Diversity and Abundance of Bacteria and Nirs-Encoding Denitrifiers Associated with the Juan De Fuca Ridge Hydrothermal System

Ann Microbiol (2014) 64:1691–1705 DOI 10.1007/s13213-014-0813-3

ORIGINAL ARTICLE

Diversity and abundance of Bacteria and nirS-encoding denitrifiers associated with the Juan de Fuca Ridge hydrothermal system

Annie Bourbonnais & S. Kim Juniper & David A. Butterfield & Rika E. Anderson & Moritz F. Lehmann

Received: 9 August 2013 /Accepted: 10 January 2014 /Published online: 4 February 2014 # Springer-Verlag Berlin Heidelberg and the University of Milan 2014

Abstract Denitrification, which results in the loss of bioavail- communities were diverse and dominated by members of the able nitrogen—an essential macronutrient for all living organ- ε-andγ-proteobacteria, including taxonomic groups contain- isms—may potentially affect chemosynthetic primary produc- ing known denitrifiers. Assemblages of denitrifiers that could tion in hydrothermal vent ecosystems where sub-oxic condi- be evaluated by nirS gene sequence comparisons showed low tions favorable to denitrification are common. Here we de- diversity. The single nirS sequence shared by the two loca- scribe the diversity and abundance of denitrifying bacteria in tions, affiliated with a γ-proteobacteria isolated from estuarine the subsurface biosphere at Axial Volcano and the Endeavour sediments (Pseudomonas sp. BA2), represented more than Segment on the Juan de Fuca Ridge using a combination of half of all sequences recovered when clustered at 97 % iden- quantitative polymerase chain reaction assays, and small sub- tity. All other nirS sequences clustered into different taxonom- unit ribosomal RNA (SSU or 16S rRNA) pyrotag and nitrite ic groups, indicating important differences in denitrifier com- reductase (nirS) clone library sequencing methods. Bacterial munity membership between the two sites. Total nirS gene abundance was at least two orders of magnitude lower than 16S rRNA abundance. Overall, our results demonstrate that Electronic supplementary material The online version of this article (doi:10.1007/s13213-014-0813-3) contains supplementary material, the diversity and abundance of the nirS gene-containing bac- which is available to authorized users. terial community are rather low, as might be expected under A. Bourbonnais : S. K. Juniper the extreme conditions encountered in the subsurface bio- School of Earth and Ocean Sciences, University of Victoria, Victoria, sphere of hydrothermal vent systems, and do not correlate BC V8P 5C2, Canada clearly with any environmental variables investigated (i.e., − + pH, temperature, and H2S, NO3 ,NH4 concentrations). D. A. Butterfield Joint Institute for the Study of the Atmosphere and Ocean, University of Washington, Seattle, WA 98105-5672, USA Keywords nirS genes . 16S rRNA genes . Denitrifying bacteria . Diffuse hydrothermal vent fluids . Juan de Fuca D. A. Butterfield Pacific Marine Environmental Laboratory, National Oceanic and Ridge Atmospheric Administration, Seattle, WA 98115, USA

R. E. Anderson School of Oceanography and Astrobiology, University of Introduction Washington, Seattle, WA 98195-7940, USA Nitrogen (N) is an essential macronutrient for all organisms, M. F. Lehmann and its availability often limits primary productivity in marine Department of Environmental Sciences, University of Basel, 4056 Basel, Switzerland environments (Mulholland and Lomas 2008). At seafloor hydrothermal vents and beneath the seafloor in the subsurface Present Address: biosphere, denitrification, which results in the loss of bioavail- * A. Bourbonnais ( ) able N [e.g., nitrate (NO −)], has the potential to affect at least School for Marine Science and Technology (SMAST), University of 3 Massachusetts Dartmouth, New Bedford, MA 02744-1221, USA local (chemosynthetic) primary productivity. For example, e-mail: [email protected] Lee and Childress (1994) showed that S-oxidizing bacteria 1692 Ann Microbiol (2014) 64:1691–1705 living in symbiosis with the HV tubeworm Riftia pachyptila Knowledge of the diversity and abundance of denitrifiers in the − exclusively assimilate NO3 , even in the presence of ammo- subsurface biosphere of hydrothermal vents is needed to better + nium (NH4 ). In these settings, bioavailable N is supplied understand nutrient cycling and mass balance in these systems. − + mainly by NO3 -rich seawater that is entrained and reduced Previous studies have reported large differences in NH4 con- + to NH4 during hydrothermal circulation and possibly by centrations in hydrothermal fields on the JFR, including fluids autochthonous N2 fixation (e.g., Mehta and Baross 2006). from diffuse flow vents at Axial Volcano and the Endeavour The process of denitrification involves the stepwise reduc- Segment (Lilley et al. 1993; Bourbonnais et al. 2012b). The − + tion of NO3 through a series of intermediates including nitrite higher NH4 concentrations commonly found in Endeavour − (NO2 ), nitric oxide (NO), and nitrous oxide (N2O), ultimately Segment vent fluids have the potential to influence the + resulting in dinitrogen (N2) production. Nitrite conversion to activity and diversity of denitrifying bacteria, with NH4 − gaseous N oxides (NOx) and N2 results in N loss, and in the being a potential source of NO3 for denitrifiers through case of N2O, greenhouse gas production. Two structurally nitrification at the oxic end of the redox gradient in different, but functionally equivalent enzymes can catalyze subseafloor mixing zones. − NO2 reduction: the homotrimeric copper-containing enzyme Here we use 16S rRNA and nirS genes to investigate encoded by the nirK gene, and the homodimeric cytochrome the diversity of potential denitrifying bacteria in relation − − − cd1-NO2 reductase encoded by nirS. The NO2 reductase to environmental variables (temperature, pH, H2S, NO3 + gene has been used widely as a functional marker to investi- and NH4 concentrations) in diffuse-flow fluids at dif- gate the diversity and abundance of denitrifying bacteria in ferent hydrothermal vent sites at Axial Volcano and the terrestrial (e.g., Henry et al. 2004;Chonetal.2009), estuarine Endeavour Segment on the JFR. We also expand on and marine environments (e.g., Braker et al. 2000, 2001; sequencing results using quantitative polymerase chain Nogales et al. 2002; Liu et al. 2003; Jayakumar et al. 2004, reaction (qPCR) to quantify 16S rRNA and nirS gene 2009; Castro-González et al. 2005; Santoro et al. 2006;Falk abundances at 15 different vent sites at Axial Volcano et al. 2007; Oakley et al. 2007; Smith et al. 2007). Most and the Endeavour Segment. studies have used the nirS gene because of reported difficulties with existing nirK primers, especially for marine samples (e.g., Braker et al. 2000; Jayakumar et al. 2004). Materials and methods Evidence for denitrification has been reported for both seafloor and subseafloor hydrothermal habitats. Previous Site description and water sampling studies, using GeoChip and metagenomic approaches to investigate microbial communities inhabiting hydrothermal Fluid samples were collected for geochemical and microbio- vent chimneys on the Juan de Fuca Ridge (JFR), detected logical analysis at hydrothermal vents of the Endeavour functional gene repertoires mediating the denitrification pro- Segment (∼48°N, 129°W, ∼2,200 m depth) and Axial − − cess, including NO3 reductase (nar), NO2 reductase (nir), Volcano (∼46°N, 130°W, ∼1,500 m depth) on the JFR, NO reductase (nor)andN2Oreductase(nos) (Wang et al. North-East Pacific Ocean. The samples were collected during 2009; Xie et al. 2010). More recently, Bourbonnais et al. two research cruises, in August 2007 and June 2009, onboard − (2012a, b) reported reduced NO3 concentrations (vs back- the R/V Thompson and the R/VAtlantis, respectively, as part ground seawater) in combination with enrichment of heavy 15 of the New Millenium Observatory (NEMO) and Endeavour- − 18 − N-NO3 and O-NO3 isotopes in low temperature (low-T) Axial Geochemistry and Ecology Research (EAGER) diffuse flow fluids on the JFR, observations that are consistent Projects (Fig. 1). The caldera of Axial Volcano rises 1,100 m − with isotope fractionation during active NO3 reduction. above the surrounding ocean floor, and has been the site of Potential denitrification rates up to 1,000 nmol L−1 day−1, two recent seafloor volcanic eruptions, in 1998 and 2011 measured in diffuse vent fluids at different sites on the JFR, (Chadwick et al. 2012). were always several fold higher than anammox The remotely operated vehicle (ROV) JASON and the (<5 nmol L−1 day−1) rates, indicating that, at least for deep submergence vehicle (DSV) Alvin were used to − JFR vents, denitrification is the dominant NO3 consuming collect all fluid samples. Samples for chemical analysis process within the subsurface biosphere, with unconstrained were collected with titanium gas-tight samplers, non-gas- feedback on chemosynthetic primary production. tight titanium syringe (“Major”) samplers, collapsible Multitrophic interactions and food web structure in hydro- Tedlar plastic bags with valves, or PVC piston samplers thermal vent ecosystems are typically sustained by with Teflon spring seals on the hydrothermal fluid and chemolithoautotrophic bacteria harnessing metabolic energy particle sampler (HFPS). Vent fluid sub-samples were from the oxidation of reduced sulfur species and molecular transferred from the collapsible bags using a syringe into − hydrogen, using dissolved O2 and NO3 as primary electron acid-washed and deionized-water-rinsed, 60-mL high- acceptors (e.g., Jannasch and Mottl 1985; Schrenk et al. 2010). density polyethylene (HDPE) brown bottles for nutrient Ann Microbiol (2014) 64:1691–1705 1693

130 + 126 122 W and NH4 concentrations were analyzed using colorimetric methods [methylene blue (Cline 1969) and indophenol blue 52 N (Solorzano 1969)], with respective standard deviations of 4 % − − and 7 %. The sum of NO3 plus NO2 was measured by reduction to NO in a heated solution of acidic vanadium (III) CANADA and subsequent detection of the NO (Braman and Hendrix 1989), with a precision for replicate analyses of ± 0.2 μmol/L. − − Vancouver NO ,NO ,andNH + were also analyzed onshore from frozen Explorer Island 3 2 4 Ridge samples stored at −20 °C using a colorimetric nutrient analyzer, − with a precision of ± 0.2 μmol/L. Dissolved NOx (NO3 and − NO2 ) concentrations measured colorimetrically and by chemi- 48 luminescence were generally in good agreement. One to five Endeavour Seattle Juan de Segment hydrothermal fluid sub-samples were collected at each site, Fuca ridge during each dive, and only averages for all sub-samples are WASHINGTON reported.

