DOCSLIB.ORG

Origin and Evolution of Tandem Repeats in the Mitochondrial DNA Control Region of Shrikes (Lanius Spp.)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Origin and Evolution of Tandem Repeats in the Mitochondrial DNA Control Region of Shrikes (Lanius Spp.) J Mol Evol (2004) 59:250–257 DOI: 10.1007/s00239-004-2619-6 Origin and Evolution of Tandem Repeats in the Mitochondrial DNA Control Region of Shrikes (Lanius spp.) Nicholas I. Mundy,1 Andreas J. Helbig2 1 Department of Zoology, University of Cambridge, Downing Street, Cambridge, CB2 3EJ, UK 2 Vogelwarte Hiddensee, Universitat Greifswald, D-18565 Kloster/Hiddensee, Germany Received: 25 September 2003 / Accepted: 12 February 2004 [Reviewing Editor: Martin Kreitman] Abstract. The origin and evolution of a 128-bp number of taxa (reviewed in Hoelzel 1993; Rand 1993; tandem repeat in the mtDNA control region of Lunt et al. 1998). In birds, control region tandem re- shrikes (Lanius: Aves) were investigated. The tandem peats have been documented at the sequence level in repeat is present in only two species, L. excubitor and waders, gulls, auks, shrikes, penguins, and eagles L. ludovicianus. In contrast to the variation in repeat (Wenink et al. 1994; Berg et al. 1995; Mundy et al. number in L. ludovicianus, all individuals of three 1996; Ritchie and Lambert 2000; Va¨ li 2002). These subspecies of L. excubitor had three repeats. Com- repeats can be categorized according to size of the parative analysis suggests that a short direct repeat, basic repeat unit and the position of the array within and a secondary structure including the tandem repeat the control region (Hoelzel 1993). Interest in repeats and a downstream inverted repeat, may be important has focused on the light they shed on mechanisms of in the origin of the tandem repeat by slipped-strand mtDNA mutation and turnover and on the practical mispairing and its subsequent turnover. Homogeni- use of repeats as markers in population genetics. zation of repeat sequences is most simply explained by The origin of mtDNA tandem repeats is generally expansion and contraction of the repeat array. Sur- thought to involve slipped-strand mispairing during prisingly, mtDNA sequences from L. excubitor were mtDNA replication (Levinson and Gutman 1987; found to be paraphyletic with respect to L. ludovici- Buroker et al. 1990; Hayasaka et al. 1991; Madsen anus. These results show the utility of a comparative et al. 1993; Fumagalli et al. 1996; Broughton and analysis for insights into the evolutionary dynamics of Dowling 1994; Wilkinson et al. 1997). Other mecha- mtDNA tandem repeats. nisms for repeat generation, such as intermolecular recombination, are considered rare (reviewed in Ro- Key words: Mitochondrial DNA — Control region kas et al. 2003). However, the details of how slipped- — Tandem repeats strand mispairing works are poorly understood and there has been little work on why repeats form in some lineages and not others. As well as being of interest to control region repeats themselves, such mechanisms are also relevant to other examples of Introduction mtDNA turnover. For example, one favored hy- pothesis for the generation of mitochondrial gene Tandemly repeated DNA in the control region of the order rearrangements involves a large duplication mitochondrial DNA is reported from an ever-growing event followed by gene loss (Macey et al. 1997). In previous work we demonstrated that there is a 128-bp tandem repeat in the control region of the Correspondence to: Nicholas I. Mundy; email: [email protected] loggerhead shrike (Lanius ludovicianus) (Mundy et al. 251 1996) (Fig. 1A). All individuals of this species either have two repeats, have three repeats, or are hetero- plasmic for two and three repeats. In contrast, the one other species of shrike examined (L. collaris) did not have the repeat. The 128-bp tandem repeat in the loggerhead shrike falls into the relatively small cate- gory of large repeats that are present in a 3¢ position in the light strand of the control region. Other ex- amples in this category include repeat arrays in rab- bits (Mignotte et al. 1990), macaques (Hayasaka et al. 1991), minnows (Broughton and Dowling 1994), redfish (Bentzen et al. 1998), and crocodiles (Ray and Densmore 2003). An important feature of these tan- dem repeat arrays is that since they presumably occur Fig. 1. A Structure of mtDNA in species with (L. ludovicianus; top) and without (L. collaris; bottom) the 128-bp tandem repeat. 