DOCSLIB.ORG

Homeodomain Protein Interactions in the CNS 1301

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Homeodomain Protein Interactions in the CNS 1301 Development 128, 1299-1312 (2001) 1299 Printed in Great Britain © The Company of Biologists Limited 2001 DEV2653 Meis3 synergizes with Pbx4 and Hoxb1b in promoting hindbrain fates in the zebrafish Nikolaos Vlachakis, Seong-Kyu Choe and Charles G. Sagerström* Department of Biochemistry and Molecular Pharmacology, and Program in Neuroscience, University of Massachusetts Medical School, Worcester, 55 Lake Avenue North, MA 01655, USA *Author for correspondence (e-mail: [email protected]) Accepted 16 January; published on WWW 22 March 2001 SUMMARY Many Hox proteins are thought to require Pbx and Meis neurons. This synergistic effect requires that Hoxb1b and co-factors to specify cell identity during embryogenesis. Meis3 have intact Pbx-interaction domains, suggesting that Here we demonstrate that Meis3 synergizes with Pbx4 and their in vivo activity is dependent on binding to Pbx4. In Hoxb1b in promoting hindbrain fates in the zebrafish. We the case of Meis3, binding to Pbx4 is also required for find that Hoxb1b and Pbx4 act together to induce ectopic nuclear access. Our results are consistent with Hoxb1b hoxb1a expression in rhombomere 2 of the hindbrain. In and Meis3 interacting with Pbx4 to form complexes contrast, Hoxb1b and Pbx4 acting together with Meis3 that regulate hindbrain development during zebrafish induce hoxb1a, hoxb2, krox20 and valentino expression embryogenesis. rostrally and cause extensive transformation of forebrain and midbrain fates to hindbrain fates, including Key words: Hindbrain, Mauthner neuron, Homeosis, Embryonic differentiation of excess rhombomere 4-specific Mauthner axis, Hoxb1b, Meis3, Pbx4, Zebrafish INTRODUCTION DNA-binding (reviewed by Mann and Affolter, 1998). An in vivo role for such complexes is suggested by the effect of Vertebrate hox genes, like their Drosophila counterparts the dominant negative forms of Hth in Drosophila (Jaw et al., HOM-C genes, play essential roles during embryogenesis. For 2000; Ryoo et al., 1999), by the finding that dimers (e.g. Chang instance, their expression in overlapping domains along the et al., 1997; Knoepfler et al., 1997) and trimers (Ferretti et al., anteroposterior (AP) axis provides a ‘hox code’ that specifies 2000; Shen et al., 1999) can be reconstituted in cell extracts AP positional identity, and changes in hox gene expression lead and by the observation that Meis, Pbx and Hox binding sites to homeotic transformations in the AP axis, wherein anterior are present in several Hox-dependent promoters (Ferretti et al., structures acquire the character of more posterior structures 2000; Jacobs et al., 1999; Pöpperl et al., 1995; Ryoo et al., (reviewed by Krumlauf, 1994). 1999). Genetic analyses in Drosophila revealed that many HOM-C pbx4, meis3 and hoxb1b are co-expressed in the caudal genes require the extradenticle (exd) and homothorax (hth) hindbrain primordium of the zebrafish embryo and Pbx4, genes for proper function (Rauskolb et al., 1993; Rieckhof et Meis3 and Hoxb1b form complexes in vitro (Vlachakis et al., al., 1997). Homologs of exd and hth are encoded by the 2000). Here we explore the role of these proteins during vertebrate pbx (Kamps et al., 1990; Monica et al., 1991; Nourse zebrafish development and test whether they need to interact et al., 1990; Vlachakis et al., 2000) and meis/prep (Berthelsen to function in vivo. We find that Hoxb1b and Pbx4 act together et al., 1998; Moskow et al., 1995; Nakamura et al., 1996) gene to induce ectopic hoxb1a expression in rhombomere (r) 2. In families, respectively. Recently, the zebrafish lazarus mutation, marked contrast, Hoxb1b and Pbx4 together with Meis3 induce which disturbs segmental patterning in hindbrain and trunk, massive rostral expression of