DOCSLIB.ORG

Complexome Profiling Identifies TMEM126B As a Component of The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Complexome Profiling Identifies TMEM126B As a Component of The View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Cell Metabolism Resource Complexome Profiling Identifies TMEM126B as a Component of the Mitochondrial Complex I Assembly Complex Heinrich Heide,1,6 Lea Bleier,1,6 Mirco Steger,1 Jo¨ rg Ackermann,2 Stefan Dro¨ se,1 Bettina Schwamb,3 Martin Zo¨ rnig,3 Andreas S. Reichert,4,5 Ina Koch,2 Ilka Wittig,1,* and Ulrich Brandt1,* 1Molecular Bioenergetics Group, Medical School, Cluster of Excellence Frankfurt ‘‘Macromolecular Complexes,’’ Goethe University, Theodor-Stern-Kai 7, 60590 Frankfurt am Main, Germany 2Molecular Bioinformatics Group, Institute of Computer Science, Faculty of Computer Science and Mathematics, Robert-Mayer-Straße 11–15, 60325 Frankfurt am Main, Germany 3Chemotherapeutisches Forschungsinstitut Georg-Speyer-Haus, Paul-Ehrlich-Straße 42–44, 60596 Frankfurt am Main, Germany 4Mitochondrial Biology, Buchmann Institute for Molecular Life Sciences, Goethe University Frankfurt am Main, Max-von-Laue-Straße 15, 60438 Frankfurt am Main, Germany 5Mitochondriale Biologie, Zentrum fu¨ r Molekulare Medizin, Goethe Universita¨ t Frankfurt am Main, Max-von-Laue-Straße 15, 60438 Frankfurt am Main, Germany 6These authors contributed equally to this work *Correspondence: [email protected] (I.W.), [email protected] (U.B.) http://dx.doi.org/10.1016/j.cmet.2012.08.009 SUMMARY Immunoprecipitation or tandem affinity protocols in combina- tion with western blotting and mass spectrometry are widely Macromolecular complexes are essential players used to identify interaction partners of specific proteins. How- in numerous biological processes. They are often ever, these approaches are limited to a selected subset of large, dynamic, and rather labile; approaches to the cellular interactome and provide hardly any insight into study them are scarce. Covering masses up to 30 the actual composition and biochemical properties of the under- MDa, we separated the native complexome of rat lying complexes. To overcome these limitations, fractionation of heart mitochondria by blue-native and large-pore the native complexes by mild nondestructive techniques like density gradient centrifugation, size-exclusion chromatography, blue-native gel electrophoresis to analyze its con- and native electrophoresis is required. These approaches have stituents by mass spectrometry. Similarities in migra- been successfully applied to define even very large multiprotein tion patterns allowed hierarchical clustering into complexes, e.g., the human centrosome (Andersen et al., 2003), interaction profiles representing a comprehensive pyruvate dehydrogenase and other complexes from chloro- analysis of soluble and membrane-bound complexes plasts (Olinares et al., 2010), and respiratory chain supercom- of an entire organelle. The power of this bottom- plexes in mitochondria (Wittig et al., 2006b). Mass spectrometric up approach was validated with well-characterized analysis of samples fractionated by these techniques has been mitochondrial multiprotein complexes. TMEM126B applied to identify the constituents of whole organelles (Foster was found to comigrate with known assembly factors et al., 2006) or multiprotein complexes (Wessels et al., 2009). of mitochondrial complex I, namely CIA30, Ecsit, and Density gradient centrifugation requires rather large amounts Acad9. We propose terming this complex mitochon- of protein and suffers from low resolution. The use of better resolving size-exclusion columns leads to significant sample drial complex I assembly (MCIA) complex. Further- dilution and cannot be used for complexes larger than 5 MDa. more, we demonstrate that TMEM126B is required Therefore, blue-native electrophoresis (BNE) (Wittig and Scha¨ g- for assembly of complex I. In summary, complexome ger, 2009; Wittig et al., 2006a) is the method of choice for sensi- profiling is a powerful and unbiased technique allow- tive and high-resolution fractionation of the ‘‘complexome’’ of ing the identification of previously overlooked com- entire cells or subcellular compartments. It has been demon- ponents