affinities for NET (nanomolar range) than for DAT (micromolar range). Hence,

64 delineating residues of NET differentially involved in DA and NE uptake would provide insights into potential treatment of drug abuse, depression or other related psychiatric disorders.

Cross-species mutants and site-directed mutagenesis have identified domains and residues importantly involved in substrate and antagonist binding to transporters. For example, a study of mouse DAT-NET chimeras indicated that residues in TMD2 and

TMD3 of mouse DAT (mDAT) were more important for uptake of DA than NE whereas residues in TMD1, 2, and 3 of mouse NET (mNET) are more involved in desipramine and nisoxetine recognition than DA (Buck and Amara 1995). Additionally, residues in the TMD3 of mouse SERT were also important in substrate and inhibitors binding

(Chen, Sachpatzidis et al. 1997) (Henry, Field et al. 2006) (Chen and Rudnick 2000).

Importantly, the recent revelation of the crystal structure of a bacterial leucine transporter (LeuTaa), a member of Na+/Cl- dependent neurotransmitters family, presumed that Y108 in the TMD3 region is likely to be directly involved in the substrate binding (Yamashita, Singh et al. 2005). These data raised the possibility that residues in

TMD3 of mNET may have an impact on its substrates binding and/or transport.

Therefore, the main aim of this study was to identify residues in the TMD3 of mNET that would differentiate NE and DA uptake. Random mutagenesis was applied to screen residues around the orthologous Y152 in the TMD3 region of mNET. Mutant constructs of NET were assessed for their DA and NE uptake.

4.3 Materials and method

4.3.1 Materials

The wild type (WT) mNET cDNA was described previously (Han and Gu 2006).

[3H]-DA (28 Ci/mmol) was purchased from PerkinElmer (Boston, MA, USA). [3H]-NE

(38Ci/mmol) was purchased from GE healthcare (Piscataway, NJ, USA). Dopamine,

NE, nisoxetine, GBR12909, and desipramine were from Sigma-Aldrich (St. Louis, MO).

Oligonucleotide primers were synthesized by commercial DNA synthesis services

(Sigma-Genosys, St. Louis, MO and Integrated DNA Technologies, Coralville, IA).

4.3.2 Site-directed random mutagenesis and construction of mNET mutants

Residues in TMD3 of WT mNET were chosen for random mutation. In order to screen mutant pools more efficiently, two restriction enzyme sites KasI and NheI, were added by site-directed silent mutation at positions adjacent to residues randomly to be mutated. Mutagenic reverse primers were made with codon SNN (N codes for A, T, G, or C and S codes for G or C) at the mutation sites and with the Nhe1 site at the 5’ end of the primer. PCR was performed using the mutagenic primers and a T7 primer. The PCR products were digested with KasI (or Kpn1) and NheI and subcloned into the WT mNET plasmid. The use of SNN instead of NNN in reverse primers reduces the number of possible combination by half (from 64 to 32) by removing redundant codons while still encoding all 20 amino acids. The mutations were confirmed by sequencing. Residues of

TMD3 in mNET selected for random mutation were 147Y, 148V, 149G, 150F, 151Y,

66 152Y, 153N, and 154V (Figure 1). Primers used for random mutagenesis at the individual residue were listed in Table 1. Functional mutants were further sequenced and the mutated residues were identified.

4.3.3 [3H]DA and [3H]NE uptake

The WT and mutant cDNAs were subcloned into the bluescript vector SKii+

(Strategene, La Holla, CA), which was under the control of a T7 promoter. Intestine

407 cells (American Type Culture Collection, Rockville, MD) were grown in 96-well plates, infected with recombinant vTF-7 vaccinia virus which carries the T7 polymerase gene, and transiently transfected with the plasmid bearing WT or mutant mNET cDNA using Lipofectin (Life Technologies, Gaithersburg, MD) as described before (Wu and

Gu 1999). Twenty to 24 hours after transfection, intestine 407 cells were assayed for

[3H] NE (20nM) and [3H] DA ( 20nM) uptake in 96-well plates at room temperature using PBS/Ca/Mg buffer (phosphate buffered saline solution containing 1 mM MgCl2,

3 3 0.1 mM CaCl2, and 50 µM L-ascorbic acid). Amounts of [ H] NE and [ H] DA accumulated in the cells were quantitated by a liquid scintillation counter (Topcount;

Packard Instrument Company, Meriden, CT, USA).

For determination of Km and Vmax values, cells were incubated in PBS/Ca/Mg buffer containing 80 nM [3H] NE or 111nM [3H] DA in the presence of increasing concentrations of unlabeled (0.1-10 µM) NE or DA for 10 min (closed to linear within

12 min) at 22°C. For determination of IC50 values, cells were incubated in PBS/Ca/Mg buffer containing 80 nM [3H] NE in the presence of different concentrations of substrate

67 or a competitive inhibitor (e.g., nisoxetine, and desipramine). Reactions were terminated by two successive washes with PBS/Ca/Mg. All experiments were performed in triplicate. The Km, Vmax, and Ki values were determined by nonlinear regression analyses of experimental data using GraphPad Prism 3.0 (San Diego, CA).

Data are presented as arithmetic means±SE of 3-7 independent experiments. The statistical significance of the differences in DA uptake and inhibition constants between the WT and mutant NET were determined by Student's t-test. Protein concentrations were determined using Protein Assay kit (Bio-Rad Laboratories, Hercules, CA, USA) and bovine serum albumin as the standard.

4.3.4 Cell Surface NET Biotinylation.

Two HA tags (YPYDVPDYAYPYDVPDYA) were fused to the 5’ end of WT and mutants NET. Fusion proteins were tested for expression by immunoblotting with an anti-HA antibody and uptake activity by the assay described above. The procedure for the cell surface protein detection was similar to that previously described (Gu, Ahn et al.

1996). Briefly, cells were plated in six-well plates at a full confluence and transfected with WT or mutant mNET cDNA construct as described above. After washing with

2 mL of cold PBS/Ca/Mg, cells were collected and sulfo-NHS-SS-biotin (Pierce,

Rockford, IL, USA) in PBS/Ca/Mg (pH 8.0) was added to cells at 1.5 mg/mL and incubated for 20 min at 4ºC. The biotinylation process was further repeated with a fresh addition of sulfo-NHS-SS-biotin in PBS/Ca/Mg at pH 8.5. Free sulfo-NHS-biotin was removed by washing twice with cold 0.1 mL 1mM glycine in 1 mL PBS/Ca/Mg. The

68 reaction was further quenched by incubation with 0.1 mL 1mM glycine for 30 min at

4ºC and cells were then washed twice with PBS/Ca/Mg. Cells were lysed in the radioimmunoprecipitation assay buffer (10 mm Tris, pH 7.4, 150 mm NaCl, 1.0 mM

EDTA, 0.1% sodium dodecyl sulfate, 1.0% Triton X-100, 1.0% sodium deoxycholate) containing the Complete Protease Inhibitor Cocktail (Roche Applied Science,

Indianapolis, IN, USA). Cell debris was removed by sedimentation at 15,000 g for

30 min. Cleared whole cell lysate (200 µl) was used for the analysis of the total amount of NET. The biotinylated proteins from the remaining lysate (750 µL) were recovered by adding 150 µl of 50% slurry of avidin-agarose beads (Pierce) to the cell lysates and incubated overnight with gentle agitation at 4°C. After three washes with the lysis buffer, the proteins bound to the beads were eluted in 100 µL Laemmli sample buffer containing 100 mM DTT. The total cell lysates and eluted surface proteins were separated by SDS–polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. The membranes were then probed with mouse monoclonal Anti-HA antibody (H9658, Sigma-Aldridge) at a 1:2000 dilution. Then, the blot was incubated with secondary peroxidase-conjugated anti-mouse IgG whole antibody (Santa Cruz

Biotechnology, Santa Cruz, CA) at a 1:2000 dilution and visualized by Enhanced

Chemiluminescence (Pierce, 32106). The densities of the protein bands were determined using Image Station 440 (Kodak, New Haven, CT, USA).

4.4 Results

4.4.1 Screening mutants that showed differential selectivity for NE and DA uptake

In LeuTaa, Y108 in the TMD3 region is directly involved in the substrate binding

(Yamashita, Singh et al. 2005). Accordingly, Y152 in the TMD3 region of mNET is othologous to Y108 of LeuTaa, and was chosen for random mutagenesis. Residues adjacent to Y152 were also randomly mutated as illustrated in Fig. 1. DA and NE uptake were assayed in cultured cells expressing the WT or the mutant NET constructs.