3¢ to the origin of heavy strand replication (OH) they CSB-1 is conserved sequence block 1. DLL2 and FTPH2 are the do not form part of the D-loop, and thus mechanisms primers used in this study. B Model of tandem repeat formation of slipped-strand mispairing that involve the D-loop (Mundy et al. 1996). The light strand is the lower strand. Toward the end of heavy-strand replication, the leading strand spontane- (e.g., Buroker et al. 1990) are not relevant to their ously denatures (top). Stem-loop formation by the inverted repeat origin and expansion/contraction. occurs and the strand reanneals onto the direct repeat sequence Other sequence motifs in and around the tandem (middle). Continued replication generates the tandem repeat (bot- repeat led to the proposal of a model of how the tom). tandem repeat arose by slipped-strand mispairing in shrikes, toward the end of heavy strand replication collected during banding procedures. Abbreviations follow genus, (Mundy et al. 1996; Fig. 1B), which was a variation species, and subspecies for species with more than one subspecies (e.g., Lei for Lanius excubitor invictus) and genus, species for spe- of a model originally proposed by Broughton and cies with no subspecies (e.g., Lco for Lanius collaris). The single Dowling (1994). In the model, short direct repeats exception involves L. ludovicianus mearnsi and L. l. gambeli, whose were proposed to be important for reannealing fol- haplotypes are labeled Llu1, Llu2, and Llu3, to be consistent with lowing strand slippage, and an inverted repeat 3¢ to nomenclature used in the previous study (Mundy et al. 1996). the tandemly repeated region was proposed to form a stable stem loop structure following slippage that Laboratory Methods stabilized the slipped strand to promote reannealing to a different position. However, data from two All laboratory procedures closely followed those used previously species were insufficient to critically appraise this (Mundy et al. 1996). Total genomic DNA was extracted from single model. feather shafts using Chelex and from blood using a salting-out procedure. Primers used to amplify the region containing tandem Key questions to test the model are: In the line- repeats were DLL2 (5¢ ATGCACTTTTACCCCATTCATGGTGG age(s) in which the tandem repeat originated, were 3¢) and FTPH2 (5¢ CCATCTTGACATCTTCAGTGCCATGC 3¢) the direct repeats present? Were the inverted repeats (see Fig. 1A for positions). Polymerase chain reaction (PCR) am- present? and Were predicted free energies of second- plifications were performed in a Hybaid thermal cycler in a 25-ll ary structures comparatively high? Absence of any of total volume containing 0.5–1.0 units Taq polymerase (Perkin–El- mer), 1· PCR buffer, a 50 lM concentration each dNTP, 1.5 mM these would lead to rejection of the model. In the MgCl2, and 25 lg bovine serum albumin (Fraction V, Sigma), and present study we have obtained an expanded dataset 10–100 ng template DNA. Cycling parameters were as follows: 1 · of control region sequences from 8 species and 14 94°C, 3 min; 30–40 · 94°C, 30 s; 50–60°C, 60 s, 72°C, 90 s; and 1 · subspecies of shrikes, including the great grey shrike 72°C, 10 min. Different samples required different annealing tem- (L. excubitor), which is generally considered to be the peratures for optimization. Direct double-stranded sequencing of PCR products was performed with Sequenase (USB) and 35S- sister species of L. ludovicianus. The results show that dATP. Products of sequencing reactions were separated on 8% the tandem repeat is only present in L. excubitor and polyacrylamide gels (Long Ranger; J. T. Baker). Dried gels were L. ludovicianus, support the model of repeat origi- exposed to