of large multiprotein complexes. strated that even rather labile macromolecular assemblies can be separated by BNE and analyzed directly by mass spectrom- etry (Wessels et al., 2009; Sokolova et al., 2010; Remmerie et al., INTRODUCTION 2011). With the recently introduced large-pore blue-native elec- trophoresis (LP-BNE), now extremely large macromolecular Macromolecular assemblies of proteins of different size and assemblies up to a molecular mass of 45 MDa can be sepa- complexity play an essential role in a broad range of cellular rated (Strecker et al., 2010). processes. Such complexes may exist as stable entities or Here, we report the analysis of the entire complexome of may form transient intermediates. Defining the composition intact rat heart mitochondria. Native complexes up to a size and functional dynamics of such assemblies are formidable chal- of 30 MDa were separated by BNE and LP-BNE, and complex- lenges, but the number of suitable methods is rather limited. ome profiles of the proteins identified by label-free quantitative 538 Cell Metabolism 16, 538–549, October 3, 2012 ª2012 Elsevier Inc. Cell Metabolism Complexome Profiling of Mitochondrial Complexes Figure 1. Separation of Mitochondrial Complexes by 2D BNE/SDS-PAGE and Assignment of Identified Proteins S4–S1, respiratory supercomplexes as defined (Wittig et al., 2006b); I, II, IV, OXPHOS complexes I, II, IV; III2,IV2, dimers of OXPHOS complexes III, IV. (A) First dimension 4%–16% acrylamide BNE gel, second dimension 16% SDS Tricine PAGE, fol- lowed by silver staining. (B) First dimension 3%–9% acrylamide LP-BNE gel, second dimension 16% SDS Tricine PAGE, followed by silver staining. (C) Proteins were assigned to mitochondria using the MitoMiner 2.0 tool (Smith and Robinson, 2009) and by the Mitoprot II algorithm (Claros and Vincens, 1996); probability score > 0.5. Grey, mitochondrial proteins; white, nonmitochondrial proteins. (D) Venn diagram illustrating the fraction of mito- chondrial proteins identified in both gel types. for Rattus norvegicus (UniProt Consor- tium, 2012), we identified a total of 539 proteins in the BNE gel and 353 proteins mass spectrometry were constructed by hierarchical clustering. in the LP-BNE gel. In both gel types, about 85% of the proteins This bottom-up complexome profiling analysis allowed us to could be assigned to mitochondria, confirming the high purity of identify a number of soluble and membrane-bound macromolec- the sample (Figure 1C). In total, 464 mitochondrial proteins were ular assemblies from different mitochondrial sub-compartments. identified, of which 63% were present in both gels (Figure 1D). We found TMEM126B as a previously overlooked component of Based on their relative abundance in different gel slices, the the mitochondrial complex I assembly factor (MCIA) complex identified proteins were hierarchically clustered by uncentered and show that this protein is indeed required for the formation correlation and single linkage with the Cluster 3.0 program (Eisen of respiratory chain complex I. et al., 1998; de Hoon et al., 2004). From heat map illustrations of the resulting profiles (Figure 2 and Table S1, parts A and B, RESULTS available online), groups of comigrating proteins are immedi- ately apparent, of which the multiprotein complexes I–V of the Validation of the Complexome Profiling Approach OXPHOS system were most prominent. Reflecting their pres- To establish and validate the complexome profiling approach, ence in supercomplexes of different composition, the subunits we used intact rat heart mitochondria as a readily available of complexes I, III, and IV were present in a number of different and defined subcellular compartment containing a number of slices of the two gels. Also the previously reported formation of well-characterized soluble and membrane bound multiprotein complex V monomers, dimers, and higher oligomers was clearly complexes. Mitochondria were prepared from hearts of young observed. male Wistar rats. The respiration rate in the active state with The respiratory chain complexes and their supercomplexes glutamate/malate was 220 nmol O $ mgÀ1 $ minÀ1, and the respi- have been used previously to calibrate native gel systems ratory control factor was >9, indicating high purity and intactness (Strecker et al., 2010; Wittig et al., 2010; Ladig et al., 2011). A of the mitochondria. After solubilization with the mild detergent plot of the calculated molecular masses against the slices of digitonin, and separation by BNE and LP-BNE, second-dimen- the two gels, in which the respective complexes were identified sion SDS-PAGE showed the typical and well established (Wittig by complexome profiling, shows that the migration distance of et al., 2006a; Wittig et al., 2006b; Strecker et al., 2010) patterns of the complexes was proportional to the logarithm of their molec- the complexes of the mitochondrial oxidative phosphorylation ular masses (Figure S1). Based on this calibration, we estimated (OXPHOS) system, namely respiratory supercomplexes (S4–S1), separation ranges up to 7 MDa for the BNE gel and up to 30 and individual complexes (I–V) as monomers and dimers (Fig- MDa for the LP-BNE gel, and we could assign approximate ures 1A and 1B). From the silver-stained gels, the presence of masses to the individual gel slices analyzed by LC-MS/MS a number of additional complexes was evident that are diffi- (Table S1, parts A and B). cult to define by this classical
Load more

Recommended publications
  • NDUFAF1 Antibody
    Efficient Professional Protein and Antibody Platforms NDUFAF1 Antibody Basic information: Catalog No.: UPA63763 Source: Rabbit Size: 50ul/100ul Clonality: monoclonal Concentration: 1mg/ml Isotype: Rabbit IgG Purification: Protein A purified. Useful Information: WB:1:1000 ICC:1:50-1:200 Applications: IHC:1:50-1:200 FC:1:50-1:100 Reactivity: Human Specificity: This antibody recognizes NDUFAF1 protein. Immunogen: Synthetic peptide within C terminal human NDUFAF1. This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for Description: this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. Part of the mitochondrial complex I assembly (MCIA) com- plex. The complex comprises at least TMEM126B, NDUFAF1, ECSIT, and ACAD9. Interacts with ECSIT. Interacts with ACAD9. At early stages of com- plex I assembly, it is found in intermediate subcomplexes that contain dif- ferent subunits including NDUFB6, NDUFA6, NDUFA9, NDUFS3, NDUFS7, ND1, ND2 and ND3 Uniprot: Q9Y375 Human BiowMW: 38 kDa Buffer: 1*TBS (pH7.4), 1%BSA, 50%Glycerol. Preservative: 0.05% Sodium Azide. Storage: Store at 4°C short term and -20°C long term. Avoid freeze-thaw cycles. Note: For research use only, not for use in diagnostic procedure.
    [Show full text]
  • Molecular Mechanism of ACAD9 in Mitochondrial Respiratory Complex 1 Assembly
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.07.425795; this version posted January 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Molecular mechanism of ACAD9 in mitochondrial respiratory complex 1 assembly Chuanwu Xia1, Baoying Lou1, Zhuji Fu1, Al-Walid Mohsen2, Jerry Vockley2, and Jung-Ja P. Kim1 1Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin, 53226, USA 2Department of Pediatrics, University of Pittsburgh School of Medicine, University of Pittsburgh, Children’s Hospital of Pittsburgh of UPMC, Pittsburgh, PA 15224, USA Abstract ACAD9 belongs to the acyl-CoA dehydrogenase family, which catalyzes the α-β dehydrogenation of fatty acyl-CoA thioesters. Thus, it is involved in fatty acid β-oxidation (FAO). However, it is now known that the primary function of ACAD9 is as an essential chaperone for mitochondrial respiratory complex 1 assembly. ACAD9 interacts with ECSIT and NDUFAF1, forming the mitochondrial complex 1 assembly (MCIA) complex. Although the role of MCIA in the complex 1 assembly pathway is well studied, little is known about the molecular mechanism of the interactions among these three assembly factors. Our current studies reveal that when ECSIT interacts with ACAD9, the flavoenzyme loses the FAD cofactor and consequently loses its FAO activity, demonstrating that the two roles of ACAD9 are not compatible. ACAD9 binds to the carboxy-terminal half (C-ECSIT), and NDUFAF1 binds to the amino-terminal half of ECSIT. Although the binary complex of ACAD9 with ECSIT or with C-ECSIT is unstable and aggregates easily, the ternary complex of ACAD9-ECSIT-NDUFAF1 (i.e., the MCIA complex) is soluble and extremely stable.
