DOCSLIB.ORG

Isolation and Characterization of EST-SSR Markers for Astilboides Tabularis (Saxifragaceae), Endangered Species in Korea

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Isolation and Characterization of EST-SSR Markers for Astilboides Tabularis (Saxifragaceae), Endangered Species in Korea pISSN 1225-8318 − Korean J. Pl. Taxon. 48(3): 195 200 (2018) eISSN 2466-1546 https://doi.org/10.11110/kjpt.2018.48.3.195 Korean Journal of RESEARCH ARTICLE Plant Taxonomy Isolation and characterization of EST-SSR markers for Astilboides tabularis (Saxifragaceae), endangered species in Korea Eui-Kwon JUNG, Dae-Hyun KANG1, Ki-Oug YOO2, Myounghai KWAK3, Young-Dong KIM and Bo-Yun KIM1* Department of Life Science, Hallym University, Chuncheon 24252, Korea 1Multidisciplinary Genome Institute, Hallym University, Chuncheon 24252, Korea 2Department of Biological Sciences, Kangwon National University, Chuncheon 24341, Korea 3Plant Resources Division, National Institute of Biological Resources, Incheon 22689, Korea (Received 4 September 2017; Revised 17 September 2018; Accepted 28 September 2018) ABSTRACT: Genetic assessments of rare and endangered species are among the first steps necessary to establish the proper management of natural populations. Transcriptome-derived single-sequence repeat markers were developed for the Korean endangered species Astilboides tabularis (Saxifragaceae) to assess its genetic diver- sity. A total of 96 candidate microsatellite loci were isolated based on transcriptome data using Illumina pair end sequencing. Of these, 26 were polymorphic, with one to five alleles per locus in 60 individuals from three pop- ulations of A. tabularis. The observed and expected heterozygosity per locus ranged from 0.000 to 0.950 and from 0.000 to 0.741, respectively. These polymorphic transcriptome-derived simple sequence repeat markers would be invaluable for future studies of population genetics and for ecological conservation of the endangered species A. tabularis. Keywords: Astilboides tabularis, endangered species, EST-SSR markers, next-generation sequencing, conservation Astilboides tabularis (Hemsl.) Engler is the only species in To the best of our knowledge, no microsatellite markers have Astilboides (Saxifragaceae) known to be distributed in a cluster been developed thus far for A. tabularis for population studies. in the forests of river valleys of northeastern Korea and China Population genetics research provides insight into conservation (Jintang and Cullen, 2001; The Angiosperm Phylogeny Group and management plans for rare and threatened species et al., 2016). This species is a protected wild plant classified as (Ottewell et al., 2016). To assess the genetic diversity of A. endangered wildlife grade II by the Ministry of the Environment tabularis, we developed expressed sequence tag–simple due to the possibility of the extinction of the population and/or sequence repeat (EST-SSR) markers. These have been used as reduction in the number of individuals by climate change a powerful molecular tool for genetic diversity studies of many (Ministry of the Environment of Korea, 2014). A. tabularis is plant species (Yan et al., 2016; Wang et al., 2017). a potential horticultural plant as an ornamental species given its large leaves (approximately 1 m in diameter) and beautiful Materials and Methods panicles (Belyaeva and Butenkova, 2016; Choi et al., 2016). It also has a long history of usage as a medicinal plant for diabetes For the construction of the RNA library, the total RNA was (Liu et al., 2016). Due to biological conservation efforts and extracted from leaves of individuals representing A. tabularis given the ecological importance of A. tabularis, genetic diversity from three populations (Voucher No. NIBRVP0000655607) analysis studies have been conducted using AFLP and isozymes (Table 1). RNA was extracted using RNeasy kits, version 2.2 (Ku et al., 2006; Lee, 2008). (Illumina, San Diego, CA, USA) following the manufacturer’s *Author for correspondence: wken416@hallym.ac.kr http://e-kjpt.org, © 2018 the Korean Society of Plant Taxonomists. This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 195 196 Eui-Kwon JUNG, Dae-Hyun KANG, Ki-Oug YOO, Myounghai KWAK, Young-Dong KIM and Bo-Yun KIM Table 1. Voucher information for the Astilboides tabularis populations sampled in this study. Vouchers were deposited in the Herbarium of the National Institute of Biological Resources (KB) and in the Herbarium of Hallym University (HHU), Republic of Korea. To prevent illegal collection, we did not disclose the exact locations of the sites. Population Locality No. Voucher No. (Herbarium) Korea-1 Bonghwachi, Jeongseon 20 NIBRVP0000655607 (KB) Korea-2 Geomyongso, Taebaek 20 KBY2017273 (HHU) China Fusong Xian, Jilin Sheng 20 NIBRVP0000655609 (KB) No., number of individuals sampled. instructions, and was subsequently used for TruSeq cDNA followed by 30 cycles of denaturation at 95oC for 1 min, library preparation and high-throughput Illumina HiSeq 100 bp annealing at annealing at 59oC for 1 min with an extension paired-end de novo transcriptome sequencing. The analysis at 72oC for 1.5 min, and a final extension step at 72oC for results reads were obtained and assembled into 102,884 10 min. Fluorescently labeled (HEX, FAM) PCR products unigenes with 7,476,378,742 read numbers. The de novo were analyzed by an automated sequencer (ABI 3730XL) transcriptome assembly of these reads was performed using with the GeneScan 500 LIZ Size Standard (Applied the short read assembling program Trinity r20140717 (Haas et Biosystems). Genotyping was performed using GeneMapper al., 2013) with the default parameters. Microsatellites were 3.7 (Applied Biosystems), and peaks were scored manually detected using MIcroSAtellite (MISA) version 1.0.0 (Thiel et by visual inspections. Finally, we identified 26 polymorphic al., 2003) with thresholds of ten repeat units for dinucleotide markers based on genotyping data, and functional annotations and five repeat units for tri-, tetra-, penta-, and hexanucleotides. for these markers were performed on a subset of ESTs with MISA identified 38,598 simple sequence repeats (SSRs), of BLASTX scores (E-value < 1 × 10-10) using the gene ontology which 96 loci were selected depending on (1) the number of database (Table 2). The genetic parameters of polymorphic SSR repeats, (2) a PCR product size of 150–500 bp, (3) an loci were assessed by calculating the number of alleles (A), o annealing temperature range of 55–60 C, and (4) a minimum the observed heterozygosity (Ho), and the expected GC content of 50% for further testing of A. tabularis. The heterozygosity (He) using GenAlEx 6.5 (Peakall and Smouse, primer sets were designed to flank the microsatellite-rich 2012). Degrees of deviation from the Hardy-Weinberg regions with a minimum of eight repeats using the Primer3 equilibrium (HWE) were estimated with ARLEQUIN 3.5 program (Rozen and Skaletsky, 1999). (Excoffier and Lischer, 2010). We sampled 60 A. tabularis individuals from three wild populations (Table 1). All samples included in this study were Results and Discussion collected in accordance with the requirements of permission and support from relevant authorities. To avoid collecting The results of the genetic diversity of 26 polymorphic clones, we specified a distance of at least 2 m among markers are shown in Table 3. Overall, the 26 microsatellite individuals within each population. The voucher specimens loci were polymorphic, with the number of alleles per locus were deposited in the National Institute of Biological Resources ranging from one to five (average 2.218). The Ho and He values Herbarium (KB) and in the Herbarium of Hallym University ranged from 0.000 to 0.950 and from 0.000 to 0.741, (HHU) in Korea (Table 1). The locations of the sites have been respectively (Table 3). Some polymorphic loci significantly withheld to prevent illegal collection. The utility of the 96 deviated from HWE, though this was