As indicated in Table 4.2, random mutations at Y152 completely abolished both

DA and NE uptake activity (>50% wild type activity), suggesting that Y152 is crucial for NET transport activity. In contrast, random mutation at Y147 resulted in 65.6% functional mutants showing proximately 50% DA and NE uptake, indicating that Y147 is less critical on altering NET activity than Y152. Interestingly, mutations at V148,

G149, F150, Y151, Y152, N153, and V154 resulted in only 16.7–34.8% clones with more than 50% DA uptake activity and 1–18% clones with more than 50% NE uptake activity (Table 4.2), suggesting that mutations at all these residues on TMD3 of mNET have more influence on NE uptake than on DA uptake through NET.

4.4.2 Identify and characterize mutants displaying differential sensitivity for DA and NE uptake

As indicated in Table 4.2, V148 was significantly required for functioning of NET.

When V148 was randomly mutated, there were only 8 colonies retaining more than 50%

70 of WT DA uptake activity. One of them was V148T with 50% DAT activity and 30%

NET activity. However, replacement of V with S resulted in the loss of function for both DA and NE uptake (data not shown). Interestingly, mutation of G149 to A resulted in a mutant displaying 60% DA uptake but only 20% NE uptake (Table 4.3). Similarly, replacement of Y152 with F almost completely abolished NE uptake, but retained 40%

DA uptake. These data suggest that V148 and Y152 might be more importantly involved in NE uptake than DA uptake. Additionally, random mutation at position Y152 did not result in any mutant displaying more than 50% DA or NE uptake, indicating that Y152 is critical for DA and NE binding and/or translocation by NET. Interestingly, although

F150V also shows more uptake activity of DA than NE, its uptake efficiency for both substrates are about the same compared to wild type (39:36, 16:15) (Table 4.4).

4.4.3 Effects of mutations on nisoxetine and desipramine inhibition and expression to NET

Inhibition of mutants’ DA and NE uptake by the NET inhibitors was examined in

Hela cells expressing the wild-type or mutant mNETs, the Ki values of nisoxetine were increased by 3.5 fold for 148T with DA as a substrate, by 2.9 fold for 148T with NE as substrate, while smaller changes (2-3 fold) were found for G149A, F150V, Y151M,

Y152F, N153H with DA or NE as substrates. Interestingly, the Ki value of V154I was decreased by 20-40% with DA or NE as the substrate. The Ki values of desipramine were increased by 2.7 fold for 149A with DA as the substrate, by 2.3 fold with NE as the substrate, while smaller changes for V148T, G150V, F151M, Y152F, Y153H.

71 Interestingly, Ki values of V154I decreased by 20-60% with DA or NE as the substrate

(Table 4.5). The surface/total expression rations for these mutations were all decreased compared to WT NET (Figure 4.6).

4.5 Discussion

Our study identified for the first time residues in the TM3 region of mNET that differentially affect NE and DA uptake.

Yamashita and colleagues (Yamashita, Singh et al. 2005) proposed that Y108 in

LeuTAa was directly involved in the leucine binding to the transporter. Y108 formed a hydrogen bond with the carbonyl group of leucine, and the hydroxyl group of Y108 also formed a hydrogen bond with the main-chain amide nitrogen of L25 to stabilize the irregular structure near the unwound region in TM1. Y108 is strictly conserved among all NSS family members and cation/amino acid transporter/channel CAATCH1

(Stevens, Feldman et al. 2002), and has been implicated in substrate binding and transport (Bismuth, Kavanaugh et al. 1997), (Singh, Yamashita et al. 2007).

Replacement of this tyrosine with phenylalanine or tryptophan rendered transporters unable to transport substrates (Bismuth, Kavanaugh et al. 1997), (Ponce 2000); however, when Y147 in KAAT1, a K+-coupled, neutral amino acid transporter, was mutated to F, it exhibited a seven-fold increase over WT in leucine uptake (Liu, Stevens et al. 2003).

These data suggested that the conserved tyrosine residue is critically involved in substrate uptake. Our results showed that when the corresponding tyrosine residue

Y152 in mNET was randomly mutated to any other amino acid, all mutant NETs lost

72 most of their transport activities. When Y152 in mNET was mutated to F, Vmax of NE uptake was only 28% of WT NE uptake activity, also, the Km was 5-folds greater than wild type, but its DA uptake Vmax was still about 73% of the wild type Vmax, and Km was

3.4 folds greater than wild type, which suggested that the Y152 is more critical for NE uptake than DA; however, when Y152 of mNET was mutated to W, both DA and NE uptakes were abolished (data not shown). Ponce and colleagues (2000) showed that higher EC50, decreased sodium selectivity, decreased chloride requirement, and a dramatic glycine affinity for the Y289F mutant of GLYT2 relative to wild type, which suggested that mNET Y152 may also be critical for maintaining the binding core for sodium, chloride (Stevens, Feldman et al. 2002) and NE binding and transport.

However, mNET Y152 is relatively less critical for DA binding and uptake. Other single mutation surrounding Y152 (V148T, G149A, F150V, Y151M, N153H, G154I) also showed the pattern that had higher uptake activity of DA than NE. Mutants surrounding

Y152 may exert their functions by disrupting (N153K) or strengthening (F150V) Y152 hydrogen bonds. These residues are near the substrate binding site and likely affect substrate binding site indirectly. It is very obvious that all mutated residues showed higher uptake activity of DA than NE, for example, in Y151X, about 26.7% (38 out of

142) mutants kept more than 50% wild type DA uptake activity, but only 1.4% (2 out of

142) mutants had more than 50% wild type NE uptake activity, which suggests that

TMD3 conformation might have a greater impact on NE binding and transporting.

In LeuTAa structure model, Val-104, which is orthologous to Ile172 in hSERT, Val-

148 in mNET, and Val-152 in hDAT, is directly involved in formation of a hydrophobic

73 binding site that accommodates the hydrophobic methyl groups of the leucine side train

(Yamashita, Singh et al. 2005). Interestingly, when Val-148 of mNET was mutated to T but not S, which might disrupt this hydrophobic binding site, it still showed significant

DA transport compared to NE. Also, V148M resulted in transporters that bind DA and

NE but are deficient in the subsequent translocation, which suggests V148 might be involved in translocation mechanism (Henry, Field et al. 2006), and different mutations of this residue (V148I, or V148A) showed different uptake rates for substrates (Lee,

Chang et al. 2000).

Since these mutants show different selectivity of substrates, we also tested whether these mutants show different selectivity of tricyclic and nontricyclic antidepressants

(desipramine and nisoxetine). It has been shown that TMD1-3 of NET contributes to the interaction with antidepressants (Buck and Amara 1995). Our results indicated that residue G149 might play an important role in nisoxetine inhibition. When it was mutated to alanine, affinity decreased about 3-4 fold. Also, V148 and G149 play a role in desipramine inhibition. When V148 was mutated to T and G149 mutated to A, both decreased desipramine Ki about 4 fold (Table 4.5). This also suggested that residues in

NET TM3 are important for antidepressant inhibition. However, V154I was more sensitive to antidepressant inhibition. For nisoxtine, the Ki of V154I decreased about 13-

40%, however, for desipramine, V154I showed different Ki for the uptake of different substrates. V154I desipramine ki is 68% of wild type with DA as substrate; V154I desipramine Ki is 33% of wild type with NE as substrate.

74 4.6 Summary

In summary, this is the first identification and characterization of critical residues in the TM3 region of mNET that are involved in determining NET cell- surface expression and selectivity of substrate uptake. This provided important insights into the structure- function relationships of the neurotransmitter family. Although these results did not provide us with the direct evidence of how substrates and antidepressants bind to membrane transporters, both random mutagenesis and pharmacological analysis of the

TMD3 region are important in elucidating mechanisms of binding by substrates, related agonists and antagonists, and also provide us with crucial information for drug designs for depression, attention deficit hyperactivity disorder and other psychiatric disorders.