Axial Volcano DNA extraction Portland DNA was extracted from Sterivex filters following the proto- OREGON col described in Huber et al. (2002) with some modifications, 44 as described in Bourbonnais et al. (2012b). Extracted DNA was resuspended in 95 μL Tris-EDTA (TE) buffer (10 mM Fig. 1 Map of sampled vent fields: Axial Volcano and the Endeavour Tris, 1 mM EDTA, pH 8.0) and stored at −80 °C. The DNA in Segment on the Juan de Fuca Ridge (JFR). See Tables 1 and 3 for exact the Steripaks collected at Hulk in 2009 was extracted at the sampling site locations University of Washington using an adapted protocol similar to that described in Huber et al. (2002) and Bourbonnais et al. (2012b), but using about ten times more reagent for each Steripak filter and eliminating the centrifugation and residual concentrations. All fluid samples were purged with N2 gas supernatant collection steps before and after adding the DNA for at least 10 min in order to remove H2S, which interferes with the colorimetric nutrient analysis. Water extraction buffer (DEB) and sodium dodecyl sulfate (SDS) samples were kept frozen at −20 °C until analysis. and Proteinase K. Filters were incubated at 65 °C for 10 min, For DNA samples, ∼3 L low-temperature hydrothermal the liquid was drawn off and added to a collection tube, and fluid were pumped through the titanium and Teflon fluid mixed with a solution of phenol:chloroform:isoamyl alcohol manifold of the HFPS and filtered onto Millipore Sterivex- (25:24:1). The latter was centrifuged at 3,000 rpm at room filters for subsequent DNA extraction and microbial anal- temperature. This step was repeated with the supernatant in a ysis. During the 2009 cruise, a barrel sampler mounted on 1:1 mixture of chloroform: isoamyl alcohol. DNA was finally μ a large elevator was used to collect a ∼170 L sample of re-suspended in 400 LTEbuffer. diffuse fluids at one site (Hulk1), which was then filtered through four Steripaks (∼40–50 L each) as described in PCR amplification and cloning Anderson et al. (2011). The temperature of this barrel sample was not measured during collection, but the fluid 16S rRNA gene fragments chemistry (dissolved silica and Mg2+ content) indicated that the average temperature was near 125 °C. After each 16S rRNA gene clone libraries were constructed to comple- dive, the Sterivex and Steripak filters were stored at ment the nirS gene clone libraries from Hulk (Endeavour −80 °C until analysis. Segment) and Shepherd (CASM field, Axial Volcano) vents, as well as for other samples used to quantify nirS abundance, where DNAwas available [i.e., collected at the following vent Measurements of physical and chemical properties sites: Bag City, T&S and Forum (Axial Volcano, 2007 samples) and Phang (Endeavour Segment, 2009 samples)]. The

Fluid samples were analyzed onboard for pH, [H2S] and Hulk2 diffuse fluid sample was collected at the same location + [NH4 ], typically within 8 h of arriving on deck and within 24 h during the same dive as the Barrel sampler deployment of seafloor sampling. pH was analyzed potentiometrically with a (Hulk1 sample; see Anderson et al. 2012). DNA samples standard deviation of 0.01 pH units for replicate analyses. H2S (4–12 ng) were PCR-amplified using Takara Ex Taq premix 1694 Ann Microbiol (2014) 64:1691–1705

(Fisher, http://www.fishersci.com). All PCR reactions were into a pCR®II-Blunt-TOPO® vector (Invitrogen) and trans- performed in a solution containing 25 μLPremixTaq,1μM formed into One Shot® Electrocomp™ Escherichia coli cells of each primer and sterile MilliQ H2O added to a final volume following the manufacturer’s instructions. The following elec- of 50 μL. PCR amplifications were performed targeting the troporation conditions were used: voltage: 2,250 V, capaci- V1–V3 region of the 16S rRNA gene, using an universal tance: 25 μF, resistance: 200 Ω and the length and width of reverse primer (519R: 5′-CAGGWATTACCGCGG the space filled with cells inside the electroporation cuvette was CKGCTG) (Turner et al. 1999) together with a B primer 2 mm. White colonies were picked randomly and trans- (Roche: CCTATCCCCTGTGTGCCTTGGCAGTCT) in ferred to 96-well culture plates (two plates for each sample) combination with unique tagged universal forward primer with LB+10 % glycerol medium + kanamycin. One plate (F63-targeted: 5′-XXXXXXXXXXCAGGCCTAACACAT from each cloning was then sent to the Michael Smith GCAAGTC (Marchesi et al. 1998), where X represents dif- Genome Sciences Centre in Vancouver (BC, Canada), ferent tags (64 in total)) combined with an A primer (Roche: where the amplified inserts were sequenced bidirectionally CCATCTCATCCCTGCGTGTCTCCGACTCAG). PCR with M13F and M13R primers. conditions were as follows: after a denaturing step of 30 s at 98 °C, samples were processed through 30 cycles of 10 s at Richness, diversity and phylogenetic analysis 98 °C, 30 s at 55 °C and 30 s at 72 °C. The final extension step was performed at 72 °C for 4 min 30 s. Following amplifica- MOTHUR 1.23.0 (Schloss 2009) was used to process all 16S tion, samples were purified using AMPure Beads (Beckman rRNA gene pyrosequences (7806, 8955, 3329, 7721, 9033, Coulter Genomics, https://www.beckmancoulter.com), and 7817 sequences in total for Bag City, Forum, Shepherd, quantified by Nanodrop and sent to the Plateforme T&S, Hulk2 and Phang, respectively). All pyrosequences (on d’Analyses Biomoléculaires (Institut de Biologie Intégrative average ∼450 bp) were pre-processed (i.e., primers were re- et des Systèmes, Université Laval, Quebec, Canada) for moved and sequences containing ambiguous bases, shorter pyrosequencing using a 454 GS-FLX DNA Sequencer with than 350 bp and of low quality were removed) and aligned Titanium Chemistry (Roche, Basel, Switzerland) and the pro- using the SILVA alignment (available on the MOTHUR cedure described by the manufacturer. website: http://www.mothur.org/wiki/Silva_reference_ alignment), and pre-clustered to remove sequences resulting nirS gene fragments from pyrosequencing errors (Huse et al. 2010). UChime was used to remove potentially chimeric sequences (Edgar et al. Fragments of the nirS gene were amplified using the primer 2011). After these steps, 22,585 sequences remained, i.e., pairs nirS1F (5′-CCTAYTGGCCGCCRCART-3′) and nirS6R 4498, 5188, 2275, 4332, 4991, and 4301 sequences, for Bag (5′-CGTTGAACTTRCCGGT-3′) (amplicon size: 890 bp) City, Forum, Shepherd, T&S, Hulk2 and Phang, respectively first described by Braker et al. (1998), and used in several (Fig. 2a). These pyrosequences were then separated into subsequent studies (Braker et al. 2000; Priemé et al. 2002; OTUs using the furthest neighbour clustering method and a Jayakumar et al. 2004, 2009; Castro-Gonzáles et al. 2005; taxonomy was assigned to each OTU using the MOTHUR- Falk et al. 2007;Oakleyetal.2007). formatted version of the RDP training set available on the The nirS gene fragments were amplified using a 25 μL MOTHUR website (http://www.mothur.org/w/images/4/49/ PCR mixture containing 1 μLtemplateDNA,0.625μLeach RDPTrainingSet.zip). of 10 μM forward and reverse primers, 2 μL10μM All nirS sequences were edited manually using Sequencher deoxynucleotides, 5 μL 5X Herculase II buffer with MgCl v.4.7 (Gene Codes Corporation, Ann Arbor, MI). The open (Stratagene, La Jolla, CA), and 1 U Herculase II fusion DNA source Bellerophon application (http://comp-bio.anu.edu.au/ polymerase (Stratagene) under the following PCR conditions: bellerophon/bellerophon.pl)(Huberetal.2004)andPinTail 3 min at 94 °C, followed by 40 cycles of 94 °C for 40 s, 56 °C (Ashelford et al. 2006) were used to detect chimeric sequences. for 40 s, 72 °C for 1 min and a final extension of 10 min at Chimeras were excluded from further analysis. Nucleotide se- 72 °C. Amplicons were visualized by UVexcitation on a ∼1% quences were aligned using the ClustalW Application agarose gel stained with ethidium bromide prepared using (Thompson et al. 1994) in BioEdit (version 7.0.5.3) and checked 0.5× TAE. DNA fragments from eight independent PCR manually. Closest related sequences were identified for each reactions were excised from agarose gels with a scalpel and OTU using the BLAST tool available on the National Center purified using a QIAquick Spin gel purification kit (Qiagen, for Biotechnology Information (NCBI) website. nirS nucleotide Valencia, CA). After purification, the DNA present in each sequences were then converted to amino acid sequences. tube was eluted with 50 μL water (pH 7.0–8.5). Tube contents Rarefaction curves were calculated using MOTHUR, se- were combined, and concentrated using a SpeedVac until the quences with <97 % similarity being treated as distinct oper- DNA concentration read on a Nanodrop was ∼150 ng/μLfor ational taxonomic units (OTUs). The coverage for each nirS (final volume: 4–5 μL). 200–450 ng DNA was ligated clone library was calculated as in Ravenschlag et al. (1999). Ann Microbiol (2014) 64:1691–1705 1695

