DOCSLIB.ORG

Multigene Phylogeny of Cyprinodontiform Fishes Suggests Continental Radiations and a Rogue Taxon Position of Pantanodon

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Multigene Phylogeny of Cyprinodontiform Fishes Suggests Continental Radiations and a Rogue Taxon Position of Pantanodon 65 (1): 37 – 44 © Senckenberg Gesellschaft für Naturforschung, 2015. 4.5.2015 Multigene phylogeny of cyprinodontiform fishes suggests continental radiations and a rogue taxon position of Pantanodon Moritz Pohl 1, Finn C. Milvertz 2, Axel Meyer 3 & Miguel Vences 1, * 1 Zoological Institute, Technische Universität Braunschweig, Mendelssohnstr. 4, 38106 Braunschweig, Germany. —2 Litorinaparken 27, 2680 Solrød Strand, Denmark — 3 Lehrstuhl für Zoologie und Evolutionsbiologie, Department of Biology, University of Konstanz, 78457 Kon- stanz, Germany — * Corresponding author; m.vences(at)tu-bs.de Accepted 19.ii.2015. Published online at www.senckenberg.de / vertebrate-zoology on 4.v.2015. Abstract We studied phylogenetic relationships among major clades in the tooth carps (Cyprinodontiformes) based on a concatenated DNA se- quence alignment of two mitochondrial and three nuclear gene segments, totalling 2553 bp, in 66 ingroup terminals. The inferred tree sup- ports monophyly of the major tooth carp subgroups, aplocheiloids and cyprinodontoids, and of several aplocheiloid subclades correspond- ing to the well-established families (Aplocheilidae, Nothobranchiidae, Rivulidae), each of which is restricted to major continental settings (India-Madagascar, Africa, South America). Contrary to previous molecular studies, our tree supports a sister-group relationship of the aplocheilids and nothobranchiids, rather than a nothobranchiid-rivulid clade. Within cyprinodontoids, the phylogeny matched more closely continent-scale distribution than current classification, suggesting that the delimitation of the families Cyprinodontidae, Poeciliidae, and Valenciidae is in need of revision. The East African Pantanodon stuhlmanni did not show close relationships with any other taxon in our analysis, suggesting that the phylogenetic position and classification of this rogue taxon is in need of further study. Key words Tooth carps; Cyprinodontiformes; Pantanodon; phylogeny; phylogeography; Madagascar. Introduction Tooth carps, order Cyprinodontiformes, comprise kil- model species in evolutionary, developmental, toxico- lifishes, live bearers, as well as several allied forms. logical, and ageing research such as the guppy, sword- According to current classifications (COSTA, 2012; HUBER, tail, mummichog, and turquoise killifish (e.g., ATZ, 2006; FROESE & PAULY, 2014) this group contains over 1986; REZNICK et al., 2008; JONES et al., 2013; SchARTL, 1100 species in ca. 125 genera and ten families, allocated 2014). Numerous molecular studies have addressed the to two suborders, Aplocheiloidei and Cyprinodontoidei phylo geny of particular subclades of cyprinodontiforms (PARENTI, 1981). Cyprinodontiforms occur mainly in (e.g., MURphY & COLLIER, 1997; MURphY et al., 1998, tropical regions of Africa, South America, Madagascar 1999; HRBEK & MEYER, 2003; DOADRIO & DOMINGUEZ, and South Asia, as well as some temperate waters in 2004; WEBB et al., 2004; HRBEK et al., 2005, 2007; North America and Eurasia, and are part of the acanto- AGNÈSE et al., 2006; COLLIER et al., 2009; JONES et al., morph radiation (NEAR et al., 2013). They comprise many 2013; Sedláček et al., 2014). However, the interre- prominent aquarium fishes and established or emerging lationships among deep cyprinodontiform clades are ISSN 1864-5755 37 Pohl, M. et al.: Multigene phylogeny of cyprinodontiform fishes and taxon position of Pantanodon largely unassessed from a molecular perspective, and Materials and Methods the