not consistent across microsatellite markers was confirmed by PCR from each populations. population of A. tabularis in a total volume 25 µL, containing This study describes the first assembly and characterization 2.5 µL of 10× Ex Taq buffer (TaKaRa Bio Inc., Otsu, Japan), of the leaf transcriptome of A. tabularis using the Illumina 2 µL of 2.5 mM dNTPs, 0.01 µM each of a forward and reverse paired-end sequencing method. Twenty-six polymorphic primer, 0.1 µL of TaKaRa Ex Taq DNA polymerase (5 units/ markers were successfully amplified, revealing polymorphisms µL) (TaKaRa Bio Inc.), and 5–10 ng of template DNA. All in A. tabularis. This work can serve as a basis for further studies PCRs were performed in a GeneAmp PCR System 9700 on the genetic diversity and structure of A. tabularis and can thermocycler (Applied Biosystems, Carlsbad, CA, USA) using provide essential information for devising effective the following program: initial denaturation at 98oC for 5 min conservation strategies. Korean Journal of Plant Taxonomy Vol. 48 No. 3 (2018) Table 2. Characteristics of the 26 polymorphic microsatellite loci developed from Astilboides tabularis. Allele size GenBank Locus Primer sequence (5ʹ-3ʹ) Repeat motif Putative function [Organism] E-value range (bp) accession No. F: TCTGCCCTGATTGCACTTCA AT01 (AG) 220–224 MH476462 Not found - R: TCTCTCCTCTGCGTCATTGC 6 F: CAGTGAGAGACAGTGGCCTT AT02 (AG) 223–227 MH476463 Unnamed protein product, partial [Vitis vinifera]1.00E-99 R: ACGCCAAAACGATTGTGGTT 6 F: CAAGCCTGCCTTCATCTTGC AT04 (AG) 220–222 MH476464 Not found - R: TGTTCCGAGGGATGTTGTGG 7 EST-SSR markers for for markers EST-SSR
Load more

Recommended publications
  • Perennials for Special Purposes
    Perennials for Special Purposes Hot & Dry Areas • Sage, Perennial (Artemisia) Newly planted perennials will need regular • Sea Holly (Eryngium) watering until established. • Sea Lavender (Limonium) • Spurge, Cushion (Euphorbia • Aster polychroma) • Baby’s Breath • Statice, German (Gypsophila) (Goniolimon) • Beardtongue • Stonecrop (Sedum) (Penstemon) • Sunflower, False (Heliopsis) • Big Bluestem • Sunflower, Perennial (Helianthus) (Andropogon) • Switch Grass (Panicum) • Bitterroot (Lewisia) • Tickseed (Coreopsis) • Blanketflower (Gaillardia) • Tufted Hair Grass (Deschampsia) • Blue Oat Grass (Helictotrichon) • Yarrow (Achillea) • Cactus, Prickly Pear (Opuntia) • Yucca • Candytuft (Iberis sempervirens) • Cinquefoil (Potentilla) Groundcover for Sun • Coneflower (Echinacea) • Daisy, Painted (Tanacetum) • Baby’s Breath, Creeping • Daisy, Shasta (Leucanthemum x superbum) (Gypsophila repens) • Daylily (Hemerocallis) • Beardtongue, Spreading • Evening Primrose (Oenothera) (Penstemon) • False Indigo (Baptisia) • Bellflower, Spreading • Feather Reed Grass (Calamagrostis) (Campanula) • Fescue, Blue (Festuca glauca) • Cinquefoil (Potentilla) • Flax (Linum) • Cliff Green (Paxistima • Foxtail Lily (Eremurus) canbyi) • Globe Thistle (Echinops) • Cranesbill (Geranium) • Goldenrod (Solidago) • Gentian, Trumpet (Gentiana acaulis) • Helen’s Flower (Helenium) • Globe Daisy (Globularia) • Hens & Chicks (Sempervivum) • Hens & Chicks (Sempervivum) • Ice Plant (Delosperma) • Irish/Scotch Moss (Sagina subulata) • Lamb’s Ears (Stachys byzantina) • Kinnikinnick
    [Show full text]
  • Evolutionary Consequences of Dioecy in Angiosperms: the Effects of Breeding System on Speciation and Extinction Rates
    EVOLUTIONARY CONSEQUENCES OF DIOECY IN ANGIOSPERMS: THE EFFECTS OF BREEDING SYSTEM ON SPECIATION AND EXTINCTION RATES by JANA C. HEILBUTH B.Sc, Simon Fraser University, 1996 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Zoology) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA July 2001 © Jana Heilbuth, 2001 Wednesday, April 25, 2001 UBC Special Collections - Thesis Authorisation Form Page: 1 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. The University of British Columbia Vancouver, Canada http://www.library.ubc.ca/spcoll/thesauth.html ABSTRACT Dioecy, the breeding system with male and female function on separate individuals, may affect the ability of a lineage to avoid extinction or speciate. Dioecy is a rare breeding system among the angiosperms (approximately 6% of all flowering plants) while hermaphroditism (having male and female function present within each flower) is predominant. Dioecious angiosperms may be rare because the transitions to dioecy have been recent or because dioecious angiosperms experience decreased diversification rates (speciation minus extinction) compared to plants with other breeding systems.