α-diversity calculators [community richness (ACE, and Nucleotide sequence accession numbers Chao1 estimators) and diversity (Shannon (H) and inverse Simpson’s indexes)] were calculated for each of the SSU 16S rRNA gene V1–V3 pyrotag sequences were deposited rRNA and nirS genes clone library. Observed richness in the National Center for Biotechnology Information corresponded to the number of OTUs detected. OTUs even- Sequence Read Archive (SRA) under the accession num- ness was calculated as in Mulder (2004). ber SRA051604. nirS sequences were deposited with β-Diversity calculators (two samples) were also deter- GenBank under sequence accession numbers JX459951– mined to compare community richness (shared ACE and JX459971. Chao1 estimators), membership (i.e., qualitative indices: Jaccard and Sorensen similarity coefficients based on the Quantification of bacteria and nirS by qPCR observed and Chao1 estimated richness) and structure [i.e., quantitative indices: abundance-based Jaccard and Sorensen Total bacterial gene copy numbers were determined by qPCR (Chao 2005), Smith theta (Smith et al. 1996)andYueand using an Opticon® 2 DNA Engine Real-Time PCR detection Clayton theta (Yue and Clayton 2005) similarity coeffi- system (Bio-Rad, Hercules, CA) according to the protocol cients] (see Table S1, Supplementary materials, for more described in Zaikova et al. (2010). The following primers detail). An analysis of similarities (ANOSIM) imple- were used: 27 F, 5′-AGA GTT TGA TCC TGG CTC AG-3′ mented in MOTHUR was used to test for significant coupled to a universal reverse primer: DW519R, 5′-GNT TTA differences in 16S rRNA bacterial communities between CCG CGG CKG CTG-3′. vent fields (i.e., Axial Volcano and Endeavour Segment). Fast Our qPCR protocol to measure the abundance of the − UniFrac (http://bmf2.colorado.edu/fastunifrac/) was used to denitrifying gene coding for NO2 reductase (nirS)was test for significant differences in 16S rRNA gene and nirS- adaptedfromthatofChonetal.(2009). The following encoding bacterial community membership and structure primer pair, from Braker et al. (1998) was used: nirS2F between sampled vents [using both the P test (Martin et al. (5′-TAC CAC CCS GAR CCG CGC GT-3′) and nirS3R 2002) and the UniFrac distance metric (Lozupone and Knight (5′-GCC GCC GTC RTG VAG GAA-3′). Each 20 μL 2005)]. amplification reaction contained 10 μLSsoFastTM A nearest-neighbor interchanges maximum likelihood tree EvaGreen® Supermix, 1 μL each 500 nM forward and (GTR+CAT model) was constructed with FastTree 2 (Price reverse primers, 6 μL DNAse-free water and 2 μL et al. 2010) using all 16S rRNA gene V1–V3 pyrotag se- template DNA. Reactions were run on a Bio-Rad quences, for subsequent analysis in Fast UniFrac (Hamady CFX96 system under the following conditions: initial et al. 2009). A nirS gene maximum likelihood tree was in- enzyme activation at 98 °C for 2 min, followed by 45 ferred by PhyML (version 3.0 for Window) (Guindon et al. cycles of denaturation at 98 °C for 1 s, annealing/ 2010) using a LG model of amino acids substitution with elongation at 67 °C for 5 s and a plate read. A melting 1,000 bootstrap replicates. curve from 67 °C to 98 °C, held at each 0.5 °C

Fig. 2 Rarefaction curves showing a 16S rRNA and b nirS gene oper- representing 95 % confidence intervals are indicated. The number of ational taxonomic unit (OTU) richness in DNA extracted from hydro- 16S rRNA pyrosequences represents the number of sequences obtained thermal fluids at the Endeavour Segment and Axial Volcano on the JFR. after final processing (i.e., screening, sorting, pre-clustering and chimera OTUs are defined at the ≥97 % sequence identity level. Errors bars removal, see text for more detail). Sample names as in Table 2 1696 Ann Microbiol (2014) 64:1691–1705 increment for 5 s was then performed to check the Results and discussion specificity of the reaction. The amplicon length was additionally verified by agarose gel electrophoresis. Physico-chemical properties qPCR data were analyzed with the Bio-Rad CFX Manager Software version 1.6. Measured physico-chemical properties for the studied sites, − + For all qPCR assays, calibration curves were con- i.e., pH, temperature, and H2S, NO3 ,andNH4 concentra- structed using a series of six 10-fold dilutions of stan- tions are presented in Table 1 for all samples used for diversity dard solutions. The calibration standards used for analysis. [H2S] was lowest in the lower-T fluids as a result of Bacteria qPCR were the same as in Zaikova et al. hot fluid mixing with H2S-free seawater below the seafloor (2009). The standard concentration, determined from (Jannash and Mottl 1985). Sulfide oxidation can also occur as PicoGreen assays using the Quant-iT PicoGreen® a result of this mixing process, and sulfate reduction by free- dsDNA kit (Invitrogen), was 2.8×1010 copies/μLfor living bacteria, or bacteria attached to conduit walls may occur bacteria. The standard used for nirS quantification was pre- at temperatures below 120 °C (see, e.g., McCollom and Shock − pared from the clone ES09-H-70 (which was identical to clone 1997; Huber et al. 2003). Low NO3 concentrations in diffuse ES09-H-1 represented in Fig. 4)inournirS gene clone library vent fluids (as low as ∼7 μmol/L at Hulk1), compared to − from Endeavour Segment. Approximately 1 μL of the glyc- ∼40 μmol/L in background seawater, indicate NO3 con- erol culture stock was inoculated into 2 mL LB medium and sumption during hydrothermal circulation at the low-T end + incubated at 37 °C for 12–16 h on a shaker. Resulting cells (Butterfield et al. 2004; Bourbonnais et al. (2012a)). NH4 were harvested by centrifugation using a conventional concentrations were significantly lower at Axial Volcano microcentrifuge at room temperature. A Qiagen® Plasmid (≤5 μmol/L) compared to Endeavour Segment (up to + Mini Kit was used to extract and purify the plasmid DNA 190 μmol/L at Hulk1). Based on NH4 concentrations and according to the manufacturer’s instructions. Residual E. coli N isotope results, Butterfield et al. (2004) and Bourbonnais + genomic DNA was removed using a plasmid-safe DNase™ et al. (2012a) attributed elevated [NH4 ] [with respect to the + treatment (Epicenter® Biotechnologies, http://www.epibio. NH4 mixing line) to biological processes (i.e., organic matter − + com/) followed by a phenol/chloroform/isoamyl alcohol treat- remineralization and dissimilatory NO3 reduction to NH4 ment as described in Zaikova et al. (2009). The plasmid DNA (DNRA)] in the sub-seafloor mixing zone at Axial Volcano. + was sequenced bidirectionally using M13 primers and proved [NH4 ] in lower-T fluids at Endeavour Segment, on the other to be identical to the nirS clone ES09-H-70 sequence obtained hand, did not significantly deviate from the mixing line be- + earlier from the glycerol stock. The final DNA concentration tween high-T fluids (>350 °C) (i.e., [NH4 ]upto∼400 μmol/ of the plasmid, quantified by a PicoGreen assay, was 8.5×108 L at the Main Endeavour Field) and seawater (Bourbonnais copies/μL. et al. 2012a). All samples were analyzed in triplicate and different dilutions were used to test for the presence of any PCR- Composition of 16S rRNA gene clone libraries and difference inhibiting compounds. The detection limit for all qPCR among vent fields assays, set above the Ct values of the less concentrated standard and the no-template controls (<40 cycles or un- α-Diversity (single sample analyses) and β-diversity (multi- detected), was generally less than ∼50 copies/mL for total ple sample analyses) calculators are summarized in Tables 2 bacteria and ∼10 copies/mL for nirS genes qPCR assays and S1 (Supplementary materials), respectively. High cover- for all triplicate samples. The r2 values of the calibration age (> ∼ 91 %) was achieved for all samples pyrosequenced in curves were generally >0.99. The amplification efficiency this study. Rarefaction analysis of 16S rRNA gene V1–V3 for each run was estimated from the slope of the standard pyrotag data revealed high bacterial diversity at the 3 % curve according to the equation: E = (10−1/slope) and was difference level (Fig. 2). Each sample contained an elevated always above 95 %. Melting-curve analyses were per- number of operational taxonomic units (OTUs), with up to formed to check the specificity of the reactions for all five-fold differences between sites (from 190 at Shepherd to standards and samples and amplification products were up to 1,070 at Bag City), and unique OTUs (abundance =1) selected and visualized on a ∼1 % agarose gel stained (from 22 % (Shepherd) to 39 % (Bag City) of the total OTUs). with ethidium bromide prepared using 0.5× TBE. Few OTUs were shared between the different vent fluid Mann-Whitney tests for non-parametric data were samples. A maximum of 143 shared OTUs was observed at used to compare nirS abundances between sampling the sites Forum and T&S, which represented 70 % of the years at Axial Volcano and between vent fields for the sequences in these two samples (Table S1, Supplementary 2009 samples. Spearman’s rank correlations were used materials). Only one OTU, a α-proteobacteria classified in to relate environmental variables to qPCR nirS gene the Methylonatrum genus, representing 0.14 % of the total abundances. sequences, was shared among all six samples. Shannon Ann Microbiol (2014) 64:1691–1705 1697

Table 1 Physico-chemical properties of hydrothermal vent fluids at two vent sites where nirS genes were cloned and sequenced are in bold. Axial Volcano (AV) and Endeavour Segment (ES) on the Juan de Fuca Standard deviation for 2 to 5 samples collected during the same dive at the Ridge (JFR) used for 16S rRNA and nirS genes diversity analysis. The same vent location is indicated

− − + Field Year Vent Sample Latitude Longitude Depth Temperature pH [H2S] (μmol/L) [NO3 +NO2 ] [NH4 ] name (°N) (°W) (m) (°C) (μmol/L) (μmol/L)