current higher-level classification of tooth carps is predominantly based on a limited number of emi- nent in-depth morphological studies (PARENTI, 1981; If not indicated as wild caught by precise collecting lo- COSTA, 1998, 2011; HERTWIG, 2008). As an exception, cations (Table 1), samples were from aquarium strains. SETIAMARGA et al. (2008), based on complete mitochon- Voucher specimens of the majority of specimens were drial genome sequences, placed cyprinodontiforms in preserved, labeled with provisional numbers (ZCMV – the Atherinomorpha clade, along with medakas, flying Miguel Vences Zoological Collection) and will be de- fishes, and silversides, and found evidence for mono- posited in the Zoologische Staatssammlung München, phyly of cyprinodontiforms and of the two suborders, Germany. Tissue samples were preserved in pure ethanol. aplocheiloids and cyprinodontoids. DNA was sampled from fin clips of the preserved vouch- Understanding cyprinodontiform phylogeny has the ers, or from eggs. Total genomic DNA was extracted from potential to inform studies on the evolution of annual- tissue or swab samples using Proteinase K (10mg/ml) ism and live bearing, and on the biogeographic origins di gestion followed by a standard salt-extraction protocol of these fishes. Traditionally the origins of tooth carps, (BRU FORD et al., 1992). especially those in the Aplocheiloidei, are interpreted as Two markers of the mitochondrial and three markers being a consequence of ancient vicariance (e.g., MURphY of the nuclear genome were targeted: Segments of the & COLLIER, 1997; SPARKS & SMITH, 2005; SAMONDS et al., mito chondrial genes cytochrome oxidase sub­­unit I 2012; COSTA, 2013), in particular because their clado- (COX1) and 16S rRNA were amplified, respectively, genesis largely reflects the breakup of the Gondwana with the primers COI-Chmf4 (TYTCWACWAAYCAYA supercontinent in deep Mesozoic times, with the Indian AAGAYATCGG) and COI-Chmr4 (ACYTCRGGRTG Aplocheilus considered being sister to the Malagasy- RCCRAARAATCA) of CHE et al. (2012), and 16SAr-L Seychellean Pachypanchax, and the South Amercan Ri- (CGCCTGTTTATCAAAAACAT) and 16SBr-H vu lidae sister to the African Nothobranchiidae (MURphY (CCGGTCTGAACTCAGATCACGT) of PALUMBI et al. & COLLIER, 1997; SPARKS & SMITH, 2005). The vicari- (1991). Segments of the nuclear genes for recombination ance hypothesis for aplocheiloid origins however re- activating protein 1 (RAG1), brain super conserved re- quires confirmation as it conflicts with clade ages re- ceptor (SREB2) and glycosyltransferase (GLYT), were covered in several studies (e.g., CROTTINI et al., 2012; am plified, respectively, with primers L2891_RAG1ex3 NEAR et al., 2012, 2013; BROUGHTON et al., 2013) that (AAGGAGTGYTGYGATGGCATGGG) and H3405_ place the origin of the entire cyprinodontiform clade into RAG1ex3 (GCNGAGACTCCTTTGACTCTGTC) of the latest Mesozoic or early Cenozoic, similar to that of NEAR et al. (2012), and newly developed primers Rag1- cichlids (VENCES et al., 2001; FRIEdmAN et al., 2013). Pachyp-F1 (TGAAAArGCTGTTCGCTTCT), SREB2- Particularly relevant for this aspect of cyprinodontiform Pachyp-F1 (CAyrCTrACCTGCAAAGTGA), SREB2- biogeography are the endemic tooth carps occurring on Pachyp-R1 (CCCATARTGCCARGAAGAAA), GLYT- Madagascar, the fourth largest island of the world. This Pachyp-F2 (CTGAATGAAsCCGAGCTrrTmATGG), island has been separated from all other landmasses GLYT-Pachyp-R1 (CATGGGATCTGCCAAGAGAC). since the Mesozoic and is characterized by a unique and Polymerase chain reactions were performed in a final highly endemic biota, yet many of its radiations appear volume of 10 μl using 0.3 μM of each primer, 0.25 mM to have originated after its isolation (YODER & NOWAK, of dNTPs, 0.4 U GoTaq and 1.25 × Reaction Buffer (Pro- 2006; SAMONDS et al., 