    [Show full text]
  • An Essential Role for ECSIT in Mitochondrial Complex I Assembly and Mitophagy in Macrophages
    Article An Essential Role for ECSIT in Mitochondrial Complex I Assembly and Mitophagy in Macrophages Graphical Abstract Authors Fla´ via R.G. Carneiro, Alice Lepelley, John J. Seeley, Matthew S. Hayden, Sankar Ghosh Correspondence [email protected] In Brief Macrophages rely on fine-tuning their metabolism to fulfill their anti-bacterial functions. Carneiro et al. show that the complex I assembly factor ECSIT is an essential regulator of the balance between mitochondrial respiration and glycolysis and the maintenance of a healthy mitochondrial pool through mitophagy. Highlights d Loss of ECSIT in macrophages leads to a striking glycolytic shift d ECSIT is essential for complex I assembly and stability in macrophages d Role of ECSIT in mROS production and removal of damaged mitochondria by mitophagy Carneiro et al., 2018, Cell Reports 22, 2654–2666 March 6, 2018 ª 2018 The Author(s). https://doi.org/10.1016/j.celrep.2018.02.051 Cell Reports Article An Essential Role for ECSIT in Mitochondrial Complex I Assembly and Mitophagy in Macrophages Fla´ via R.G. Carneiro,1,3,4 Alice Lepelley,1,4 John J. Seeley,1 Matthew S. Hayden,1,2 and Sankar Ghosh1,5,* 1Department of Microbiology and Immunology, Vagelos College of Physicians and Surgeons, Columbia University, New York, NY 10032, USA 2Section of Dermatology, Department of Surgery, Dartmouth-Hitchcock Medical Center, Lebanon, NH 03756, USA 3FIOCRUZ, Center for Technological Development in Health (CDTS), Rio de Janeiro, Brazil 4These authors contributed equally 5Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2018.02.051 SUMMARY 2015). There, ECSIT-dependent mROS production promotes activation of the phagosomal nicotinamide adenine dinucleotide ECSIT is a mitochondrial complex I (CI)-associated phosphate (NADPH) oxidase system and ROS-dependent protein that has been shown to regulate the pro- killing of engulfed microbes (West et al., 2011).
