US 20120252869A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0252869 A1 Collard et al. (43) Pub. Date: Oct. 4, 2012

(54) TREATMENT OF SIRTUIN (SIRT) RELATED A6IP 25/28 (2006.01) DISEASES BY INHIBITION OF NATURAL A6IP 25/6 (2006.01) ANTISENSE TRANSCRIPT TO A SIRTUN A6IP 9/00 (2006.01) (SIRT) A6IP3/00 (2006.01) A6IP3/10 (2006.01) (75) Inventors: Joseph Collard, Delray Beach, FL A6IP3/04 (2006.01) (US): Olga Khorkova Sherman, A6IP3/06 (2006.01) Tequesta, FL (US) A6IPL/I6 (2006.01) A6IP27/02 (2006.01) (73) Assignee: pro CuRNA, LLC, Miami, FL A6IP 9/089/10 3882006.O1 A6IP 7/00 (2006.01) A6IP35/02 (2006.01) (21) Appl. No.: 13/386,057 A6IP3 L/18 (2006.01) (22) PCT Filed: Jul. 23, 2010 A6IP 9/10 (2006.01) A6IP 9/00 (2006.01) (86). PCT No.: PCT/US 10/43.075 A6IP 2L/00 (2006.01) A6IPL/04 (2006.01) S371 (c)(1), A6IP 9/02 (2006.01) (2), (4) Date: Jan. 20, 2012 A6IPI/00 (2006.01) A6IP 29/00 (2006.01) Related U.S. Application Data A6IP II/00 (2006.01) A6IPI3/00 (2006.01) (63) Continuation-in-part of application No. PCT/US2009/ A6IP 700 (2006.01) 066445, filed on Dec. 2, 2009. A6IP35/00 (2006.01) (60) Provisional application No. 61/259,072, filed on Nov. CI2N 5/071 (2010.01) 6, 2009, provisional application No. 61/228,392, filed (52) U.S. Cl...... 514/44. A 435/375; 536/24.5; 3. on Jul. 24, 2009. (57) ABSTRACT Publication Classification The present invention relates to antisense oligonucleotides (51) Int. Cl. that modulate the expression of and/or function of a Sirtuin A6 IK3I/7088 (2006.01) (SIRT), in particular, by targeting natural antisense poly C7H 2L/04 (2006.01) nucleotides of a Sirtuin (SIRT). The invention also relates to C07K 9/00 (2006.01) the identification of these antisense oligonucleotides and their A6 IK 38/14 (2006.01) use in treating diseases and disorders associated with the A6IP 25/00 (2006.01) expression of Sirtuins (SIRT)s. Patent Application Publication Oct. 4, 2012 Sheet 1 of 10 US 2012/O252869 A1

*:::::::::::::::: :38:8;&: 8::::::::

&

:::::::::::::::8: 8:8: 8:8:::::::::::::::::::::::::::::::::8:88:

8::::::

six. Patent Application Publication Oct. 4, 2012 Sheet 2 of 10 US 2012/O252869 A1

ex-xx-secrease,

:

.

W.M.W.M.W.W

:::::::::::

:::::::::::::::::$88: 8888&::::::::::::::::::::::::::::::::

: 3.

: & & - s : : 3. Patent Application Publication Oct. 4, 2012 Sheet 3 of 10 US 2012/O252869 A1

x: 8:8:88:38:88: 8:::::::::::

Patent Application Publication Oct. 4, 2012 Sheet 4 of 10 US 2012/O252869 A1

*::::::::

8:883:... 8

Patent Application Publication Oct. 4, 2012 Sheet 5 of 10 US 2012/O252869 A1

Patent Application Publication Oct. 4, 2012 Sheet 6 of 10 US 2012/O252869 A1

:::::::::::

s''WY'':----ass''''------''''''''''''''''''''''''''''''''''''''''MTY''''''''''------MYX'v's 8::::::::::::::::::::::::::::: : 88: 8x8::::::::::::::::

88.

:

3.3

: & Patent Application Publication Oct. 4, 2012 Sheet 7 of 10 US 2012/O252869 A1

:8:::::::::::::::::::::::::::::

8

s:&

Patent Application Publication Oct. 4, 2012 Sheet 8 of 10 US 2012/O252869 A1

::::::::::::

Patent Application Publication Oct. 4, 2012 Sheet 9 of 10 US 2012/O252869 A1

8. &:::::::::

& 8:

Patent Application Publication Oct. 4, 2012 Sheet 10 of 10 US 2012/O252869 A1

US 2012/0252869 A1 Oct. 4, 2012

TREATMENT OF SIRTUIN (SIRT) RELATED otide, for example, nucleotides set forth in SEQID NO: 5 to DISEASES BY INHIBITION OF NATURAL 14, and any variants, alleles, homologs, mutants, derivatives, ANTISENSE TRANSCRIPT TO A SIRTUIN fragments and complementary sequences thereto. Examples (SIRT) of antisense oligonucleotides are set forth as SEQID NOS: 15 to 94. 0007 Another embodiment provides a method of modu 0001. The present application claims the priority of U.S. lating function and/or expression of a Sirtuin (SIRT) poly provisional patent application No. 61/228,392 filed Jul. 24. nucleotide in patient cells or tissues in vivo or in vitro com 2009, U.S. provisional patent application No. 61/259,072, prising contacting said cells or tissues with an antisense filed Nov. 6, 2009, PCT patent application No. PCT/ oligonucleotide 5 to 30 nucleotides in length wherein said US09166445 filed Dec. 2, 2009, PCT patent application No. oligonucleotide has at least 50% sequence identity to a PCT/US10/26119 filed Mar. 3, 2010 and U.S. provisional reverse complement of the an antisense of the Sirtuin (SIRT) patent application No. 61/330.427 filed May 3, 2010. polynucleotide; thereby modulating function and/or expres sion of the Sirtuin (SIRT) polynucleotide in patient cells or FIELD OF TILE INVENTION tissues in viva or in vitro. 0008. Another embodiment provides a method of modu 0002 Embodiments of the invention comprise oligonucle lating function and/or expression of a Sirtuin (SIRT) poly otides modulating expression and/or function of a Sirloin nucleotide in patient cells or tissues in vivo or in vitro com (SERF) and associated molecules. prising contacting said cells or tissues with an antisense oligonucleotide 5 to 30 nucleotides in length wherein said BACKGROUND oligonucleotide has at least 50% sequence identity to an anti 0003 DNA-RNA and RNA-RNA hybridization are sense oligonucleotide to a Sirtuin (SIRT) antisense poly important to many aspects of nucleic acid function including nucleotide; thereby modulating function and/or expression of DNA replication, transcription, and translation. Hybridiza the Sirtuin (SIRT) polynucleotide in patient cells or tissues in tion is also central to a variety of technologies that either vivo or in vitro. detect a particular nucleic acid or alter its expression. Anti 0009. In one embodiment, a composition comprises one or sense nucleotides, for example, disrupt gene expression by more antisense oligonucleotides which bind to sense and/or hybridizing to target RNA, thereby interfering with RNA antisense Sirtuin (SIRT) polynucleotides. splicing, transcription, translation, and replication. Antisense 0010. In another embodiment, the oligonucleotides com DNA has the added feature that DNA-RNA hybrids serve as prise one or more modified or substituted nucleotides. a substrate for digestion by ribonuclease H, an activity that is 0011. In another embodiment, the oligonucleotides com present in most cell types. Antisense molecules can be deliv prise one or more modified bonds. ered into cells, as is the case for oligodeoxynucleotides (0012. In yet another embodiment, the modified nucle (ODNs), or they can be expressed from endogenous genes as otides comprise modified bases comprising phosphorothio RNA molecules. The FDA recently approved an antisense ate, methylphosphonate, peptide nucleic acids. 2'-O-methyl, drug, VITRAVENETM (for treatment of cytomegalovirus fluoro- or carbon, methylene or other locked nucleic acid retinitis), reflecting that antisense has therapeutic utility. (LNA) molecules. Preferably, the modified nucleotides are locked nucleic acid molecules, including C-L-LNA. SUMMARY 0013. In another embodiment, the oligonucleotides are 0004. In one embodiment, the invention provides methods administered to a patient subcutaneously, intramuscularly, for inhibiting the action of a natural antisense transcript by intravenously or intraperitoneally. using antisense oligonucleotide(s) targeted to any region of 0014. In another embodiment, the oligonucleotides are the natural antisense transcript resulting in up-regulation of administered in a pharmaceutical composition. A treatment the corresponding sense gene. It is also contemplated herein regimen comprises administering the antisense compounds at that inhibition of the natural antisense transcript can be least once to patient; however, this treatment can be modified achieved by siRNA, ribozymes and small molecules, which to include multiple doses over a period of time. The treatment are considered to be within the scope of the present invention. can be combined with one or more other types of therapies. 0005. One embodiment provides a method of modulating 0015. In another embodiment, the oligonucleotides are function and/or expression of a Sirtuin (SIRT) polynucleotide encapsulated in a liposome or attached to a carrier molecule in patient cells or tissues in vivo or in vitro comprising con (e.g. cholesterol, TAT peptide). tacting said cells or tissues with an antisense oligonucleotide 10016. Other aspects are described infra. 5 to 30 nucleotides in length wherein said oligonucleotide has at least 50% sequence identity to a reverse complement of a BRIEF DESCRIPTION OF THE DRAWINGS polynucleotide comprising 5 to 30 consecutive nucleotides 0017 FIGS. 1 and 2 show Real time PCR results of oligo within nucleotides 1 to 1028 of SEQID NO: 5 or nucleotides nucleotides designed to SIRT antisense CV396200. The 1 to 429 of SEQID NO: 6, or nucleotides 1 to 156 of SEQID results show that the levels of the SIRT1 mRNA in HepG2 NO: 7 or nucleotides 1 to 593 of SEQID NO:8, 1 to 373 of cells are significantly increased 48 h after treatment with one SEQID NO:9, 1 to 1713 of SEQID NO: 10, 1 to 660 of SEQ of the siRNAs designed to sofas (sirtas 5, P=0.01). In the ID NO: 11, 1 to 589 of SEQID NO: 12, 1 to 428 of SEQID same samples the levels of sirtas RNA were significantly NO: 13 and 1 to 4441 of SEQID NO: 14 thereby modulating decreased after treatment with sirtas 5, but unchanged after function and/or expression of the Sirtuin (SIRT) polynucle treatment with sirtas 6 and sirtas 7, which also had no otide in patient cells or tissues in vivo or in vitro. effect on the SIRT1 mRNA levels (FIG.2).sirtas 5, sirtas 6 0006. In another embodiment, an oligonucleotide targets a and sirtas 7 correspond to SEQ ID NOs: 38, 39 and 40 natural antisense sequence of a Sirtuin (SIRT) polynucle respectively. US 2012/O252869 A1 Oct. 4, 2012