AV 2007 Bag City AV07BC 45.92 129.99 1,533 13.7±0.9 6.5±0.1 39.3±19.3 8.6±2.7 1.9±0.7 AV 2007 Forum AV07F 45.95 129.98 1,524 6.2±0.3 6.4±0.2 39.6±7.7 29.7±4.5 0.6±0.1 AVa 2007 Shepherd AV07S 45.99 130.03 1,582 24.4±3.8 6.0±0.1 121.4±37.1 13.9±5.8 2.7±0.5 AV 2007 T&S AV07TS 45.99 130.03 1,580 73.0 5.7 389.1 30.9 4.3 ESa 2009 Hulk1 ES09H1 47.95 129.10 2,198 13–125a 5.7 645 7.2 190.0 ES 2009 Hulk2 ES09H2 47.95 129.10 2,198 29.5±10.6 6.3±0.3 212.5±132.7 27.8 38.0±20.5 ES 2009 Phang ES09P 47.92 129.11 2,277 24.1±1.7 6.5±0.3 255.6±133.6 30.4±4.1 42.7±20.8 a The two vent sites where nirS genes were cloned and sequenced b Lower limit inferred from temperature probe readings at the same vent site and upper limit calculated from [Si4+ ] (see Anderson et al. 2011) diversity indices varied from 4.4 at Shepherd to 6.3 at Bag et al. 2004;Nakagawaetal.2005a; Huber et al. 2007, 2010) City. Similarly high bacterial diversity, with high numbers of approaches have generally revealed ε-proteobacteria to be the rare OTUs, has been documented previously in hydrothermal dominant class in diverse hydrothermal vent habitats. The vent systems using a pyrosequencing approach (e.g., Huber most important ε-proteobacteria genera detected at the differ- et al. 2007, 2010). ent sites were Sulfurovum (up to 43 % at Phang), Sulfurimonas The bacterial communities in the sampled vent fluids were (up to 26 % at Forum), Arcobacter (up to 16 % at Bag City), dominated primarily by ε-proteobacteria (up to 72 % of the Hydrogenimonas (up to 13 % at Phang), Thioreductor (up to bacterial diversity at Hulk2) and γ-proteobacteria (up to 47 % 10 % at Hulk), and Nitratifractor (up to 7 % at Phang) (Fig. 3). at Shepherd). α-proteobacteria represented ∼20 % of the total Culture experiments have demonstrated that several bacterial community at Shepherd and Hulk1 (see Anderson chemolithoautotrophic species (some being mesophilic or et al. 2012), but their abundance was typically lower than 4 % thermophilic) within all the above-mentioned genera isolated − at all other sites. β-andδ-proteobacteria generally constituted from hydrothermal vent environments are capable of NO3 only minor fractions of the total bacterial community. The reduction, mainly coupled to sulfide and/or hydrogen oxida- Bacteroidetes represented another important phylum at some tion. These genera include Sulfurovum lithotrophicum sites, accounting for up to ∼10 % of the total bacteria at (Inagaki et al. 2004), Sulfurimonas autotrophica (Inagaki Shepherd (Fig. 3). et al. 2003), Sulfurimonas paralvinellae (Takai et al. 2006), Previous studies using culture-dependent (Nakagawa et al. Thioreductor micantisoli (Nagakawa et al. 2005b) 2005a) and culture-independent (Lopez-Garcia 2003;Alain Nitratiruptor tergarcus and Nitratiruptor salsuginis

Table 2 Biodiversity and predicted richness of 16S rRNA and nirS gene sequences from hydrothermal vent fluids of the JFR. See Table 1 for sample names

a a a b c d Gene Sample name Coverage (%) Sobs SACE SChao1 H′ 1/D E

16S rRNA AV07BC 90.8 1,070 1,514 1,468 6.28 244.6 0.90 AV07F 96.4 527 729 718 4.66 34.3 0.74 AV07S 94.2 190 213 215 4.44 53.2 0.85 AV07TS 94.0 757 1,013 973 5.68 110.7 0.86 ES09H2 93.8 845 1,155 1,180 5.59 79.3 0.83 ES09P 95.6 566 739 815 5.22 63.0 0.82 nirS AV07S 96.7 9 11.3 9.8 1.20 2.39 0.55 ES09H1f 92.1 12 60.3 22.5 1.42 2.64 0.57 a Number of different OTUs observed (Sobs) or statistical predictions using the ACE (SACE) or Chao1 (SChao1) richness estimators b Shannon index, higher number represents more OTUs diversity c Reciprocal of Simpson’s index, higher number represents more OTUs diversity d Evenness, varying from 0 to 1. Higher number represents a more evenly distributed community 1698 Ann Microbiol (2014) 64:1691–1705

(Nagakawa et al. 2005c) in hydrothermal sediments, a poly- Phang and T&S and Hulk2 (95 % significance level, chaete nest and vent chimney structures of the Okinawa see Table S2, Supplementary materials). As discussed in Trough (Japan), as well as Arcobacter sulfidicus (Heylen Section “Physico-chemical properties”, physico-chemical et al. 2006; Sievert et al. 2007), and Hydrogenimonas properties at the sampling sites at the Axial Volcano and the thermophila identified in a black smoker in a Central Indian Endeavour Segment vent fields differed significantly, espe- + Ridge hydrothermal field (Takai et al. 2004). cially in terms of their NH4 concentrations (see Table 1). γ-Proteobacteria represented the dominant class at However, overall, no clear relationship between 16S rRNA Shepherd (Fig. 3). The dominant γ-proteobacteria genera gene community membership and structure, and specific en- observed were Halomonas (up to 11 % at Shepherd), vironmental factors could be identified, even when normaliz- Neptunomonas (upto9%atForum)andPseudomonas ing chemistry data to [Si4+] to account for varying degrees of (∼5 % at Shepherd). Sanger sequencing of the 16S rRNA subseafloor dilution by seawater. Our results are in agreement genes also identified γ-proteobacteria as the main class at with the study by Huber et al. (2010), who also did not Hulk1 (∼40 % of the total microbial community, see observe any link between the diversity of ε-proteobacteria Anderson et al. 2012), with Pseudomonas (11 %), and geochemical parameters in hydrothermal vent fluids of Pseudoalteromonas (10 %) and Alteromonas (8 %) being the the Mariana Arc seamounts. dominant genera. Culture experiments have shown that some More recently, a study by Huber et al. (2010) found signif- species (mostly heterotrophic) from these genera isolated icant large and local-scale geographic differences in ε- from, or near, hydrothermal vent environments were capable proteobacteria communities in diffuse vent fluids between − of NO3 reduction (and often complete denitrification); for hydrothermal seamounts and individual vents of the Mariana example, Halomonas neptunia, Halomonas suldidaeris, Arc, suggesting a link between geographic isolation, rather Halomonas axialensis,andHalomonas hydrothermalis isolat- than geochemical factors, and microbial community member- ed from North and South Pacific hydrothermal vent fields ship at this location. Therefore, despite the two fields being in (Kaye et al. 2004), and Pseudomonas stutzeri (strain MT-1) the same subseafloor microbial province, i.e., the Juan de Fuca from mud of the Mariana Trench at 11,000 m depth (Tamegai mid-ocean ridge (see Schrenk et al. 2010), it is reasonable to et al. 1997). expect differences in bacterial communities between the two Various non-abundance and abundance-based β-diversity vent fields. However, an unweighted pair group method with calculators suggest differences in both bacterial community arithmatic mean (UPGMA) tree describing the dissimilarity membership and structure among individual vent sites between samples (based on the Yue and Clayton theta values (Table S1, Supplementary materials). The UniFrac distance [Fig. S1, Supplementary materials) and principal coordinates metric and a P-test confirmed that all of the 16S rRNA gene analysis (PCoA) (Fig. S2, Supplementary materials)] showed bacterial communities in the sampled vent fluids were signif- that vent fluid bacterial communities were not clearly clus- icantly different (P-value≤0.001) from each other in terms of tered according to their vent fields provenance. Analysis of membership (non-abundance weighted), except at Forum and similarities (one-way ANOSIM test) using the distance matrix T&S, and most sites were different in terms of structure generated with the Yue and Clayton measure detected no (abundance-weighted), except for the communities found significant groupings between vent fields at a 95 % confidence at Forum and Bag City, Forum and T&S, Hulk2 and level (r-value=0.57, P-value=0.07, 1000 permutations).

Fig. 3 Relative abundance of all Axial Volcano Endeavour Segment taxa ≥2 % (for at least one sample) in hydrothermal vent 100 Actinobacteria fluids of the JFR. The genus is Bacteroidetes indicated in brackets for members 80 Cyanobacteria of the proteobacteria. All Proteobacteria sequences are pyrosequences α – 60 from the hypervariable V1 V3 β region of the 16S rRNA gene (see δ text for more detail). Sample 40 ε names as in Table 1 γ 20 Others

