pISSN 1225-8318 − Korean J. Pl. Taxon. 48(3): 195 200 (2018) eISSN 2466-1546 https://doi.org/10.11110/kjpt.2018.48.3.195 Korean Journal of RESEARCH ARTICLE Plant Taxonomy Isolation and characterization of EST-SSR markers for Astilboides tabularis (Saxifragaceae), endangered species in Korea Eui-Kwon JUNG, Dae-Hyun KANG1, Ki-Oug YOO2, Myounghai KWAK3, Young-Dong KIM and Bo-Yun KIM1* Department of Life Science, Hallym University, Chuncheon 24252, Korea 1Multidisciplinary Genome Institute, Hallym University, Chuncheon 24252, Korea 2Department of Biological Sciences, Kangwon National University, Chuncheon 24341, Korea 3Plant Resources Division, National Institute of Biological Resources, Incheon 22689, Korea (Received 4 September 2017; Revised 17 September 2018; Accepted 28 September 2018) ABSTRACT: Genetic assessments of rare and endangered species are among the first steps necessary to establish the proper management of natural populations. Transcriptome-derived single-sequence repeat markers were developed for the Korean endangered species Astilboides tabularis (Saxifragaceae) to assess its genetic diver- sity. A total of 96 candidate microsatellite loci were isolated based on transcriptome data using Illumina pair end sequencing. Of these, 26 were polymorphic, with one to five alleles per locus in 60 individuals from three pop- ulations of A. tabularis. The observed and expected heterozygosity per locus ranged from 0.000 to 0.950 and from 0.000 to 0.741, respectively. These polymorphic transcriptome-derived simple sequence repeat markers would be invaluable for future studies of population genetics and for ecological conservation of the endangered species A. tabularis. Keywords: Astilboides tabularis, endangered species, EST-SSR markers, next-generation sequencing, conservation Astilboides tabularis (Hemsl.) Engler is the only species in To the best of our knowledge, no microsatellite markers have Astilboides (Saxifragaceae) known to be distributed in a cluster been developed thus far for A. tabularis for population studies. in the forests of river valleys of northeastern Korea and China Population genetics research provides insight into conservation (Jintang and Cullen, 2001; The Angiosperm Phylogeny Group and management plans for rare and threatened species et al., 2016). This species is a protected wild plant classified as (Ottewell et al., 2016). To assess the genetic diversity of A. endangered wildlife grade II by the Ministry of the Environment tabularis, we developed expressed sequence tag–simple due to the possibility of the extinction of the population and/or sequence repeat (EST-SSR) markers. These have been used as reduction in the number of individuals by climate change a powerful molecular tool for genetic diversity studies of many (Ministry of the Environment of Korea, 2014). A. tabularis is plant species (Yan et al., 2016; Wang et al., 2017). a potential horticultural plant as an ornamental species given its large leaves (approximately 1 m in diameter) and beautiful Materials and Methods panicles (Belyaeva and Butenkova, 2016; Choi et al., 2016). It also has a long history of usage as a medicinal plant for diabetes For the construction of the RNA library, the total RNA was (Liu et al., 2016). Due to biological conservation efforts and extracted from leaves of individuals representing A. tabularis given the ecological importance of A. tabularis, genetic diversity from three populations (Voucher No. NIBRVP0000655607) analysis studies have been conducted using AFLP and isozymes (Table 1). RNA was extracted using RNeasy kits, version 2.2 (Ku et al., 2006; Lee, 2008). (Illumina, San Diego, CA, USA) following the manufacturer’s *Author for correspondence: [email protected] http://e-kjpt.org, © 2018 the Korean Society of Plant Taxonomists. This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 195 196 Eui-Kwon JUNG, Dae-Hyun KANG, Ki-Oug YOO, Myounghai KWAK, Young-Dong KIM and Bo-Yun KIM Table 1. Voucher information for the Astilboides tabularis populations sampled in this study. Vouchers were deposited in the Herbarium of the National Institute of Biological Resources (KB) and in the Herbarium of Hallym University (HHU), Republic of Korea. To prevent illegal collection, we did not disclose the exact locations of the sites. Population Locality No. Voucher No. (Herbarium) Korea-1 Bonghwachi, Jeongseon 20 NIBRVP0000655607 (KB) Korea-2 Geomyongso, Taebaek 20 KBY2017273 (HHU) China Fusong Xian, Jilin Sheng 20 NIBRVP0000655609 (KB) No., number of individuals sampled. instructions, and was subsequently used for TruSeq cDNA followed by 30 cycles of denaturation at 95oC for 1 min, library