0018 FIG. 3 shows results for the oligonucleotide walk (0027 FIG. 13 is a graph of real time PCR results showing across the SIRT antisense. Real time PCR results show that the fold change--standard deviation in SIRT1 mRNA after the levels of the SIRT1 mRNA in HepG2 cells are signifi treatment of 3T3 cells with phosphorothioate oligonucle cantly increased 48 h. after treatment with three of the anti otides introduced using Lipofectamine 2000, as compared to sense oligonucleotides designed to sirtas. CUR-0292 to control. Real time PCR results show that the levels of SIRT1 CUR-0309 correspond to SEQID NOs: 15 to 32 respectively. mRNA are significantly increased in 3T3 cells 48 h after 0019 FIGS. 4 and 5 show results for PS, LNA and 2'O Me treatment with three of the oligonucleotides designed to Modified oligonucleotides HepG2 (FIG. 4) and Vero76 (FIG. SIRT1 mouse antisense AK044604. Bars denoted as CUR 5) cells. Real time PCR results show that the levels of the 0949, CUR-0842, CUR-1098 and CUR-1099 correspond to SUM mRNA in HepG2 cells are significantly increased 48 h. samples treated with SEQID NOS: 67, 61,71 and 72 respec after treatment with PS, LNA, 2'O Me and 2'O Me mixmer tively. designed antisense oligonucleotides to SIRT1 antisense. Lev 0028 FIG. 14 is a graph of real time PCR results showing els of SIRT1 mRNA in Veto cells also increased 48 hours after the fold change--standard deviation in SIRT1 mRNA after treatment with PS and LNA modified antisense oligonucle treatment of 3T3 cells with phosphorothioate oligonucle otides to SIRT1 antisense. Bars denoted as CUR-0245, CUR otides introduced using Lipofectamine 2000, as compared to 0736, CUR 0688, CUR-0740 and CUR-0664 correspond to control. Real time PCR results show that the levels of SIRT1 SEQ ID NOs: 33 to 37 respectively. mRNA are significantly increased in 3T3 cells 48 h after 0020 FIG. 6 shows PCR results of Monkey Fat Biopsies. treatment with five of the oligonucleotides designed to SIRT1 Real time PCR results show an increase in SIRT1 mRNA mouse antisense AK044604. Bars denoted as CUR-0948, levels in fat biopsies from monkeys dosed with CUR-963, an CUR-0949, CUR-0950, CUR-0951, CUR-0846, and CUR oligonucleotide designed to SIRT1 antisense CV396200.1. 0844 correspond to samples treated with SEQID NOS: 66 to CUR-963 corresponds to SEQID NO. 34. 69, 65 and 63 respectively. 0021 FIG. 7 shows PCR results of primary monkey liver (0029 FIG. 15 is a graph of real time PCR results showing hepatocytes. Real time PCR results show an increase in the fold change--standard deviation in SIRT1 mRNA after SIRT1 mRNA levels after treatment with an oligonucleotide treatment of 3T3 cells with phosphorothioate oligonucle against SIRT1 antisense. Bar denoted as CUR-0245 corre otides introduced using Lipofectamine 2000, as compared to sponds to SEQID NO:33. control. Real time PCR results show that the levels of SIRT1 0022 FIG. 8 shows results for oligonucleotides designed mRNA are significantly increased in HepG2 cells 48 h after to SIRT antisense CV396.200. Real Time PCR results show treatment with two of the oligonucleotides designed to SIRT1 that levels of SIRT1 mRNA in HepG2 cells are significantly mouse antisense AK044604. Bars denoted as CUR-0842, increased in one of the oligonucleotides designed to SIRT1 CUR-0844, and CUR-0845 correspond to samples treated antisense CV396200. The bars denoted as CUR-1230, CUR with SEQID NOS: 61, 63 and 64 respectively. 1231, CUR-1232 and CUR-1233 correspond to SEQID NOs: 0030 FIG. 16 is a graph of real time PCR results showing 41 to 44. the fold change--standard deviation in SIRT1 mRNA after 0023 FIG. 9 shows results for oligonucleotides designed treatment of 3T3 cells with phosphorothioate oligonucle to SIRT antisense CV428275. Real Time PCR results show otides introduced using Lipofectamine 2000, as compared to that levels of SIRT1 mRNA in HepG2 cells are significantly control. Real time PCR results show that the levels of SIRT1 increased in two of the oligonucleotides designed to SIRT1 mRNA are significantly increased in HepG2 cells 48 h after antisense CV428275. The bars denoted as CUR-1302, CUR treatment with two of the oligonucleotides designed to SIRT1 1304, CURA303 and CUR-1305 correspond to SEQIDNOs: mouse antisense AK044604. Bars denoted as CUR-0843, 45 to 48. CUR-0846 correspond to samples treated with SEQID NOS: 0024 FIG. 10 shows Real time PCR results. The results 62 and 65 respectively. show that a significant increase in slim mRNA levels in 0031 FIG. 17 is a graph of real time PCR results showing HepG2 cells 48 hours after treatment with one of the oligo the fold change--standard deviation in Sirtuin3 mRNA after nucleotides designed to SIRT antisense BE717453. The bars treatment of HepG2 cells with phosphorothioate oligonucle denoted as CUR-1264, CUR1265 and CUR-1266 correspond otides introduced using Lipofectamine 2000, as compared to to SEQID NOs: 49 to 51 respectively. control. RT PCR results show that sirt3 levels in HepG2 cells 0025 FIG. 11 shows Real time PCR results. The results are increased 48 hours after treatment with phosphorothioate show that show that the levels of the SIRT1 mRNA in HepG2 antisense oligonucleotides designed to sirt3 antisense cells are significantly increased 48 h after treatment with Hs.683117 (CUR-1545-1550). Bars denoted as CUR-0551, three of the oligonucleotides designed to SIRT1 antisense CUR-1552, CUR-1555, CUR-1556, CUR-1553, CUR-1554, AV718812. The bars denoted as CUR-1294, CUR-1297, CUR-1545, CUR-1546, CUR-1548, CUR-1549, CUR-1550 CUR-1295, CUR-1296 and CUR-1298 correspond to SEQ and CUR-1547, correspond to samples treated with SEQID ID NOs: 52 to 56 respectively. NOS: 73 to 84 respectively. 0026 FIG. 12 is a graph of real time PCR results showing 0032 FIG. 18 is a graph of real time PCR results showing the fold change+standard deviation in SIRT1 mRNA after the fold change standard deviation in SIRT6 mRNA after treatment of HepG2 cells with phosphorothioate oligonucle treatment of HepG2 cells with phosphorothioate oligonucle otides introduced using Lipofectamine 2000, as compared to otides introduced using Lipofectamine 2000, as compared to control. Real time PCR results show that the levels of SIRT1 control. Real time PCR results show that the levels of SIRT6 mRNA are significantly increased in HepG2 cells 48 h after mRNA in HepG2 cells are significantly increased 48 h after treatment with two of the oligos designed to SIRT1 antisense treatment with one of the oliogs designed to SIRT6 antisense AW169958. Bars denoted as CUR-1381, CUR-1382, CUR NM 133475. Bars denoted as CUR-0873, CUR-0869 to 4383 and CUR-1384 correspond to samples treated with SEQ CUR-0871, CUR-0874 and CUR-0872, correspond to ID NOS: 57 to 60 respectively. samples treated with SEQID NOS: 85 to 90 respectively. US 2012/O252869 A1 Oct. 4, 2012