% of 16S rDNA sequences rDNA 16S of % 0

ES09P

AV07S

AV07F

ES09H2 AV07TS AV07BC Ann Microbiol (2014) 64:1691–1705 1699

Composition of nirS gene clone libraries and comparison The majority of nirS OTUs could be related to cultured γ- to other marine environments proteobacteria (clusters IIb, IVa and IVb), which is not sur- prising considering that γ-proteobacteria represented the PCR-products that were ∼890 bp long were obtained with dominant class at both sites (see “Composition of 16S rRNA nirS1F-nirS6R primers from DNA extracted from one diffuse genes clone libraries and difference among vent fields”). fluid sample at each vent field, i.e., Shepherd (Axial Volcano) Furthermore, a larger portion of both the 16S rRNA (see and Hulk1 (Endeavour Segment). We tried to amplify nirS in Anderson et al. 2012)andnirS gene sequences was closely other DNA samples from nearby vent sites without associated with the genus Pseudomonas (cluster IVb) at success, probably because of the lower DNA concentra- Hulk1 compared to Shepherd (Figs. 3, 4,S3, Supplementary tions (and absolute nirS abundances) in these samples materials). Bacteria of the genus Pseudomonas are metaboli- (see Section “q-PCR nirS gene abundances in relation to cally versatile, with some strains capable of sulfide-dependent environmental factors”,Table3). chemolithotrophic denitrification (e.g., Chen et al. 2013). In

nirS gene coverage was high for both samples, i.e., 97 % at O2-depleted diffuse vent fluids, chemolithotrophic denitrifica- Shepherd and 92 % at Hulk1, for a total of 91 and 89 tion is expected to be an important process given the high sequences, respectively (Table 2,Fig.2b). Diversity of this concentration of reduced sulfur species. gene was relatively low at both sites, with Shannon indices of The rest of the nirS sequences clustered with cultured α- ≤1.4. Only 9 and 12 OTUs were observed at Shepherd and and β-proteobacteria, representing 3 % and 35 % of the Hulk1, respectively, for a total of 20 distinct OTUs at the 3 % sequences at Shepherd and 10 % and 2 % of the sequences nucleic acid difference level (Table 2). The low nirS diversity at Hulk1, respectively (Figs. 4,S3). α-andβ-proteobacteria suggests that non-denitrifying bacteria could account for the were detected in our 16S rRNA gene sequences at both sites bulk of the 16S rRNA diversity in our samples. The same nirS (see “Composition of 16S rRNA genes clone libraries and gene sequences could also be shared by bacteria that clustered difference among vent fields”, Fig. 3). apart based on their 16S rRNA gene phylogeny. nirS gene Few studies have sequenced nirS genes in hydrothermal diversity for water column samples from the oxygen mini- vent environments. nirS sequences in this study shared≤45 % mum zones of the Black Sea (Oakley et al. 2007) and Arabian identity with a sequence from a γ-proteobacteria endosymbi- Sea (Jayakumar et al. 2009) has been reported to decrease as ont of the deep-sea tubeworm Tevnia jerichonana (vent Tica, − NO3 is consumed during denitrification. The substantial 9°N, East Pacific Rise) (acc: NZ_AFZB01000041) (out- − NO3 depletion relative to background seawater observed at group, Fig. 4). Furthermore, a metagenomic study by Xie both sites (∼70 % at Shepherd and ∼80 % at Hulk1, see et al. (2010) showed that the majority of the genes involved Table 1) could analogously represent a similarly advanced in denitrification in a black smoker chimney in the Mothra stage of denitrification and potentially explain the low nirS hydrothermal vent field at the JFR were related most closely to diversity. β and α- proteobacteria, rather than γ-proteobacteria. This In the phylogenetic tree shown in Fig. 4, our nirS se- contrasts with our results presented here, and suggests that quences grouped into four main clusters, further dividing into distinct nirS communities can be found in different hydrother- seven subclusters. Both nirS clone libraries were dominated mal vent habitats. by an OTU grouping in cluster IVb, which was 99 % similar at the amino acid level to a γ-proteobacteria, Pseudomonas sp. nirS gene biodiversity differences between vent fields BA2.5, isolated from sediments collected in the middle of the macrotidal, hypernutrified and muddy estuary of the River Most nirS sequences at Axial Volcano and Endeavour Colne in the United Kingdom (Nogales et al. 2002). This OTU Segment clearly did not cluster together in the phylogenetic represented 58 % and 59 % of the total sequences at Shepherd tree. Only 1 OTU, closely related to the γ-proteobacteria and Hulk1. Pseudomonas sp. BA2.5 isolated from estuarine sediments, For the remaining OTUs, comparisons to closest uncul- was shared (Fig. 4, Table S1, Supplementary materials). All tured and cultured organisms in the NCBI database showed up unshared OTUs grouped in distinct phylogenetic clusters (I, to, respectively, 72 % and 70 % (Shepherd) and 86 % and IIa, IIIb, and IVa at Shepherd and IIb and IIIa at Hulk1, see 77 % (Hulk1) similarity at the amino acid level. With the “Composition of nirS gene clone libraries and comparison to exception of one OTU at Hulk1 (cluster IVb), all other un- other marine environments”, Figs. 4 and S3). shared OTUs were more closely related to nirS sequences Various β-diversity calculators (Table S1, Supplementary from uncultured organisms isolated from sediments of the materials) suggested a marked difference in community mem- Chesapeake Bay estuary, the water column of the Central bership (non-abundance weighted), with similarity coeffi- Baltic Sea, a rice field soil and sediments of the Hai River in cients always higher than 0.90 (with 1 indicating completely China and deep-sea sediments near an East Pacific Rise hy- dissimilar communities). UniFrac distance metric (P-value: drothermal field (Figs. 4 and S3, Supplementary materials). 0.02) and P-test (P-value≤1.0e-03) also revealed a significant 1700 Ann Microbiol (2014) 64:1691–1705

Table 3 Copy number and relative abundance of nirS genes (based on sample was collected near Endeavour Segment. Error propagation on qPCR assays) in hydrothermal vent fluids of the JFR. % nirS genes are standard deviations for triplicate qPCR assays is indicated denoted relative to total bacterial abundances. The background seawater

Vent field Year Site Latitude (°N) Longitude (°W) Depth (m) Temperature (ºC) Volume nirS genes nirS genes (%) filtered (L) (copies/mL seawater)

AV a 07 Bag City 45.92 129.99 1,533 13.2 3.15 (2.5±0.3)×103 1.8±0.2 AV 07 Cloud Pit 45.93 129.98 1,521 6.8 3.01 (2.7±0.3)×102 1.7±0.2 AV a 07 Forum 45.95 129.98 1,524 5.7 2.05 (11.9±0.4)×102 0.4±0.3 AV 07 Gollum 45.93 130.01 1,544 21.7 2.55 (6.9±0.5)×102 3.2±0.4 AV 07 Marker 113 45.92 129.99 1,523 31.3 2.62 (4.0±0.5)×102 0.04±0.01 AV a 07 Shepherd 45.99 130.03 1,582 25.0 3.05 (2.7±0.3)×103 1.7±0.4 AV 07 The Spot 45.92 129.99 1,535 30.0 3.56 (42.0±0.2)×101 0.09±0 AV a 07 T&S 45.99 130.03 1,580 75.9 2.81 (1.5±0.4)×103 1.2±0.4 AV 07 Zen Garden1 45.94 129.98 1,518 23.7 3.40 (1.1±0.2)×102 2.7±0.4 AV 07 Zen Garden2 45.94 129.98 1,518 7.2 2.90 (4.5±0.6)×102 0.39±0.07 AV 09 Diva 45.93 129.98 1,520 17.7 2.51 (3.8±0.3)×101 1.7±0.2 AV 09 Gollum 45.93 130.01 1,542 12.7 3.03 (4.1±0.3)×102 7.8±0.6 AV 09 Hermosa 45.93 129.98 1,519 40.4 2.64 (2.2±0.3)×102 3.3±0.5 AV 09 Marker 33 45.93 129.98 1,520 34.5 3.00 (1.2±0.1)×102 0.37±0.05 AV 09 Marker 113 45.92 129.99 1,521 30.1 3.38 (2.2±0.1)×103 2.5±0.5 ES 09 Fairy Castle 47.97 129.09 2,157 28.9 2.53 (7.3±0.6)×101 0.17±0.05 ES a 09 Hulk1 47.95 129.10 2,198 13-130 45.0 (4.3±0.3)×103 0.12±0.01 ES a 09 Hulk2 47.95 129.10 2,198 22.8 3.00 (36.0 ±0.5)×101 0.4±0.1 ES a 09 Phang 47.92 129.11 2,277 24.0 2.71 (1.8±0.1)×103 1.6±0.3 ES 09 Bkgd 48.00 129.10 <2,000 1.8 3.00 BDL BDL

a Sites also used for 16S rRNA and nirS genes diversity analysis difference in nirS community membership at both sites. The ecosystems. Opakiewicz et al. (2009)andHuberetal. two nirS communities were not significantly different in terms (2010) found that total bacteria and ε-proteobacteria commu- of structure (abundance weighted), mostly because the only nity structures were distinct in diffuse vent fluids at different shared OTU represented >50 % of the total nirS sequences at locations at Axial Volcano and on active seamounts of the both sites. However, biasing effects are often observed during Mariana Arc. We also generally found distinct bacterial com- DNA amplification by PCR in a multi-template sample (i.e., munity structures at our JFR vent sites, suggesting that small- the most abundant sequences are linearly selectively ampli- scale geographic isolation might also similarly influence fied; Gonzales et al. 2012), and abundance-weighted analyses denitrifying bacteria communities (Tables S1,S2, must be taken with extreme caution. Supplementary materials). The differences in nirS community membership could be The observed differences in nirS community membership caused by physical isolation (e.g., see Braker et al. 2001;Falk could also be caused by differences in fluid physico-chemical et al. 2007). Using terminal restriction fragment length poly- factors between individual vents or vent fields. Changes in − morphism and correspondence analysis, Braker et al. (2001) NO2 reductase (nirS and nirK) community compositions showed that both 16S rRNA gene and nirS sequences in were observed along environmental gradients in oxygen min- marine sediments from Puget Sound and the Washington imum zones of the Eastern South Pacific, Arabian Sea, Baltic margin clustered according to geographic location. In our Sea and Black Sea (Jayakumar et al. 2004, 2009; Castro- study, since no clear clustering was observed between vent Gonzáles et al. 2005;Falketal.2007;Oakleyetal.2007). fields for 16S rRNA gene bacterial communities, there is no The two sites sampled for nirS biodiversity (Shepherd at reason to attribute differences in nirS community membership Axial Volcano and Hulk1 on the Endeavour Segment) differed + at Shepherd and Hulk1 to the geographic separation of these mostly in their [NH4 ], [H2S] and temperature of the diffuse two locations on the Juan de Fuca Ridge. Smaller-scale geo- fluids (Table 1). Previous studies have shown that temperature graphic separation and the ecological history of individual can cause changes in nirS and nirK community composition vent sites have been shown to be important factors in shaping in soils (Braker et al. 2010) and affect nirS gene expression in microbial community structures in hydrothermal vent Pseudomonas mandeli (Saleh-Lakha et al. 2009). Similarly, Ann Microbiol (2014) 64:1691–1705 1701