several hindbrain genes (hoxb1a, was cloned (Popperl et al., 2000) and found to encode the hoxb2, krox20 and valentino) and cause anterior truncations, previously reported pbx4 gene (Vlachakis et al., 2000), apparently due to the transformation of rostral (forebrain and suggesting a role for pbx genes also in vertebrate development. midbrain) fates to caudal (hindbrain) fates. This transformation Vertebrate meis genes also likely play a role, as misexpression is extensive enough that we observe excess Mauthner neurons of Xenopus Meis3 leads to abnormalities of the AP axis (normally found in r4) anteriorly. These effects are dependent (Salzberg et al., 1999). on Meis3 and Hoxb1b having intact Pbx interaction domains, Pbx and Meis form dimeric and trimeric complexes with suggesting that they interact with Pbx4 in vivo. Our results also Hox proteins in vitro and these complexes are thought to indicate that Meis3 must interact with Pbx4 to access the modulate Hox activity, primarily by conferring high-specificity nucleus. Since meis3, pbx4 and hoxb1b are co-expressed in the 1300 N. Vlachakis, S.-K. Choe and C. G. Sagerström zebrafish hindbrain primordium during embryogenesis, our HAHoxb1b constructs) or 3 embryos (for MYCMeis3 constructs) results are consistent with complexes containing combinations were run per lane. of Pbx4, Hoxb1b and Meis3 regulating normal hindbrain development. In situ hybridization, immunostaining and immunoprecipitations In situ hybridizations and immunoprecipitations have been described previously (Vlachakis et al., 2000). Immunostaining with 3A10, anti- MATERIALS AND METHODS c-myc (clone 9E10) and anti-HA (clone 12CA5) was done as described by Hatta (Hatta, 1992). HRP was detected using the TSA- Cloning direct kit (Dupont Biotechnology Systems). Photographs were taken All genes used were derived from zebrafish, all expression constructs with a Leica confocal or an Olympus inverted microscope. Rabbit were in the pCS2+ vector and all constructs were verified by polyclonal anti-Pbx4 antiserum was raised to a peptide containing the sequencing. Meis3, Pbx4, HA-Hoxb1b and MutMeis3 (carries two 13 C-terminal residues of Pbx4 and used at 1:1000 for western blots. point mutations in the homeodomain, Q44→E and N51→A) have been described (Vlachakis et al., 2000, Sagerström et al, 2001). In Fate mapping δhoxb1b, the N-terminal 146 amino acids (aa) were deleted by Embryos were injected with hoxb1b+pbx4+meis3 mRNAs at the 1- digesting pCS2+HAHoxb1b with SmaI/PstI and inserting to 2-cell stage. At early gastrula stage (6.5 hpf; hours postfertilization) oligonucleotide 5′-TTCCCGGGGTAGGCTGCA-3′. In BMNMeis3 animal pole cells of control and injected embryos were labeled with the N-terminal 171 aa were replaced with the FRB (FKBP 12- 1,1′-diooctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate rapamycin binding) domain from FRAP (FKBP 12-rapamycin (DiI) and fate mapping performed as described (Fekany-Lee et al., associated protein) (Chen et al., 1995). Primers 5′- 2000) except embryos were fixed at 4- to 5-somite stages. TATATCTAGACTGCTTTGAGATTCGTCGGA-3′ and 5′-GGATG- AATTCATGGACTATAAAGATGACGA-3′ amplified the FLAG- FRB domain which was subcloned via EcoRI and XbaI sites in RESULTS the primers into pCS2+ (pCS2+FLAG-FRB). Primers 5′-GGTCT- AGACGAGAGGGTGGATCTAAATCTGAC-3′ and 5′-GGTCT- Hoxb1b requires an intact Pbx-interaction domain to AGATCAGTGGGCATGTATGTCAAG-3′ amplified aa 172-415 of induce hoxb1a expression in rhombomere 2 the Meis3 ORF from pCS2+meis3. This was subcloned via XbaI Misexpression of Hoxa1 in the mouse leads to ectopic Hoxb1 sites in the primers into pCS2+FLAG-FRB downstream of FRB. MYCFRBMeis3 was generated by subcloning an XhoI/NotI fragment expression in r2 of the hindbrain (Zhang et al., 1994). To test from pCS2+FLAG-FRBMeis3 into pCS2+MT cut with XhoI/NotI. if this is the case also for zebrafish, we expressed