DOCSLIB.ORG

Number 11 November 2013

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Number 11 November 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Volume 17 - Number 11 November 2013 The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Scope The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles (“cards”) on genes, leukaemias, solid tumours, cancer-prone diseases, and also more traditional review articles (“deep insights”) on the above subjects and on surrounding topics. It also present case reports in hematology and educational items in the various related topics for students in Medicine and in Sciences. Editorial correspondance Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected] Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Carol Moreau, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France). The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008. The Atlas is hosted by INIST-CNRS (http://www.inist.fr) http://AtlasGeneticsOncology.org © ATLAS - ISSN 1768-3262 The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Jean-Loup Huret (Poitiers, France) Editorial Board Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections Atlas Genet Cytogenet Oncol Haematol. 2013; 17(11) Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Volume 17, Number 11, November 2013 Table of contents Gene Section ITGA6 (integrin, alpha 6) 731 Young Hwa Soung, Jun Chung MITF (microphthalmia-associated transcription factor) 735 Nicole D Riddle, Paul Zhang PHOX2B (paired-like homeobox 2b) 740 Tiziana Bachetti, Isabella Ceccherini SGOL1 (shugoshin-like 1 (S. pombe)) 746 Tomoaki Kahyo, Haruhiko Sugimura CXCL5 (chemokine (C-X-C motif) ligand 5) 749 Anna A Bulysheva, W Andrew Yeudall MIR211 (microRNA 211) 753 Amir Avan, Mina Maftouh, Godefridus J Peters, Elisa Giovannetti SRD5A2 (steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)) 757 Nelson LS Tang, Chen Di Liao SSX2 (synovial sarcoma, X breakpoint 2) 759 Josiane Eid, Christina Garcia, Andrea Frump Leukaemia Section t(6;9)(p23;q34) DEK/NUP214 766 Jean-Loup Huret t(6;7)(p25.3;q32.3) DUSP22/FRA7H 770 Sarah H Johnson, George Vasmatzis, Andrew L Feldman Solid Tumour Section Fallopian tube tumors: an overview 773 Roland Gregor Stein, Joachim Diessner, Arnd Hönig, Jörg Wischhusen, Johannes Dietl Cancer Prone Disease Section Familial Juvenile Polyposis Syndrome 788 Scott K Sherman, James R Howe Atlas Genet Cytogenet Oncol Haematol. 2013; 17(11) Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Deep Insight Section Premature Chromosome Condensation (PCC): Tools in chromosome and cytogenetic research 791 Eisuke Gotoh Case Report Section Homogeneously Staining Region (HSR) harboring CMYC amplification in a patient with primary plasma cell leukemia 799 Nusrat F Pathan, Margarita Palutke, Anwar N Mohamed Atlas Genet Cytogenet Oncol Haematol. 2013; 17(11) Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Atlas Genet Cytogenet Oncol Haematol. 2013; 17(11) Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Gene Section Review ITGA6 (integrin, alpha 6) Young Hwa Soung, Jun Chung Louisiana State University Health Sciences Center - Shreveport, Dept of Biochemistry and Molecular Biology, 1501 Kings Highway PO Box 33932, Shreveport, LA 71130-3932, USA (YHS, JC) Published in Atlas Database: April 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/ITGA6ID41007ch2q31.html DOI: 10.4267/2042/51810 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology Identity Transcription The ITGA6 gene has 2 transcript variants encoding two Other names: CD49f, ITGA6B, VLA-6 different isoforms. HGNC (Hugo): ITGA6 Transcript variant 1 (NCBI Accession Location: 2q31.1 NM_001079818) encodes the longer isoform a (NP_001073286) comprised of 25 exons. DNA/RNA Transcript variant 2 (NCBI Accession NM_000210.2) encodes the shorter isoform b (NP_000201) comprised Description of 26 exons which has a distinct C-terminus with an ITGA6 (Gene ID: 3655) is located on chromosome 2 at alterative coding exon compared to isoform a. 2q31.1. Pseudogene Gene ranges from 173292314 to 173371181 on the plus There are no known pseudogenes. strand with a total length of 78870 bp. Figure 1. Schematic diagram of ITGA6 location on chromosome 2. Chromosome 2 is represented with banding pattern. ITGA6 is located at 31.1 and ranges from 173292314 to 173371181 on reverse strand. The region surrounding ITGA6 is enlarged. Genes are represented by arrows in the direction of transcription. Atlas Genet Cytogenet Oncol Haematol. 2013; 17(11) 731 ITGA6 (integrin, alpha 6) Soung YH, Chung J Protein Homology Mouse, rat and human homologs of ITGA6 share Note greater than 90% amino acid identity. The integrin alpha6 gene encodes for a protein of 10733 amino acid residues (NP_000201),