X-ray film (X-Omat; Kodak Eastman) for 1–7 days. nation, and shed light on mechanisms of repeat Sequences were read by eye. turnover. DNA Sequence Analysis Materials and Methods Sequences were aligned using Clustal X (Higgins and Sharp 1989). A control region sequence from a rook (Corvus frugilegus) was used Samples as the closest available outgroup (GenBank Accession No. Y18522 [Ha¨ rlid and Arnason 1999]). Phylogenetic analyses were performed Species and subspecies sampled in the study are shown in Table 1. in PAUP* (Swofford 1999). Neighbor-joining trees were con- Samples from L. ludovicianus and L. excubitor invictus were structed using HKY distances. Branch support in neighbor-joining plucked feathers; those from other species were blood samples and parsimony was assessed using 1000 bootstrap replicates. 252 Table 1. Shrike taxa sampled in this study Taxon Origin Lab ID Loggerhead shrike Lanius ludovicianus mearnsi San Clemente I., USA Haplotypes Llu1, Llu2 (Mundy et al. 1996)a L. l. gambeli California, USA Haplotypes Llu2, Llu3 (Mundy et al. 1996)a L. l. excubitorides Alberta, Canada Lle6 Great grey shrike L. e. excubitor Germany Lee1, Lee2, Lee3 Northern shrike L. e. invictus Oregon, USA Lei1, Lei2, Southern grey shrike L. e. meridionalis Spain Lem1, Lem2, Lem3 Fiscal shrike L. collaris Guinea Lco1 (Mundy et al. 1996) Woodchat shrike L. s. senator Italy Lss1, Lss3 L. s. badius Italy Lsb4 L. s. niloticus Israel Lsn5 Red-backed shrike L. c. collurio Italy Lcc3, Lcc6 Isabelline shrike L. isabellinus Mongolia Lis1, Lis2 Masked shrike L. n. nubicus Israel Lnn1 Long-tailed shrike L. s. schach Hong Kong Lsc1, Lsc2 a Haplotypes Llu1, Llu2, and Llu3 were obtained in the previous study (Mundy et al. 1996), from numerous individuals of L. l. mearnsi and L. l. gambeli, and these designations are retained here for ease of comparison.
Load more

Recommended publications
  • Best Practice Recommendations for Internal Validation of Human Short Tandem Repeat Profiling on Capillary Electrophoresis Platforms
    Best Practice Recommendations for Internal Validation of Human Short Tandem Repeat Profiling on Capillary Electrophoresis Platforms Best Practice Recommendations for Internal Validation of Human Short Tandem Repeat Profiling on Capillary Electrophoresis Platforms Biological Methods Subcommittee Biology/DNA Scientific Area Committee Organization of Scientific Area Committees (OSAC) for Forensic Science Best Practice Recommendations for Internal Validation of Human Short Tandem Repeat Profiling on Capillary Electrophoresis Platforms OSAC Proposed Standard Best Practice Recommendations for Internal Validation of Human Short Tandem Repeat Profiling on Capillary Electrophoresis Platforms Prepared by Biological Methods Subcommittee Version: 1.0 Disclaimer: This document has been developed by the Biological Methods Subcommittee of the Organization of Scientific Area Committees (OSAC) for Forensic Science through a consensus process and is proposed for further development through a Standard Developing Organization (SDO). This document is being made available so that the forensic science community and interested parties can consider the recommendations of the OSAC pertaining to applicable forensic science practices. The document was developed with input from experts in a broad array of forensic science disciplines as well as scientific research, measurement science, statistics, law, and policy. This document has not been published by an SDO. Its contents are subject to change during the standards development process. All interested groups or individuals are strongly encouraged to submit comments on this proposed document during the open comment period administered by the Academy Standards Board (www.asbstandardsboard.org). Best Practice Recommendations for Internal Validation of Human Short Tandem Repeat Profiling on Capillary Electrophoresis Platforms Foreword This document outlines best practice recommendations for the internal validation of human short tandem repeat DNA profiling on capillary electrophoresis platforms utilized in forensic laboratories.