AV07S-1 I AV07S-13 (+1) 100 Pelagial of the Central Baltic Sea clone M150-38 [DG072182.1] IIa 78 AV07S-28 Paracoccus denitrificans PD1222 [NC_008686.1] α 100 Paracoccus denitrificans LMD 92.63 [U75413.1] α 78 ES09H1-12 (+1) 93 Chesapeake Bay sediments clone CT2-S-18 [DQ676144.1] 91 ES09H1-38 IIb 70 95 ES09H1-14 (+3) 93 100 ES09H1-58 (+1) 100 Polymorphum gilvum SL003B-26A1 [NC_015259.1] α Roseobacter denitrificans OCh 114 [NC_008209.1] α 100 Roseobacter litoralis OCh 149 [NC_015730.1] α ES09H1-17 90 Chesapeake Bay sediments clone CB1-S-30 [DQ675718.1] Rice field soil (China) clone 1000N-S15 [JF772694.1] 64 97 ES09H1-47 IIIa Pseudogulbenkiania sp. NH8B [NC_016002.1] β 96 Ralstonia eutropha H16 [NC_008314.1] β 99 Ralstonia eutropha JMP134 [NC_007348.1] β East Pacific Ridge hydrothermal field sediments clone EPR-NS-3 [GU348403.1] 99 Peruvian OMZ clone ns7cl [FJ799328.1] 79 AV07S-81 97 East Pacific Ridge hyrothermal field sediments clone EPR-NS-1 [GU348401.1] 80 Pacific coast of Mexico OMZ clone m305059 [AY195933.1] AV07S-29 (+3) IIIb 66 Chesapeake Bay sediments clone CT2-S-117 [DQ676184.1] 84 Baltic Sea sediments clone BSS-1-68 [AM238454.1] AV07S-59 100 86 Chesapeake Bay sediments clone CB2-S-164 [DQ675906.1] 94 Pacific Northwest sediments clone pA12 [AJ248405.2] Northwest Pacific sediments clone pA4 [AJ248402.2] Chesapeake Bay sediments clone CT1-S2-37 [DQ676070.1] 99 Hai river (China) sediments clone R-51 [JN257859.1] Hai river (China) sediments clone S-108 [JN257960.1] Beggiatoa sp. PS contig07202 1271-1272 [NZ_ABBZ01001128] γ γ 69 Marinobacter sp. CG157051 [DQ479849.1] 100 Pacific Northwest sediments isolate D4-14 [AJ248395.2] γ AV07S-51 49 Black Sea suboxic zone clone 160_BO1067 [DQ479840.1] AV07S-78 97 AV07S-14 (+7) AV07S-7 (+15) IVa 61 76 Subtropical macrotidal estuary sediments clone FR5_nirS28 [GQ863040.1] 83 59 Chesapeake Bay sediments clone CB2-S-75 [DQ675851.1] 80 51 Pearl River eutrophic estuary (China) clone S4-07 [ADU86627.1] 90 Chesapeake Bay sediments clone CB3-S-97 [DQ675955.1] AV07S-37 Pseudomonas aeruginosa PAO1 [NC_002516.2] γ 100 Coastal Arabian Sea water column clone V400-3E [AY336885.1] Pseudomonas brassicacearum NFM421 [NC_015379.1] γ 98 Pseudomonas fluorescens [AF197466.1] γ 98 ES09H1-5 (+23) 90 Pseudomonas fluorescens WH6 [NZ_AEAZ01000023] γ 99 Pseudomonas sp. BH11.6 from esturarine sediments [AJ440496.1] γ 88 Pelagial of the Central Baltic Sea clone M40-3 [DQ072212.1] 73 Eastern South Pacific OMZ [AJ811481.1] IVb Poole Harbour (UK) coastal seawater [EF659459.1] 80 AV07S-2 (+51) 83 ES09H1-1 (+53) 89 Pseudomonas sp. BA2.5 from estuarine sediments [AJ440494.1] 100 Pseudomonas sp. I-Bh4-8 from soil [FN555557.1] γ ES09H1-80 (+1) Alcaligenes faecalis A15 [AJ224913.1] β 100 Pseudomonas stutzeri JM300 [M80653.1] γ Azospirillum brasiliense Sp7 [AJ224912.1] α Endosymbiont of Tevnia jerichonana (vent Tica) [NZ_AFZB01000041] γ 0.3 sub/site Fig. 4 Phylogenetic tree of nirS sequences from hydrothermal vent fluids parentheses. GenBank accession numbers are provided (in brackets) for at Axial Volcano and Endeavour Segment on the JFR. The tree was other cultured bacteria and environmental clones not sequenced in this constructed by the maximum likelihood method based on an alignment study. The percentage of 1,000 bootstrap resamplings above 50 % is of partial sequences of ∼230 amino acids. Sample names were assigned as indicated. The scale bar indicates the number of amino acid substitutions in Table 2. Numbers following sample names are clone identifiers. per site Numbers of identical (≥97 %; OTU definition) clones are indicated in

− + NO3 availability (following NH4 nitrification at the oxic end diversity in diffuse vent fluids, similar to what has been of the redox gradient) could affect denitrifying bacteria observed in oxygen minimum zones (e.g., Jayakumar et al. 1702 Ann Microbiol (2014) 64:1691–1705