Hoxb1b (the For Meis3-VP16 primers 5′-AAAGATATCCCCACCGTAC- zebrafish counterpart to murine Hoxa1; Alexandre et al., 1996; TCGTCAATTCC-3′ and 5′-AAAGATATCTCGACGGCCCCCCC- Amores et al., 1998) ectopically by mRNA microinjection (see GACCGATGTCAGC-3′ amplified the VP16 domain from Materials and Methods). Control injections with lacZ mRNA pCS2+vp16N (Kessler, 1997). This was subcloned via EcoRV sites resulted in normal embryos (Fig. 1Aa,b; Table 1) while in the primers into the SmaI site (1092 bp in Meis3 ORF) of expression of Hoxb1b (Fig. 1Ac,d) resulted in ectopic pCS2+meis3. All point mutations were generated with the expression of hoxb1a (the zebrafish counterpart to murine QuikChange kit from Stratagene: BMHoxb1b (has a substitution in → ′ Hoxb1, normally expressed in r4; Amores et al., 1998; Prince the pentapeptide FDWMK, W186 F) was generated using primer 5 - et al., 1998) in r2 (52%; arrow in Fig. 1Ac), and largely normal GGGGGATTCCTCTTGACTTTCATAAAGTCAAAGGTTGGCGC- 3′, BMM2Meis3 (has two substitutions in the M2 motif, L141→A and expression of hoxb2 (Fig. 1Ad; normally expressed in r3-r5; E142→A) using primer 5′-CGGTTTCATCTATTAGAAGCAGC- Prince et al., 1998). This is consistent with a report AAAGGTTCATGACCTCTGTGATAATTTCTGCC-3′, BMwM2Meis3 demonstrating an ectopic pair of Mauthner neurons (normally (has five substitutions in the M2 motif, I131→A, L134→A, L138→A, found in r4) in r2 following hoxb1b misexpression in zebrafish L141→A and E142→A) using primer 5′-CTGATGATCCAGGCC- (Alexandre et al., 1996). GCTCAAGTTGCACGGTTTCATGCATTAGAAGCAGC−3′ with Adjacent Pbx and Hox binding sites are present in the BMM2Meis3 as a template and BMM1/2Meis3 (has four substitutions murine Hoxb1 enhancer and both sites are required for in the M1 motif, aa 64-67 KCEL→NNSQ and two substitutions expression in a transgenic model (Pöpperl et al., 1995), → → ′ in the M2 motif, L141 A and E142 A) using primer 5 - suggesting that Pbx and Hox proteins might
Load more

Recommended publications
  • Expression of HOXB2, a Retinoic Acid Signalingtarget in Pancreatic Cancer and Pancreatic Intraepithelial Neoplasia Davendra Segara,1Andrew V
    Cancer Prevention Expression of HOXB2, a Retinoic Acid SignalingTarget in Pancreatic Cancer and Pancreatic Intraepithelial Neoplasia Davendra Segara,1Andrew V. Biankin,1, 2 James G. Kench,1, 3 Catherine C. Langusch,1Amanda C. Dawson,1 David A. Skalicky,1David C. Gotley,4 Maxwell J. Coleman,2 Robert L. Sutherland,1and Susan M. Henshall1 Abstract Purpose: Despite significant progress in understanding the molecular pathology of pancreatic cancer and its precursor lesion: pancreatic intraepithelial neoplasia (PanIN), there remain no molecules with proven clinical utility as prognostic or therapeutic markers. Here, we used oligo- nucleotide microarrays to interrogate mRNA expression of pancreatic cancer tissue and normal pancreas to identify novel molecular pathways dysregulated in the development and progression of pancreatic cancer. Experimental Design: RNA was hybridized toAffymetrix Genechip HG-U133 oligonucleotide microarrays. A relational database integrating data from publicly available resources was created toidentify candidate genes potentially relevant topancreatic cancer. The protein expression of one candidate, homeobox B2 (HOXB2), in PanIN and pancreatic cancer was assessed using immunohistochemistry. Results: We identified aberrant expression of several components of the retinoic acid (RA) signaling pathway (RARa,MUC4,Id-1,MMP9,uPAR,HB-EGF,HOXB6,andHOXB2),manyof which are known to be aberrantly expressed in pancreatic cancer and PanIN. HOXB2, a down- stream target of RA, was up-regulated 6.7-fold in pancreatic cancer compared with normal pan- creas. Immunohistochemistry revealed ectopic expression of HOXB2 in15% of early PanINlesions and 48 of 128 (38%) pancreatic cancer specimens. Expression of HOXB2 was associated with nonresectable tumors and was an independent predictor of poor survival in resected tumors.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • Roles of Cofactors and Chromatin Accessibility in Hox Protein Target