    [Show full text]
  • Microsatellites Within the Feline Androgen Receptor Are
    JFM0010.1177/1098612X16634386Journal of Feline Medicine and SurgeryFarwick et al 634386research-article2016 Original Article Journal of Feline Medicine and Surgery 1 –7 Microsatellites within the feline © The Author(s) 2016 Reprints and permissions: androgen receptor are suitable for X sagepub.co.uk/journalsPermissions.nav DOI: 10.1177/1098612X16634386 chromosome-linked clonality testing jfms.com in archival material Nadine M Farwick1, Robert Klopfleisch1, Achim D Gruber1 and Alexander Th A Weiss2 Abstract Objectives A hallmark of neoplasms is their origin from a single cell; that is, clonality. Many techniques have been developed in human medicine to utilise this feature of tumours for diagnostic purposes. One approach is X chromosome-linked clonality testing using polymorphisms of genes encoded by genes on the X chromosome. The aim of this study was to determine if the feline androgen receptor gene was suitable for X chromosome-linked clonality testing. Methods The feline androgen receptor gene, was characterised and used to test clonality of feline lymphomas by PCR and polyacrylamide gel electrophoresis, using archival formalin-fixed, paraffin-embedded material. Results Clonality of the feline lymphomas under study was confirmed and the gene locus was shown to represent a suitable target in clonality testing. Conclusions and relevance Because there are some pitfalls using X chromosome-linked clonality testing, further studies are necessary to establish this technique in the cat. Accepted: 26 January 2016 Introduction Most tumours arise
    [Show full text]
  • Role of Human Endogenous Retroviral Long Terminal Repeats (Ltrs) in Maintaining the Integrity of the Human Germ Line
    Viruses 2011, 3, 901-905; doi:10.3390/v3060901 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Commentary Role of Human Endogenous Retroviral Long Terminal Repeats (LTRs) in Maintaining the Integrity of the Human Germ Line Meihong Liu and Maribeth V. Eiden * Laboratory of Cellular and Molecular Regulation, National Institute of Mental Health, 49 Convent Drive MSC 4483, Bethesda, MD 20892, USA; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.:+1-301-402-1641 Fax: +1-301-402-1748. Received: 27 April 2011; in revised form: 10 June 2011 / Accepted: 15 June 2011 / Published: 21 June 2011 Abstract: Retroviruses integrate a reverse transcribed double stranded DNA copy of their viral genome into the chromosomal DNA of cells they infect. Occasionally, exogenous retroviruses infect germ cells and when this happens a profound shift in the virus host dynamic occurs. Retroviruses maintained as hereditable viral genetic material are referred to as endogenous retroviruses (ERVs). After millions of years of co-evolution with their hosts many human ERVs retain some degree of function and a few have even become symbionts. Thousands of copies of endogenous retrovirus long terminal repeats (LTRs) exist in the human genome. There are approximately 3000 to 4000 copies of the ERV-9 LTRs in the human genome and like other solo LTRs, ERV-9 LTRs can exhibit distinct promoter/enhancer activity in different cell lineages. It has been recently reported that a novel transcript of p63, a primordial member of the p53 family, is under the transcriptional control of an ERV-9 LTR [1].