2009). Also, since chemolithotrophic denitrifying bacteria of hydrothermal vent fields on the JFR. Limited sample quantity diverse phylogenetic affiliations have been shown to oxidize also precluded quantitative assessment of expressed nirS − sulfur, while using NO3 as an electron acceptor, H2Savail- genes, which can be done by reverse transcription qPCR ability could also potentially affect nirS-encoding denitrifying (e.g., see Smith et al. 2007;Chonetal.2009). Yet, Smith bacteria diversity (see review by Shao et al. 2010). et al. (2007) and Dong et al. (2009) found no correlation In this study, we did not observe clear trends between 16S between nirS transcripts in sediments and environmental var- rRNA gene bacterial community membership/structure and iables for most nirS phylotypes quantified in the Colne estu- measured environmental factors. However, we cannot conclude ary. Other environmental factors that were not measured in that major differences in vent fluid chemistry would not have a this study (e.g., the availability of particulate or dissolved selective effect on denitrifying bacteria. Furthermore, homoge- organic carbon as substrate for heterotrophic denitrifying bac- nization of bacterial communities from multiple subseafloor teria) could also influence nirS gene abundance. In conclu- habitats (e.g., biofilms) prior to fluid venting (and sampling) sion, this study underscores that our understanding of the could obscure trends that link physico-chemical parameters and environmental controls on the nirS abundance (expressed or microbial community composition. Thus the role of geochem- not) is still rudimentary, in marine environments in general, ical modulators of denitrifying communities at hydrothermal andinhydrothermalecosystemsinparticular. vents, as observed in estuarine and other marine studies, re- mains elusive. Below, we examine the relationship between qPCR nirS abundance and fluid physico-chemistry. Concluding remarks q-PCR nirS gene abundances in relation to environmental This study conducted at hydrothermal vent sites on the JFR factors provides a first-time inventory of nirS gene biodiversity and abundance in the subsurface biosphere of mid-ocean ridge Bacterial abundance, measured by qPCR, varied from ∼2× hydrothermal systems. In a comparison of two vent sites 103 copies/μL(Diva)to4×106 copies/μL (Hulk1). Archaea (Shepherd, Axial Volcano; Hulk1, Endeavour Segment) we typically represented less than ∼3 % of the total microbial found significant differences in nirS community membership population (data not shown), which is consistent with the despite the low diversity of nirS genes in diffuse fluids and the study by Huber et al. (2010) for hydrothermal vent fluids of fact that a single shared sequence affiliated with γ- the Mariana Arc seamounts. nirS gene abundance varied from proteobacteria from marine sediments (Pseudomonas sp. 4×101 copies/μL (Diva) to 4×103 copies/μL (Hulk2) and BA2.5) represented more than half of all sequences recovered. represented less than 8 % of the total bacterial population Since no inter-vent-field spatial patterns were observed for the (Table 3). No significant differences (at 95 % confidence 16S rRNA gene bacterial communities in vent fluids at the six level) in nirS abundances were found between sampling years investigated sites, it is difficult to attribute any systematic (P-value=0.2 for 2007 versus 2009 samples collected at Axial difference in nirS-encoding community membership to Volcano) or between vent fields (P-value=0.07 for 2009 large-scale geographic isolation. Small-scale geographic iso- samples collected at Axial Volcano versus Endeavour lation and the different physico-chemical properties of the Segment). diffuse vent fluids at the time of sampling are likely to affect Correlations between marine nirS gene abundances and (nirS) denitrifying bacterial diversity. Yet, the factors control- environmental factors have been reported in previous studies. ling nirS abundances remain unclear, as no significant rela- For example, Smith et al. (2007) and Dong et al. (2009) tionships were found between nirS abundance and measured observed a decline in the abundances of three different nirS physico-chemical variables. − phylotypes in sediments as NO3 concentrations and denitri- This study is one of the first efforts to investigate microbial fication rates decreased along the hyper-eutrophic Colne es- communities involved in N transformations in discharging tuary (United Kingdom). However, in this study we did not diffuse vent fluids. We still lack a clear understanding of the observe any significant correlations between nirS gene abun- environmental controls on the spatial and temporal variations dance and any of the environmental factors (i.e., temperature, in denitrifying functional gene (nirS, nirK, nosZ)biodiversity − + pH, and H2S, NO3 and NH4 concentrations) in diffuse vent and abundance in subseafloor hydrothermal systems. To this fluids at the 15 different investigated sites (data not shown). end, future studies will need to be broader in scope, comparing We have to note that this lack of correlation might be also samples from many different hydrothermal vent habitats and explained by the fact that our approach only targeted one part examining the diversity and abundance of expressed (nirS-encoding bacteria) of the denitrifying community. Using denitrifying genes (e.g., by sequencing cDNA from rRNA or a GeoChip approach, Wang et al. (2009) found that the nirK mRNA of the nirS gene) in relation to environmental vari- − forms of NO2 reductase were more abundant than nirS in ables. Analogous to massive pyrosequencing of short se- chimney samples from the Main Endeavour and Mothra quences of conserved regions of the 16S rRNA genes (e.g., Ann Microbiol (2014) 64:1691–1705 1703 this study, Huber et al. 2007, 2010), functional gene pyrose- Braker G, Ayala-del-Rio HL, Devol AH, Fesefeldt A, Tiedje JM (2001) quencing is a promising tool that could be better exploited in Community structure of denitrifiers, Bacteria, and Archaea along redox gradients in Pacific Northwest marine sediments by terminal the future to expand the existing functional gene database to restriction fragment length polymorphism analysis of amplified describe microbial diversity in hydrothermal vent systems and nitrite reductase (nirS) and 16S rRNA genes. Appl Environ in other environments. Microbiol 67:1893–1901 Braker G, Schwarz J, Conrad R (2010) Influence of temperature on the composition and activity of denitrifying soil communities. FEMS Acknowledgments The authors wish to thank James Holden, Bill Microbiol Ecol 73:134–148 Chadwick, the officer and crew of the R/V Atlantis and R/V Thomas G. Braman RS, Hendrix SA (1989) Nanogram nitrite and nitrate determina- Thompson and the Jason and Alvin submersible teams. We specially tion in environmental and biological materials by vanadium (III) thank Steven J. Hallam for sharing laboratory space and commenting reduction with chemiluminescence detection. Anal Chem 61:2715– on a previous version of the manuscript. Kevin Roe analyzed fluids for 2718 pH, H2S, dissolved silica, and ammonia on board. Hoang-My Butterfield DA, Roe KK, Lilley MD, Huber JA, Baross JA, Embley RW, Christensen analyzed fluids for Mg and other cations and anions in Massoth GJ (2004) Mixing, reaction and microbial activity in the 2009. We thank Elena Zaikova for laboratory assistance and Dr. Juergen sub-seafloor revealed by temporal and spatial variation in diffuse Ehlting and Alyse Hawley for sharing laboratory material and space. The flow vents at Axial Volcano. In: Wilcock WSD, DeLong EF, Kelley Couchsurfing community is thanked for providing accommodation to DS, Baross JA, Cary SC (eds) The Subseafloor Biosphere at Mid- A.B.. during laboratory analysis at the University of British Columbia Ocean Ridge, Geophysical Monograph Series, vol 144. American (Vancouver). This work was funded through an NSERC (Natural Sci- Geophysical Union, Washington, pp 269–289 ences and Engineering Research Council of Canada) graduate fellowship Castro‐González M, Braker G, Farías L, Ulloa O (2005) Communities of and a Rix Family fellowship to A.B.., and by an NSERC Discovery grant nirS‐type denitrifiers in the water column of the oxygen minimum and British Columbia Leadership Chair to S.K.J. The research cruises zone in the eastern South Pacific. Environ Microbiol 7:1298–1306 were funded by the US National Oceanic and Atmospheric Administra- Chadwick WW Jr, Nooner SL, Butterfield DA, Lilley MD (2012) tion, Pacific Marine Environmental Laboratory and by the National Seafloor deformation and forecasts of the April 2011 eruption at Science Foundation. Axial Seamount. Nat Geosci 5:474–477 Chao A, Chazdon RL, Colwell RK, Shen TJ (2005) A new statistical approach for assessing similarity of species composition with inci- dence and abundance data. Ecol Lett 8:148–159 References Chen C, Ho KL, Liu FC, Ho M, Wang A, Ren N, Lee DJ (2013) Autotrophic and heterotrophic denitrification by a newly isolated strain Pseudomonas sp. C27. Bioresour Technol 145:351–356 Alain K, Zbinden M, Le Bris N, Lesongeur F, Quérellou J, Gaill F, Chon K, Chang JS, Lee E, Lee JW, Ryu JY, Cho J (2009) Abundance of Cambon‐Bonavita MA (2004) Early steps in microbial colonization denitrifying genes coding for nitrate (narG), nitrite (nirS), and processes at deep‐sea hydrothermal vents. Environ Microbiol 6: nitrous oxide (nosZ) reductases in estuarine versus waste production 227–241 water effluent fed constructed wetlands. Ecol Eng 1500:1–6 Anderson RE, Brazelton WJ, Baross JA (2011) Using CRISPRs as a Cline JD (1969) Spectrophotometric determination of hydrogen sulfide in metagenomic tool to identify microbial hosts of a diffuse flow natural waters. Limnol Oceanogr 14:454–458 hydrothermal vent viral assemblage. FEMS Microbiol Ecol 77: Dong LF, Smith CJ, Papaspyrou S, Stott A, Osborn AM, Nedwell DB 120–133 (2009) Changes in benthic denitrification, nitrate ammonification, Anderson RE, Beltrán MT, Hallam SJ, Baross JA (2012) and anammox process rates and nitrate and nitrite reductase gene Microbial community structure across fluid gradients in the abundances along an estuarine nutrient gradient (the Colne Estuary, Juan de Fuca Ridge hydrothermal system. FEMS Microbiol United Kingdom). Appl Environ Microbiol 75:3171–3179 Ecol 83:324–339 Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011) UCHIME Ashelford KE, Chuzhanova NA, Fry JC, Jones AJ, Weightman AJ (2006) improves sensitivity and speed of chimera detection. Bioinformatics New screening software shows that most recent large 16S rRNA 27:2194–2200 gene clone libraries contain chimeras. Appl Environ Microbiol 72: Falk S, Hannig M, Gliesche C, Wardenga R, Köster M, Jürgens K, Braker 5734–5741 G (2007) nirS-containing denitrifier communities in the water col- Bourbonnais A, Lehmann MF, Butterfield DA, Juniper SK (2012a) umn and sediment of the Baltic Sea. Biogeosciences 4:255–268 Subseafloor nitrogen transformations in diffuse hydrothermal vent Gonzalez JM, Portillo MC, Belda-Ferre P, Mira A (2012) Amplification fluids of the Juan de Fuca Ridge evidenced by the isotopic compo- by PCR artificially reduces the proportion of the rare biosphere in sition of nitrate and ammonium. Geochem Geophys Geosyst 13: microbial communities. PloS One 7:e29973. doi:10.1371/journal. Q02T01. doi:10.1029/2011GC003863 pone.0029973 Bourbonnais A, Juniper SK, Butterfield DA, Devol AH, Kuypers MMM, Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O Lavik G, Hallam SJ, Wenk CB, Chang BX, Murdock SA, Lehmann (2010) New algorithms and methods to estimate maximum- MF (2012b) Activity and abundance of denitrifying bacteria in the likelihood phylogenies: assessing the performance of PhyML 3.0. subsurface biosphere of diffuse hydrothermal vents of the Juan de Syst Biol 59:307–321 Fuca Ridge. Biogeosciences 9:4661–4678 Hamady M, Lozupone C, Knight R (2009) Fast UniFrac: facilitating Braker G, Fesefeldt A, Witzel KP (1998) Development of PCR primer high-throughput phylogenetic analyses of microbial communities systems for amplification of nitrite reductase genes (nirK and nirS) including analysis of pyrosequencing and PhyloChip data. ISME J to detect denitrifying bacteria in environmental samples. Appl 4:17–27 Environ Microbiol 64:3769–3775 Henry S, Baudoin E, López-Gutiérrez JC, Martin-Laurent F, Brauman A, Braker G, Zhou J, Wu L, Devol AH, Tiedje JM (2000) Nitrite reductase Philippot L (2004) Quantification of denitrifying bacteria in soils by genes (nirK and nirS) as functional markers to investigate diversity nirK gene targeted real-time PCR. J Microbiol Methods 59:327–335 of denitrifying bacteria in Pacific Northwest marine sediment com- Heylen K, Vanparys B, Wittebolle L, Verstraete W, Boon N, De Vos P munities. Appl Environ Microbiol 66:2096–2104 (2006) Cultivation of denitrifying bacteria: optimization of isolation 1704 Ann Microbiol (2014) 64:1691–1705