Load more

Recommended publications
  • Expression of HOXB2, a Retinoic Acid Signalingtarget in Pancreatic Cancer and Pancreatic Intraepithelial Neoplasia Davendra Segara,1Andrew V
    Cancer Prevention Expression of HOXB2, a Retinoic Acid SignalingTarget in Pancreatic Cancer and Pancreatic Intraepithelial Neoplasia Davendra Segara,1Andrew V. Biankin,1, 2 James G. Kench,1, 3 Catherine C. Langusch,1Amanda C. Dawson,1 David A. Skalicky,1David C. Gotley,4 Maxwell J. Coleman,2 Robert L. Sutherland,1and Susan M. Henshall1 Abstract Purpose: Despite significant progress in understanding the molecular pathology of pancreatic cancer and its precursor lesion: pancreatic intraepithelial neoplasia (PanIN), there remain no molecules with proven clinical utility as prognostic or therapeutic markers. Here, we used oligo- nucleotide microarrays to interrogate mRNA expression of pancreatic cancer tissue and normal pancreas to identify novel molecular pathways dysregulated in the development and progression of pancreatic cancer. Experimental Design: RNA was hybridized toAffymetrix Genechip HG-U133 oligonucleotide microarrays. A relational database integrating data from publicly available resources was created toidentify candidate genes potentially relevant topancreatic cancer. The protein expression of one candidate, homeobox B2 (HOXB2), in PanIN and pancreatic cancer was assessed using immunohistochemistry. Results: We identified aberrant expression of several components of the retinoic acid (RA) signaling pathway (RARa,MUC4,Id-1,MMP9,uPAR,HB-EGF,HOXB6,andHOXB2),manyof which are known to be aberrantly expressed in pancreatic cancer and PanIN. HOXB2, a down- stream target of RA, was up-regulated 6.7-fold in pancreatic cancer compared with normal pan- creas. Immunohistochemistry revealed ectopic expression of HOXB2 in15% of early PanINlesions and 48 of 128 (38%) pancreatic cancer specimens. Expression of HOXB2 was associated with nonresectable tumors and was an independent predictor of poor survival in resected tumors.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • Roles of Cofactors and Chromatin Accessibility in Hox Protein Target
    Beh et al. Epigenetics & Chromatin (2016) 9:1 DOI 10.1186/s13072-015-0049-x Epigenetics & Chromatin RESEARCH Open Access Roles of cofactors and chromatin accessibility in Hox protein target specificity Ching Yew Beh1†, Sherif El‑Sharnouby2†, Aikaterini Chatzipli2,3, Steven Russell3,4, Siew Woh Choo1* and Robert White2* Abstract Background: The regulation of specific target genes by transcription factors is central to our understanding of gene network control in developmental and physiological processes yet how target specificity is achieved is still poorly understood. This is well illustrated by the Hox family of transcription factors as their limited in vitro DNA-binding specificity contrasts with their clear in vivo functional specificity. Results: We generated genome-wide binding profiles for three Hox proteins, Ubx, Abd-A and Abd-B, following transient expression in Drosophila Kc167 cells, revealing clear target specificity and a striking influence of chromatin accessibility. In the absence of the TALE class homeodomain cofactors Exd and Hth, Ubx and Abd-A bind at a very similar set of target sites in accessible chromatin, whereas Abd-B binds at an additional specific set of targets. Provi‑ sion of Hox cofactors Exd and Hth considerably modifies the Ubx genome-wide binding profile enabling Ubx to bind at an additional novel set of targets. Both the Abd-B specific targets and the cofactor-dependent Ubx targets are in chromatin that is relatively DNase1 inaccessible prior to the expression of Hox proteins/Hox cofactors. Conclusions: Our experiments demonstrate a strong role for chromatin accessibility in Hox protein binding and sug‑ gest that Hox protein competition with nucleosomes has a major role in Hox protein target specificity in vivo.