    [Show full text]
  • A New Census of Protein Tandem Repeats and Their Relationship with Intrinsic Disorder
    G C A T T A C G G C A T genes Article A New Census of Protein Tandem Repeats and Their Relationship with Intrinsic Disorder Matteo Delucchi 1,2 , Elke Schaper 1,2,† , Oxana Sachenkova 3,‡, Arne Elofsson 3 and Maria Anisimova 1,2,* 1 ZHAW Life Sciences und Facility Management, Applied Computational Genomics, 8820 Wädenswil, Switzerland; [email protected] 2 Swiss Institute of Bioinformatics, 1015 Lausanne, Switzerland 3 Science of Life Laboratory, Department of Biochemistry and Biophysics, Stockholm University, 106 91 Stockholm, Sweden * Correspondence: [email protected]; Tel.: +41-(0)58-934-5882 † Present address: Carbon Delta AG, 8002 Zürich, Switzerland. ‡ Present address: Vildly AB, 385 31 Kalmar, Sweden. Received: 9 March 2020; Accepted: 1 April 2020; Published: 9 April 2020 Abstract: Protein tandem repeats (TRs) are often associated with immunity-related functions and diseases. Since that last census of protein TRs in 1999, the number of curated proteins increased more than seven-fold and new TR prediction methods were published. TRs appear to be enriched with intrinsic disorder and vice versa. The significance and the biological reasons for this association are unknown. Here, we characterize protein TRs across all kingdoms of life and their overlap with intrinsic disorder in unprecedented detail. Using state-of-the-art prediction methods, we estimate that 50.9% of proteins contain at least one TR, often located at the sequence flanks. Positive linear correlation between the proportion of TRs and the protein length was observed universally, with Eukaryotes in general having more TRs, but when the difference in length is taken into account the difference is quite small.
    [Show full text]
  • An Intronic Variable Number of Tandem Repeat Polymorphisms of the Cold
    European Journal of Human Genetics (2006) 14, 1295–1305 & 2006 Nature Publishing Group All rights reserved 1018-4813/06 $30.00 www.nature.com/ejhg ARTICLE An intronic variable number of tandem repeat polymorphisms of the cold-induced autoinflammatory syndrome 1 (CIAS1) gene modifies gene expression and is associated with essential hypertension Toshinori Omi1, Maki Kumada1, Toyomi Kamesaki1, Hiroshi Okuda1, Lkhagvasuren Munkhtulga1, Yoshiko Yanagisawa1, Nanami Utsumi1, Takaya Gotoh1, Akira Hata2, Masayoshi Soma3, Satoshi Umemura4, Toshio Ogihara5, Norio Takahashi6, Yasuharu Tabara7, Kazuyuki Shimada8, Hiroyuki Mano9, Eiji Kajii1, Tetsuro Miki7 and Sadahiko Iwamoto*,1 1Division of Human Genetics, Center for Community Medicine, Jichi Medical School, Tochigi, Japan; 2Department of Public Health, Graduate School of Medicine, Chiba University, Chiba, Japan; 3Department of Nephrology and Endocrinology, Advanced Medical Research Center, Nihon University School of Medicine, Tokyo, Japan; 4Second Department of Internal Medicine, Yokohama City University Medical School, Kanagawa, Japan; 5Department of Genetics, Radiation Effects Research Foundation, Hiroshima, Japan; 6Department of Geriatric Medicine, Osaka University Graduate School of Medicine, Osaka, Japan; 7Department of Geriatric Medicine, Ehime University School of Medicine, Ehime, Japan; 8Division of Cardiovascular Medicine, Department of Medicine, Jichi Medical School, Tochigi, Japan; 9Division of Functional Genomics, Jichi Medical School, Kawachigun, Tochigi, Japan Cold-induced autoinflammatory syndrome 1 (CIAS1) gene is a member of the NALP subfamily of the CATERPILLER protein family that is expressed predominantly in peripheral blood leukocytes, which is to regulate apoptosis or inflammation through the activation of NF-jB and caspase. Recent genetic analyses suggested an association between inflammation and oxidative stress-related genes in the development of hypertension. This is the first genetic study indicating an association between the CIAS1 gene and susceptibility to essential hypertension (EH).