    [Show full text]
  • 2021 Wholesale Catalog Pinewood Perennial Gardens Table of Contents
    2021 Wholesale Catalog Pinewood Perennial Gardens Table of Contents In Our Catalog ........................................................................................................................................2 Quart Program ........................................................................................................................................3 Directions ..............................................................................................................................................3 New Plants for 2021 ...............................................................................................................................4 Native Plants Offered for Sale ..................................................................................................................4 L.I. Gold Medal Plant Program .................................................................................................................5 Characteristics Table ..........................................................................................................................6-10 Descriptions of Plants Achillea to Astilboides .........................................................................................................11-14 Baptisia to Crocosmia ..........................................................................................................14-16 Delosperma to Eupatorium ...................................................................................................16-18 Gaillardia to Helleborus
    [Show full text]
  • Saxifragaceae
    Flora of China 8: 269–452. 2001. SAXIFRAGACEAE 虎耳草科 hu er cao ke Pan Jintang (潘锦堂)1, Gu Cuizhi (谷粹芝 Ku Tsue-chih)2, Huang Shumei (黄淑美 Hwang Shu-mei)3, Wei Zhaofen (卫兆芬 Wei Chao-fen)4, Jin Shuying (靳淑英)5, Lu Lingdi (陆玲娣 Lu Ling-ti)6; Shinobu Akiyama7, Crinan Alexander8, Bruce Bartholomew9, James Cullen10, Richard J. Gornall11, Ulla-Maj Hultgård12, Hideaki Ohba13, Douglas E. Soltis14 Herbs or shrubs, rarely trees or vines. Leaves simple or compound, usually alternate or opposite, usually exstipulate. Flowers usually in cymes, panicles, or racemes, rarely solitary, usually bisexual, rarely unisexual, hypogynous or ± epigynous, rarely perigynous, usually biperianthial, rarely monochlamydeous, actinomorphic, rarely zygomorphic, 4- or 5(–10)-merous. Sepals sometimes petal-like. Petals usually free, sometimes absent. Stamens (4 or)5–10 or many; filaments free; anthers 2-loculed; staminodes often present. Carpels 2, rarely 3–5(–10), usually ± connate; ovary superior or semi-inferior to inferior, 2- or 3–5(–10)-loculed with axile placentation, or 1-loculed with parietal placentation, rarely with apical placentation; ovules usually many, 2- to many seriate, crassinucellate or tenuinucellate, sometimes with transitional forms; integument 1- or 2-seriate; styles free or ± connate. Fruit a capsule or berry, rarely a follicle or drupe. Seeds albuminous, rarely not so; albumen of cellular type, rarely of nuclear type; embryo small. About 80 genera and 1200 species: worldwide; 29 genera (two endemic), and 545 species (354 endemic, seven introduced) in China. During the past several years, cladistic analyses of morphological, chemical, and DNA data have made it clear that the recognition of the Saxifragaceae sensu lato (Engler, Nat.