conditions and diversity study. Appl Environ Microbiol 72:2637– primers that amplify genes coding for bacterial 16S rRNA. Appl 2643 Environ Microbiol 64:795–799 Huber JA, Butterfield DA, Baross JA (2002) Temporal changes in ar- Martin AP (2002) Phylogenetic approaches for describing and comparing chaeal diversity and chemistry in a mid-ocean ridge subseafloor the diversity of microbial communities. Appl Environ Microbiol 68: habitat. Appl Environ Microbiol 68:1585–1594 3673–3682 Huber JA, Butterfield DA, Baross JA (2003) Bacterial diversity in a McCollom TM, Shock EL (1997) Geochemical constraints on subseafloor habitat following a deep-sea volcanic eruption. FEMS chemolithoautotrophic metabolism by microorganisms in seafloor Microbiol Ecol 43:393–409 hydrothermal systems. Geochim Cosmochim Acta 61:4375–4391 Huber T, Faulkner G, Hugenholtz P (2004) Bellerophon: a program to Mehta MP, Baross JA (2006) Nitrogen fixation at 92 °C by a hydrother- detect chimeric sequences in multiple sequence alignments. mal vent archaeon. Science 314:1783–1786 Bioinformatics 20:2317–2319 Mulder C, Bazeley‐White E, Dimitrakopoulos P, Hector A, Scherer‐ Huber JA, Mark Welch DB, Morrison HG, Huse SM, Neal PR, Lorenzen M, Schmid B (2004) Species evenness and productivity Butterfield DA, Sogin ML (2007) Microbial population structures in experimental plant communities. Oikos 107:50–63 in the deep marine biosphere. Science 318:97–100 Mulholland MR, Lomas MW (2008) N uptake and assimilation. In: Huber JA, Cantin HV,Huse SM, Mark Welch DB, Sogin ML, Butterfield Capone DG, Bronk DA, Mulholland MR, Carpenter EJ (eds) DA (2010) Isolated communities of Epsilonproteobacteria in hy- Nitrogen in the marine environment. Elsevier/Academic, 384, drothermal vent fluids of the Mariana Arc seamounts. FEMS pp 303–384 Microbiol Ecol 73:538–549 Nakagawa S, Takai K, Inagaki F, Hirayama H, Nunoura T, Horikoshi K, Huse SM, Welch DM, Morrison HG, Sogin ML (2010) Ironing out the Sako Y (2005a) Distribution, phylogenetic diversity and physiolog- wrinkles in the rare biosphere through improved OTU clustering. ical characteristics of epsilon‐Proteobacteria in a deep‐sea hydro- Environ Microbiol 12:1889–1898 thermal field. Environ Microbiol 7:1619–1632 Inagaki F, Takai K, Kobayashi H, Nealson KH, Horikoshi K (2003) Nakagawa S, Inagaki F, Takai K, Horikoshi K, Sako Y (2005b) Sulfurimonas autotrophica gen. nov., sp. nov., a novel sulfur- Thioreductor micantisoli gen. nov., sp. nov., a novel mesophilic, oxidizing ε-proteobacterium isolated from hydrothermal sediments sulfur-reducing chemolithoautotroph within the ε-Proteobacteria in the Mid-Okinawa Trough. Int J Syst Evol Microbiol 53:1801– isolated from hydrothermal sediments in the Mid-Okinawa 1805 Trough. Int J Syst Evol Microbiol 55:599–605 Inagaki F, Takai K, Nealson KH, Horikoshi K (2004) Sulfurovum Nakagawa S, Takai K, Inagaki F, Horikoshi K, Sako Y (2005c) lithotrophicum gen. nov., sp. nov., a novel sulfur-oxidizing Nitratiruptor tergarcus gen. nov., sp. nov. and Nitratifractor chemolithoautotroph within the ε-Proteobacteria isolated from salsuginis gen. nov., sp. nov., nitrate-reducing chemolithoautotrophs Okinawa Trough hydrothermal sediments. Int J Syst Evol of the ε-Proteobacteria isolated from a deep-sea hydrothermal sys- Microbiol 54:1477–1482 tem in the Mid-Okinawa Trough. Int J Syst Evol Microbiol 55:925– Jannasch HW, Mottl MJ (1985) Geomicrobiology of deep-sea hydrother- 933 mal vents. Science 229:717–725 Nogales B, Timmis KN, Nedwell DB, Osborn AM (2002) Detection and Jayakumar DA, Francis CA, Naqvi SWA, Ward BB (2004) Diversity of diversity of expressed denitrification genes in estuarine sediments nitrite reductase genes (nirS) in the denitrifying water column of the after reverse transcription-PCR amplification from mRNA. Appl coastal Arabian Sea. Aquat Microb Ecol 34:69–78 Environ Microbiol 68:5017–5025 Jayakumar A, O’Mullan G, Naqvi SWA, Ward B (2009) Denitrifying Oakley BB, Francis CA, Roberts KJ, Fuchsman CA, Srinivasan S, Staley bacterial community composition changes associated with stages of JT (2007) Analysis of nitrite reductase (nirK and nirS)genesand denitrification in oxygen minimum zones. Microbial Ecol 58:350– cultivation reveal depauperate community of denitrifying bacteria in 362 the Black Sea suboxic zone. Environ Microbiol 9:118–130 Kaye JZ, Márquez MC, Ventosa A, Baross JA (2004) sp. nov., Opatkiewicz AD, Butterfield DA, Baross JA (2009) Individual hydro- Halomonas sulfidaeris sp. nov., Halomonas axialensis sp. nov. thermal vents at Axial Seamount harbor distinct subseafloor micro- and Halomonas hydrothermalis sp. nov.: halophilic bacteria isolated bial communities. FEMS Microbiol Ecol 70:413–424 from deep-sea hydrothermal-vent environments. Int J Syst Evol Price MN, Dehal PS, Arkin AP (2010) FastTree 2–approximately Microbiol 54:499–511 maximum-likelihood trees for large alignments. PLoS One 5: Lee RW, Childress JJ (1994) Assimilation of inorganic nitrogen by e9490. doi:10.1371/journal.pone.0009490 marine invertebrates and their chemoautotrophic and Priemé A, Braker G, Tiedje JM (2002) Diversity of nitrite reductase (nirK methanotrophic symbionts. Appl Environ Microbiol 60:1852–1858 and nirS) gene fragments in forested upland and wetland soils. Appl Lilley MD, Butterfield DA, Olson EJ, Lupton JE, Macko SA, McDuff RE Environ Microbiol 68:1893–1900 + (1993) Anomalous CH4 and NH4 concentrations at an Ravenschlag K, Sahm K, Pernthaler J, Amann R (1999) High bacterial unsedimented mid-ocean-ridge hydrothermal system. Nature 364: diversity in permanently cold marine sediments. Appl Environ 45–47 Microbiol 65:3982–3989 Liu X, Tiquia SM, Holguin G, Wu L, Nold SC, Devol AH, Luo K, Saleh-Lakha S, Shannon KE, Henderson SL, Goyer C, Trevors JT, Palumbo AV, Tiedje JM, Zhou J (2003) Molecular diversity of Zebarth BJ, Burton DL (2009) Effect of pH and temperature on denitrifying genes in continental margin sediments within the denitrification gene expression and activity in Pseudomonas oxygen-deficient zone off the Pacific coast of Mexico. Appl mandelii. Appl Environ Microbiol 75:3903–3911 Environ Microbiol 69:3549–3560 Santoro AE, Boehm AB, Francis CA (2006) Denitrifier community López‐García P, Duperron S, Philippot P, Foriel J, Susini J, Moreira D composition along a nitrate and salinity gradient in a coastal aquifer. (2003) Bacterial diversity in hydrothermal sediment and Appl Environ Microbiol 72:2102–2109 epsilonproteobacterial dominance in experimental microcolonizers Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, at the Mid‐Atlantic Ridge. Environ Microbiol 5:961–976 Lesniewski RA, Oakley BB, Parks DH, Robinson CJ (2009) Lozupone C, Knight R (2005) UniFrac: a new phylogenetic method for Introducing mothur: open-source, platform-independent, comparing microbial communities. Appl Environ Microbiol 71: community-supported software for describing and comparing mi- 8228–8235 crobial communities. Appl Environ Microbiol 75:7537–75541 Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ, Wade Schrenk MO, Huber JA, Edwards KJ (2010) Microbial provinces in the WG (1998) Design and evaluation of useful bacterium-specific PCR subseafloor. Annu Rev Mar Sci 2:279–304 Ann Microbiol (2014) 64:1691–1705 1705

Shao MF, Zhang T, Fang HHP (2010) Sulfur-driven autotrophic denitri- description of the genus Sulfurimonas. Int J Syst Evol Microbiol 56: fication: diversity, biochemistry, and engineering applications. Appl 1725–1733 Microbiol Biotechnol 88:1027–1042 Tamegai H, Li L, Masui N, Kato C (1997) A denitrifying bacterium from Sievert SM, Wieringa E, Wirsen CO, Taylor CD (2007) Growth and the deep sea at 11,000-m depth. Extremophiles 1:207–211 mechanism of filamentous‐sulfur formation by Candidatus Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving Arcobacter sulfidicus in opposing oxygen‐sulfide gradients. the sensitivity of progressive multiple sequence alignment through Environ Microbiol 9:271–276 sequence weighting, position-specific gap penalties and weight ma- Smith W, Solow AR, Preston PE (1996) An estimator of species overlap trix choice. Nucleic Acids Res 22:4673–4680 using a modified beta-binomial model. Biometrics 52:1472–1477 Turner S, Pryer KM, Miao VPW, Palmer JD (1999) Investigating deep Smith CJ, Nedwell DB, Dong LF, Osborn AM (2007) Diversity and phylogenetic relationships among cyanobacteria and plastids by abundance of nitrate reductase genes (narG and napA), nitrite re- small subunit rRNA sequence analysis. J Eukaryot Microbiol 46: ductase genes (nirS and nrfA), and their transcripts in estuarine 327–338 sediments. Appl Environ Microbiol 73:3612–3622 Wang F, Zhou H, Meng J, Peng X, Jiang L, Sun P, Zhang C, Van Solorzano L (1969) Determination of ammonia in natural waters by the Nostrand JD, Deng Y, He Z (2009) GeoChip-based analysis phenolhypochlorite method. Limnol Oceanogr 14:799–801 of metabolic diversity of microbial communities at the Juan Takai K, Nealson KH, Horikoshi K (2004) Hydrogenimonas thermophila de Fuca Ridge hydrothermal vent. Proc Natl Acad Sci USA gen. nov., sp. nov., a novel thermophilic, hydrogen-oxidizing 106:4840–4845 chemolithoautotroph within the ε-Proteobacteria, isolated from a Xie W, Wang F, Guo L, Chen Z, Sievert SM, Meng J, Huang G, Li Y,Yan black smoker in a Central Indian Ridge hydrothermal field. Int J Q, Wu S (2010) Comparative metagenomics of microbial commu- Syst Evol Microbiol 54:25–32 nities inhabiting deep-sea hydrothermal vent chimneys with con- Takai K, Suzuki M, Nakagawa S, Miyazaki M, Suzuki Y, Inagaki F, trasting chemistries. ISME J 5:414–426 Horikoshi K (2006) Sulfurimonas paralvinellae sp. nov., a novel Yue JC, Clayton MK (2005) A similarity measure based on species mesophilic, hydrogen-and sulfur-oxidizing chemolithoautotroph proportions. Commun Stat Theory 34:2123–2131 within the Epsilon proteobacteria isolated from a deep-sea hydro- Zaikova E, Walsh DA, Stilwell CP, Mohn WW, Tortell PD, Hallam SJ thermal vent polychaete nest, reclassification of Thiomicrospira (2010) Microbial community dynamics in a seasonally anoxic fjord: denitrificans as Sulfurimonas denitrificans comb. nov. and emended Saanich Inlet, British Columbia. Environ Microbiol 12:172–191