2012). Madagascar is inhabited mega). by two native genera of cyprinodontiforms: the genus PCR products were purified using Exonuclease I and Pachypanchax with currently six Malagasy and one Shrimp Alkaline Phosphatase (SAP) or Antarctic Phos- Seychellean species; and the genus Pantanodon, with phatase (AP) according to the manufacturer’s instruc- one described and one undescribed species known from tions (NEB). Purified PCR templates were directly se- Madagascar, and one species occurring in Eastern Africa quenced using dye-labeled dideoxy terminator chemistry (SPARKS, 2003; LOISELLE, 2006). So far, no molecular data on an ABI 3130 automated DNA sequencer (Applied are available for Pantanodon, and only one Malagasy Biosystems). We checked chromatograms and corrected species of Pachypanchax has been included in molecular errors manually in CodonCode Aligner 3.5.6 (CodonCode phylogenies (MURphY & COLLIER, 1997; CROTTINI et al., Corporation). Newly obtained sequences were submitted 2012). to GenBank (accession numbers: KJ844613-KJ844868). As a first step to improve the understanding of high- Sequences of outgroup taxa were taken from Genbank, er-level cyprinodontiform relationships, we newly deter- and largely correspond to those determined by NEAR et mined a data set of two mitochondrial and three nuclear al. (2012). We used a representative of the Gobiiformes genes for a set of 66 cyprinodontiform terminals. Our (Perccottus) as outgroup and included a series of ather- data set spans seven of the ten currently accepted families iniform, beloniform and perciform species as hierarchical and includes the enigmatic Pantanodon. By highlighting outgroups. various unsolved questions and taxa that merit furter We used MEGA 5 (TAMURA et al., 2011) to align pro- phylogenetic study, we anticipate our study inform and tein-coding sequences (COX1, RAG1, GLYT, SREB2) facilitate future systematic revisions of tooth carps. manually and the non-coding 16S using the MUSCLE 38 VERTEBRATE ZOOLOGY — 65 (1) 2015 algorithm. The 16S alignment was subsequently pro- the most divergent within Madagascar, so that monophyly cessed with Gblocks 0.91b software (CASTRESANA, 2000) of the entire Malagasy clade vs. the single Seychellean with a less stringent 50% threshold
Load more

Recommended publications
  • Article Evolutionary Dynamics of the OR Gene Repertoire in Teleost Fishes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.09.434524; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Article Evolutionary dynamics of the OR gene repertoire in teleost fishes: evidence of an association with changes in olfactory epithelium shape Maxime Policarpo1, Katherine E Bemis2, James C Tyler3, Cushla J Metcalfe4, Patrick Laurenti5, Jean-Christophe Sandoz1, Sylvie Rétaux6 and Didier Casane*,1,7 1 Université Paris-Saclay, CNRS, IRD, UMR Évolution, Génomes, Comportement et Écologie, 91198, Gif-sur-Yvette, France. 2 NOAA National Systematics Laboratory, National Museum of Natural History, Smithsonian Institution, Washington, D.C. 20560, U.S.A. 3Department of Paleobiology, National Museum of Natural History, Smithsonian Institution, Washington, D.C., 20560, U.S.A. 4 Independent Researcher, PO Box 21, Nambour QLD 4560, Australia. 5 Université de Paris, Laboratoire Interdisciplinaire des Energies de Demain, Paris, France 6 Université Paris-Saclay, CNRS, Institut des Neurosciences Paris-Saclay, 91190, Gif-sur- Yvette, France. 7 Université de Paris, UFR Sciences du Vivant, F-75013 Paris, France. * Corresponding author: e-mail: [email protected]. !1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.09.434524; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Teleost fishes perceive their environment through a range of sensory modalities, among which olfaction often plays an important role.