    [Show full text]
  • Long Terminal Repeat Enhancer Core Sequences in Proviruses Adjacent to C-Myc in T-Cell Lymphomas Induced by a Murine Retrovirus
    JOURNAL OF VIROLOGY, Jan. 1995, p. 446–455 Vol. 69, No. 1 0022-538X/95/$04.0010 Copyright q 1995, American Society for Microbiology Long Terminal Repeat Enhancer Core Sequences in Proviruses Adjacent to c-myc in T-Cell Lymphomas Induced by a Murine Retrovirus HARRY L. MORRISON, BOBBY SONI, AND JACK LENZ* Department of Molecular Genetics, Albert Einstein College of Medicine, Bronx, New York 10461 Received 28 June 1994/Accepted 17 October 1994 The transcriptional enhancer in the long terminal repeat (LTR) of the T-lymphomagenic retrovirus SL3-3 differs from that of the nonleukemogenic virus Akv at several sites, including a single base pair difference in an element termed the enhancer core. Mutation of this T-A base pair to the C-G sequence found in Akv significantly attenuated the leukemogenicity of SL3-3. Thus, this difference is important for viral leukemoge- nicity. Since Akv is an endogenous virus, this suggests that the C-G in its core is an adaptation to being minimally pathogenic. Most tumors that occurred in mice inoculated with the mutant virus, called SAA, contained proviruses with reversion or potential suppressor mutations in the enhancer core. We also found that the 72-bp tandem repeats constituting the viral enhancer could vary in number. Most tumors contained mixtures of proviruses with various numbers of 72-bp units, usually between one and four. Variation in repeat number was most likely due to recombination events involving template misalignment during viral replication. Thus, two processes during viral replication, misincorporation and recombination, combined to alter LTR enhancer structure and generate more pathogenic variants from the mutant virus.
    [Show full text]
  • Estimation of Duplication History Under a Stochastic Model for Tandem Repeats Farzad Farnoud1* , Moshe Schwartz2 and Jehoshua Bruck3
    Farnoud et al. BMC Bioinformatics (2019) 20:64 https://doi.org/10.1186/s12859-019-2603-1 RESEARCH ARTICLE Open Access Estimation of duplication history under a stochastic model for tandem repeats Farzad Farnoud1* , Moshe Schwartz2 and Jehoshua Bruck3 Abstract Background: Tandem repeat sequences are common in the genomes of many organisms and are known to cause important phenomena such as gene silencing and rapid morphological changes. Due to the presence of multiple copies of the same pattern in tandem repeats and their high variability, they contain a wealth of information about the mutations that have led to their formation. The ability to extract this information can enhance our understanding of evolutionary mechanisms. Results: We present a stochastic model for the formation of tandem repeats via tandem duplication and substitution mutations. Based on the analysis of this model, we develop a method for estimating the relative mutation rates of duplications and substitutions, as well as the total number of mutations, in the history of a tandem repeat sequence. We validate our estimation method via Monte Carlo simulation and show that it outperforms the state-of-the-art algorithm for discovering the duplication history. We also apply our method to tandem repeat sequences in the human genome, where it demonstrates the different behaviors of micro- and mini-satellites and can be used to compare mutation rates across chromosomes. It is observed that chromosomes that exhibit the highest mutation activity in tandem repeat regions are the same as those thought to have the highest overall mutation rates. However, unlike previous works that rely on comparing human and chimpanzee genomes to measure mutation rates, the proposed method allows us to find chromosomes with the highest mutation activity based on a single genome, in essence by comparing (approximate) copies of the pattern in tandem repeats.