0033 FIG. 19 is a graph of real time PCR results showing SEQ ID NO: 99 corresponds to CUR 962, * indicates phos the fold change+standard deviation in SIRT6 mRNA after phothioate bond and +indicates LNA. treatment of HepG2 cells with phosphorothioate oligonucle otides introduced using Lipofectamine 2000, as compared to DETAILED DESCRIPTION control. Real time PCR results show that the levels of SIRT6 mRNA in HepG2 cells are significantly increased 48 h after 0037. Several aspects of the invention are described below treatment with one of the oliogs designed to SIRT6 antisense with reference to example applications for illustration. It bf772662. Bars denoted as CUR-0878, CUR-0876, CUR should be understood that numerous specific details, relation 0877 and CUR-0875, correspond to samples treated with ships, and methods are set forth to provide a full understand SEQ ID NOS: 91 to 94 respectively. ing of the invention. One having ordinary skill in the relevant 0034 FIG. 20 is a graph of real time PCR results showing art, however, will readily recognize that the invention can be the fold change+standard deviation in SIRT6 mRNA after practiced without one or more of the specific details or with treatment of DBS-FCL-1 cells with phosphorothioate oligo other methods. The present invention is not limited by the nucleotides introduced using Lipofectamine 2000, as com ordering of acts or events, as some acts may occur in different pared to control. Real time PCR results show that the levels of orders and/or concurrently with other acts or events. Further SIRT6 mRNA in DBS-FCL-1 cells are significantly more, not all illustrated acts or events are required to imple increased 48 h after treatment with two of the oliogs designed ment a methodology in accordance with the present inven to SIRT6 antisense bf772662 and one oligo designed to tion. NM 133475. Bars denoted as CUR-0876, CUR-0878, 0038 All genes, gene names, and gene products disclosed CUR-0875 and CUR-0874, correspond to samples treated herein are intended to correspond to homologs from any with SEQID NOS: 92,91, 94 and 89 respectively. species for which the compositions and methods disclosed 0035 Sequence Listing Description herein are applicable. Thus, the terms include, but are not limited to genes and gene products from humans and mice. It SEQ ID NO: 1: Homo sapiens sirtuin (silent mating type is understood that when a gene or gene product from a par information regulation 2 homolog) 1 (S. cerevisiae) (SIRT1). ticular species is disclosed, this disclosure is intended to be mRNA (NCBI Accession Number: NM 012238.3) exemplary only, and is not to be interpreted as a limitation SEQ ID NO: 2: Mus musculus sirtuin 1 (silent mating type unless the context in which it appears clearly indicates. Thus, information regulation 2, homolog) 1 (S. cerevisiae) (SIRT1) for example, for the genes disclosed herein, which in some mRNA (NCBI Accession Number: NM 001159589) embodiments relate to mammalian nucleic acid and amino SEQ ID NO:3: Homo sapiens sirtuin (silent mating type acid sequences are intended to encompass homologous and/ information regulation 2 homolog)3 (S. cerevisiae) (SIRT3). or orthologous genes and gene products from other animals transcript variant 1, mRNA (NCBI Accession No.: including, but not limited to other mammals, fish, amphib NM 912239.5). ians, reptiles, and birds. In embodiments, the genes or nucleic SEQ ID NO: 4: Homo sapiens sirtuin 6 (SIRT6), transcript acid sequences are human. variant 1, mRNA (NCBI Accession No.: NM 016539). SEQ ID NO. 5: Expanded natural antisense sequence DEFINITIONS (CV396200-expanded) SEQ ID NO: 6: NaturalAntisense sequence (CV428275) 0039. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As wed herein, the singular forms SEQ ID NO: 7: Natural Antisense Sequence (BE717453) “a”, “an and “the are intended to include the plural forms as SEQ ID NO: 8: Natural Antisense Sequence (AV718812) well, unless the context clearly indicates otherwise. Further more, to the extent that the terms “including”, “includes”, 0036 SEQID NO: 9: Natural SIRT1 antisense sequence “having”, “has”, “with, or variants thereofare used in either (AW169958) the detailed description and/or the claims, such terms are SEQ ID NO: 10 Natural SIRT1 mouse antisense sequence intended to be inclusive in a manner similar to the term (AKO44604) “comprising.” SEQ ID NO: 11: Natural SIRT3 antisense sequence (Hs. 0040. The term “about' or “approximately” means within 683.117) an acceptable error range for the particular value as deter SEQ ID NO: 12: Natural SIRT3 antisense sequence mined by one of ordinary skill in the art, which will depend in (DA645474) part on how the value is measured or determined, i.e., the SEQ ID NO: 13: Natural SIRT6 antisense sequence limitations of the measurement system. For example, “about can mean within 1 or more than 1 Standard deviation, per the (BF772662) practice in the art. Alternatively. “about can mean a range of SEQ ID NO: 14: Natural SIRT6 antisense sequence up to 20%, preferably up to 10%, more preferably up to 5%, (ANKRD24) and more preferably still up to 1% of a given value. Alterna SEQ ID NOs: 15 to 94: Antisense oligonucleotides, * indi tively, particularly with respect to biological systems or pro cates phosphothioate bond, +indicates LNA and m indicates cesses, the term can mean within an order of magnitude, 2"O Me preferably within 5-fold, and more preferably within 2-fold, SEQ ID NO:95 to 98 SEQ 95 correspond to the exon 4 of of a value. Where particular values are described in the appli the SIRT1 natural antisense CV396200, SEQID NO: 96, 97 cation and claims, unless otherwise stated the term “about and 98 correspond to the forward primer sequence, reverse meaning within an acceptable error range for the particular primer sequence and the reporter sequence respectively. value should be assumed. US 2012/O252869 A1 Oct. 4, 2012