    [Show full text]
  • §4-71-6.5 LIST of CONDITIONALLY APPROVED ANIMALS November
    §4-71-6.5 LIST OF CONDITIONALLY APPROVED ANIMALS November 28, 2006 SCIENTIFIC NAME COMMON NAME INVERTEBRATES PHYLUM Annelida CLASS Oligochaeta ORDER Plesiopora FAMILY Tubificidae Tubifex (all species in genus) worm, tubifex PHYLUM Arthropoda CLASS Crustacea ORDER Anostraca FAMILY Artemiidae Artemia (all species in genus) shrimp, brine ORDER Cladocera FAMILY Daphnidae Daphnia (all species in genus) flea, water ORDER Decapoda FAMILY Atelecyclidae Erimacrus isenbeckii crab, horsehair FAMILY Cancridae Cancer antennarius crab, California rock Cancer anthonyi crab, yellowstone Cancer borealis crab, Jonah Cancer magister crab, dungeness Cancer productus crab, rock (red) FAMILY Geryonidae Geryon affinis crab, golden FAMILY Lithodidae Paralithodes camtschatica crab, Alaskan king FAMILY Majidae Chionocetes bairdi crab, snow Chionocetes opilio crab, snow 1 CONDITIONAL ANIMAL LIST §4-71-6.5 SCIENTIFIC NAME COMMON NAME Chionocetes tanneri crab, snow FAMILY Nephropidae Homarus (all species in genus) lobster, true FAMILY Palaemonidae Macrobrachium lar shrimp, freshwater Macrobrachium rosenbergi prawn, giant long-legged FAMILY Palinuridae Jasus (all species in genus) crayfish, saltwater; lobster Panulirus argus lobster, Atlantic spiny Panulirus longipes femoristriga crayfish, saltwater Panulirus pencillatus lobster, spiny FAMILY Portunidae Callinectes sapidus crab, blue Scylla serrata crab, Samoan; serrate, swimming FAMILY Raninidae Ranina ranina crab, spanner; red frog, Hawaiian CLASS Insecta ORDER Coleoptera FAMILY Tenebrionidae Tenebrio molitor mealworm,
    [Show full text]
  • A New Genus of Miniature Cynolebiasine from the Atlantic
    64 (1): 23 – 33 © Senckenberg Gesellschaft für Naturforschung, 2014. 16.5.2014 A new genus of miniature cynolebiasine from the Atlantic Forest and alternative biogeographical explanations for seasonal killifish distribution patterns in South America (Cyprinodontiformes: Rivulidae) Wilson J. E. M. Costa Laboratório de Sistemática e Evolução de Peixes Teleósteos, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Caixa Postal 68049, CEP 21944 – 970, Rio de Janeiro, Brasil; wcosta(at)acd.ufrj.br Accepted 21.ii.2014. Published online at www.senckenberg.de/vertebrate-zoology on 30.iv.2014. Abstract The analysis of 78 morphological characters for 16 species representing all the lineages of the tribe Cynopoecilini and three out-groups, indicates that the incertae sedis miniature species ‘Leptolebias’ leitaoi Cruz & Peixoto is the sister group of a clade comprising the genera Leptolebias, Campellolebias, and Cynopoecilus, consequently recognised as the only member of a new genus. Mucurilebias gen. nov. is diagnosed by seven autapomorphies: eye occupying great part of head side, low number of caudal-fin rays (21), distal portion of epural much broader than distal portion of parhypural, an oblique red bar through opercle in both sexes, isthmus bright red in males, a white stripe on the distal margin of the dorsal fin in males, and a red stripe on the distal margin of the anal fin in males.Mucurilebias leitaoi is an endangered seasonal species endemic to the Mucuri river basin. The biogeographical analysis of genera of the subfamily Cynolebiasinae using a dispersal-vicariance, event-based parsimony approach indicates that distribution of South American killifishes may be broadly shaped by dispersal events.