    Beh et al. Epigenetics & Chromatin (2016) 9:1 DOI 10.1186/s13072-015-0049-x Epigenetics & Chromatin RESEARCH Open Access Roles of cofactors and chromatin accessibility in Hox protein target specificity Ching Yew Beh1†, Sherif El‑Sharnouby2†, Aikaterini Chatzipli2,3, Steven Russell3,4, Siew Woh Choo1* and Robert White2* Abstract Background: The regulation of specific target genes by transcription factors is central to our understanding of gene network control in developmental and physiological processes yet how target specificity is achieved is still poorly understood. This is well illustrated by the Hox family of transcription factors as their limited in vitro DNA-binding specificity contrasts with their clear in vivo functional specificity. Results: We generated genome-wide binding profiles for three Hox proteins, Ubx, Abd-A and Abd-B, following transient expression in Drosophila Kc167 cells, revealing clear target specificity and a striking influence of chromatin accessibility. In the absence of the TALE class homeodomain cofactors Exd and Hth, Ubx and Abd-A bind at a very similar set of target sites in accessible chromatin, whereas Abd-B binds at an additional specific set of targets. Provi‑ sion of Hox cofactors Exd and Hth considerably modifies the Ubx genome-wide binding profile enabling Ubx to bind at an additional novel set of targets. Both the Abd-B specific targets and the cofactor-dependent Ubx targets are in chromatin that is relatively DNase1 inaccessible prior to the expression of Hox proteins/Hox cofactors. Conclusions: Our experiments demonstrate a strong role for chromatin accessibility in Hox protein binding and sug‑ gest that Hox protein competition with nucleosomes has a major role in Hox protein target specificity in vivo.
    [Show full text]
  • DNMT3A Arg882 Mutation Drives Chronic Myelomonocytic Leukemia Through Disturbing Gene Expression/DNA Methylation in Hematopoietic Cells
    DNMT3A Arg882 mutation drives chronic myelomonocytic leukemia through disturbing gene expression/DNA methylation in hematopoietic cells Jie Xua,1, Yue-Ying Wanga,1,2, Yu-Jun Daia,1, Wu Zhanga, Wei-Na Zhanga, Shu-Min Xionga, Zhao-Hui Gub, Kan-Kan Wanga, Rong Zengc, Zhu Chena,b,2, and Sai-Juan Chena,b,2 aState Key Laboratory of Medical Genomics, Shanghai Institute of Hematology, Rui Jin Hospital affiliated with Shanghai Jiao Tong University School of Medicine, Shanghai 200025, China; bKey Laboratory of Ministry of Education of Systems Biomedicine, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai 200240, China; and cKey Laboratory of Systems Biology, Shanghai Institutes for Biological Science, Chinese Academy of Sciences, Shanghai 200031, China Contributed by Zhu Chen, January 16, 2014 (sent for review December 2, 2013) The gene encoding DNA methyltransferase 3A (DNMT3A) is mu- the transforming potentials of hematopoietic stem/progenitor tated in ∼20% of acute myeloid leukemia cases, with Arg882 (R882) cells (HSPCs). We also examined the possible mechanisms of as the hotspot. Here, we addressed the transformation ability of the these abnormal potentials at transcriptome, epigenetics, and DNMT3A-Arg882His (R882H) mutant by using a retroviral transduc- protein–protein interaction levels in transformed HSPCs with tion and bone marrow transplantation (BMT) approach and found the DNMT3A-R882H mutation. that the mutant gene can induce aberrant proliferation of hemato- Results poietic stem/progenitor cells. At 12 mo post-BMT, all mice developed chronic myelomonocytic leukemia with thrombocytosis. RNA DNMT3A-R882H Mutation Enhances Proliferation Potential of Hema- microarray analysis revealed abnormal expressions of some he- topoietic Cells.