4.7 Tables

Name Orientation Location Sequence

mNET GGTGAAGCTTGCAAAGAGGTAGTAGAGTGACCAGGCGATGATSNNAT reverse TM3 V154X TGTAGTAAAAG

mNET GGTGAAGCTTGCAAAGAGGTAGTAGAGTGACCAGGCGATGATGACSN reverse TM3 N153X NGTAGTAAAAGCCGACATAGAG

mNET GGTGAAGCTTGCAAAGAGGTAGTAGAGTGACCAGGCGATGATGACA reverse TM3 Y152X TTSNNGTAAAAGCCGACATAGAGG

mNET GGTGAAGCTTGCAAAGAGGTAGTAGAGTGACCAGGCGATGATGACA reverse TM3 Y151X TTGTASNNAAAGCCGACATAGAGGGCAATG

mNET GGTGAAGCTTGCAAAGAGGTAGTAGAGTGACCAGGCGATGATGACA reverse TM3 F150X TTGTAGTASNNGCCGACATAGAGGGCAATGAGG

mNET GGTGAAGCTTGCAAAGAGGTAGTAGAGTGACCAGGCGATGATGACA reverse TM3 G149X TTGTAGTAAAASNNGACATAGAGGGCAATGAGGATC

mNET AGGTGAAGCTTGCAAAGAGGTAGTAGAGTGACCAGGCGATGATGAC reverse TM3 V148X ATTGTAGTAAAAGCCSNNATAGAGGGCAATGAGGATCACAGCAT

mNET GGTGAAGCTTGCAAAGAGGTAGTAGAGTGACCAGGCGATGATGACA reverse TM3 Y147X TTGTAGTAAAAGCCGACSNNGAGGGCAATGAGGATCACAGCAT

T7 primer forward TAATACGACTCACTATAGGG

TTGGGTACCACCATGTACCCATACGACGTTCCAGACTACGCTTACCCA 2HA primer forward TATGACGTTCCAGACTACGCTATGCTTCTGGCGCGAATG

Table 4.1 A list of oligonucleotide primers for random mutation

* Mutagenic primers were made with codon SNN (N codes for A, T, G, or C and S codes for G or C) at the mutation sites. Underline is Nhe1 site.

mNET No. of clones No. of clones with >50% No. of clones with >50% mutants screened wt DA uptake wt NE uptake Y147X 96 63 46 V148X 48 8 3 G149X 112 39 7 F150X 143 47 26 Y151X 142 38 2 Y152X 47 0 0 N153X 143 35 12 V154X 95 33 14

Table 4.2 Summary of the residues selected for random mutagenesis in TM3 of mNET and functioning. Note: X means any of the 20 amino acids.

77 Constructs NE uptake (%WT) DA uptake (%WT) mNET 100±3.4 100±6.5 V148T 33± 1.3 70±6.0 G149A 40±2.1 67±2.5 F150V 83±4.1 140±11.4 Y151M 11±0.2 60±0.2 Y152F 6.5±0.5 39±3 N153H 22.5±0.4 88±5.5 V154T 55±1.2 83±3.0

Table 4.3 DA and NE uptake by mNET WT and mutants.Uptake activity was expressed as a percentage of the uptake in WT. The results shown are means ± S.E. (n≥3).

DA uptake NE uptake Uptake Uptake constructs Km(µM) Vmax(pmole/mg) effenciency Km(µM) Vmax(pmole/mg) effenciency (Vmax/Km) (Vmax/Km) wt 0.293±0.02 10.76±0.9 36 1.163±0.124 17.74±2.2 15 V148T 0.445±0.013 10.44±0.67 23 2.604±0.429 15.94±3.05 6 G149A 1.21±0.107 28.12±.007 23 5.074±0.655 27.35±4.68 5 F150V 0.613±0.114 24.4±0.1 39 1.504±0.168 24±1.4 16 Y151M 2.97±0.48 15.3±3.6 5.15 4.836±1.221 6±1.6 1.2 Y152F 1.023±0.154 7.83±0.06 7 5.747±1.188 5±0.8 0.9 N153H 0.57±0.057 11.3±1 19 2.845±0.324 12.6±2.53 4 V154I 0.209±0.065 5.04±0.87 24 0.960±0.207 7.88±2.02 8

Table 4.4 DA and NE uptake kinetics for mutant NETs. The data represent the mean±S.E.M. (n=3)

Nisoxetine (nM) Desipramine (nM) Construct DA substrate NE substrate DA substrate NE substrate wt 13.62±2.15 6.71±1.03 49.63±2.48 33.17±5.34 V148T 62.38±10.01 26.33±3.48 155.3± 2.73 75.14±17 G149A 44.16±4.4 14.80±4.36 185.3±33.65 111.6±35 F150V 15.56±0.947 5.93±0.57 51±5.2 25.85±5.39 Y151M 51.92±11.49 19.00±4.58 151.7±20.17 88.30±13.92 Y152F 29.45±4.41 13.23±2.83 120.3±11.26 73.91±24.51 N153H 26.05±2.37 9.167±1.82 72.33±3.180 42.67±10.74 V154I 8.29±0.98 5.957±0.86 33.80±4.386 11.07±0.87

Table 4.5 Inhibition profiles for NET mutants. Accumulation of [3H] dopamine/norepinephrine into transfected cells was assessed in the absence or presence of increasing concentrations of uptake inhibitors. The data represent the mean±S.E.M. (n=3)

constructs Mean±S.E. mNET 1±0 V148T 0.32±0.08 G149A 0.48±0.18 F150V 0.6±0.16 Y151M 0.42±0.16 Y152F 0.47±0.15 N153H 0.5±0.1 V154I 0.46±0.21

Table 4.6 Surface/total protein expression ratio compared to WT mNET (n=3).

4.8 Figures

85KD 60KD

V154I N153H Y152F Y151M F150V G149A V148T WT

Figure 4.1 Total protein expression of mutants and wild type mNET.

Intact cells transiently transfected with the mNET and mutants cDNAs were incubated with a membrane impermeable biotinylation reagent. The cells were then lysed and the biotinylated proteins were purified with avidin-agarose beads. The proteins were analyzed with Western blot. These are whole cell lysates from cells transfected with mutants and mNET cDNAs with the same amount of proteins loaded. Molecular mass markers are indicated at the right of the blot.

85KD

60KD

V148T G149A F150V Y151M Y152F N153H V154I WT

Figure 4.2 Surface protein expression of mutants and wild type mNET.

Intact cells transiently transfected with the mNET and mutants cDNAs were incubated with a membrane impermeable biotinylation reagent. The cells were then lysed and the biotinylated proteins were purified with avidin-agarose beads. The proteins were analyzed with Western blot. These are biotinylated proteins purified from the same amount of cell lysates transfected with mutants and mNET. Molecular mass markers are indicated at the right of the blot.

CHAPTER 5

DIRECT EVIDENCE THAT TWO CYSTEINES IN THE DOPAMINE TRANSPORTER FORM A DISULFIDE BOND

5.1 Abstract

Previously, Dr. Gu generated a fully functional dopamine transporter (DAT) mutant (dmDATx7) with all cysteines removed except the two cysteines in extracellular loop 2 (EL2). His random mutagenesis data showed that loss of either or both EL2 cysteines did not produce any functional transporter, suggesting that the two cysteines cannot be replaced by any other amino acid.

The cysteine-specific reagent MTSEA-biotin labeled dmDATx7 only after a DTT treatment which reduced disulfide bond. Since there is no other cysteine in dmDATx7, the MTSEA-biotin labeling must be on the EL2 cysteines made available by the DTT treatment. This result provided the first direct evidence that the EL2 cysteines form a disulfide bond. Interestingly, the DTT treatment had little effect on transport activity, suggesting that the disulfide bond is not necessary for the uptake function of DAT. Our results and previous results are consistent with the notion that the disulfide bond between EL2 cysteines is required for DAT biosynthesis and/or its delivery to the cell surface. 84

5.2 Introduction

Dopaminergic neurotransmission is primarily terminated by removal of dopamine via dopamine transporter (DAT), which belongs to a superfamily of Na+/Cl-–-dependent neurotransmitter transporters (Amara and Arriza 1993), (Rudnick and Clark 1993).

Other members of this family include transporters of serotonin (SERT), norepinephrine

(NET), glycine, GABA, etc. They are intrinsic membrane proteins containing 12 putative TMDs. DAT is the major target of psycho stimulants and therapeutic drugs such as cocaine, AMPH, and methylphenidate (Ritalin) (Goodnick 1991), (Ritz, Lamb et al.

1987), (Giros and Caron 1993), (Gu, Wall et al. 1994), (Ascher, Cole et al. 1995), (Han and Gu 2006). Structural information of DAT allowed a better understanding of the molecular mechanisms of its function and drug interactions. Recently, the crystal structure of a leucine transporter from bacterium Aquifex aeolicus (LeuTAa) has been solved (Yamashita, Singh et al. 2005). This transporter is a homolog of the Na+/Cl-–- dependent neurotransmitter transporters. Although the overall sequence homology between LeuTAa and neurotransmitter transporters is only 20–25%, clusters of high sequence conservation are distributed throughout the primary structure and it is believed that the overall structure of LeuTAa is similar to the structures of its mammalian homologs. However, there are major differences between LeuTAa and the neurotransmitter transporters. The second extracellular loop (EL2) linking TM3 and

TM4 is small in LeuTAa while it is very large in neurotransmitter transporters and it contains two highly conserved cysteines and several glycosylation sites. Another major

85 difference is that cysteine is absent in the leucine transporter while it is relatively abundant in neurotransmitter transporters. For example, there are 13 cysteine residues in human, rat, and mouse DAT (hDAT, rDAT, and mDAT, respectively), 15 cysteines in

C. elegans DAT (ceDAT), and 9 cysteines in Drosophila melanogaster DAT (dmDAT).

Therefore, the crystal structure of the leucine transporter did not provide relevant clues about the role of cysteines in monoamine transporter conformation and uptake function.