    [Show full text]
  • Cell Line Authentication: Technology, Workflow, and Service
    Maintaining Scientific Integrity Through Cell Line Authentication Gabriela Saldanha Genomics Business Unit Life Sciences Research Promega Corporation Presentation Outline • Background on cell line authentication (CLA) • Basics of STRs and CLA protocols Promega Corporation 2 The legend of HeLa • HeLa- first immortal cancer line to be established in 1951 by George Gey • Cervical cancer derived from patient Henrietta Lacks • Widely used in research According to Rebecca Skloot, “More than 60,000 scientific articles had been published about research done on HeLa, and that number was increasing steadily at a rate of more than 300 papers each month.” • Rapid growing; can contaminate and overtake HeLa cells other cell types Promega Corporation 3 Stanley Gartler describes HeLa contamination of cell lines 1968: Gartler publishes first evidence of HeLa contamination based on G6PD isoenzymes NAME DESCRIPTION ORIGIN G6PD VARIANT HeLa Cervical adenocarcinoma, African Type A (fast) human KB Oral epidermoid Caucasian Type A (fast) Nature Reviews, 2010 carcinoma, human HEp-2 Larynx epidermoid Caucasian Type A (fast) carcinoma, human Conclusion: 90% (18/20) Chang liver Liver, human Caucasian Type A (fast) human cell lines are ‘HeLa’ Int-407 Embryonic intestine, Caucasian Type A (fast) human Promega Corporation 4 Poor culture condition leads to contamination • Poor tissue culture environment • No disposable, plastic culture dishes • No commercial media • Cells grown on bench-top • Bunsen burners and steam used for sterilization • Technicians wore surgical
    [Show full text]
  • Finding a Tandem Repeats Motifs in the Completed
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 22 October 2019 doi:10.20944/preprints201910.0249.v1 Finding a Tandem Repeats Motifs in the Completed Genomes of Human Coronavirus (hku1) Which is Identified as a Hotspot Region for the Viruses Recombination by Using Regular Expression Language Mohammed Ahmed Ezzelregal Hassan 1, Mohamed Elsayed Hasan2 1. PhD. in Bioinformatics, University of SADAT City, Genetic Engineering and Biotechnology Research Institute GEBRI, Bioinformatics Department, [email protected] Bioinformatician and molecular geneticist at Molecular genetics and taxonomy lab, General Authority for Fish Resources and Development (GAFRD) 2. PhD. in Bioinformatics, University of SADAT City, Genetic Engineering and Biotechnology Research Institute GEBRI, Bioinformatics Department , [email protected] Bioinformatician at the central laboratory unit of GEBRI institute 1 © 2019 by the author(s). Distributed under a Creative Commons CC BY license. Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 22 October 2019 doi:10.20944/preprints201910.0249.v1 Abstract A lot of research studies have been surveyed the completed genomes of prokaryotic and eukaryotic and focused on the correlation between the percentage of microsatellite sequences in completed genomes and the whole size of the organism genomes. There are fewer studies made in repetitive sequences otherwise simple sequence repeats or long tandem repeats of virus genomes. simple sequence repeats (SSRs) are the most important regions for recombination and moving repeats blocks from site to another site in the genomes. A tool was programmed and designed by visual basic 6.0 to find the long tandem repeats in DNA sequences of the small genomes.
    [Show full text]
  • Identification and Characterisation of Endogenous Avian Leukosis Virus Subgroup E (ALVE) Insertions in Chicken Whole Genome Sequencing Data Andrew S
    Mason et al. Mobile DNA (2020) 11:22 https://doi.org/10.1186/s13100-020-00216-w RESEARCH Open Access Identification and characterisation of endogenous Avian Leukosis Virus subgroup E (ALVE) insertions in chicken whole genome sequencing data Andrew S. Mason1,2* , Ashlee R. Lund3, Paul M. Hocking1ˆ, Janet E. Fulton3† and David W. Burt1,4† Abstract Background: Endogenous retroviruses (ERVs) are the remnants of retroviral infections which can elicit prolonged genomic and immunological stress on their host organism. In chickens, endogenous Avian Leukosis Virus subgroup E (ALVE) expression has been associated with reductions in muscle growth rate and egg production, as well as providing the potential for novel recombinant viruses. However, ALVEs can remain in commercial stock due to their incomplete identification and association with desirable traits, such as ALVE21 and slow feathering. The availability of whole genome sequencing (WGS) data facilitates high-throughput identification and characterisation of these retroviral remnants. Results: We have developed obsERVer, a new bioinformatic ERV identification pipeline which can identify ALVEs in WGS data without further sequencing. With this pipeline, 20 ALVEs were identified across eight elite layer lines from Hy-Line International, including four novel integrations and characterisation of a fast feathered phenotypic revertant that still contained ALVE21. These bioinformatically detected sites were subsequently validated using new high- throughput KASP assays, which showed that obsERVer was highly precise and exhibited a 0% false discovery rate. A further fifty-seven diverse chicken WGS datasets were analysed for their ALVE content, identifying a total of 322 integration sites, over 80% of which were novel. Like exogenous ALV, ALVEs show site preference for proximity to protein-coding genes, but also exhibit signs of selection against deleterious integrations within genes.