    [Show full text]
  • New Perspective in Diagnostics of Mitochondrial Disorders
    Pronicka et al. J Transl Med (2016) 14:174 DOI 10.1186/s12967-016-0930-9 Journal of Translational Medicine RESEARCH Open Access New perspective in diagnostics of mitochondrial disorders: two years’ experience with whole‑exome sequencing at a national paediatric centre Ewa Pronicka1,2*, Dorota Piekutowska‑Abramczuk1†, Elżbieta Ciara1†, Joanna Trubicka1†, Dariusz Rokicki2, Agnieszka Karkucińska‑Więckowska3, Magdalena Pajdowska4, Elżbieta Jurkiewicz5, Paulina Halat1, Joanna Kosińska6, Agnieszka Pollak7, Małgorzata Rydzanicz6, Piotr Stawinski7, Maciej Pronicki3, Małgorzata Krajewska‑Walasek1 and Rafał Płoski6* Abstract Background: Whole-exome sequencing (WES) has led to an exponential increase in identification of causative vari‑ ants in mitochondrial disorders (MD). Methods: We performed WES in 113 MD suspected patients from Polish paediatric reference centre, in whom routine testing failed to identify a molecular defect. WES was performed using TruSeqExome enrichment, followed by variant prioritization, validation by Sanger sequencing, and segregation with the disease phenotype in the family. Results: Likely causative mutations were identified in 67 (59.3 %) patients; these included variants in mtDNA (6 patients) and nDNA: X-linked (9 patients), autosomal dominant (5 patients), and autosomal recessive (47 patients, 11 homozygotes). Novel variants accounted for 50.5 % (50/99) of all detected changes. In 47 patients, changes in 31 MD-related genes (ACAD9, ADCK3, AIFM1, CLPB, COX10, DLD, EARS2, FBXL4, MTATP6, MTFMT, MTND1, MTND3, MTND5, NAXE, NDUFS6, NDUFS7, NDUFV1, OPA1, PARS2, PC, PDHA1, POLG, RARS2, RRM2B, SCO2, SERAC1, SLC19A3, SLC25A12, TAZ, TMEM126B, VARS2) were identified. The ACAD9, CLPB, FBXL4, PDHA1 genes recurred more than twice suggesting higher general/ethnic prevalence. In 19 cases, variants in 18 non-MD related genes (ADAR, CACNA1A, CDKL5, CLN3, CPS1, DMD, DYSF, GBE1, GFAP, HSD17B4, MECP2, MYBPC3, PEX5, PGAP2, PIGN, PRF1, SBDS, SCN2A) were found.
    [Show full text]
  • Understanding ACAD9 Function and the Physiologic Consequences of Its Deficiency
    Title Page Understanding ACAD9 Function and the Physiologic Consequences of its Deficiency by Andrew Guelde Sinsheimer BA, Oberlin College, 2008 Submitted to the Graduate Faculty of the Department of Human Genetics Graduate School of Public Health in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Committee Membership Page UNIVERSITY OF PITTSBURGH GRADUATE SCHOOL OF PUBLIC HEALTH This dissertation was presented by Andrew Guelde Sinsheimer It was defended on April 23, 2019 and approved by David Finegold, MD, Professor, Human Genetics, Graduate School of Public Health, University of Pittsburgh Eric S. Goetzman, PhD. Associate Professor, Human Genetics, Graduate School of Public Health, University of Pittsburgh Candace Kammerer, PhD, Associate Professor, Human Genetics, Graduate School of Public Health, University of Pittsburgh Dissertation Advisor: Jerry Vockley, MD, PhD, Professor, Human Genetics, Graduate School of Public Health, University of Pittsburgh ii Copyright © by Andrew Guelde Sinsheimer 2019 iii Abstract Jerry Vockley, MD, PhD Understanding ACAD9 Function and the Physiologic Consequences of its Deficiency Andrew Guelde Sinsheimer, PhD University of Pittsburgh, 2019 Abstract Acyl CoA Dehydrogenase 9 (ACAD9) is a member of the family of flavoenzymes that catalyze the dehydrogenation of Acyl-CoAs to 2,3 enoyl-CoAs in mitochondrial fatty acid oxidation (FAO). Inborn errors of metabolism of nearly all family members, including ACAD9, have been described in humans, and represent significant causes of morbidity and mortality particularly in children. ACAD9 deficiency leads to a combined defect in fatty acid oxidation and oxidative phosphorylation (OXPHOS) due to a duel role in the pathways. In addition to its function in mitochondrial FAO, ACAD9 has been shown to have a second function as one of 14 factors responsible for assembly of complex I of the electron transport chain (ETC).