    [Show full text]
  • The Evolution of the Placenta Drives a Shift in Sexual Selection in Livebearing Fish
    LETTER doi:10.1038/nature13451 The evolution of the placenta drives a shift in sexual selection in livebearing fish B. J. A. Pollux1,2, R. W. Meredith1,3, M. S. Springer1, T. Garland1 & D. N. Reznick1 The evolution of the placenta from a non-placental ancestor causes a species produce large, ‘costly’ (that is, fully provisioned) eggs5,6, gaining shift of maternal investment from pre- to post-fertilization, creating most reproductive benefits by carefully selecting suitable mates based a venue for parent–offspring conflicts during pregnancy1–4. Theory on phenotype or behaviour2. These females, however, run the risk of mat- predicts that the rise of these conflicts should drive a shift from a ing with genetically inferior (for example, closely related or dishonestly reliance on pre-copulatory female mate choice to polyandry in conjunc- signalling) males, because genetically incompatible males are generally tion with post-zygotic mechanisms of sexual selection2. This hypoth- not discernable at the phenotypic level10. Placental females may reduce esis has not yet been empirically tested. Here we apply comparative these risks by producing tiny, inexpensive eggs and creating large mixed- methods to test a key prediction of this hypothesis, which is that the paternity litters by mating with multiple males. They may then rely on evolution of placentation is associated with reduced pre-copulatory the expression of the paternal genomes to induce differential patterns of female mate choice. We exploit a unique quality of the livebearing fish post-zygotic maternal investment among the embryos and, in extreme family Poeciliidae: placentas have repeatedly evolved or been lost, cases, divert resources from genetically defective (incompatible) to viable creating diversity among closely related lineages in the presence or embryos1–4,6,11.
    [Show full text]
  • Deterministic Shifts in Molecular Evolution Correlate with Convergence to Annualism in Killifishes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.09.455723; this version posted August 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Deterministic shifts in molecular evolution correlate with convergence to annualism in killifishes Andrew W. Thompson1,2, Amanda C. Black3, Yu Huang4,5,6 Qiong Shi4,5 Andrew I. Furness7, Ingo, Braasch1,2, Federico G. Hoffmann3, and Guillermo Ortí6 1Department of Integrative Biology, Michigan State University, East Lansing, Michigan 48823, USA. 2Ecology, Evolution & Behavior Program, Michigan State University, East Lansing, MI, USA. 3Department of Biochemistry, Molecular Biology, Entomology, & Plant Pathology, Mississippi State University, Starkville, MS 39759, USA. 4Shenzhen Key Lab of Marine Genomics, Guangdong Provincial Key Lab of Molecular Breeding in Marine Economic Animals, BGI Marine, Shenzhen 518083, China. 5BGI Education Center, University of Chinese Academy of Sciences, Shenzhen 518083, China. 6Department of Biological Sciences, The George Washington University, Washington, DC 20052, USA. 7Department of Biological and Marine Sciences, University of Hull, UK. Corresponding author: Andrew W. Thompson, [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.08.09.455723; this version posted August 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: The repeated evolution of novel life histories correlating with ecological variables offer opportunities to test scenarios of convergence and determinism in genetic, developmental, and metabolic features. Here we leverage the diversity of aplocheiloid killifishes, a clade of teleost fishes that contains over 750 species on three continents.
    [Show full text]
  • Ecosystem Profile Madagascar and Indian
    ECOSYSTEM PROFILE MADAGASCAR AND INDIAN OCEAN ISLANDS FINAL VERSION DECEMBER 2014 This version of the Ecosystem Profile, based on the draft approved by the Donor Council of CEPF was finalized in December 2014 to include clearer maps and correct minor errors in Chapter 12 and Annexes Page i Prepared by: Conservation International - Madagascar Under the supervision of: Pierre Carret (CEPF) With technical support from: Moore Center for Science and Oceans - Conservation International Missouri Botanical Garden And support from the Regional Advisory Committee Léon Rajaobelina, Conservation International - Madagascar Richard Hughes, WWF – Western Indian Ocean Edmond Roger, Université d‘Antananarivo, Département de Biologie et Ecologie Végétales Christopher Holmes, WCS – Wildlife Conservation Society Steve Goodman, Vahatra Will Turner, Moore Center for Science and Oceans, Conservation International Ali Mohamed Soilihi, Point focal du FEM, Comores Xavier Luc Duval, Point focal du FEM, Maurice Maurice Loustau-Lalanne, Point focal du FEM, Seychelles Edmée Ralalaharisoa, Point focal du FEM, Madagascar Vikash Tatayah, Mauritian Wildlife Foundation Nirmal Jivan Shah, Nature Seychelles Andry Ralamboson Andriamanga, Alliance Voahary Gasy Idaroussi Hamadi, CNDD- Comores Luc Gigord - Conservatoire botanique du Mascarin, Réunion Claude-Anne Gauthier, Muséum National d‘Histoire Naturelle, Paris Jean-Paul Gaudechoux, Commission de l‘Océan Indien Drafted by the Ecosystem Profiling Team: Pierre Carret (CEPF) Harison Rabarison, Nirhy Rabibisoa, Setra Andriamanaitra,