Cysteine residues can form inter- and intra-molecular disulfide bonds which may be critical for proper transporter folding, trafficking, surface expression, stability, and uptake function. It has been shown that substitutions of either of the two highly conserved EL2 cysteines in hDAT with an alanine abolished DA uptake activity (Wang,

Moriwaki et al. 1995). The authors proposed the possibility that the two EL2 cysteines form a disulfide bond (Wang, Moriwaki et al. 1995).

The two EL2 cysteines (C200 and C209) in human serotonin transporter (hSERT) have also been studied by Chen and coworkers. (Chen, Liu-Chen et al. 1997). They found that replacing one of the two cysteines with a serine (C200S) resulted in higher sensitivity to cysteine specific MTS reagents, indicating that replacing one cysteine increased the accessibility or reactivity of other cysteines. In addition, the single cysteine replacement (C200S or C209S) dramatically decreased cell surface expression while the double substitution mutant C200S–C209S retained normal surface expression. The authors also proposed that their results support the possibility that EL2 cysteines are linked by a disulfide bond. However, there is no direct evidence for this proposed disulfide bond. The presence of numerous other cysteines in the transporter constructs

86 used in the above studies made it difficult to draw firm conclusions. In this study, we used a functional dmDAT mutant with all cysteines removed except the two

EL2cysteines to obtain direct evidence that the two EL2 cysteines form a disulfide bond.

5.3 Materials and methods

5.3.1 [3H]dopamine uptake into transiently transfected cells

Intestine 407 cells (American Type Culture Collection, Rockville, MD) were grown in 96-well plates, infected with recombinant vTF-7 vaccinia virus, which carries the T7 polymerase gene, and transiently transfected with the plasmids bearing wild type and cysteine mutant cDNAs using Lipofectin (Invitrogen Corp., Carlsbad, CA) as described before (Wu and Gu 2003). About 20–24 h after transfection, intestine cells were assayed for dopamine uptake in 96-well plates at room temperature using the PBS/Ca/Mg buffer

(phosphate buffered saline solution containing 1 mM MgCl2, 0.1 mM CaCl2, and 50 µM

L-ascorbic acid). For the determination of Km and Vmax values, cells were incubated in

PBS/Ca/Mg buffer containing 60 nM [3H]dopamine in the presence of increasing concentrations of unlabeled dopamine (0.1–20 µM) for 10 min at room temperature. For determination of IC50 values, cells were incubated in the PBS/Ca/Mg buffer containing

60 nM [3H]dopamine in the presence of increasing concentrations of inhibitors (e.g., cocaine, AMPH, methamphetamine, and methylphenidate). Reactions were terminated by two successive washes with PBS/Ca/Mg, and cells were dissolved in 0.1 M NaOH.

Amounts of [3H]dopamine accumulated in the cells were quantitated by liquid- scintillation counting. All experiments were performed in triplicates. Cells transfected 87 with vehicle were used as controls and radioactivity associated with these cells were considered the background and subtracted from the total uptake. The Km, Vmax, and IC50 values were determined by nonlinear regression analyses of experimental data using

GraphPad Prism 3.0 (San Diego, CA) and t-test was performed to determine the significance of the differences between a mutant and the wild type dmDAT. Protein concentrations were determined using Bio-Rad dye and bovine serum albumin as the standard. The Km, Vmax, and IC50 values presented are averages and standard error of means calculated from 3 or more experiments.

5.3.2 Cell-surface biotinylation and immunoblotting

Intestine 407 cells were plated in 6-well plates at full confluence and transfected with wild type and cysteine mutant dmDAT cDNAs. After two washes with 1 ml

PBS/Ca/Mg, NHS–SS–biotin (Pierce Chemical Co., Rockford, IL) in PBS/Ca/Mg (pH

8.0) was added to cells at 2 mg/ml and incubated for 20 min at 4 ºC. The biotinylation process was repeated with a fresh addition of NHS-SS-biotin in PBS/Ca/Mg at pH 8.5.

Free NHS-SS-biotin was removed by washing twice with 1 ml ice-cold 0.1 M glycine in

PBS/Ca/Mg. The reaction was further quenched by incubation with 0.1 M glycine for 20 min on ice and then cells were washed twice with Ca/Mg–PBS. Cells were lysed in 1 ml radioimmunoprecipitation assay buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 1.0 mM

EDTA, 0.1% SDS, 1.0% Triton X-100, 1.0% sodium deoxycholate) containing the complete protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN) at 4 ºC for 1 h with constant shaking. Cell debris was removed by sedimentation at 15,000g for 88 30 min. The crude cell lysate was incubated with 30 µl avidin–agarose beads (Pierce

Chemical Co.) for 1 h at room temperature. The beads were washed twice with 1 ml lysis buffer and the proteins bound to the beads were eluted in 30 µl 2 x Laemmli sample buffer containing 100 mM dithiothreitol (DTT). The crude cell lysate (30 µl) and the eluded biotinylated protein (30 µl) were separated by SDS polyacrylamide gel electrophoresis, transferred onto nitrocellulose membranes (Bio-Rad Laboratories,

Philadelphia, PA) and blocked for 1 h in 5% dry milk and 0.1% Tween-20 in PBS. The membranes were then probed with mouse anti-c-Myc monoclonal antibody (Cell

Signaling Technology Danvers, MA) diluted at 1:400. Subsequently, the blot was incubated with a peroxidase-conjugated goat anti-mouse IgG1 antibody (Santa Cruz

Biotechnology, Santa Cruz, CA) diluted at 1:3000, and visualized by Enhanced chemiluminescence (Amersham Biosciences, Piscataway, NJ). NHS–SS–biotin was prepared freshly for each use. Protein concentrations of crude cell lysates were used for normalization in western blots.

5.3.3 Detection of free reactive cysteine residues

The procedure for labeling reactive cysteine residues was similar to that described in the literature (Seal, Leighton et al. 1998). Cells were washed twice with 1 ml

PBS/Ca/Mg, and incubated in PBS/Ca/Mg (pH 7.5) in the presence or absence of 20 mM DTT and/or 0.05% NP40 at room temperature for 20 min. Then cells were washed twice again with 1 ml PBS/Ca/Mg, and incubated with 0.5 mg/ml MTSEA biotin (N- biotinylaminoethyl Methanethiosulfonate) (Toronto Research Chemicals Inc., North

89 York, Canada) in PBS/Ca/Mg at room temperature for 30 min. The reaction was stopped by aspiration and wash. Cells were harvested and lysed, and biotinylated DAT was detected the same way as for NHS–SS–biotin labeling described above. The MTSEA- biotin reagent was prepared in PBS/Ca/Mg from a stock solution freshly prepared in

DMSO.

To test whether chemical modification of these EL2 cysteines disrupts transporter uptake activity, Cells were washed twice with 1 ml PBS/Ca/Mg, and incubated in

PBS/Ca/Mg (pH 7.5) in the presence or absence of 20 mM DTT at room temperature for

20 min. Then cells were washed twice again with 1 ml PBS/Ca/Mg, and incubated with

0.5 mg/ml MTSEA biotin (N-biotinylaminoethyl Methanethiosulfonate), 10 mM

MTSES (Sodium (2-Sulfonatoethyl) methanethiosulfonate), or 10 mM MTSET (2-

(Trimethylammonium) ethyl methanethiosulfonate Bromide) (Toronto Research

Chemicals Inc., North York, Canada) in PBS/Ca/Mg at room temperature for 10 min.

The reaction was stopped by aspiration and the washed cells were incubated in the

PBS/Ca/Mg buffer containing 60 nM [3H]dopamine for 10 minutes. Reactions were terminated by two successive washes with PBS/Ca/Mg, and cells were dissolved in 0.1

M NaOH. Amounts of [3H]dopamine accumulated in the cells were quantitated by liquid-scintillation counting. All experiments were performed in triplicates. Cells transfected with vehicle were used as controls and radioactivity associated with these cells were considered the background and subtracted from the total uptake.