    [Show full text]
  • TMEM126B (BC017574) Human Untagged Clone – SC105901
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC105901 TMEM126B (BC017574) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: TMEM126B (BC017574) Human Untagged Clone Tag: Tag Free Symbol: TMEM126B Synonyms: HT007; MGC111203; transmembrane protein 126B Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for BC017574, the custom clone sequence may differ by one or more nucleotides ATGGCAGCATCTATGCATGGTCAGCCCAGTCCTTCTCTAGAAGATGCAAAACTCAGAAGACCAATGGTCA TAGAAATCATAGAAAAAAATTTTGACTATCTTAGAAAAGAAATGACACAAAATATATATCAAATGGCGAC ATTTGGAACAACAGCTGGTTTCTCTGGAATATTCTCAAACTTCCTGTTCAGACGCTGCTTCAAGGTTAAA CATGATGCTTTGAAGACATATGCATCATTGGCTACACTTCCATTTTTGTCTACTGTTGTTACTGACAAGC TTTTTGTAATTGATGCTTTGTATTCAGGTGAATTTAAATTCACTAATGTATAA 5' Read Nucleotide >OriGene 5' read for BC017574 unedited Sequence: GTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCAAAAGGTGGTGTTCG GGTATGAGGCTGGGACTAAGCCAAGGGATTCAGGTGTGGTGCCGGTGGGAACTGAGGAAG CGCCCAAGGAAATGAAACACGATTTCCAAAATGAACTTAATCTTTCATGAGAAACTGAGG ATAGAGATGTCAATAAGCAGCCACTGTTTCCACCTCCCCACCTGAAGAGCTAGGAGGACA ACTACAAAGAGCCTGACTGCCTTCTCGGAATGAGGAGAGAGGAAAACAGCAACAGTATCA GTTTTCAAGATGGCAGCATCTATGCATGGTCAGCCCAGTCCTTCTCTAGAAGATGCAAAA CTCAGAAGACCAATGGTCATAGAAATCATAGAAAAAAATTTTGACTATCTTAGAAAAGAA ATGACACAAAATATATATCAAATGGCGACATTTGGAACAACAGCTGGTTTCTCTGGAATA TTCTCAAACTTCCTGTTCAGACGCTGCTTCAAGGTTAAACATGATGCTTTGAAGACATAT
    [Show full text]
  • Dynamics of Human Mitochondrial Complex I Assembly: Implications for Neurodegenerative Diseases
    REVIEW published: 22 August 2016 doi: 10.3389/fmolb.2016.00043 Dynamics of Human Mitochondrial Complex I Assembly: Implications for Neurodegenerative Diseases Gabriele Giachin, Romain Bouverot, Samira Acajjaoui, Serena Pantalone and Montserrat Soler-López * Structural Biology Group, European Synchrotron Radiation Facility, Grenoble, France Neurons are extremely energy demanding cells and highly dependent on the mitochondrial oxidative phosphorylation (OXPHOS) system. Mitochondria generate the energetic potential via the respiratory complexes I to IV, which constitute the electron transport chain (ETC), together with complex V. These redox reactions release energy in the form of ATP and also generate reactive oxygen species (ROS) that are involved in cell signaling but can eventually lead to oxidative stress. Complex I (CI or NADH:ubiquinone oxidoreductase) is the largest ETC enzyme, containing 44 subunits and the main contributor to ROS production. In recent years, the structure of the CI has become available and has provided new insights into CI assembly. A number of chaperones have been identified in the assembly and stability of the mature holo-CI, although they are Edited by: not part of its final structure. Interestingly, CI dysfunction is the most common OXPHOS Luca Mollica, disorder in humans and defects in the CI assembly process are often observed. However, Italian Institute of Technology, Italy the dynamics of the events leading to CI biogenesis remain elusive, which precludes our Reviewed by: understanding of how ETC malfunctioning affects neuronal integrity. Here, we review Revati Wani, Pfizer, USA the current knowledge of the structural features of CI and its assembly factors and the Trevor P. Creamer, potential role of CI misassembly in human disorders such as Complex I Deficiencies or University of Kentucky, USA Alzheimer’s and Parkinson’s diseases.