    [Show full text]
  • Karyotypic Relationships Among Astilboides, Bergenia, Darmera, and Mukdenia and Their Implications for Subtribal Boundaries in Saxifrageae (Saxifragaceae)
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/237162727 Karyotypic relationships among Astilboides, Bergenia, Darmera, and Mukdenia and their implications for subtribal boundaries in Saxifrageae (Saxifragaceae) Article in Canadian Journal of Botany · January 2011 DOI: 10.1139/b86-075 CITATIONS READS 3 72 1 author: Douglas E Soltis University of Florida 1,009 PUBLICATIONS 76,596 CITATIONS SEE PROFILE Some of the authors of this publication are also working on these related projects: Systematics and evolution of Amaryllidaceae tribe Hippeastreae View project Teaching Plant Systematics View project All content following this page was uploaded by Douglas E Soltis on 01 October 2014. The user has requested enhancement of the downloaded file. Karyotypic relationships among Astilboides, Bergenia, Darmera, and Mukdenia and their implications for subtribal boundaries in Saxifrageae (Saxifragaceae) Department of Botany, Washington State Universiv, Pullman, WA, U.S.A. 99164-4330 Received May 7, 1985 SOLTIS,D. E. 1986. Karyotypic relationships among Astilboides, Bergenia, Dar~nera,and Mukdenia and their implications for subtribal boundaries in Saxifrageae (Saxifragaceae). Can. J. Bot. 64: 586-588. Chromosomal studies have revealed that 2n = 34 in Astilboides, Darmera, Mukdenia, and Bergenia and that these genera have very similar karyotypes. Few taxa of Saxifrageae have x = 17, and chromosomal data therefore suggest that these four genera form a natural group. The generic affinities suggested by chromosomal data are not in agreement with the traditional interpretation of relationships in Saxifrageae. Astilboides has been placed in subtribe Astilbinae, while Bergenia, Darmera, and Mukdenia were considered members of Saxifraginae. The data presented here, in conjunction with data from earlier chromosomal studies, indicate that traditional subtribal boundaries do not accurately reflect relationships in tribe Saxifrageae.
    [Show full text]
  • Phytophoto Index 2018
    PhytoPhoto 2018 Image Availability Accessing the photo collection is easy. Simply send an email with the plant names or a description of images sought to inquiries@phytophoto.com and a gallery of photos meeting your criteria will be submitted to you, usually the same day. Abeliophyllum distichum Abutilon vitifolium ‘Album’ Acer palmatum fall color Abeliophyllum distichum ‘Roseum’ Abutilon vitifolium white Acer palmatum in front of window Abelmoschus esculentus "Okra" Abutilon Wisley Red Acer palmatum in orange fall color Abelmoschus manihot Abutilon x hybridum 'Bella Red' Acer palmatum var. dissectum Abies balsamea 'Nana' Abutilon-orange Acer palmatum var. dissectum Dissectum Abies concolor 'Blue Cloak' Abutilon-white Viride Group Abies guatemalensis Acacia baileyana Acer pensylvaticum Abies koreana 'Glauca' Acacia baileyana 'Purpurea' Acer platanoides 'Princeton Gold' Abies koreana 'Green Carpet' Acacia boormanii Acer pseudoplatanus Abies koreana 'Horstmann's Silberlocke' Acacia confusa Acer pseudoplatanus 'Leopoldii' Abies koreana 'Silberperle' Acacia cultriformis Acer pseudoplatanus 'Purpureum' Abies koreana 'Silberzwerg' Acacia dealbata Acer pseudoplatanus ‘Puget Pink’ Abies koreana 'Silver Show' Acacia iteaphylla Acer pseudoplatanus f... 'Leopoldii' Abies koreana Aurea Acacia koa Acer rubrum Abies koreana-cone Acacia koa seedlings Acer rubrum and stop sign Abies lasiocarpa Acacia koaia Acer rufinerve Hatsuyuki Abies lasiocarpa v. arizonica 'Argentea' Acacia longifolia Acer saccharinum Abies lasiocarpa v. arizonica 'Glauca Acacia
    [Show full text]
