Development 128, 1299-1312 (2001) 1299 Printed in Great Britain © The Company of Biologists Limited 2001 DEV2653 Meis3 synergizes with Pbx4 and Hoxb1b in promoting hindbrain fates in the zebrafish Nikolaos Vlachakis, Seong-Kyu Choe and Charles G. Sagerström* Department of Biochemistry and Molecular Pharmacology, and Program in Neuroscience, University of Massachusetts Medical School, Worcester, 55 Lake Avenue North, MA 01655, USA *Author for correspondence (e-mail: [email protected]) Accepted 16 January; published on WWW 22 March 2001 SUMMARY Many Hox proteins are thought to require Pbx and Meis neurons. This synergistic effect requires that Hoxb1b and co-factors to specify cell identity during embryogenesis. Meis3 have intact Pbx-interaction domains, suggesting that Here we demonstrate that Meis3 synergizes with Pbx4 and their in vivo activity is dependent on binding to Pbx4. In Hoxb1b in promoting hindbrain fates in the zebrafish. We the case of Meis3, binding to Pbx4 is also required for find that Hoxb1b and Pbx4 act together to induce ectopic nuclear access. Our results are consistent with Hoxb1b hoxb1a expression in rhombomere 2 of the hindbrain. In and Meis3 interacting with Pbx4 to form complexes contrast, Hoxb1b and Pbx4 acting together with Meis3 that regulate hindbrain development during zebrafish induce hoxb1a, hoxb2, krox20 and valentino expression embryogenesis. rostrally and cause extensive transformation of forebrain and midbrain fates to hindbrain fates, including Key words: Hindbrain, Mauthner neuron, Homeosis, Embryonic differentiation of excess rhombomere 4-specific Mauthner axis, Hoxb1b, Meis3, Pbx4, Zebrafish INTRODUCTION DNA-binding (reviewed by Mann and Affolter, 1998). An in vivo role for such complexes is suggested by the effect of Vertebrate hox genes, like their Drosophila counterparts the dominant negative forms of Hth in Drosophila (Jaw et al., HOM-C genes, play essential roles during embryogenesis. For 2000; Ryoo et al., 1999), by the finding that dimers (e.g. Chang instance, their expression in overlapping domains along the et al., 1997; Knoepfler et al., 1997) and trimers (Ferretti et al., anteroposterior (AP) axis provides a ‘hox code’ that specifies 2000; Shen et al., 1999) can be reconstituted in cell extracts AP positional identity, and changes in hox gene expression lead and by the observation that Meis, Pbx and Hox binding sites to homeotic transformations in the AP axis, wherein anterior are present in several Hox-dependent promoters (Ferretti et al., structures acquire the character of more posterior structures 2000; Jacobs et al., 1999; Pöpperl et al., 1995; Ryoo et al., (reviewed by Krumlauf, 1994). 1999). Genetic analyses in Drosophila revealed that many HOM-C pbx4, meis3 and hoxb1b are co-expressed in the caudal genes require the extradenticle (exd) and homothorax (hth) hindbrain primordium of the zebrafish embryo and Pbx4, genes for proper function (Rauskolb et al., 1993; Rieckhof et Meis3 and Hoxb1b form complexes in vitro (Vlachakis et al., al., 1997). Homologs of exd and hth are encoded by the 2000). Here we explore the role of these proteins during vertebrate pbx (Kamps et al., 1990; Monica et al., 1991; Nourse zebrafish development and test whether they need to interact et al., 1990; Vlachakis et al., 2000) and meis/prep (Berthelsen to function in vivo. We find that Hoxb1b and Pbx4 act together et al., 1998; Moskow et al., 1995; Nakamura et al., 1996) gene to induce ectopic hoxb1a expression in rhombomere (r) 2. In families, respectively. Recently, the zebrafish lazarus mutation, marked contrast, Hoxb1b and Pbx4 together with Meis3 induce which disturbs segmental patterning in hindbrain and trunk, massive rostral expression of several hindbrain genes (hoxb1a, was cloned (Popperl et al., 2000) and found to encode the hoxb2, krox20 and valentino) and cause anterior truncations, previously reported pbx4 gene (Vlachakis et al., 2000), apparently due to the transformation of rostral (forebrain and suggesting a role for pbx genes also in vertebrate development. midbrain) fates to caudal (hindbrain) fates. This transformation Vertebrate meis genes also likely play a role, as misexpression is extensive enough that we observe excess Mauthner neurons of Xenopus Meis3 leads to abnormalities of the AP axis (normally found in r4) anteriorly. These effects are dependent (Salzberg et al., 1999). on Meis3 and Hoxb1b having intact Pbx interaction domains, Pbx and Meis form dimeric and trimeric complexes with suggesting that they interact with Pbx4 in vivo. Our results also Hox proteins in vitro and these complexes are thought to indicate that Meis3 must interact with Pbx4 to access the modulate Hox activity, primarily by conferring high-specificity nucleus. Since meis3, pbx4 and hoxb1b are co-expressed in the 1300 N. Vlachakis, S.