    [Show full text]
  • Mitochondrial Disease Associated with Complex I (NADH-Coq Oxidoreductase) Deficiency
    Mitochondrial disease associated with complex I (NADH-CoQ oxidoreductase) deficiency Immo E. Scheffler Division of Biology (Molecular Biology Section), University of California San Diego, 9500 Gilman Dr., La Jolla, CA 92093-0322, USA e-mail: [email protected] Abstract: Mitochondrial diseases due to a reduced capacity for oxidative phosphorylation were first identified more than 20 years ago, and their incidence is now recognized to be quite significant. In a large proportion of cases the problem can be traced to a complex I (NADH-CoQ oxidoreductase) deficiency (Phenotype MIM #252010). Because the complex consists of 44 subunits, there are many potential targets for pathogenic mutations, both on the nuclear and mitochondrial genomes. Surprisingly, however, almost half of the complex I deficiencies are due to defects in as yet unidentified genes that encode proteins other than the structural proteins of the complex. This review attempts to summarize what we know about the molecular basis of complex I deficiencies: mutations in the known structural genes, and mutations in an increasing num- ber of genes encoding “assembly factors”, that is, proteins required for the biogenesis of a functional complex I that are not found in the final complex I. More such genes must be identified before definitive genetic counselling can be applied in all cases of affected families. Introduction: Until about 25 years ago the words ‘mitochondria’ and ‘mitochondrial diseases’ probably did not exist in the vocabulary of the majority of physicians. In 1988 several pioneering papers opened a new era of biomedical research resulting in an avalanche of publications with no end in sight (Holt et al 1988a, b; Wallace et al 1988a, b).
    [Show full text]
  • Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions
    International Journal of Molecular Sciences Review Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions Margherita Protasoni 1 and Massimo Zeviani 1,2,* 1 Mitochondrial Biology Unit, The MRC and University of Cambridge, Cambridge CB2 0XY, UK; [email protected] 2 Department of Neurosciences, University of Padova, 35128 Padova, Italy * Correspondence: [email protected] Abstract: Mitochondria are ubiquitous intracellular organelles found in almost all eukaryotes and involved in various aspects of cellular life, with a primary role in energy production. The interest in this organelle has grown stronger with the discovery of their link to various pathologies, including cancer, aging and neurodegenerative diseases. Indeed, dysfunctional mitochondria cannot provide the required energy to tissues with a high-energy demand, such as heart, brain and muscles, leading to a large spectrum of clinical phenotypes. Mitochondrial defects are at the origin of a group of clinically heterogeneous pathologies, called mitochondrial diseases, with an incidence of 1 in 5000 live births. Primary mitochondrial diseases are associated with genetic mutations both in nuclear and mitochondrial DNA (mtDNA), affecting genes involved in every aspect of the organelle function. As a consequence, it is difficult to find a common cause for mitochondrial diseases and, subsequently, to offer a precise clinical definition of the pathology. Moreover, the complexity of this condition makes it challenging to identify possible therapies or drug targets. Keywords: ATP production; biogenesis of the respiratory chain; mitochondrial disease; mi-tochondrial electrochemical gradient; mitochondrial potential; mitochondrial proton pumping; mitochondrial respiratory chain; oxidative phosphorylation; respiratory complex; respiratory supercomplex Citation: Protasoni, M.; Zeviani, M.