90 5.4 Results and discussion

5.4.1 Transport activity and pharmacological profiles of cysteine mutants

The transport activity of dmDAT and the cysteine replacement mutants (dmDATx3 and dmDATx7) expressed in Intestine cells are shown in Figure 5.1. The Km and Vmax data were measured by Dr. Chen in our lab. The Km values (µM) for dmDAT, dmDATx3, and dmDATx7 were 2.2 ± 0.25, 2.56 ± 0.31, and 1.30 ± 0.15 (P < 0.05 versus dmDAT, t-test), respectively. The Vmax (pmole/mg protein/min) values for dmDAT, dmDATx3, and dmDATx7 were 11.42 ± 2.02, 11.46 ± 2.20, and 9.10 ± 1.6, respectively. This result demonstrated that the 7 cysteines replaced in dmDADTx7 are not required for DAT expression and normal uptake function. To facilitate biochemical analysis, Dr. Chen and coworkers added a double c-Myc tag (EQKLISEEDLN

EQKLISEEDLN) at the N-terminus of dmDATx7 and a His tag (8 Histidine residues) at the C-terminus of dmDATx7 (dmDATx7 mh). The addition of the two tags did not affect transport activity (Data not shown).

To determine whether cysteine mutations would alter the inhibition potencies of psychostimulants, we tested dopamine uptake in the presence of cocaine, AMPH, methamphetamine, and methylphenidate. As shown in Figure 5.2A, dmDATx7 was slightly but significantly less sensitive to cocaine inhibition than the wild type, while dmDATx3 was not significantly different from the wild type. The IC50 values of cocaine inhibition for dmDAT, dmDATx3, and dmDATx7 were 6.0 ± 0.1, 8.3 ± 0.6 and 17.4 ±

1.9 µM (P < 0.05 versus dmDAT, t-test). The IC50 values of AMPH inhibition of DA uptake for dmDAT, dmDATx3, dmDATx7 are 4.9 ± 0.9, 5.3 ± 1.0, and 2.1 ± 0.7 (P <

91 0.05 versus dmDAT, t-test), respectively (Figure 5.2B), while IC50 values of methamphetamine inhibition are 4.5 ± 0.9, 6.6 ± 1.2, and 2.8 ± 0.7M respectively

(Figure 5.2C). The mutant dmDATx7 exhibited slightly higher sensitivity than wild type dmDAT or dmDATx3 to AMPH and methamphetamine which are also DAT substrates. This is consistent with the slightly higher apparent affinity of dmDATx7 for dopamine compared to dmDAT and dmDATx3. As shown in Figure 5.2D, there was no significant difference in methylphenidate inhibition of DA uptake activity among dmDAT wild type and cysteine mutants with IC50 values of 6.8 ± 1.1, 9.0 ± 1.0, and 10.2

± 1.4 respectively. Therefore, it is likely that the cysteines replacements might slightly affect drug or substrate binding indirectly by changing the transporter conformation.

5.4.2 Direct evidence of a disulfide bond between the two EL2 cysteines.

The cell surface DAT expression level was measured using NHS–SS–biotin, which reacts with lysine residues and form a covalent bond. Since NHS–SS–biotin is not membrane permeable, it only labels proteins expressed on the surface of intact cells. As shown in Figure 5.3, the majority of dmDATx7 on cell surface were expressed in a mature form with heterogeneous glycosylation (the diffused band around 90 kDa) and a smaller amount of dmDATx7 was in an immature form with very light or no glycosylation (the tight band around 60 kD). In whole cell lysate, the immature form was more abundant (data not shown). This pattern of expression has also been observed for hDAT and hSERT (Chen, Liu-Chen et al. 1997) (Hastrup, Karlin et al. 2001). In stably transfected cell lines, the highly glycosylated mature form of hDAT are expressed

92 on cell surface while the immature form is not present on the cell surface (Hastrup,

Karlin et al. 2001). In the vaccinia-infected and transiently transfected cells, the immature form can also be labeled by NHS–SS–biotin (Chen, Liu-Chen et al. 1997).

This could be explained by that the plasma membrane of some vaccinia-infected cells may have become leaky allowing membrane impermeable NHS-SS-biotin to enter the cells and label the immature form of DAT (Chen, Liu-Chen et al. 1997).

MTSEA-biotin contains a biotin moiety that is linked to MTSEA. It reacts readily with accessible free cysteine residues resulting in the attachment of the biotin moiety to the thiol-group of a cysteine through a disulfide linkage. If two cysteines form a disulfide bond, they are not reactive and cannot be labeled by MTSEA-biotin. We used this reagent to examine whether the two cysteines in EL2 of dmDATx7 form a disulfide bond. As shown in Figure 5.3, there was very little MTSEA-biotin labeling of the glycosylated form (~90 kD) of dmDATx7 without pretreatment (lane B.1), suggesting that the two EL2 cysteines were not reactive or accessible to the reagent. Adding mild detergent may relax tightly folded protein conformation, expose buried residues and

DTT reduces disulfide bond linked cysteines and thus produce free reactive cysteines.

Figure 5.3 shows that pretreatment with DTT (lane B.2) dramatically increased

MTSEA-biotin labeling, suggesting the appearance of free reactive cysteines previously unavailable. In contrast, mild detergent (0.05% NP40) did not increase the accessibility of reactive cysteines (lane 3). In addition, the presence of NP40 did not enhance but actually reduced the effect of DTT treatment (lane B. 4). These results demonstrate that the EL2 cysteines were accessible to DTT and NP40 seems to promote a conformational

93 change that made the cysteines less accessible. Since there is no other cysteine in dmDATx7, the MTSEA-biotin labeling observed must be on one or both of the EL2 cysteines. These two cysteines were reactive only after DTT treatment, indicating that they were linked and protected by a disulfide bond before DTT treatment.

Next I examined whether the disulfide bond plays a role in the uptake function. I incubated the dmDATx7 transfected cells with increasing concentrations of DTT and measured the DA uptake activity. As shown in Figure 5.4, incubation with up to 20 mM

DTT for 20 min had no significant effect on uptake function while the same treatment broke the disulfide bond (Figure 5.3). I also tested whether MTSEA, MESES and

MESET chemically modified cysteine would disrupt uptake activity. pdDATx7 or wild type plasmid transfected cells were pretreated by DTT and incubated with MTSEA,

MESES and MESET solution, dopamine uptake activities were tested after 10 minutes drug incubation, PBS washing and 60nM hot dopamine incubation and PBS washing, uptake results showed no significant difference (p>0.05) compared to no drug treated control (data not shown). Therefore, the disulfide bond is not necessary for the uptake function of the transporter. Since the two EL2 cysteines are required for the expression of functional transporters, it is likely that the disulfide bond may play important roles in the maturation, trafficking, and/or surface expression of the transport protein but not so important for uptake activity. This is in agreement with the observation that substitutions of either of the two EL2 cysteines in hDAT with an alanine dramatically decrease DAT surface expression (Chen, Liu-Chen et al. 1997).

94 5.5 Summary

In summary, Dr. Gu had generated a fully functional DAT mutant, in which all cysteine residues were replaced except the two EL2 cysteines that are highly conserved among all cloned monoamine transporters. Substitutions of either one or both of the EL2 cysteines to any other amino acids did not result in any mutant transporters that were expressed on cell surface and with significant uptake activity, suggesting critical roles of the two EL2 cysteines. The DAT construct with only the EL2 cysteines remaining allowed the unambiguous determination of whether the two EL2 cysteines form a disulfide bond. MTSEA-biotin did not label dmDATx7, indicating that the two EL2 cysteines are not accessible or in free reactive form (Chen, Wei et al. 2007). Mild detergent treatment did not increase the accessibility of the cysteines while the DTT treatment made free cysteines available for MTSEA-biotin labeling. This experiment provided direct evidence that the two EL2 cysteines form a disulfide bond. In addition, breaking the disulfide bond with DTT did not abolish DA uptake function, suggesting that the disulfide bond between EL2 cysteines is likely to play important roles in DAT biosynthesis and/or its delivery to the cell surface (Chen, Wei et al. 2007).

95 5.6 Figures

Figure 5.1 Saturation uptake by wild type dmDAT and cysteine replacement mutants.

Dopamine uptake activities by cells transiently tranfected with dmDAT (squares), dmDATx3 (triangles) and dmDATx7 (diamonds) were measured in the presence of increasing concentrations of unlabeled dopamine at room temperature. The presented data are averages of triplicates and the error bars represent standard error of means. (Dr. Chen).