-K. Choe and C. G. Sagerström zebrafish hindbrain primordium during embryogenesis, our HAHoxb1b constructs) or 3 embryos (for MYCMeis3 constructs) results are consistent with complexes containing combinations were run per lane. of Pbx4, Hoxb1b and Meis3 regulating normal hindbrain development. In situ hybridization, immunostaining and immunoprecipitations In situ hybridizations and immunoprecipitations have been described previously (Vlachakis et al., 2000). Immunostaining with 3A10, anti- MATERIALS AND METHODS c-myc (clone 9E10) and anti-HA (clone 12CA5) was done as described by Hatta (Hatta, 1992). HRP was detected using the TSA- Cloning direct kit (Dupont Biotechnology Systems). Photographs were taken All genes used were derived from zebrafish, all expression constructs with a Leica confocal or an Olympus inverted microscope. Rabbit were in the pCS2+ vector and all constructs were verified by polyclonal anti-Pbx4 antiserum was raised to a peptide containing the sequencing. Meis3, Pbx4, HA-Hoxb1b and MutMeis3 (carries two 13 C-terminal residues of Pbx4 and used at 1:1000 for western blots. point mutations in the homeodomain, Q44→E and N51→A) have been described (Vlachakis et al., 2000, Sagerström et al, 2001). In Fate mapping δhoxb1b, the N-terminal 146 amino acids (aa) were deleted by Embryos were injected with hoxb1b+pbx4+meis3 mRNAs at the 1- digesting pCS2+HAHoxb1b with SmaI/PstI and inserting to 2-cell stage. At early gastrula stage (6.5 hpf; hours postfertilization) oligonucleotide 5′-TTCCCGGGGTAGGCTGCA-3′. In BMNMeis3 animal pole cells of control and injected embryos were labeled with the N-terminal 171 aa were replaced with the FRB (FKBP 12- 1,1′-diooctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate rapamycin binding) domain from FRAP (FKBP 12-rapamycin (DiI) and fate mapping performed as described (Fekany-Lee et al., associated protein) (Chen et al., 1995). Primers 5′- 2000) except embryos were fixed at 4- to 5-somite stages. TATATCTAGACTGCTTTGAGATTCGTCGGA-3′ and 5′-GGATG- AATTCATGGACTATAAAGATGACGA-3′ amplified the FLAG- FRB domain which was subcloned via EcoRI and XbaI sites in RESULTS the primers into pCS2+ (pCS2+FLAG-FRB). Primers 5′-GGTCT- AGACGAGAGGGTGGATCTAAATCTGAC-3′ and 5′-GGTCT- Hoxb1b requires an intact Pbx-interaction domain to AGATCAGTGGGCATGTATGTCAAG-3′ amplified aa 172-415 of induce hoxb1a expression in rhombomere 2 the Meis3 ORF from pCS2+meis3. This was subcloned via XbaI Misexpression of Hoxa1 in the mouse leads to ectopic Hoxb1 sites in the primers into pCS2+FLAG-FRB downstream of FRB. MYCFRBMeis3 was generated by subcloning an XhoI/NotI fragment expression in r2 of the hindbrain (Zhang et al., 1994). To test from pCS2+FLAG-FRBMeis3 into pCS2+MT cut with XhoI/NotI. if this is the case also for zebrafish, we expressed Hoxb1b (the For Meis3-VP16 primers 5′-AAAGATATCCCCACCGTAC- zebrafish counterpart to murine Hoxa1; Alexandre et al., 1996; TCGTCAATTCC-3′ and 5′-AAAGATATCTCGACGGCCCCCCC- Amores et al., 1998) ectopically by mRNA microinjection (see GACCGATGTCAGC-3′ amplified the VP16 domain from Materials and Methods). Control injections with lacZ mRNA pCS2+vp16N (Kessler, 1997). This was subcloned via EcoRV sites resulted in normal embryos (Fig. 1Aa,b; Table 1) while in the primers into the SmaI site (1092 bp in Meis3 ORF) of expression of Hoxb1b (Fig. 1Ac,d) resulted in ectopic pCS2+meis3. All point mutations were generated with the expression of hoxb1a (the zebrafish counterpart to murine QuikChange kit from Stratagene: BMHoxb1b (has a substitution in → ′ Hoxb1, normally expressed in r4; Amores et al., 1998; Prince the pentapeptide FDWMK, W186 F) was generated using primer 5 - et al., 1998) in r2 (52%; arrow in Fig. 1Ac), and largely normal GGGGGATTCCTCTTGACTTTCATAAAGTCAAAGGTTGGCGC- 3′, BMM2Meis3 (has two substitutions in the M2 motif, L141→A and expression of hoxb2 (Fig. 1Ad; normally expressed in r3-r5; E142→A) using primer 5′-CGGTTTCATCTATTAGAAGCAGC- Prince et al., 1998). This is consistent with a report AAAGGTTCATGACCTCTGTGATAATTTCTGCC-3′, BMwM2Meis3 demonstrating an ectopic pair of Mauthner neurons (normally (has five substitutions in the M2 motif, I131→A, L134→A, L138→A, found in r4) in r2 following hoxb1b misexpression in zebrafish L141→A and E142→A) using primer 5′-CTGATGATCCAGGCC- (Alexandre et al., 1996). GCTCAAGTTGCACGGTTTCATGCATTAGAAGCAGC−3′ with Adjacent Pbx and Hox binding sites are present in the BMM2Meis3 as a template and BMM1/2Meis3 (has four substitutions murine Hoxb1 enhancer and both sites are required for in the M1 motif, aa 64-67 KCEL→NNSQ and two substitutions expression in a transgenic model (Pöpperl et al., 1995), → → ′ in the M2 motif, L141 A and E142 A) using primer 5 - suggesting that Pbx and Hox proteins might