    [Show full text]
  • Utviklingsavvik V02
    2/1/2021 Utviklingsavvik v02 Avdeling for medisinsk genetikk Utviklingsavvik Genpanel, versjon v02 * Enkelte genomiske regioner har lav eller ingen sekvensdekning ved eksomsekvensering. Dette skyldes at de har stor likhet med andre områder i genomet, slik at spesifikk gjenkjennelse av disse områdene og påvisning av varianter i disse områdene, blir vanskelig og upålitelig. Disse genetiske regionene har vi identifisert ved å benytte USCS segmental duplication hvor områder større enn 1 kb og ≥90% likhet med andre regioner i genomet, gjenkjennes (https://genome.ucsc.edu). For noen gener ligger alle ekson i områder med segmentale duplikasjoner: ACTB, ACTG1, ASNS, ATAD3A, CA5A, CFC1, CLCNKB, CYCS, DDX11, GBA, GJA1, MSTO1, PIGC, RBM8A, RPL15, SBDS, SDHA, SHOX, SLC6A8 Vi gjør oppmerksom på at ved identifiseringav ekson oppstrøms for startkodon kan eksonnummereringen endres uten at transkript ID endres. Avdelingens websider har en full oversikt over områder som er affisert av segmentale duplikasjoner. ** Transkriptets kodende ekson. Ekson Gen Gen affisert (HGNC (HGNC Transkript Ekson** Fenotype av symbol) ID) segdup* AAAS 13666 NM_015665.6 1-16 Achalasia-addisonianism-alacrimia syndrome, 231550 AARS 20 NM_001605.2 2-21 Epileptic encephalopathy, early infantile, 29 616339 AARS2 21022 NM_020745.4 1-22 Combined oxidative phosphorylation deficiency 8, 614096 AASS 17366 NM_005763.4 2-24 Hyperlysinaemia (Disorders of histidine, tryptophan or lysine metabolism) ABAT 23 NM_020686.6 2-16 GABA transaminase deficiency (Disorders of neurotransmitter metabolism, gamma-aminobutyrate)
    [Show full text]
  • Blueprint Genetics TMEM126B Single Gene Test
    TMEM126B single gene test Test code: S02533 Phenotype information Mitochondrial complex I deficiency Alternative gene names HT007 Panels that include the TMEM126B gene Comprehensive Muscular Dystrophy / Myopathy Panel Test Strengths The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this test’) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations This test does not detect the following: Complex inversions Gene conversions Balanced translocations Mitochondrial DNA variants Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above non-coding variants covered by the test). This test may not reliably detect the following: Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Indels larger than 50bp Single exon deletions or duplications Variants within pseudogene regions/duplicated segments https://blueprintgenetics.com/ The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
    [Show full text]
  • Robust Sampling of Defective Pathways in Alzheimer's Disease. Implications in Drug Repositioning
    International Journal of Molecular Sciences Article Robust Sampling of Defective Pathways in Alzheimer’s Disease. Implications in Drug Repositioning Juan Luis Fernández-Martínez 1,2,* , Óscar Álvarez-Machancoses 1,2 , Enrique J. deAndrés-Galiana 1,3 , Guillermina Bea 1 and Andrzej Kloczkowski 4,5 1 Group of Inverse Problems, Optimization and Machine Learning, Department of Mathematics, University of Oviedo, C/Federico García Lorca, 18, 33007 Oviedo, Spain; [email protected] (Ó.Á.-M.); [email protected] (E.J.d.-G.); [email protected] (G.B.) 2 DeepBioInsights, C/Federico García Lorca, 18, 33007 Oviedo, Spain 3 Department of Informatics and Computer Science, University of Oviedo, C/Federico García Lorca, 18, 33007 Oviedo, Spain 4 Battelle Center for Mathematical Medicine, Nationwide Children’s Hospital, Columbus, OH 43205, USA; [email protected] 5 Department of Pediatrics, The Ohio State University, Columbus, OH 43205, USA * Correspondence: [email protected] Received: 27 April 2020; Accepted: 13 May 2020; Published: 19 May 2020 Abstract: We present the analysis of the defective genetic pathways of the Late-Onset Alzheimer’s Disease (LOAD) compared to the Mild Cognitive Impairment (MCI) and Healthy Controls (HC) using different sampling methodologies. These algorithms sample the uncertainty space that is intrinsic to any kind of highly underdetermined phenotype prediction problem, by looking for the minimum-scale signatures (header genes) corresponding to different random holdouts. The biological pathways can be identified performing posterior analysis of these signatures established via cross-validation holdouts and plugging the set of most frequently sampled genes into different ontological platforms. That way, the effect of helper genes, whose presence might be due to the high degree of under determinacy of these experiments and data noise, is reduced.
    [Show full text]