0041 As used herein, the term “mRNA' means the pres philic, inducing special secondary structures like, for ently known mRNA transcript(s) of a targeted gene, and any example, alanine containing peptides that induce alpha-heli further transcripts which may be elucidated. CCS. 0042. By “antisense oligonucleotides' or “antisense com 0046. As used herein “Sirtuins (SIRT)s are inclusive of pound is meant an RNA or DNA molecule that binds to all family members, mutants, alleles, fragments, species, cod another RNA or DNA (target RNA, DNA). For example, if it ing and noncoding sequences, sense and antisense polynue is an RNA oligonucleotide it binds to another RNA target by leotide Strands, etc. means of RNA-RNA interactions and alters the activity of the 0047. As used herein, the words Sirtuin1, SIRT1, sirtuin, target RNA. An antisense oligonucleotide can upregulate or silent mating type information regulation 2 homolog 1, downregulate expression and/or function of a particular poly hSIR2, hSIRT1, NAD-dependent deacetylase sirtuin-1, nucleotide. The definition is meant to include any foreign SIR2L1, SIR2-like protein 1, are considered the same in the RNA or DNA molecule which is useful from a therapeutic, literature and are used interchangeably in the present appli diagnostic, or other viewpoint. Such molecules include, for cation. example, antisense RNA or DNA molecules, interference 0048. As used herein, the words Sirtuin 3, Sirtuin3, Sir RNA (RNAi), micro RNA, decoy RNA molecules, siRNA, tuin-3, SIRT3, SIRT3, hSIRT3, NAD-dependent deacetylase enzymatic RNA, therapeutic editing RNA and agonist and sirtuin-3, mitochondrial, SIR2L3, SIR2-like protein 3 are antagonist RNA, antisense oligomeric compounds, antisense used interchangeably in the present application. oligonucleotides, external guide sequence (EGS) oligonucle 0049. As used herein, the words Sirtuin 6, Sirtuiné, Sir otides, alternate splicers, primers, probes, and other oligo tuin-6, SIRT6, SIRT6, NAD-dependent deacetylase sirtuin meric compounds that hybridize to at least a portion of the 6, SIR2L6, SIR2-like protein 6 are considered the same in the target nucleic acid. As such, these compounds may be intro literature and are used interchangeably in the present appli duced in the form of single-stranded, double-stranded, par cation. tially single-stranded, or circular oligomeric compounds. 0050. As used herein, the term "oligonucleotide specific 0043. In the context of this invention, the term "oligo for or "oligonucleotide which targets’ refers to an oligo nucleotide' refers to an oligomer or polymer of ribonucleic nucleotide having a sequence (i) capable of forming a stable acid (RNA) or deoxyribonucleic acid (DNA) or mimetics complex with a portion of the targeted gene, or (ii) capable of thereof. The term "oligonucleotide', also includes linear or forming a stable duplex with a portion of a mRNA transcript circular oligomers of natural and/or modified monomers or of the targeted gene. Stability of the complexes and duplexes linkages, including deoxyribonucleosides, ribonucleosides, can be determined by theoretical calculations and/or in vitro Substituted and alpha-anomeric forms thereof, peptide assays. Exemplary assays for determining stability of hybrid nucleic acids (PNA), locked nucleic acids (LIMA), phospho ization complexes and duplexes are described in the rothioate, methylphosphonate, and the like. Oligonucleotides Examples below. are capable of specifically binding to a target poly-nucleotide 0051. As used herein, the term “target nucleic acid by way of a regular pattern of monomer-to-monomer inter encompasses DNA, RNA (comprising premRNA and actions, such as Watson-Crick type of base pairing, Hoðgs mRNA) transcribed from such DNA, and also cDNA derived teen or reverse Hoogsteen types of base pairing, or the like. from Such RNA, coding, noncoding sequences, sense or anti 0044) The oligonucleotide may be “chimeric', that is, sense polynucleotides. The specific hybridization of an oli composed of different regions. In the context of this invention gomeric compound with its target nucleic acid interferes with "chimeric' compounds are oligonucleotides, which contain the normal function of the nucleic acid. This modulation of two or more chemical regions, for example, DNA region(s), function of a target nucleic acid by compounds, which spe RNA region(s), PNA region(s) etc. Each chemical region is cifically hybridize to it, is generally referred to as “antisense”. made up of at least one monomer unit, i.e., a nucleotide in the The functions of DNA to be interfered include, for example, case of an oligonucleotides compound. These oligonucle replication and transcription. The functions of RNA to be otides typically comprise at least one region wherein the interfered, include all vital functions such as, for example, oligonucleotide is modified in order to exhibit one or more translocation of the RNA to the site of protein translation, desired properties. The desired properties of the oligonucle translation of protein from the RNA, splicing of the RNA to otide include, but are not limited, for example, to increased yield one or more mRNA species, and catalytic activity which resistance to nuclease degradation, increased cellular uptake, may be engaged in or facilitated by the RNA. The overall and/or increased binding affinity for the target nucleic acid. effect of such interference with target nucleic acid function is Different regions of the oligonucleotide may therefore have modulation of the expression of an encoded product or oli different properties. The chimeric oligonucleotides of the gonucleotides. present invention can be formed as mixed structures of two or 0052 RNA interference “RNAi is mediated by double more oligonucleotides, modified oligonucleotides, oligo stranded RNA (dsRNA) molecules that have sequence-spe nucleotides and/or oligonucleotide analogs as described cific homology to their “target nucleic acid sequences. In above. certain embodiments of the present invention, the mediators 0045. The oligonucleotide can be composed of regions are 5-25 nucleotide “small interfering RNA duplexes (siR that can be linked in “register that is, when the monomers are NAs). The siRNAs are derived from the processing of dsRNA linked consecutively, as in native DNA, or linked via spacers. by an RNase enzyme known as Dicer, siRNA duplex products The spacers are intended to constitute a covalent “bridge' are recruited into a multi-protein siRNA complex termed between the regions and have in cases a length not exceeding RISC (RNA Induced Silencing Complex). Without wishing about 100 carbon atoms. The spacers may carry different to be bound by any particular theory, a RISC is then believed functionalities, for example, having positive or negative to be guided to a target nucleic acid (suitably mRNA), where charge, carry special nucleic acid binding properties (intcre the siRNA duplex interacts in a sequence-specific way to alators, groove binders, toxins, fluorophors etc.), being lipo mediate cleavage in a catalytic fashion. Small interfering US 2012/O252869 A1 Oct. 4, 2012