    [Show full text]
  • DNMT3A Arg882 Mutation Drives Chronic Myelomonocytic Leukemia Through Disturbing Gene Expression/DNA Methylation in Hematopoietic Cells
    DNMT3A Arg882 mutation drives chronic myelomonocytic leukemia through disturbing gene expression/DNA methylation in hematopoietic cells Jie Xua,1, Yue-Ying Wanga,1,2, Yu-Jun Daia,1, Wu Zhanga, Wei-Na Zhanga, Shu-Min Xionga, Zhao-Hui Gub, Kan-Kan Wanga, Rong Zengc, Zhu Chena,b,2, and Sai-Juan Chena,b,2 aState Key Laboratory of Medical Genomics, Shanghai Institute of Hematology, Rui Jin Hospital affiliated with Shanghai Jiao Tong University School of Medicine, Shanghai 200025, China; bKey Laboratory of Ministry of Education of Systems Biomedicine, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai 200240, China; and cKey Laboratory of Systems Biology, Shanghai Institutes for Biological Science, Chinese Academy of Sciences, Shanghai 200031, China Contributed by Zhu Chen, January 16, 2014 (sent for review December 2, 2013) The gene encoding DNA methyltransferase 3A (DNMT3A) is mu- the transforming potentials of hematopoietic stem/progenitor tated in ∼20% of acute myeloid leukemia cases, with Arg882 (R882) cells (HSPCs). We also examined the possible mechanisms of as the hotspot. Here, we addressed the transformation ability of the these abnormal potentials at transcriptome, epigenetics, and DNMT3A-Arg882His (R882H) mutant by using a retroviral transduc- protein–protein interaction levels in transformed HSPCs with tion and bone marrow transplantation (BMT) approach and found the DNMT3A-R882H mutation. that the mutant gene can induce aberrant proliferation of hemato- Results poietic stem/progenitor cells. At 12 mo post-BMT, all mice developed chronic myelomonocytic leukemia with thrombocytosis. RNA DNMT3A-R882H Mutation Enhances Proliferation Potential of Hema- microarray analysis revealed abnormal expressions of some he- topoietic Cells.
    [Show full text]
  • Systems Biology Approaches to Mining High Throughput Biological Data
    BioMed Research International Systems Biology Approaches to Mining High Throughput Biological Data Guest Editors: Fang-Xiang Wu, Min Li, Jishou Ruan, and Feng Luo Systems Biology Approaches to Mining High Throughput Biological Data BioMed Research International Systems Biology Approaches to Mining High Throughput Biological Data Guest Editors: Fang-Xiang Wu, Min Li, Jishou Ruan, and Feng Luo Copyright © 2015 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Systems Biology Approaches to Mining High Throughput Biological Data, Fang-Xiang Wu, Min Li, Jishou Ruan, and Feng Luo Volume 2015, Article ID 504362, 2 pages ProSim: A Method for Prioritizing Disease Genes Based on Protein Proximity and Disease Similarity, Gamage Upeksha Ganegoda, Yu Sheng, and Jianxin Wang Volume 2015, Article ID 213750, 11 pages Differential Expression Analysis in RNA-Seq by a Naive Bayes Classifier with Local Normalization, YongchaoDou,XiaomeiGuo,LinglingYuan,DavidR.Holding,andChiZhang Volume 2015, Article ID 789516, 9 pages ?? -Profiles: A Nonlinear Clustering Method for Pattern Detection in High Dimensional, Data Kai Wang, Qing Zhao, Jianwei Lu, and Tianwei Yu Volume 2015, Article ID 918954, 10 pages Screening Ingredients from Herbs against Pregnane X Receptor in
    [Show full text]
  • Coordinated Waves of Gene Expression During Neuronal Differentiation of Embryonic Stem Cells As Basis for Novel Approaches to Developmental Neurotoxicity Testing
    Cell Death and Differentiation (2011) 18, 383–395 & 2011 Macmillan Publishers Limited All rights reserved 1350-9047/11 www.nature.com/cdd Coordinated waves of gene expression during neuronal differentiation of embryonic stem cells as basis for novel approaches to developmental neurotoxicity testing B Zimmer1, PB Kuegler1, B Baudis1, A Genewsky1, V Tanavde2, W Koh2, B Tan2, T Waldmann1, S Kadereit1 and M Leist*,1 As neuronal differentiation of embryonic stem cells (ESCs) recapitulates embryonic neurogenesis, disturbances of this process may model developmental neurotoxicity (DNT). To identify the relevant steps of in vitro neurodevelopment, we implemented a differentiation protocol yielding neurons with desired electrophysiological properties. Results from focussed transcriptional profiling suggested that detection of non-cytotoxic developmental disturbances triggered by toxicants such as retinoic acid (RA) or cyclopamine was possible. Therefore, a broad transcriptional profile of the 20-day differentiation process was obtained. Cluster analysis of expression kinetics, and bioinformatic identification of overrepresented gene ontologies revealed waves of regulation relevant for DNT testing. We further explored the concept of superimposed waves as descriptor of ordered, but overlapping biological processes. The initial wave of transcripts indicated reorganization of chromatin and epigenetic changes. Then, a transient upregulation of genes involved in the formation and patterning of neuronal precursors followed. Simultaneously, a long wave of ongoing neuronal differentiation started. This was again superseded towards the end of the process by shorter waves of neuronal maturation that yielded information on specification, extracellular matrix formation, disease-associated genes and the generation of glia. Short exposure to lead during the final differentiation phase, disturbed neuronal maturation.
    [Show full text]