preparation and high-throughput Illumina HiSeq 100 bp annealing at annealing at 59oC for 1 min with an extension paired-end de novo transcriptome sequencing. The analysis at 72oC for 1.5 min, and a final extension step at 72oC for results reads were obtained and assembled into 102,884 10 min. Fluorescently labeled (HEX, FAM) PCR products unigenes with 7,476,378,742 read numbers. The de novo were analyzed by an automated sequencer (ABI 3730XL) transcriptome assembly of these reads was performed using with the GeneScan 500 LIZ Size Standard (Applied the short read assembling program Trinity r20140717 (Haas et Biosystems). Genotyping was performed using GeneMapper al., 2013) with the default parameters. Microsatellites were 3.7 (Applied Biosystems), and peaks were scored manually detected using MIcroSAtellite (MISA) version 1.0.0 (Thiel et by visual inspections. Finally, we identified 26 polymorphic al., 2003) with thresholds of ten repeat units for dinucleotide markers based on genotyping data, and functional annotations and five repeat units for tri-, tetra-, penta-, and hexanucleotides. for these markers were performed on a subset of ESTs with MISA identified 38,598 simple sequence repeats (SSRs), of BLASTX scores (E-value < 1 × 10-10) using the gene ontology which 96 loci were selected depending on (1) the number of database (Table 2). The genetic parameters of polymorphic SSR repeats, (2) a PCR product size of 150–500 bp, (3) an loci were assessed by calculating the number of alleles (A), o annealing temperature range of 55–60 C, and (4) a minimum the observed heterozygosity (Ho), and the expected GC content of 50% for further testing of A. tabularis. The heterozygosity (He) using GenAlEx 6.5 (Peakall and Smouse, primer sets were designed to flank the microsatellite-rich 2012). Degrees of deviation from the Hardy-Weinberg regions with a minimum of eight repeats using the Primer3 equilibrium (HWE) were estimated with ARLEQUIN 3.5 program (Rozen and Skaletsky, 1999). (Excoffier and Lischer, 2010). We sampled 60 A. tabularis individuals from three wild populations (Table 1). All samples included in this study were Results and Discussion collected in accordance with the requirements of permission and support from relevant authorities. To avoid collecting The results of the genetic diversity of 26 polymorphic clones, we specified a distance of at least 2 m among markers are shown in Table 3. Overall, the 26 microsatellite individuals within each population. The voucher specimens loci were polymorphic, with the number of alleles per locus were deposited in the National Institute of Biological Resources ranging from one to five (average 2.218). The Ho and He values Herbarium (KB) and in the Herbarium of Hallym University ranged from 0.000 to 0.950 and from 0.000 to 0.741, (HHU) in Korea (Table 1). The locations of the sites have been respectively (Table 3). Some polymorphic loci significantly withheld to prevent illegal collection. The utility of the 96 deviated from HWE, though this was not consistent across microsatellite markers was confirmed by PCR from each populations. population of A. tabularis in a total volume 25 µL, containing This study describes the first assembly and characterization 2.5 µL of 10× Ex Taq buffer (TaKaRa Bio Inc., Otsu, Japan), of the leaf transcriptome of A. tabularis using the Illumina 2 µL of 2.5 mM dNTPs, 0.01 µM each of a forward and reverse paired-end sequencing method. Twenty-six polymorphic primer, 0.1 µL of TaKaRa Ex Taq DNA polymerase (5 units/ markers were successfully amplified, revealing polymorphisms µL) (TaKaRa Bio Inc.), and 5–10 ng of template DNA. All in A. tabularis. This work can serve as a basis for further studies PCRs were performed in a GeneAmp PCR System 9700 on the genetic diversity and structure of A. tabularis and can thermocycler (Applied Biosystems, Carlsbad, CA, USA) using provide essential information for devising effective the following program: initial denaturation at 98oC for 5 min conservation strategies. Korean Journal of Plant Taxonomy Vol. 48 No. 3 (2018) Table 2. Characteristics of the 26 polymorphic microsatellite loci developed from Astilboides tabularis. Allele size GenBank Locus Primer sequence (5ʹ-3ʹ) Repeat motif Putative function [Organism] E-value range (bp) accession No. F: TCTGCCCTGATTGCACTTCA AT01 (AG) 220–224 MH476462 Not found - R: TCTCTCCTCTGCGTCATTGC 6 F: CAGTGAGAGACAGTGGCCTT AT02 (AG) 223–227 MH476463 Unnamed protein product, partial [Vitis vinifera]1.00E-99 R: ACGCCAAAACGATTGTGGTT 6 F: CAAGCCTGCCTTCATCTTGC AT04 (AG) 220–222 MH476464 Not found - R: TGTTCCGAGGGATGTTGTGG 7 EST-SSR markers for for markers EST-SSR