RNAs that can be used in accordance with the present inven pyrimidine heterocycles-containing molecules, but also het tion can be synthesized and used according to procedures that erocyclic analogues and tautomers thereof illustrative are well known in the art and that will be familiar to the examples of other types of nucleotides are molecules contain ordinarily skilled artisan. Small interfering RNAs for use in ing adenine, guanine, thymine, cytosine, uracil, purine, Xan the methods of the present invention suitably comprise thine, diaminopurine, 8-oxo-N6-methyladenine, 7-deaZax between about 1 to about 50 nucleotides (nt). In examples of anthine, deazaguanine, N4.N4-ethanocytosin, N6.N6 non limiting embodiments, siRNAS can comprise about 5 to ethano-2,6-diaminopurine, 5-methylcytosine, 5-(C3-C6)- about 40 nt, about 5 to about 30 nt, about 10 to about 30 nt, alkynylcytosine, 5-fluorouracil, 5-bromouracil, about 15 to about 25 nt, or about 20-25 nucleotides. pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridin, 0053 Selection of appropriate oligonucleotides is facili isocytosine, isoguanin, inosine and the “non-naturally occur tated by using computer programs that automatically align ring nucleotides described in U.S. Pat. No. 5,432.272, The nucleic acid sequences and indicate regions of identity or term “nucleotide' is intended to cover every and all of these homology. Such programs are used to compare nucleic acid examples as well as analogues and tautomers thereof. Espe sequences obtained, for example, by searching databases cially interesting nucleotides are those containing adenine, Such as GenBank or by sequencing PCR products. Compari guanine, thymine, cytosine, and uracil, which are considered Son of nucleic acid sequences from a range of species allows as the naturally occurring nucleotides in relation, to therapeu the selection of nucleic acid sequences that display an appro tic and diagnostic application in humans. Nucleotides include priate degree of identity between species. In the case of genes the natural 2'-deoxy and 2'-hydroxyl Sugars, e.g., as described that have not been sequenced, Southern blots are performed to in Komberg and Baker, DNA Replication, 2nd Ed. (Freeman, allow a determination of the degree of identity between genes San Francisco, 1992) as well as their analogs. in target species and other species. By performing Southern 0.058 Analogs in reference to nucleotides includes syn blots at varying degrees of stringency, as is well known in the thetic nucleotides having modified base moieties and/or art, it is possible to obtain an approximate measure of identity. modified Sugar moieties. Such analogs include synthetic These procedures allow the selection of oligonucleotides that nucleotides designed to enhance binding properties, e.g., exhibit a high degree of complementarity to target nucleic duplex or triplex stability, specificity, or the like. acid sequences in a subject to be controlled and a lower degree 0059. As used herein, “hybridization” means the pairing of complementarity to corresponding nucleic acid sequences of Substantially complementary strands of oligomeric com in other species. One skilled in the art will realize that there is pounds. One mechanism of pairing involves hydrogen bond considerable latitude in selecting appropriate regions of ing, which may be Watson-Crick, Hoogsteen or reversed genes for use in the present invention. Hoögsteen hydrogen bonding, between complementary 0054 By “enzymatic RNA is meant an RNA molecule nucleoside or nucleotide bases (nucleotides) of the strands of with enzymatic activity. Enzymatic nucleic acids (ribozymes) oligomeric compounds. For example, adenine and thymine act by first binding to a target RNA. Such binding occurs are complementary nucleotides which pair through the for through the target binding portion of an enzymatic nucleic mation of hydrogen bonds. Hybridization can occur under acid which is held in close proximity to an enzymatic portion varying circumstances. of the molecule that acts to cleave the target RNA. Thus, the 0060 An antisense compound is “specifically hybridiz enzymatic nucleic acid first recognizes and then binds a target able' when binding of the compound to the target nucleic acid RNA through base pairing, and once bound to the correct site, interferes with the normal function of the target nucleic acid acts enzymatitally to cut the target RNA. to cause a modulation of function and/or activity, and there is 0055. By “decoy RNA is meant an RNA molecule that a sufficient degree of complementarity to avoid non-specific mimics the natural binding domain for a ligand. The decoy binding of the antisense compound to non-target nucleic acid RNA therefore competes with natural binding target for the sequences under conditions in which specific binding is binding of a specific ligand. For example, it has been shown desired, i.e., under physiological conditions in the case of in that over-expression of HIV trans-activation response (TAR) Vivo assays or therapeutic treatment, and under conditions in RNA can act as a “decoy’ and efficiently binds HIV at pro which assays are performed in the case of in vitro assays. tein, thereby preventing it from binding to TAR sequences 0061. As used herein, the phrase “stringent hybridization encoded in the HIV RNA. This is meant to be a specific conditions” or “stringent conditions' refers to conditions example. Those in the art will recognize that this is but one under which a compound of the invention will hybridize to its example, and other embodiments can be readily generated target sequence, but to a minimal number of other sequences. using techniques generally known in the art. Stringent conditions are sequence-dependent and will be dif 0056. As used herein, the term “monomers’ typically indi ferent in different circumstances and in the context of this cates monomers linked by phosphodiester bonds or analogs invention, “stringent conditions’ under which oligomeric thereof to form oligonucleotides ranging in size from a few compounds hybridize to a target sequence are determined by monomeric units, e.g., from about 3-4, to about several hun the nature and composition of the oligomeric compounds and dreds of monomeric units. Analogs of phosphodiester link the assays in which they are being investigated. In general, ages include: phosphorothioate, phosphorodithioate, meth stringent hybridization conditions comprise low concentra ylphosphomates, phosphoroselenoate, phosphoramidate, and tions (<0.15M) of salts with inorganic cations such as Na++ the like, as more fully described below. or K++(i.e., low ionic strength), temperature higher than 20° 0057 The term “nucleotide' covers naturally occurring C.-25° C. below the Tm of the oligomeric compound target nucleotides as well as nonnaturally occurring nucleotides. It sequence complex, and the presence of denaturants such as should be clear to the person skilled in the art that various formamide, dimethylformamide, dimethyl sulfoxide, or the nucleotides which previously have been considered “non detergent sodium dodecyl sulfate (SDS). For example, the naturally occurring have Subsequently been found in nature. hybridization rate decreases 1.1% for each 1% formamide. Thus, “nucleotides’ includes not only the known purine and An example of a high Stringency hybridization condition is US 2012/O252869 A1 Oct. 4, 2012

0.1x sodium chloride-sodium citrate buffer (SSC)/0.1% about 30° C. for short oligonucleotides (e.g., 10 to 50 nucle (w/v) SDS at 60° C. for 30 minutes. otide). Stringent conditions may also be achieved with the 0062 “Complementary, as used herein, refers to the addition of destabilizing agents such as formamide. capacity for precise pairing between two nucleotides on one 0065. As used herein, “modulation” means either an or two oligomeric Strands. For example, if a nucleobase at a increase (stimulation) or a decrease (inhibition) in the expres certain position of an antisense compound is capable of Sion of a gene. hydrogen bonding with a nucleobase at a certain position of a 0066. The term “variant, when used in the context of a target nucleic acid, said target nucleic acid being a DNA, polynucleotide sequence, may encompass a polynucleotide RNA, or oligonucleotide molecule, then the position of sequence related to a wildtype gene. This definition may also hydrogen bonding between the oligonucleotide and the target include, for example, “allelic,” “splice.” “species,” or “poly nucleic acid is considered to be a complementary position. morphic' variants. A splice variant may have significant iden The oligomeric compound and the further DNA, RNA, or tity to a reference molecule, but will generally have a greater oligonucleotide molecule are complementary to each other or lesser number of polynucleotides due to alternate splicing when a Sufficient number of complementary positions in each of exons during mRNA processing. The corresponding molecule are occupied by nucleotides which can hydrogen polypeptide may possess additional functional domains oran bond with each other. Thus, “specifically hybridizable' and absence of domains. Species variants are polynucleotide “complementary are terms which are used to indicate a sequences that vary from one species to another. Of particular Sufficient degree of precise pairing or complementarity overa utility in the invention are variants of wildtype gene products. sufficient number of nucleotides such that stable and specific Variants may result from at least one mutation sin the nucleic binding occurs between the oligomeric compound and a tar acid sequence and may result in altered mRNAS or in get nucleic acid. polypeptides whose structure or function may or may not be 0063. It is understood in the art that the sequence of an altered. Any given natural or recombinant gene may have oligomeric compound need not be 100% complementary to none, one, or many allelic forms. Common mutational that of its target nucleic acid to be specifically hybridizable. changes that give rise to variants are generally ascribed to Moreover, an oligonucleotide may hybridize over one or natural deletions, additions, or Substitutions of nucleotides. more segments such that intervening or adjacent segments are Each of these types of changes may occur alone, or in com not involved in the hybridization event (e.g., a loop structure, bination with the others, one or more times in a given mismatch or hairpin structure). The oligomeric compounds of Sequence. the present invention comprise at least about 70%, or at least 0067. The resulting polypeptides generally will have sig about 75%, or at least about 80%, or at least about 85%, or at nificantamino acid identity relative to each other. A polymor least about 90%, or at least about 95%, or at least about 99% phic variant is a variation in the polynucleotide sequence of a sequence complementarity to a target region within the target particular gene between individuals of a given species. Poly nucleic acid sequence to which they are targeted. For morphic variants also may encompass 'single nucleotide example, an antisense compound in which 18 of 20 nucle otides of the antisense compound are complementary to a polymorphisms” (SNPs) or single base mutations in which target region, and would therefore specifically hybridize, the polynucleotide sequence varies by one base. The presence would represent 90 percent complementarity. In this of SNPs may be indicative of, for example, a certain popula example, the remaining noncomplementary nucleotides may tion with a propensity for a disease state, that is Susceptibility be clustered or interspersed with complementary nucleotides virus resistance. and need not be contiguous to each other or to complementary 0068 Derivative polynucleotides include nucleic acids nucleotides. AS Such, an antisense compound which is 18 Subjected to chemical modification, for example, replace nucleotides in length having 4 (four) noncomplementaty ment of hydrogen by an alkyl, acyl, or amino group. Deriva nucleotides which are flanked by two regions of complete tives, e.g., derivative oligonucleotides, may comprise non complementarity with the target nucleic acid would have naturally-occurring portions, such as altered Sugar moieties 77.8% overall complementarity with the target nucleic acid orinter-Sugar linkages. Exemplary among these are phospho and would thus fall within the scope of the present invention. rothioate and other Sulfur containing species which am Percent complementarity of an antisense compound with a known in the art. Derivative nucleic acids may also contain region of a trget nucleic acid can be determined routinely labels, including radionucleotides, enzymes, fluorescent using BLAST programs (basic local alignment search tools) agents, chemiluminescent agents, chromogenic agents, Sub and Powei BLAST programs known in the art. Percent homol strates, cofactors, inhibitors, magnetic particles, and the like. ogy, sequence identity or complementarity, can be deter 0069. A "derivative' polypeptide or peptide is one that is mined by, for example, the Gap program (Wisconsin modified, for example, by glycosylation, pegylation, phos Sequence Analysis Package, Version 8 for Unix, Genetics phorylation, Sulfation, reduction/alkylation, acylation, Computer Group, University Research Park, Madison Wis.), chemical coupling, or mild formalin treatment. A derivative using default settings, which uses the algorithm of Smith and may also be modified to contain a detectable label, either Waterman (Adv. Appl. Math., (1981)2, 482-489). directly or indirectly, including, but not limited to, a radio 0064. As used herein, the term “Thermal Melting Point isotope, fluorescent, and enzyme label. (Tm) refers to the temperature, under defined ionic strength, (0070. As used herein, the term “animal” or “patient” is pH, and nucleic acid concentration, at which 50% of the meant to include, for example, humans, sheep, elks, deer, oligonucleotides complementary to the target sequence mule deer, minks, mammals, monkeys, horses, cattle, pigs, hybridize to the target sequence at equilibrium. Typically, goats, dogs, cats, rats, mice, birds, chicken, reptiles, fish, stringent conditions will be those in which the salt concen insects and arachnids. tration is at least about 0.01 to 1.0 MNaion concentration (or (0071 "Mammal’ covers warm blooded mammals that are other salts) at pH 7.0 to 8.3 and the temperature is at least typically under medical care (e.g., humans and domesticated US 2012/O252869 A1 Oct. 4, 2012