    [Show full text]
  • A Replacement Name for the Preoccupied Genus Name Adamas Huber, 1979 (Actinopterygii: Cyprinodontiformes)
    _____________Mun. Ent. Zool. Vol. 1, No. 1, January 2006___________ 167 A REPLACEMENT NAME FOR THE PREOCCUPIED GENUS NAME ADAMAS HUBER, 1979 (ACTINOPTERYGII: CYPRINODONTIFORMES) Hüseyin Özdikmen*, Nazmi Polat**, Mahmut Yılmaz*** and Okan Yazıcıoğlu*** * Gazi Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, 06500 Ankara / TÜRKİYE, e-mail: [email protected] ** Gazi Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, 06500 Ankara / TÜRKİYE, e-mail: [email protected] *** Gazi Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, 06500 Ankara / TÜRKİYE, e-mails: [email protected]; [Özdikmen, H., Polat, N., Yılmaz, M. & Yazıcıoğlu, O. 2006. A replacement name for the preoccupied genus name Adamas Huber, 1979 (Actinopterygii: Cyprinodontiformes). Munis Entomology & Zoology, 1 (1): 167-168] ABSTRACT: A replacement name, Fenerbahce is proposed for the genus name Adamas Huber, 1979 in the fish family Aplocheilidae (Cyprinodontiformes). KEY WORDS: Fenerbahce, Adamas, homonymy, replacement name, Actinopterygii, Cyprinodontiformes, Aplocheilidae. Class Actinopterygii Order Cyprinodontiformes Family Aplocheilidae Genus Fenerbahce nom. nov. Adamas Huber, 1979. Journal Am. Killifish Ass. 12 (6): 166 and Revue fr. Aquariol. Herpetol. 6 (1): 6. (Actinopterygii: Cyprinodontiformes: Aplocheiloidei: Aplocheilidae: Aplocheilinae). Preoccupied by Adamas Malaise, 1945. Opusc. ent., Lund, Suppl. 4, 97. (Hymenoptera: Symphyta: Tenthredinoidea: Tenthredinidae: Allantinae: Adamasini). The genus name Adamas was proposed by Malaise, 1945 as an objective replacement name of the genus Dinax Konow, 1897 with the type species Dinax jakowleffi Konow, 1897. For the present, the genus Adamas Malaise, 1945 includes six species (Wei, 2004). Subsequently, the genus Adamas was described by Huber, 1979 with the type species Adamas formosus Huber, 1979 by monotypy from in front of Ntokou village near the banks of Likouala-Mossaka River, Congo.
    [Show full text]
  • Monophyly and Taxonomy of the Neotropical Seasonal Killifish Genus Leptolebias (Teleostei: Aplocheiloidei: Rivulidae), with the Description of a New Genus
    Zoological Journal of the Linnean Society, 2008, 153, 147–160. With 11 figures Monophyly and taxonomy of the Neotropical seasonal killifish genus Leptolebias (Teleostei: Aplocheiloidei: Rivulidae), with the description of a new genus WILSON J. E. M. COSTA* Downloaded from https://academic.oup.com/zoolinnean/article/153/1/147/2606377 by guest on 23 November 2020 Laboratório de Ictiologia Geral e Aplicada, Departamento de Zoologia, Universidade Federal do Rio de Janeiro, Caixa Postal 68049, CEP 21944-970, Rio de Janeiro, Brazil Received 30 March 2007; accepted for publication 4 July 2007 A phylogenetic analysis based on morphological characters indicates that Leptolebias Myers, 1952, a genus of small killifishes highly threatened with extinction, from Brazil, is paraphyletic. As a consequence, Leptolebias is restricted in this study to a well-supported clade that includes Leptolebias marmoratus (Ladiges, 1934), Leptolebias splendens (Myers, 1942), Leptolebias opalescens (Myers, 1942), and Leptolebias citrinipinnis (Costa, Lacerda & Tanizaki, 1988), from the coastal plains of Rio de Janeiro, and Leptolebias aureoguttatus (Cruz, 1974) (herein redescribed, and for which a lectotype is designated) and Leptolebias itanhaensis sp. nov., from the coastal plains of São Paulo and Paraná, in southern Brazil. Leptolebias is diagnosed by three synapomorphies: a caudal fin that is longer than deep, a single anterior supraorbital neuromast, and dark pigmentation that does not extend to the distal portion of the dorsal fin in males. A key is provided for the identification of species of Leptolebias. Three species formerly placed in Leptolebias, Leptolebias minimus (Myers, 1942), Leptolebias fractifasciatus (Costa, 1988), and Leptolebias cruzi (Costa, 1988), are transferred to Notholebias gen.