    [Show full text]
  • Intra-Epidemic Genome Variation in Highly Pathogenic African Swine
    Farlow et al. Virology Journal (2018) 15:190 https://doi.org/10.1186/s12985-018-1099-z RESEARCH Open Access Intra-epidemic genome variation in highly pathogenic African swine fever virus (ASFV) from the country of Georgia Jason Farlow3* , Marina Donduashvili1, Maka Kokhreidze1, Adam Kotorashvili2, Nino G. Vepkhvadze1, Nato Kotaria2 and Ana Gulbani1 Abstract Background: African swine fever virus (ASFV) causes an acute hemorrhagic infection in suids with a mortality rate of up to 100%. No vaccine is available and the potential for catastrophic disease in Europe remains elevated due to the ongoing ASF epidemic in Russia and Baltic countries. To date, intra-epidemic whole-genome variation for ASFV has not been reported. To provide a more comprehensive baseline for genetic variation early in the ASF outbreak, we sequenced two Georgian ASFV samples, G-2008/1 and G-2008/2, derived from domestic porcine blood collected in 2008. Methods: Genomic DNA was extracted directly from low-volume ASFV PCR-positive porcine blood samples and subjected to next generation sequencing on the Illumina Miseq platform. De novo and mapped sequence assemblies were performed using CLCBio software. Genomic illustrations, sequence alignments and assembly figures were generated using Geneious v10.2.4. Sequence repeat architecture was analyzed using DNASTAR GeneQuest 14.1.0. Results: The G-2008/1 and G-2008/2 genomes were distinguished from each other by coding changes in seven genes, including MGF 110-1 L, X69R, MGF 505-10R, EP364R, H233R, E199L, and MGF 360-21R in addition to eight homopolymer tract variations. The 2008/2 genome possessed a novel allele state at a previously undescribed intergenic repeat locus between genes C315R and C147L.
    [Show full text]
  • Conversion of DNA Sequences: from a Transposable Element to a Tandem Repeat Or to a Gene
    G C A T T A C G G C A T genes Review Conversion of DNA Sequences: From a Transposable Element to a Tandem Repeat or to a Gene Ana Paço 1,* , Renata Freitas 2,3,4 and Ana Vieira-da-Silva 1 1 MED-Mediterranean Institute for Agriculture, Environment and Development, University of Évora, 7002–554 Évora, Portugal; [email protected] 2 IBMC-Institute for Molecular and Cell Biology, University of Porto, R. Campo Alegre 823, 4150–180 Porto, Portugal; [email protected] 3 I3S-Institute for Innovation and Health Research, University of Porto, Rua Alfredo Allen, 208, 4200–135 Porto, Portugal 4 ICBAS-Institute of Biomedical Sciences Abel Salazar, University of Porto, 4050-313 Porto, Portugal * Correspondence: [email protected]; Tel.: +351-266-760-878 Received: 19 October 2019; Accepted: 29 November 2019; Published: 5 December 2019 Abstract: Eukaryotic genomes are rich in repetitive DNA sequences grouped in two classes regarding their genomic organization: tandem repeats and dispersed repeats. In tandem repeats, copies of a short DNA sequence are positioned one after another within the genome, while in dispersed repeats, these copies are randomly distributed. In this review we provide evidence that both tandem and dispersed repeats can have a similar organization, which leads us to suggest an update to their classification based on the sequence features, concretely regarding the presence or absence of retrotransposons/transposon specific domains. In addition, we analyze several studies that show that a repetitive element can be remodeled into repetitive non-coding or coding sequences, suggesting (1) an evolutionary relationship among DNA sequences, and (2) that the evolution of the genomes involved frequent repetitive sequence reshuffling, a process that we have designated as a “DNA remodeling mechanism”.
    [Show full text]