animals). Examples include feline, canine, equine, bovine, include, but are not limited to, bipolar disorder and schizo and human, as well as just human. phrenia, are also included in the definition of neurological 0072 “Treating or “treatment” covers the treatment of a disorder. The following is a list of several neurological disor disease-state in a mammal, and includes: (a) preventing the ders, symptoms, signs and syndromes that can be treated disease-state from occurring in a mammal, in particular, when using compositions and methods according to the present Such mammal is predisposed to the disease-state but has not invention: acquired epileptiform aphasia; acute disseminated yet been diagnosed as having it; (b) inhibiting the disease encephalomyelitis; adrenoleukodystrophy; age-related state, e.g., arresting it development; and/or (c) relieving the macular degeneration; agenesis of the corpus calloSum; agno disease-state, e.g., causing regression of the disease state until sia; Aicardi syndrome; Alexander disease; Alpers disease; a desired endpoint is reached. Treating also includes the ame alternating hemiplegia; Vascular dementia; amyotrophic lat lioration of a symptom of a disease (e.g., lessen the pain or eral Sclerosis; anencephaly; Angelman syndrome; angioma discomfort), wherein Such amelioration may or may not be tosis; anoxia; aphasia; apraxia; arachnoid cysts, arachnoidi directly affecting the disease (e.g., cause, transmission, tis; Anronl-Chiari malformation; arteriovenous expression, etc.). malformation; Asperger syndrome; ataxia telegiectasia; 0073. As used herein, "cancer refers to all types of cancer attention deficit hyperactivity disorder, autism; autonomic or neoplasm or malignant tumors found in mammals, includ dysfunction; back pain; Batten disease; Behcet's disease; ing, but not limited to: leukemias, lymphomas, melanomas, Bell's palsy, benign essential blepharospasm; benign focal; carcinomas and sarcomas. The cancer manifests itself as a amyotrophy; benign intracranial hypertension; Binswanger's "tumor or tissue comprising malignant cells of the cancer. disease; blepharospasm; Bloch Sulzberger syndrome; bra Examples of tumors include Sarcomas and carcinomas Such chial plexus injury; brain abscess; brain injury; brain tumors as, but not limited to: fibrosarcoma, myxosarcoma, liposar (including glioblastoma multiforme); spinal tumor, Brown coma, chondrosarcoma, osteogenic sarcoma, chordoma, Sequard syndrome; Canavan disease; carpal tunnel Syn angiosarcoma, endotheliosarcoma, lymphangiosarcoma, drome; causalgia; central pain syndrome; central pontine lymphangioendotheliosarcoma, synovioma, mesothelioma, myclinolysis; cephalic disorder; cerebral aneurysm; cerebral Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon arteriosclerosis; cerebral atrophy; cerebral gigantism; cere carcinoma, pancreatic cancer, breast cancer, ovarian cancer, bral palsy; Charcot-Marie-Tooth disease; chemotherapy-in prostate cancer, squamous cell carcinoma, basal cell carci duced neuropathy and neuropathic pain; Chiari malforma noma, adenocarcinoma, Sweat gland carcinoma, sebaceous tion; chorea; chronic inflammatory demyelinating gland carcinoma, papillary carcinoma, papillary adenocarci polyneuropathy; chronic pain; chronic regional pain Syn nomas, cystadenocarcinoma, medullary carcinoma, bron drome; Coffin Lowry syndrome; coma, including persistent chogenic carcinoma, renal cell carcinoma, hepatoma, bile Vegetative state; congenital facial diplegia; corticobasal duct carcinoma, choriocarcinoma, seminoma, embryonal degeneration; cranial arteritis; craniosynostosis; Creutzfeldt carcinoma, Wilms tumor, cervical cancer, testicular tumor, Jakob disease; cumulative trauma disorders; Cushing's Syn lung carcinoma, Small cell lung carcinoma, bladder carci drome; cytomegalic inclusion body disease; cytomegalovirus noma, epithelial carcinoma, glioma, astrocytoma, medullo infection; dancing eyes-dancing feet syndrome; Dandy blastoma, craniopharyngioma, ependymoma, pinealoma, Walker syndrome; Dawson disease; De Morsier's syndrome: hemangioblastoma, acoustic neuroma, oligodendroglioma, Dejerine-Klumke palsy, dementia; dermatomyositis; dia meningioma, melanoma, neuroblastoma, and retinoblas betic neuropathy; diffuse Sclerosis; dysaulonomia; dys toma. Additional cancers which can be treated by the dis graphia; dyslexia; dystonias; early infantile epileptic closed composition according to the invention include but not encephalopathy; empty sella syndrome; encephalitis; limited to, for example, Hodgkin's Disease, Non-Hodgkin’s encephaloceles; encephalotrigeminal angiomatosis; epi Lymphoma, multiple myeloma, neuroblastoma, breast can lepsy; Erb's palsy; essential tremor, Fabry's disease; Fahr's cer, ovarian cancer, lung cancer, rhabdomyosarcoma, pri syndrome; fainting; familial spastic paralysis; febrile sei mary thrombocytosis, primary macroglobulinemia, Small Zures; Fisher syndrome; Friedreich's ataxia; fronto-temporal cell lung tumors, primary brain tumors, stomach cancer, dementia and other “tauopathies'; Gaucher's disease; Gerst colon cancer, malignant pancreatic insulanoma, malignant mann's syndrome; giant cell arteritis; giant cell inclusion carcinoid, urinary bladder cancer, premalignant skin lesions, disease; globoid cell leukodystrophy: Guillain-Barre syn testicular cancer, lymphomas, thyroid cancer, neuroblastoma, drome; HTLV-1-associated myelopathy; Hallervorden-Spatz esophageal cancer, genitourinary tract cancer, malignant disease; head injury; headache; hemifacial spasm; hereditary hypercalcemia, cervical cancer, endometrial cancer, adrenal spastic paraplegia; heredopathia atactic a polyneuritiformis; cortical cancer, and prostate cancer. herpes Zosteroticus; herpes Zoster; Hirayama syndrome; HIV 0074 “Neurological disease or disorder refers to any dis associated dementia and neuropathy (also neurological mani ease or disorder of the nervous system and/or visual system. festations of AIDS); holoprosencephaly: Huntington's dis “Neurological disease or disorder include disease or disor ease and other polyglutamine repot diseases; hydranenceph ders that involve the central nervous system (brain, brainstem aly; hydrocephalus; hypercortisolism; hypoxia; immune and cerebellum), the peripheral nervous system (including mediated encephalomyelitis; inclusion body myositis; cranial nerves), and the autonomic nervous system (parts of incontinentia pigmenti; infantile phytanic acid storage dis which are located in both central and peripheral nervous ease; infantile refsum disease; infantile spasms; inflamma system). Examples of neurological disorders include but are tory myopathy; intracranial cyst; intracranial hypertension; not limited to, headache, stupor and coma, dementia, seizure, Joubert syndrome; Keams-Sayre syndrome; Kennedy disease sleep disorders, trauma, infections, neoplasms, neuroopthal Kinsboume syndrome; Klippel Fell syndrome; Krabbe dis mology, movement disorders, demyelinating diseases, spinal ease; Kugelberg-Welander disease; kuru; Lafora disease; cord disorders, and disorders of peripheral nerves, muscle Lambert-Eaton myasthenic syndrome; Landau-Kleffner Syn and neuromuscular junctions. Addiction and mental illness, drome; lateral medullary (Wallenberg) syndrome; learning US 2012/O252869 A1 Oct. 4, 2012 disabilities; Leigh's