    [Show full text]
  • Systems Biology Approaches to Mining High Throughput Biological Data
    BioMed Research International Systems Biology Approaches to Mining High Throughput Biological Data Guest Editors: Fang-Xiang Wu, Min Li, Jishou Ruan, and Feng Luo Systems Biology Approaches to Mining High Throughput Biological Data BioMed Research International Systems Biology Approaches to Mining High Throughput Biological Data Guest Editors: Fang-Xiang Wu, Min Li, Jishou Ruan, and Feng Luo Copyright © 2015 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Systems Biology Approaches to Mining High Throughput Biological Data, Fang-Xiang Wu, Min Li, Jishou Ruan, and Feng Luo Volume 2015, Article ID 504362, 2 pages ProSim: A Method for Prioritizing Disease Genes Based on Protein Proximity and Disease Similarity, Gamage Upeksha Ganegoda, Yu Sheng, and Jianxin Wang Volume 2015, Article ID 213750, 11 pages Differential Expression Analysis in RNA-Seq by a Naive Bayes Classifier with Local Normalization, YongchaoDou,XiaomeiGuo,LinglingYuan,DavidR.Holding,andChiZhang Volume 2015, Article ID 789516, 9 pages ?? -Profiles: A Nonlinear Clustering Method for Pattern Detection in High Dimensional, Data Kai Wang, Qing Zhao, Jianwei Lu, and Tianwei Yu Volume 2015, Article ID 918954, 10 pages Screening Ingredients from Herbs against Pregnane X Receptor in
    [Show full text]
  • Coordinated Waves of Gene Expression During Neuronal Differentiation of Embryonic Stem Cells As Basis for Novel Approaches to Developmental Neurotoxicity Testing
    Cell Death and Differentiation (2011) 18, 383–395 & 2011 Macmillan Publishers Limited All rights reserved 1350-9047/11 www.nature.com/cdd Coordinated waves of gene expression during neuronal differentiation of embryonic stem cells as basis for novel approaches to developmental neurotoxicity testing B Zimmer1, PB Kuegler1, B Baudis1, A Genewsky1, V Tanavde2, W Koh2, B Tan2, T Waldmann1, S Kadereit1 and M Leist*,1 As neuronal differentiation of embryonic stem cells (ESCs) recapitulates embryonic neurogenesis, disturbances of this process may model developmental neurotoxicity (DNT). To identify the relevant steps of in vitro neurodevelopment, we implemented a differentiation protocol yielding neurons with desired electrophysiological properties. Results from focussed transcriptional profiling suggested that detection of non-cytotoxic developmental disturbances triggered by toxicants such as retinoic acid (RA) or cyclopamine was possible. Therefore, a broad transcriptional profile of the 20-day differentiation process was obtained. Cluster analysis of expression kinetics, and bioinformatic identification of overrepresented gene ontologies revealed waves of regulation relevant for DNT testing. We further explored the concept of superimposed waves as descriptor of ordered, but overlapping biological processes. The initial wave of transcripts indicated reorganization of chromatin and epigenetic changes. Then, a transient upregulation of genes involved in the formation and patterning of neuronal precursors followed. Simultaneously, a long wave of ongoing neuronal differentiation started. This was again superseded towards the end of the process by shorter waves of neuronal maturation that yielded information on specification, extracellular matrix formation, disease-associated genes and the generation of glia. Short exposure to lead during the final differentiation phase, disturbed neuronal maturation.
    [Show full text]