Figure 5.2 Drug inhibition profiles of wild type dmDAT and cysteine replacement mutants.

Dopamine uptake was measured in the presence of increasing concentrations of stimulant drugs cocaine (A), AMPH (B), methamphetamine (C), and methylphenidate (D). Averages of triplicates and standard error of means are shown. The experimental data were fit by nonlinear regression (Dr. Chen and Hua Wei).

Figure 5.3 Direct evidence of a disulfide bond between the two cysteine residues in the second extracellular loop.

(A) Cells were transiently transfected with vehicle (lane 1) or dmDATx7 (lane 2) and labeled with biotin using NHS-SS-biotin which reacts with lysine residues. (B) Cells transfected with dmDATx7 were pre-incubated in the presence or absence of 20 mM DTT or 0.05% NP40 for 20 min as indicated. The cells were then incubated for 30 min with MTSEA-biotin which only react with free cysteine residues. The biotinylated proteins were purified with avidin-beads and analyzed by Western blot using antibodies against the c-Myc tag on the N-terminus of the dmDATx7.

Figure 5.4 Effect of DTT treatment on DA uptake activity.

Cells transiently transfected with dmDATx7 were washed and incubated with DTT at indicated concentrations for 20 min at 22ºC. DA uptake activities were measured and backgrounds in vehicle transfected cells were subtracted. The presented data are averages of 5 wells for each DTT concentration and the error bars represent standard error of means.

CHAPTER 6

SUMMARY AND FUTURE WORK

Biogenic amine transporters reuptake neurotransmitters back into neurons and thereby terminate neurotransmission. Neurotransmitters are important in regulating many physiological functions. NET is expressed in selective NE nerve terminal pre synapses where it exerts spatial and temporal control over the action of NE. NET is also an important target of antidepressants and psycostimulants. Most of these drugs bind to

NET and block its reuptake activity to increase extracellular NE concentration or promote NE release from presynaptic stores. Some studies have shown that the NA system and NET also played critical roles in producing cocaine effects. Since NET knockout mice may also have developmental adaptations due to the long-term loss of an important transporter and could hamper the interpretation of knockout mice studies, it is necessary to generate a knock-in mouse line with a cocaine resistant NET to study the contribution of NET to cocaine effects.

In chapter 2, we have performed several rounds of random and site-directed mutagenesis in the mNET and screened for mutants with altered sensitivity to cocaine inhibition of substrate uptake. We have identified a triple mutation F101C-A105G-

N153T, containing two mutations in TMD2 and one mutation in TMD3. This triple mutant retains close to wild-type transport function but displays a 37-fold decrease in

100 cocaine sensitivity and 24-fold decrease in desipramine sensitivity. In contrast, the mutant's sensitivities to AMPH, methamphetamine, and methylphenidate are only slightly changed. Our data revealed critical residues contributing to the potent uptake inhibition by these important drugs. Furthermore, this triple mutant was used to generate a unique knock-in mouse line to study the role of NET in the addictive effects of cocaine and the therapeutic effect of desipramine.

In chapter 3, we showed that it is possible to generate a cocaine insensitive NET knock-in mouse line with a feeder-cell free ES system. This unique mNET cocaine- insensitive (NETCI) mouse line will be used to study how cocaine works on noradrenergic system and how noradrenergic system contributes to cocaine addiction.

Also, this mouse model can be used to study the therapeutic effect of desipramine.

In chapter 4, we identified for the first time residues in the TMD3 of mNET that differentially affect NE and DA uptake. Our results of random mutagenesis screening showed that when the corresponding tyrosine residue Y152 in mNET was randomly mutated to any other amino acids, all mutants lost most of their transport activities.

When Y152 in mNET was mutated to F, Vmax of NE uptake was only 28% of WT NE uptake activity, also, the Km is 5 fold greater than wild type, but its DA uptake Vmax was still about 73% of the wild type Vmax and Km was 3.4 fold greater than wild type. This suggested that the Y152 is more critical for NE uptake than DA. However, when Y152 mNET was mutated to W, both DA and NE uptake were abolished. Although these results did not provide us the direct evidence of how substrate and antidepressant bind to membrane transporters, both random mutagenesis and pharmacological analysis of

101 regions are important in elucidating mechanisms of substrate, related agonists and antagonists binding.

In chapter 5, we analyzed a fully functional dopamine transporter mutant

(dmDATx7) generated by Dr. Gu with all cysteines removed except the two cysteines in extracellular loop 2 (EL2). The cysteine-specific reagent MTSEA-biotin labeled dmDATx7 only after a DTT treatment which reduced disulfide bond. Since there are no other cysteines in dmDATx7, the MTSEA-biotin labeling must be on the EL2 cysteines made available by the DTT treatment. This result provided the first direct evidence that the EL2 cysteines form a disulfide bond. Interestingly, the DTT treatment had little effect on transport activity suggesting that the disulfide bond was not necessary for the uptake function of DAT. Our results and previous results are consistent with the notion that the disulfide bond between EL2 cysteines is required for DAT biosynthesis and/or its delivery to the cell surface.

102

LIST OF REFERENCES

Amara, S. G. and J. L. Arriza (1993). "Neurotransmitter transporters: three distinct gene families." Current Opinion in Neurobiology 3(3): 337-44.

Amara, S. G. and M. J. Kuhar (1993). "Neurotransmitter transporters: recent progress." Annu Rev Neurosci 16: 73-93.

Apparsundaram, S., S. Schroeter, et al. (1998). "Acute regulation of norepinephrine transport: II. PKC-modulated surface expression of human norepinephrine transporter proteins." J Pharmacol Exp Ther 287(2): 744-51.

Arroyo, M., W. A. Baker, et al. (2000). "Cocaine self-administration in rats differentially alters mRNA levels of the monoamine transporters and striatal neuropeptides." Brain Res Mol Brain Res 83(1-2): 107-20.

Ascher, J. A., J. O. Cole, et al. (1995). "Bupropion: a review of its mechanism of antidepressant activity." J Clin Psychiatry 56(9): 395-401.

Auclair, A., C. Drouin, et al. (2004). "5-HT2A and alpha1b-adrenergic receptors entirely mediate dopamine release, locomotor response and behavioural sensitization to opiates and psychostimulants." Eur J Neurosci 20(11): 3073-84.

Belej, T., D. Manji, et al. (1996). "Changes in serotonin and norepinephrine uptake sites after chronic cocaine: pre- vs. post-withdrawal effects." Brain Res 736(1-2): 287- 96.

Benmansour, S., A. V. Altamirano, et al. (2004). "Regulation of the norepinephrine transporter by chronic administration of antidepressants." Biol Psychiatry 55(3): 313-6.

103 Beveridge, T. J., H. R. Smith, et al. (2005). "Effects of chronic cocaine self- administration on norepinephrine transporters in the nonhuman primate brain." Psychopharmacology (Berl) 180(4): 781-8.

Bismuth, Y., M. P. Kavanaugh, et al. (1997). "Tyrosine 140 of the gamma-aminobutyric acid transporter GAT-1 plays a critical role in neurotransmitter recognition." J Biol Chem 272(26): 16096-102.

Bruss, M., J. Kunz, et al. (1993). "Chromosomal mapping of the human gene for the tricyclic antidepressant-sensitive noradrenaline transporter." Hum Genet 91(3): 278-80.

Bryan-Lluka, L. J., F. A. Paczkowski, et al. (2001). "Effects of short- and long-term exposure to c-AMP and c-GMP on the noradrenaline transporter." Neuropharmacology 40(4): 607-17.

Buck, K. J. and S. G. Amara (1995). "Structural domains of catecholamine transporter chimeras involved in selective inhibition by antidepressants and psychomotor stimulants." Mol Pharmacol 48(6): 1030-7.

Bunn, S. J., K. J. O'Brien, et al. (1992). "Pertussis toxin inhibits noradrenaline accumulation by bovine adrenal medullary chromaffin cells." Naunyn Schmiedebergs Arch Pharmacol 346(6): 649-56.

Carboni E, S. A., Vacca C, Di Chiara G. (2006). "Cumulative effect of norepinephrine and dopamine carrier blockade on extracellular dopamine increase in the nucleus accumbens shell, bed nucleus of stria terminalis and prefrontal cortex." J Neurochem. 96(2): 473-481.

Carboni, E., C. Spielewoy, et al. (2001). "Cocaine and amphetamine increase extracellular dopamine in the nucleus accumbens of mice lacking the dopamine transporter gene." J Neurosci 21(9): RC141: 1-4.

Chen, J. G., S. Liu-Chen, et al. (1997). "External cysteine residues in the serotonin transporter." Biochemistry 36(6): 1479-86.