disease; Lennox-Gustaut Syndrome; syndrome; Werdnig-Hoffman disease; West syndrome; whip Lesch-Nyhan syndrome; leukodystrophy; Lewy body lash; Williams syndrome: Wildon's disease; and Zellweger dementia; Lissencephaly; locked-in syndrome; Lou Gehrig's syndrome. disease (i.e., motor neuron disease or amyotrophic lateral (0075 "Metabolic disease” refers to a wide range of dis Sclerosis); lumbar disc disease; Lyme disease-neurological eases and disorders of the endocrine system including, for sequelae; Machado-Joseph disease; macrencephaly: mega example, insulin resistance, diabetes, obesity, impaired glu lencephaly: Melkersson-Rosenthal syndrome: Menieres dis cose tolerance, high blood cholesterol, hyperglycemia, dys ease; meningitis; Menkes disease; metachromatic leukodys lipidemia and hyperlipidemia. trophy; microcephaly; migraine; Miller Fisher syndrome; 0076 An “Inflammation” refers to systemic inflammatory mini-strokes; mitochondrial myopathies; Mobius syndrome; conditions and conditions associated locally with migration monomelic amyotrophy; motor neuron disease; Moyamoya and attraction of monocytes, leukocytes and/or neutrophils. disease; mucopolysaccharidoses; milti-infant dementia; mul Examples of inflammation include, but are not limited to, tifocal motor neuropathy; multiple Sclerosis and other demy Inflammation resulting from infection with pathogenic elinating disorders; multiple system atrophy with postural organisms (including grain-positive bacteria, gram-negative hypotension; p muscular dystrophy; myasthenia gravis; bacteria, viruses, fungi, and parasites such as protozoa and myelinoclastic diffuse Sclerosis; myoclonic encephalopathy helminths), transplant rejection (including rejection of Solid of infants; myoclonus; myopathy; myotonia congenital; nar organs such as kidney, liver, heart, lung or cornea, as well as colepsy; neurofibromatosis; neuroleptic malignant Syn rejection of bone marrow transplants including graft-Versus host disease (GVHD)), or from localized chronic or acute drome; neurological manifestations of AIDS; neurological autoimmune or allergic reactions. Autoimmune diseases sequelae oflupus; neuromyotonia; neuronal ceroid lipofusci include acute glomerulonephritis; rheumatoid or reactive nosis; neuronal migration disorders; Niemann-Pick disease; arthritis; chronic glornertilonephritis; inflammatory bowel O'Sullivan-McLeod syndrome; occipital neuralgia; occult diseases such as Crohn's disease, ulcerative colitis and necro spinal dysraphism sequence; Ohtahara syndrome; olivopon tizing enterocolitis; granulocyte transfusion associated Syn tocerebellar atrophy; opSoclonus myoclonus; optic neuritis; dromes; inflammatory dermatoses such as contact dermatitis, orthostatic hypotension; overuse syndrome; paresthesia; atopic dermatitis, psoriasis; systemic lupus erythematosus Neurodegenerative disease or disorder (Parkinson's disease, (SLE), autoimmune thyroiditis, multiple Sclerosis, and some Huntington's disease, Alzheimer's disease, amyotrophic lat forms of diabetes, or any other autoimmune state where eral sclerosis (ALS), dementia, multiple sclerosis and other attack by the subject's own immune system results in patho diseases and disorders associated with neuronal cell death); logic tissue destruction. Allergic reactions include allergic paramyotonia congenital; paraneoplastic diseases; paroxyS asthma, chronic bronchitis, acute and delayed hypersensitiv mal attacks; Parry Romberg syndrome: Pelizaeus-Merz ity. Systemic inflammatory disease states include inflamma bacher disease; periodic paralyses; peripheral neuropathy; tion associated with trauma, burns, reperfusion following painful neuropathy and neuropathic pain; persistent vegeta ischemic events (e.g. thrombotic events in heart, brain, intes tive state; pervasive developmental disorders: photic Sneeze: tines or peripheral vasculature, including myocardial infarc reflex; phytanic acid storage disease; Pick's disease; pinched tion and stroke), sepsis, ARDS or multiple organ dysfunction nerve: pituitary tumors; polymyositis; porencephaly; post syndrome inflammatory cell recruitment also occurs in ath polio syndrome; postherpetic neuralgia; postinfectious erosclerotic plaques. Inflammation includes, but is not lim encephalomyelitis; postural hypotension; Prader-Willi syn ited to, Non-Hodgkin’s lymphoma, Wegener's granulomato drome; primary lateral Sclerosis; prion diseases; progressive sis, Hashimoto's thyroiditis, hepatocellular carcinoma, hemifacial atrophy; progressive multifocalleukoencephal thymus atrophy, chronic pancreatitis, rheumatoid arthritis, opathy; progressive Sclerosing poliodystrophy; progressive reactive lymphoid hyperplasia, osteoarthritis, ulcerative coli Supranuclearpalsy, pseudotumor cerebri; Ramsay-Hunt Syn tis, papillary carcinoma, Crohn's disease, ulcerative colitis, drome (types 1 and 11); Rasmussen's encephalitis; reflex acute cholecystitis, chronic cholecystitis, cirrhosis, chronic sympathetic dystrophy syndrome; Refsum disease; repetitive sialadenitis, peritonitis, acute pancreatitis, chronic pancreati motion disorders; repetitive stress injuries; restless legs Syn tis, chronic Gastritis, adenomyosis, endometriosis, acute cer drome; retrovirus-associated myelopathy: Rett syndrome; viciitis, chronic cerviciitis, lymphoid hyperplasia, multiple iReye's syndrome: Saint Vitus dance: Sandhoff disease: Sclerosis, hypertrophy secondary to idiopathic thrombocy Schilder's disease; schizencephaly; Septo-optic dysplasia; topenic purpura, primary IgA nephropathy, systemic lupus shaken baby syndrome; shingles; Shy-Drager syndrome; erythematosus, psoriasis, pulmonary emphysema, chronic Sjogren's syndrome; sleep apnea; Soto's syndrome; spastic pyelonephritis, and chronic cystitis. ity; spina bifida; spinal cord injury; spinal cord tumors; spinal 0077. A cardiovascular disease or disorder includes those muscular atrophy; Stiff-Person syndrome; stroke: Sturge disorders that can either cause ischemia or are caused by Weber syndrome; Subacute Sclerosing panencephalitis; Sub reperfusion of the heart. Examples include, but are not limited cortical arteriosclerotic encephalopathy; Sydenham chorea; to, atherosclerosis, coronary artery disease, granulomatous Syncope; syringomyelia; tardive dyskinesia; lay-Sachs dis myocarditis, chronic myocarditis (non-granulomatous), pri ease temporal arteritis; tethered spinal cord syndrome; Thom mary hypertrophic cardiomyopathy, peripheral artery disease Sen disease; thoracic outlet syndrome; Tic Douloureux; (PAD), stroke, angina pectoris, myocardial infarction, cardio Todd's paralysis; Tourette syndrome; transient ischemic vascular tissue damage caused by cardiac arrest, cardiovas attack; transmissible spongiform encephalopathies; trans cular tissue damage caused by cardiac bypass, cardiogenic verse myelitis; traumatic brain injury; tremor, trigeminal neu shock, and related conditions that would be known by those of ralgia; tropical spastic paraparesis; tuberous Sclerosis; Vascu ordinary skill in the art or which involve dysfunction of or lar dementia (multi-infarct dementia); vasculitis including tissue damage to the heart or vasculature, especially, but not temporal arteritis; Von Hippel-Lindau disease; Wallenberg's limited to, tissue damage related to Sirtuin3 activation. CVS US 2012/O252869 A1 Oct. 4, 2012