  • An Encyclopedia of Shade Perennials This Page Intentionally Left Blank an Encyclopedia of Shade Perennials
    An Encyclopedia of Shade Perennials This page intentionally left blank An Encyclopedia of Shade Perennials W. George Schmid Timber Press Portland • Cambridge All photographs are by the author unless otherwise noted. Copyright © 2002 by W. George Schmid. All rights reserved. Published in 2002 by Timber Press, Inc. Timber Press The Haseltine Building 2 Station Road 133 S.W. Second Avenue, Suite 450 Swavesey Portland, Oregon 97204, U.S.A. Cambridge CB4 5QJ, U.K. ISBN 0-88192-549-7 Printed in Hong Kong Library of Congress Cataloging-in-Publication Data Schmid, Wolfram George. An encyclopedia of shade perennials / W. George Schmid. p. cm. ISBN 0-88192-549-7 1. Perennials—Encyclopedias. 2. Shade-tolerant plants—Encyclopedias. I. Title. SB434 .S297 2002 635.9′32′03—dc21 2002020456 I dedicate this book to the greatest treasure in my life, my family: Hildegarde, my wife, friend, and supporter for over half a century, and my children, Michael, Henry, Hildegarde, Wilhelmina, and Siegfried, who with their mates have given us ten grandchildren whose eyes not only see but also appreciate nature’s riches. Their combined love and encouragement made this book possible. This page intentionally left blank Contents Foreword by Allan M. Armitage 9 Acknowledgments 10 Part 1. The Shady Garden 11 1. A Personal Outlook 13 2. Fated Shade 17 3. Practical Thoughts 27 4. Plants Assigned 45 Part 2. Perennials for the Shady Garden A–Z 55 Plant Sources 339 U.S. Department of Agriculture Hardiness Zone Map 342 Index of Plant Names 343 Color photographs follow page 176 7 This page intentionally left blank Foreword As I read George Schmid’s book, I am reminded that all gardeners are kindred in spirit and that— regardless of their roots or knowledge—the gardening they do and the gardens they create are always personal.
    [Show full text]
  • Lasttraderdissertation.Pdf (1.690Mb)
    Molecular and Morphological Investigation of Astilbe by Brian W. Trader Dissertation submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Horticulture APPROVED: Holly L. Scoggins, Chair _ Joyce G. Latimer Duncan M. Porter Stephen E. Scheckler Richard E. Veilleux June 19, 2006 Blacksburg, Virginia Keywords: Phylogenetics, SNPs, Saxifragaceae, and matK Molecular and Morphological Investigation of Astilbe Brian Wayne Trader Abstract Astilbe (Saxifragaceae) is a genus of herbaceous perennials widely cultivated for their ornamental value. The genus is considered taxonomically complex because of its geographic distribution, variation within species, and the lack of adequate morphological characters to delineate taxa. To date, an inclusive investigation of the genus has not been conducted. This study was undertaken to (a) develop a well-resolved phylogeny of the genus Astilbe using an expanded morphological data set and sequences from the plastid gene matK, (b) use single nucleotide polymorphisms to determine the lineages of cultivated varieties, and (c) successfully culture Astilbe in vitro and evaluate potential somaclonal variation of resulting Astilbe microshoots. Phylogenetic trees generated from a morphological character matrix of 28 character states divided Astilbe into three distinct clades. Relationships were well resolved among the taxa, though only a few branches had greater than 50% bootstrap support. There is evidence from the phylogeny that some described species may actually represent variation within populations of species. From our analysis I propose an Astilbe genus with 13 to 15 species and offer a key for distinguishing species and varieties. There was little matK sequence variation among taxa of Astilbe.