    [Show full text]
  • The Neotropical Genus Austrolebias: an Emerging Model of Annual Killifishes Nibia Berois1, Maria J
    lopmen ve ta e l B D io & l l o l g e y C Cell & Developmental Biology Berois, et al., Cell Dev Biol 2014, 3:2 ISSN: 2168-9296 DOI: 10.4172/2168-9296.1000136 Review Article Open Access The Neotropical Genus Austrolebias: An Emerging Model of Annual Killifishes Nibia Berois1, Maria J. Arezo1 and Rafael O. de Sá2* 1Departamento de Biologia Celular y Molecular, Facultad de Ciencias, Universidad de la República, Montevideo, Uruguay 2Department of Biology, University of Richmond, Richmond, Virginia, USA *Corresponding author: Rafael O. de Sá, Department of Biology, University of Richmond, Richmond, Virginia, USA, Tel: 804-2898542; Fax: 804-289-8233; E-mail: [email protected] Rec date: Apr 17, 2014; Acc date: May 24, 2014; Pub date: May 27, 2014 Copyright: © 2014 Rafael O. de Sá, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Annual fishes are found in both Africa and South America occupying ephemeral ponds that dried seasonally. Neotropical annual fishes are members of the family Rivulidae that consist of both annual and non-annual fishes. Annual species are characterized by a prolonged embryonic development and a relatively short adult life. Males and females show striking sexual dimorphisms, complex courtship, and mating behaviors. The prolonged embryonic stage has several traits including embryos that are resistant to desiccation and undergo up to three reversible developmental arrests until hatching. These unique developmental adaptations are closely related to the annual fish life cycle and are the key to the survival of the species.
    [Show full text]
  • Draft Risk Assessment Report Nothobranchius Furzeri (Turquoise
    APPLICATION TO AMEND THE LIST OF SPECIMENS SUITABLE FOR LIVE IMPORT Draft Risk Assessment Report 1. Taxonomy of the species a. Family name: Aplocheilidae b. Genus name: Nothobranchius c. Species: N. furzeri d. Subspecies: No e. Taxonomic Reference: http://www.uniprot.org/taxonomy/105023 f. Common Names: Turquoise killifish g. Is the species a genetically-modified organism (GMO)? No 2. Status of the species under CITES Species is not listed in the CITES Appendices. 3. Ecology of the species a. Longevity: what is the average lifespan of the species in the wild and in captivity? The average lifespan of the species in captivity is 13 weeks (1). Wild derived N. furzeri from three different habitats showed a maximum lifespan of 25-32 weeks (1). b. What is the maximum length and weight that the species attains? Provide information on the size and weight range for males and females of the species. As per the original formal description of the species, the standard length of N. furzeri from a wild population ranged from 2.5cm to 4.4cm (2). The maximum length the species can attain is 7cm (3). The mean maximal body weight reported for males is 3.8 ± 1.1 g (range: 0.5 – 6.7 g) and 2.2 ± 0.6 g (range: 0.2 - 3.6 g) for females (4). Growth rates of Nothobranchius in the wild have been reported to be similar to those in captivity (5). c. Discuss the identification of the individuals in this species, including if the sexes of the species are readily distinguishable, and if the species is difficult to distinguish from other species.