Chen, J. G. and G. Rudnick (2000). "Permeation and gating residues in serotonin transporter." Proc Natl Acad Sci U S A 97(3): 1044-9. 104 Chen, J. G., A. Sachpatzidis, et al. (1997). "The third transmembrane domain of the serotonin transporter contains residues associated with substrate and cocaine binding." J Biol Chem 272(45): 28321-7.

Chen, R., D. D. Han, et al. (2005). "A triple mutation in the second transmembrane domain of mouse dopamine transporter markedly decreases sensitivity to cocaine and methylphenidate." J Neurochem 94(2): 352-9.

Chen, R., M. R. Tilley, et al. (2006). "Abolished cocaine reward in mice with a cocaine- insensitive dopamine transporter." Proc Natl Acad Sci U S A 103(24): 9333-8.

Chen, R., H. Wei, et al. (2007). "Direct evidence that two cysteines in the dopamine transporter form a disulfide bond." Mol Cell Biochem 298(1-2): 41-8.

Dipace, C., U. Sung, et al. (2007). "Amphetamine induces a calcium/calmodulin- dependent protein kinase II-dependent reduction in norepinephrine transporter surface expression linked to changes in syntaxin 1A/transporter complexes." Mol Pharmacol 71(1): 230-9.

Drouin, C., G. Blanc, et al. (2002). "Critical role of alpha1-adrenergic receptors in acute and sensitized locomotor effects of D-amphetamine, cocaine, and GBR 12783: influence of preexposure conditions and pharmacological characteristics." Synapse 43(1): 51-61.

Drouin, C., L. Darracq, et al. (2002). "Alpha1b-adrenergic receptors control locomotor and rewarding effects of psychostimulants and opiates." J Neurosci 22(7): 2873- 84.

Erb, S., P. K. Hitchcott, et al. (2000). "Alpha-2 adrenergic receptor agonists block stress- induced reinstatement of cocaine seeking." Neuropsychopharmacology 23(2): 138-50.

Fischman, M. W. and C. R. Schuster (1982). "Cocaine self-administration in humans." Fed Proc 41(2): 241-6.

Fleckenstein, A. E., H. M. Haughey, et al. (1999). "Differential effects of psychostimulants and related agents on dopaminergic and serotonergic transporter function." Eur J Pharmacol 382(1): 45-9. 105 Fritz, J. D., L. D. Jayanthi, et al. (1998). "Cloning and chromosomal mapping of the murine norepinephrine transporter." J Neurochem 70(6): 2241-51.

Gelernter, J., S. Kruger, et al. (1993). "Assignment of the norepinephrine transporter protein (NET1) locus to chromosome 16." Genomics 18(3): 690-2.

Giros, B. and M. G. Caron (1993). "Molecular characterization of the dopamine transporter." Trends in Pharmacological Sciences 14(2): 43-9.

Goodnick, P. J. (1991). "Pharmacokinetics of second generation antidepressants: bupropion." Psychopharmacol Bull 27(4): 513-9.

Gu, H., S. C. Wall, et al. (1994). "Stable expression of biogenic amine transporters reveals differences in inhibitor sensitivity, kinetics, and ion dependence." Journal of Biological Chemistry 269(10): 7124-30.

Gu, H. H., J. Ahn, et al. (1996). "Cell-specific sorting of biogenic amine transporters expressed in epithelial cells." Journal of Biological Chemistry 271(30): 18100-6.

Gu, H. H., X. Wu, et al. (2006). "Conserved serine residues in serotonin transporter contribute to high-affinity cocaine binding." Biochem Biophys Res Commun 343(4): 1179-85.

Hahn, M. K., M. S. Mazei-Robison, et al. (2005). "Single nucleotide polymorphisms in the human norepinephrine transporter gene affect expression, trafficking, antidepressant interaction, and protein kinase C regulation." Mol Pharmacol 68(2): 457-66.

Hahn, M. K., D. Robertson, et al. (2003). "A mutation in the human norepinephrine transporter gene (SLC6A2) associated with orthostatic intolerance disrupts surface expression of mutant and wild-type transporters." J Neurosci 23(11): 4470-8.

Han, D. D. and H. H. Gu (2006). "Comparison of the monoamine transporters from human and mouse in their sensitivities to psychostimulant drugs." BMC Pharmacol 6(1): 6.

106 Hastrup, H., A. Karlin, et al. (2001). "Symmetrical dimer of the human dopamine transporter revealed by cross-linking Cys-306 at the extracellular end of the sixth transmembrane segment." Proc Natl Acad Sci U S A 98(18): 10055-60.

Hein, L. (2006). "Adrenoceptors and signal transduction in neurons." Cell Tissue Res 326(2): 541-51.

Henry, L. K., J. R. Field, et al. (2006). "Tyr-95 and ile-172 in transmembrane segments 1 and 3 of human serotonin transporters interact to establish high affinity recognition of antidepressants." J Biol Chem 281(4): 2012-23.

Holton, K. L., M. K. Loder, et al. (2005). "Nonclassical, distinct endocytic signals dictate constitutive and PKC-regulated neurotransmitter transporter internalization." Nat Neurosci 8(7): 881-8.

Inazu, M., H. Takeda, et al. (2003). "Functional expression of the norepinephrine transporter in cultured rat astrocytes." J Neurochem 84(1): 136-44.

Jayanthi, L. D., B. Annamalai, et al. (2006). "Phosphorylation of the norepinephrine transporter at threonine 258 and serine 259 is linked to protein kinase C- mediated transporter internalization." J Biol Chem 281(33): 23326-40.

Jayanthi, L. D., D. J. Samuvel, et al. (2004). "Regulated internalization and phosphorylation of the native norepinephrine transporter in response to phorbol esters. Evidence for localization in lipid rafts and lipid raft-mediated internalization." J Biol Chem 279(18): 19315-26.

Kim, C. H., M. K. Hahn, et al. (2006). "A polymorphism in the norepinephrine transporter gene alters promoter activity and is associated with attention-deficit hyperactivity disorder." Proc Natl Acad Sci U S A 103(50): 19164-9.

Kuhar, M. J., M. C. Ritz, et al. (1991). "The dopamine hypothesis of the reinforcing properties of cocaine." Trends in Neurosciences 14(7): 299-302.

Lee, B., S. Tiefenbacher, et al. (2004). "Pharmacological blockade of alpha2- adrenoceptors induces reinstatement of cocaine-seeking behavior in squirrel monkeys." Neuropsychopharmacology 29(4): 686-93.

107 Lee, S. H., M. Y. Chang, et al. (2000). "Importance of valine at position 152 for the substrate transport and 2beta-carbomethoxy-3beta-(4-fluorophenyl)tropane binding of dopamine transporter." Mol Pharmacol 57(5): 883-9.

Lee, Y. J., C. Hohoff, et al. (2005). "Norepinephrine transporter (NET) promoter and 5'- UTR polymorphisms: association analysis in panic disorder." Neurosci Lett 377(1): 40-3.

Lin, Z. and G. R. Uhl (2002). "Dopamine transporter mutants with cocaine resistance and normal dopamine uptake provide targets for cocaine antagonism." Mol Pharmacol 61(4): 885-91.

Lingen, B., M. Bruss, et al. (1994). "Cloning and expression of the bovine sodium- and chloride-dependent noradrenaline transporter." FEBS Lett 342(3): 235-8.

Liu, Z., B. R. Stevens, et al. (2003). "K+ amino acid transporter KAAT1 mutant Y147F has increased transport activity and altered substrate selectivity." J Exp Biol 206(Pt 2): 245-54.

Macey, D. J., H. R. Smith, et al. (2003). "Chronic cocaine self-administration upregulates the norepinephrine transporter and alters functional activity in the bed nucleus of the stria terminalis of the rhesus monkey." J Neurosci 23(1): 12-6.

Mao, W., C. Iwai, et al. (2005). "Norepinephrine induces endoplasmic reticulum stress and downregulation of norepinephrine transporter density in PC12 cells via oxidative stress." Am J Physiol Heart Circ Physiol 288(5): H2381-9.

Mao, W., F. Qin, et al. (2004). "Extracellular norepinephrine reduces neuronal uptake of norepinephrine by oxidative stress in PC12 cells." Am J Physiol Heart Circ Physiol 287(1): H29-39.

Mateo, Y., E. A. Budygin, et al. (2004). "Role of serotonin in cocaine effects in mice with reduced dopamine transporter function." Proc Natl Acad Sci U S A 101(1): 372-7.