    [Show full text]
  • Tracheophyte of Xiao Hinggan Ling in China: an Updated Checklist
    Biodiversity Data Journal 7: e32306 doi: 10.3897/BDJ.7.e32306 Taxonomic Paper Tracheophyte of Xiao Hinggan Ling in China: an updated checklist Hongfeng Wang‡§, Xueyun Dong , Yi Liu|,¶, Keping Ma | ‡ School of Forestry, Northeast Forestry University, Harbin, China § School of Food Engineering Harbin University, Harbin, China | State Key Laboratory of Vegetation and Environmental Change, Institute of Botany, Chinese Academy of Sciences, Beijing, China ¶ University of Chinese Academy of Sciences, Beijing, China Corresponding author: Hongfeng Wang (wanghongfeng90@163.com) Academic editor: Daniele Cicuzza Received: 10 Dec 2018 | Accepted: 03 Mar 2019 | Published: 27 Mar 2019 Citation: Wang H, Dong X, Liu Y, Ma K (2019) Tracheophyte of Xiao Hinggan Ling in China: an updated checklist. Biodiversity Data Journal 7: e32306. https://doi.org/10.3897/BDJ.7.e32306 Abstract Background This paper presents an updated list of tracheophytes of Xiao Hinggan Ling. The list includes 124 families, 503 genera and 1640 species (Containing subspecific units), of which 569 species (Containing subspecific units), 56 genera and 6 families represent first published records for Xiao Hinggan Ling. The aim of the present study is to document an updated checklist by reviewing the existing literature, browsing the website of National Specimen Information Infrastructure and additional data obtained in our research over the past ten years. This paper presents an updated list of tracheophytes of Xiao Hinggan Ling. The list includes 124 families, 503 genera and 1640 species (Containing subspecific units), of which 569 species (Containing subspecific units), 56 genera and 6 families represent first published records for Xiao Hinggan Ling. The aim of the present study is to document an updated checklist by reviewing the existing literature, browsing the website of National Specimen Information Infrastructure and additional data obtained in our research over the past ten years.
    [Show full text]
  • Scottish Rock Garden Club 69Th Seed Distribution 2015-16
    SCOTTISH ROCK GARDEN CLUB 69th SEED DISTRIBUTION 2015-2016 Send requests for seed to: Send seed donations to: Mr Neil McNulty Drs Ian and Carole Bainbridge 6 Main Road Luckie Harg’s Crookedholm Anwoth Road Kilmarnock Gatehouse of Fleet KA3 6JT Castle Douglas Scotland DG7 2EF Scotland Contact us at seed@srgc.org.uk Please read page 2 and the notes in the Yearbook Scottish Rock Garden Club 69th Seed Distribution 2015-16 Applications The procedure for seed requests is as usual: use the forms in the centre of the booklet, and send these to Neil McNulty, or go online at the SRGC website (see centrefold page ii) to make your requests. The website password is on centrefold page (i). Even if you request seed on the paper forms by post, you can pay for seed by credit card online in Sterling, but not by debit card. All seed requests must be received by January 15th. Donors may choose 25 packets, non-donors 16 packets. Please follow the instructions carefully, and write legibly to ensure we pick the items you want. The charge for the main request for all members is now £5, €7, or $10 US, to cover packing, postage and administration of the exchange. Distribution Distribution of seed starts in January, first for donors’ main requests, then for non-donors’, and finally for surplus seed applications. Main requests will be sent out in January, but surplus requests will be processed only after all main orders have been fulfilled. Main and surplus requests will therefore arrive some time apart.