    [Show full text]
  • Genome Composition Plasticity in Marine Organisms
    Genome Composition Plasticity in Marine Organisms A Thesis submitted to University of Naples “Federico II”, Naples, Italy for the degree of DOCTOR OF PHYLOSOPHY in “Applied Biology” XXVIII cycle by Andrea Tarallo March, 2016 1 University of Naples “Federico II”, Naples, Italy Research Doctorate in Applied Biology XXVIII cycle The research activities described in this Thesis were performed at the Department of Biology and Evolution of Marine Organisms, Stazione Zoologica Anton Dohrn, Naples, Italy and at the Fishery Research Laboratory, Kyushu University, Fukuoka, Japan from April 2013 to March 2016. Supervisor Dr. Giuseppe D’Onofrio Tutor Doctoral Coordinator Prof. Claudio Agnisola Prof. Ezio Ricca Candidate Andrea Tarallo Examination pannel Prof. Maria Moreno, Università del Sannio Prof. Roberto De Philippis, Università di Firenze Prof. Mariorosario Masullo, Università degli Studi Parthenope 2 LIST OF PUBLICATIONS 1. On the genome base composition of teleosts: the effect of environment and lifestyle A Tarallo, C Angelini, R Sanges, M Yagi, C Agnisola, G D’Onofrio BMC Genomics 17 (173) 2016 2. Length and GC Content Variability of Introns among Teleostean Genomes in the Light of the Metabolic Rate Hypothesis A Chaurasia, A Tarallo, L Bernà, M Yagi, C Agnisola, G D’Onofrio PloS one 9 (8), e103889 2014 3. The shifting and the transition mode of vertebrate genome evolution in the light of the metabolic rate hypothesis: a review L Bernà, A Chaurasia, A Tarallo, C Agnisola, G D'Onofrio Advances in Zoology Research 5, 65-93 2013 4. An evolutionary acquired functional domain confers neuronal fate specification properties to the Dbx1 transcription factor S Karaz, M Courgeon, H Lepetit, E Bruno, R Pannone, A Tarallo, F Thouzé, P Kerner, M Vervoort, F Causeret, A Pierani and G D’Onofrio EvoDevo, Submitted 5.
    [Show full text]
  • The Validity of the Fish Genus Name Fenerbahce Özdikmen Et Al., 2006 (Pisces: Cyprinodontiformes: Nothobranchiidae)
    _____________Mun. Ent. Zool. Vol. 3, No. 1, January 2008__________ 291 THE VALIDITY OF THE FISH GENUS NAME FENERBAHCE ÖZDİKMEN ET AL., 2006 (PISCES: CYPRINODONTIFORMES: NOTHOBRANCHIIDAE) Hüseyin Özdikmen* * Gazi Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, 06500 Ankara / TÜRKİYE, e-mail: [email protected] [Özdikmen, H. 2008. The validity of the fish genus name Fenerbahce Özdikmen et al., 2006 (Pisces: Cyprinodontiformes: Nothobranchiidae). Munis Entomology & Zoology 3 (1): 291-294] ABSTRACT: According to ICZN (1999), a discussion on the validity of the genus name Fenerbahce Özdikmen et al., 2006: 167 is given. The replacement name Fenerbahce Özdikmen et al., 2006 for Adamas Huber, 1979 which is a junior homonym of Adamas Malaise, 1945 is an available and a valid name to the articles 8.6 and 9.8 in ICZN (1999). The derived family-group name, Adamantini Huber, 2000 that have been changed by Huber (2007) as Adamansini derived from the genus name Adamans Huber, 2007 also changes to Fenerbahceini nom. n. For this reason, Huber’s new names, Adamans Huber, 2007 and Adamansini Huber, 2007 are invalid and synonyms of Fenerbahce Özdikmen et al., 2006 and Fenerbahceini nom. nov. respectively. KEY WORDS: Fenerbahce, Adamas, Adamans, Adamansini, Fenerbahceini, Pisces. Huber published a paper in 2007 in the journal “Zoosystema”. In his paper entitled “Non-availability of a name electronically published: the case of Adamas Huber, 1979 (Pisces, Cyprinodontiformes, Nothobranchiidae), invalidly replaced on the Internet”, he stated that “According to the current Code (ICZN 1999), valid from January 1, 2000, a new name proposed on the Internet or on electronic fi les is available if, and only if, it complies with articles 8.6 and 9.8, as quoted hereafter: “8.6.
    [Show full text]