Melikian, H. E., J. K. McDonald, et al. (1994). "Human norepinephrine transporter. Biosynthetic studies using a site-directed polyclonal antibody." Journal of Biological Chemistry 269(16): 12290-7. 108 Melikian, H. E., S. Ramamoorthy, et al. (1996). "Inability to N-glycosylate the human norepinephrine transporter reduces protein stability, surface trafficking, and transport activity but not ligand recognition." Mol Pharmacol 50(2): 266-76.

Miguita, K., Q. Cordeiro, et al. (2006). "Association study between the 1287 A/G exonic polymorphism of the norepinephrine transporter (NET) gene and obsessive- compulsive disorder in a Brazilian sample." Rev Bras Psiquiatr 28(2): 158-9.

Miles, P. R., M. L. Mundorf, et al. (2002). "Release and uptake of catecholamines in the bed nucleus of the stria terminalis measured in the mouse brain slice." Synapse 44(3): 188-97.

Moore, R. Y. and F. E. Bloom (1979). "Central catecholamine neuron systems: anatomy and physiology of the norepinephrine and epinephrine systems." Annu Rev Neurosci 2: 113-68.

Moron, J. A., A. Brockington, et al. (2002). "Dopamine uptake through the norepinephrine transporter in brain regions with low levels of the dopamine transporter: evidence from knock-out mouse lines." J Neurosci 22(2): 389-95.

Nguyen, T. T. and S. G. Amara (1996). "N-linked oligosaccharides are required for cell surface expression of the norepinephrine transporter but do not influence substrate or inhibitor recognition." J Neurochem 67(2): 645-55.

Nichols, J., E. P. Evans, et al. (1990). "Establishment of germ-line-competent embryonic stem (ES) cells using differentiation inhibiting activity." Development 110(4): 1341-8.

Nutt, D. J., M. D. Lalies, et al. (1997). "Noradrenergic mechanisms in the prefrontal cortex." J Psychopharmacol 11(2): 163-8.

Ordway, G. A., W. Jia, et al. (2005). "Norepinephrine transporter function and desipramine: residual drug effects versus short-term regulation." J Neurosci Methods 143(2): 217-25.

Pacholczyk, T., R. D. Blakely, et al. (1991). "Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter." Nature 350(6316): 350-4. 109 Ponce, J., Biton, B., Benavides, J., Avenet, P. & Aragon, C. (2000). "Transmembrane Domain III Plays an Important Role in Ion Binding and Permeation in the Glycine Transporter GLYT2." J Biol Chem 275(18): 13856-13862.

Ritz, M. C., R. J. Lamb, et al. (1987). "Cocaine receptors on dopamine transporters are related to self-administration of cocaine." Science 237(4819): 1219-23.

Rocha, B. A., F. Fumagalli, et al. (1998). "Cocaine self-administration in dopamine- transporter knockout mice [see comments] [published erratum appears in Nat Neurosci 1998 Aug;1(4):330]." Nat Neurosci 1(2): 132-7.

Rothman, R. B. and M. H. Baumann (2003). "Monoamine transporters and psychostimulant drugs." Eur J Pharmacol 479(1-3): 23-40.

Rudnick, G. and J. Clark (1993). "From synapse to vesicle: the reuptake and storage of biogenic amine neurotransmitters." Biochimica et Biophysica Acta 1144(3): 249- 63.

Sand, P. G., T. Mori, et al. (2002). "Norepinephrine transporter gene (NET) variants in patients with panic disorder." Neurosci Lett 333(1): 41-4.

Schank, J. R., R. Ventura, et al. (2006). "Dopamine beta-hydroxylase knockout mice have alterations in dopamine signaling and are hypersensitive to cocaine." Neuropsychopharmacology 31(10): 2221-30.

Seal, R. P., B. H. Leighton, et al. (1998). "Transmembrane topology mapping using biotin-containing sulfhydryl reagents." Methods Enzymol 296: 318-31.

Sen, N., L. Shi, et al. (2005). "A pincer-like configuration of TM2 in the human dopamine transporter is responsible for indirect effects on cocaine binding." Neuropharmacology 49(6): 780-90.

Singh, S. K., A. Yamashita, et al. (2007). "Antidepressant binding site in a bacterial homologue of neurotransmitter transporters." Nature 448(7156): 952-6.

Smythies, J. (2005). "Section III. The norepinephrine system." Int Rev Neurobiol 64: 173-211. 110 Sora, I., C. Wichems, et al. (1998). "Cocaine reward models: conditioned place preference can be established in dopamine- and in serotonin-transporter knockout mice." Proc Natl Acad Sci U S A 95(13): 7699-704.

Stevens, B. R., D. H. Feldman, et al. (2002). "Conserved tyrosine-147 plays a critical role in the ligand-gated current of the epithelial cation/amino acid transporter/channel CAATCH1." J Exp Biol 205(Pt 16): 2545-53.

Sung, U., S. Apparsundaram, et al. (2003). "A regulated interaction of syntaxin 1A with the antidepressant-sensitive norepinephrine transporter establishes catecholamine clearance capacity." J Neurosci 23(5): 1697-709.

Sung, U. and R. D. Blakely (2007). "Calcium-dependent interactions of the human norepinephrine transporter with syntaxin 1A." Mol Cell Neurosci 34(2): 251-60.

Surratt, C. K., O. T. Ukairo, et al. (2005). "Recognition of psychostimulants, antidepressants, and other inhibitors of synaptic neurotransmitter uptake by the plasma membrane monoamine transporters." AAPS J 7(3): E739-51.

Uchida, J., Y. Kiuchi, et al. (1998). "Ca(2+)-dependent enhancement of [3H]noradrenaline uptake in PC12 cells through calmodulin-dependent kinases." Brain Res 809(2): 155-64.

Ventura, R., C. Morrone, et al. (2007). "Prefrontal/accumbal catecholamine system determines motivational salience attribution to both reward- and aversion-related stimuli." Proc Natl Acad Sci U S A 104(12): 5181-6.

Wang, J. B., A. Moriwaki, et al. (1995). "Dopamine transporter cysteine mutants: second extracellular loop cysteines are required for transporter expression." J Neurochem 64(3): 1416-9.

Wei, H., E. R. Hill, et al. (2008). "Functional mutations in mouse norepinephrine transporter reduce sensitivity to cocaine inhibition." Neuropharmacology.

Weinshenker, D., N. S. Miller, et al. (2002). "Mice with chronic norepinephrine deficiency resemble amphetamine-sensitized animals." Proc Natl Acad Sci U S A 99(21): 13873-7.

111 Wellman, P. J. (2000). "Norepinephrine and the control of food intake." Nutrition 16(10): 837-42.

Wise, R. A. and M. A. Bozarth (1987). "A psychomotor stimulant theory of addiction." Psychol Rev 94(4): 469-92.

Wong, E. H., M. S. Sonders, et al. (2000). "Reboxetine: a pharmacologically potent, selective, and specific norepinephrine reuptake inhibitor." Biol Psychiatry 47(9): 818-29.

Wu, X. and H. H. Gu (2003). "Cocaine affinity decreased by mutations of aromatic residue phenylalanine 105 in the transmembrane domain 2 of dopamine transporter." Molecular Pharmacology 63(3): 653-8.

Xu, F., R. R. Gainetdinov, et al. (2000). "Mice lacking the norepinephrine transporter are supersensitive to psychostimulants." Nat Neurosci 3(5): 465-71.

Yamashita, A., S. K. Singh, et al. (2005). "Crystal structure of a bacterial homologue of Na+/Cl--dependent neurotransmitter transporters." Nature 437(7056): 215-23.

Zhang, X. Y. and T. A. Kosten (2005). "Prazosin, an alpha-1 adrenergic antagonist, reduces cocaine-induced reinstatement of drug-seeking." Biol Psychiatry 57(10): 1202-4.

Zhao, Z., A. M. Baros, et al. (2008). "Norepinephrine Transporter Regulation Mediates the Long-Term Behavioral Effects of the Antidepressant Desipramine." Neuropsychopharmacology.

Zhu, M. Y., R. D. Blakely, et al. (1998). "Down-regulation of the human norepinephrine transporter in intact 293-hNET cells exposed to desipramine." J Neurochem 70(4): 1547-55.

Zhu, M. Y., P. B. Kyle, et al. (2004). "The persistent membrane retention of desipramine causes lasting inhibition of norepinephrine transporter function." Neurochem Res 29(2): 419-27.

112 Zhu, M. Y., S. Shamburger, et al. (2000). "Regulation of the human norepinephrine transporter by cocaine and amphetamine." J Pharmacol Exp Ther 295(3): 951-9.

113