    [Show full text]
  • Sheet1 Acaena Affinis £4.20 from Southern Chile, This Mat Forming Evergreen Has Pinnate Leaves, Lightly Glaucous on the Topside, More So on the Underside
    Sheet1 Acaena affinis £4.20 From Southern Chile, this mat forming evergreen has pinnate leaves, lightly glaucous on the topside, more so on the underside. Heads of striking red anthers in May followed by rusty red burrs. Good understorey under shrubs. Any reasonable soil in sun or part shade. (4-5) 10cm. Acaena buchananii £4.20 Creeping, evergreen mats of soft pale grey-green, toothed leaves. Small, insignificant flowers followed by spikey, red-flushed seed heads. Well drained soil in sun or part shade. 15x60cm. Acaena magellanica £4.20 Dense evergreen carpeter, forming mats of finely cut, fern-like soft olive-green leaves, with silver blue overtones. Heads of small white flowers in late spring are follwed by showy red burrs. Excellent edger for a well drained spot in sun. (5-6) 5cm. Acaena saccaticupula 'Blue Haze' £4.50 (syn.A.Pewter') Vigorous creeping evergreen ground cover with long blue-grey pinnate toothed leaves flushed bronze. Showy dark red burrs in late summer. Well drained soil in sun or part shade. 10x75cm. Acanthus dioscoridis perringii £6.20 2.00 An elegant bear's breeches with deeply toothed, glossy leaves. Short spikes of pale-pink flowers in early summer. Needs excellent drainage in gritty, well drained soil in sun. (5-6) 60cm. Acanthus hungaricus 'Hot Lips' £5.50 2.00 Spikes of silvery-green bracts with dusky-purple protruding flowers, having a frilly, prominent white lower lip. Very long flowering throughout summer. Basal clumps of very finely cut, glossy green leaves. Best in a light, free draining soil in sun. (6-8) 70cm.
    [Show full text]
  • Distribution of Vascular Plants Along the Altitudinal Gradient of Gyebangsan (Mt.) in Korea
    Journal of Asia-Pacific Biodiversity 7 (2014) e40ee71 Contents lists available at ScienceDirect Journal of Asia-Pacific Biodiversity journal homepage: http://www.elsevier.com/journals/journal-of-asia-pacific- biodiversity/2287-884x Original article Distribution of vascular plants along the altitudinal gradient of Gyebangsan (Mt.) in Korea Jong-Cheol Yang*, Hee-Suk Hwang, Hye-Jeong Lee, Su-Young Jung, Seong-Jin Ji, Seung-Hwan Oh, You-Mi Lee Division of Forest Biodiversity and Herbarium, Korea National Arboretum, Pocheon, Gyeonggi 487-821, Republic of Korea article info abstract Article history: This study was conducted to examine the distribution of vascular plants along the altitudinal gradient Received 31 December 2013 and investigation routes of Gyebangsan (Mt.) in Korea. The total number of flora of Gyebangsan (Mt.) was Received in revised form 510 taxa in total, comprising 83 families, 283 genera, 449 species, four subspecies, 52 varieties and five 11 February 2014 forms. In the flora of this area, 14 taxa were Korean endemic plants and 17 taxa were rare plants. Accepted 11 February 2014 Naturalized plants in Korea numbered 27 taxa. The number of vascular plants monotonically decreased Available online 15 March 2014 with increasing altitude. In contrast, the rare plants mostly increased with increasing altitude. The endemic plants of Korea did not show any special pattern by altitude gradient. The naturalized plants Keywords: Gyebangsan (Mt.) altitude were mainly distributed at the open area below 1000 m. Ó Distribution Copyright 2014, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Korea endemic plant Production and hosting by ELSEVIER. All rights reserved.
    [Show full text]