diseases include, but are not limited to, atherosclerosis, I0085 SIRT3 is a major mitochondrial deacetylase. Mito granulomatous myocarditis, myocardial infarction, myocar chondrial proteins show hyperacetylation in SIRT3 knockout dial fibrosis secondary to valvular heart disease, myocardial mice, but not in SIRT4 or SIRT5 knockout mice. Acetyl-CoA fibrosis without infarction, primary hypertrophic cardiomy synthetase 2 (AceCS2), a mitochondrial enzyme that converts opathy, and chronic myocarditis (non-granulomatous). acetate into acetyl-CoA, was the first mitochondrial substrate of SIRT3 identified, Deacetylation of AceCS2 at lysine 642 Polynucleotide and Oligonucleotide Compositions and Mol by SIRT3 activates acetyl-CoA synthetase activity, providing ecules increased acetyl-CoA to feed into the tricarboxylic acid cycle. Glutamate dehydrogenase (GDII), another mitochondrial Targets protein involved in energy production, is deacetylated by 0078. In one embodiment, the targets comprise nucleic SIRT3, GDH can also be ADP-ribosylated by SIRT4 in turn to acid sequences of a Sirtuin (SIRT), including without limita decrease its enzyme activity. This indicates that SIRT3 could tion sense and/or antisense noncoding and/or coding play an important role in cell metabolism. SIRT3 has also sequences associated with a Sirtuin (SIRT). been shown to be involved in selective apoptosis pathways 0079. In one embodiment, the targets comprise nucleic and cell growth control. SIRT3 and SIRT4, but not SIRT5, acid sequences of SIRT1, including without limitation sense have been implicated in the NAD+ salvage pathway that and/or antisense noncoding and/or coding sequences associ regulates the NAT+ level relating to cell survival. In addition, ated with SIRT1 gene. variability in the hSIRT3 gene has been linked to human 0080. In one embodiment, the targets comprise nucleic longevity. acid sequences of SIRT3, including without limitation sense I0086. The Silent information Regulator-2 gene (Sir2) and/or antisense noncoding and/or coding sequences associ encodes an NAD-dependent histone deacetylase that links ated with SIRT3 gene. regulation of chromatin, genomic stability, and life span in S. 0081. In one embodiment, the targets comprise nucleic cerevisiae. By promoting chromatin silencing, Sir2 inhibits acid sequences of SIRT6, including without limitation sense transcription at several genetic loci and represses recombina and/or antisense noncoding and/or coding sequences associ tion at ribosomal DNA (rDNA) repeats. Yeast with mutations ated with SIRT6 gene. in Sir2 have increased genomic instability in the context of I0082 “SIRT1 protein” refers to a member of the sir2 fam rDNA recombination, which in turn shortens replicative life ily of sirtuin deacetylases. In one embodiment, a SIRT1 pro span—a marker of reproductive aging in this organism. Con tein includes yeast Sir2 (GenBankAccession No. P53685), C. versely, extracopies of Sir2 that suppress rDNA recombina elegans Sir-2.1 (GenBank Accession No. NP sub. 501912), tion increase replicative life span. These effects of Sir2 Sug human SIRT1 (GenBank Accession No. NM. sub. 012238 gest paradigms in which genes that promote genome and NP sub. 036370 (or AF083106)) stabilization through chromatin modulation may be impor I0083. SIRT1 “Sirtuins' are proteins that include a SIR2 tant contributors to regulation of organismal life span, aging, domain, a domain defined as amino acids sequences that are and age-related pathology. scored as hits in the Pfam family “SIR2'-PF02146 (attached 0087 Consistent with a conserved role for Sir2 factors in to the Appendix). This family is referenced in the INTERPRO life span regulation, increased activity of Sir2 proteins in the database as INTERPRO description (entry IPRO03000). To multicellular organisms C. elegans and D. melanogaster also identify the presence of a “SIR2 domain in a protein increases life span. However, these Sir2 factors may operate sequence, and make the determination that a polypeptide or through mechanisms that are independent of genome stabili protein of interest has a particular profile, the amino acid Zation, and their physiologic molecular Substrates are still sequence of the protein can be searched against the Pfam unclear. In mammals, there are seven Sir2 family members, database of HMMs (e.g., the Pfam database, release 9) using SIRT1-SIRT7. The SIRTs have been of great interest as can the default parameters (http://www.sanger.ac.uk/Software/ didate regulators of mammalian life span and aging-related Pfam/HMM search). The SIR2 domain is indexed in Pfamas processes. In this context, several mammalian SIRTs have PF02146 and in INTERPRO as INTERPRO description (en functions that impact on aging-associated molecular path try IPRO03000). A description of the Pfam database can be ways and disease. However, initial studies of mammalian found in "The Plain Protein Families Database' Bateman Aet SIRTs linked these enzymes to biochemical targets and cel al. (2002) Nucleic Acids Research 30(1):276-280 and Son lular functions that are distinct from those of. S. cerevisiae hammer et al. (1997) Proteins 28(3):405-420 and a detailed Sir2. description of HMMs can be found, for example, in Gribskov I0088. The generation of mice deficient for the mammalian et al. (1990) Meth. Enzymol. 183:146-1.59; Gribskov et al. SIRT6 Rene revealed a potential role for SIRT6 in linking (1987) Proc. Natl. Acad. Sci. USA84:4355-4358; Kroghet at regulation of life span, chromatin, and genomic stability. In (1994) J. Mol. Biol. 235:1501-1531; and Stultz et al. (1993) this context, SIRT6 deficiency in mice leads to dramatically Protein Sci. 2:305-314. shortened life span and acute degenerative phenotypes that 0084 Among the mitochondrial sirtuins, SIRT3 possesses overlap with pathologies of premature aging. Moreover, the most robust deacetylase activity. Indeed, significantly SIRT6 knockout mouse cells have genomic instability and higher levels of mitochondrial protein acetylation were DNA damage hypersensitivity. In biochemical fractionation detected in the livers of SIRT3-null mice, compared to those assays, SIRT6 protein associates preferentially with a chro of SIRT4 or SIRT5 knockout animals. However, little is matin-enriched cellular fraction. Together, these observations known about the physiological role of SIRT3 despite the fact Suggested that SIRT6 might couple chromatin regulation with that a number of SIRT3 substrates and co-precipitating pro DNA repair. However, a physiologic role for SIRT6 in such a teins have been identified: acetyl-CoA synthetase 2, Ku70, process has not yet been demonstrated. FOXO3a, subunit 9 of mitochondrial Complex 1 (NDUFA9), I0089. In some embodiments, antisense oligonucleotides glutamate dehydrogenase and isocitrate dehydrogenase 2. are used to prevent or treat diseases or disorders associated US 2012/O252869 A1 Oct. 4, 2012

with Sirtuin (SIRT) family members. Exemplary Sirtuin treatments. Diagnosis can be made, e.g., based on the Sub (SIRT) mediated diseases and disorders which can be treated ject's SIRT status. A patient's SIRT expression levels in a with cell/tissues regenerated from stem cells obtained using given tissue such as skin can be determined by methods the antisense compounds comprise: cancer (e.g., breast can known to those of skill in the an and described elsewhere cer, colorectal cancer, CCL, CML, prostate cancer), a neuro herein, e.g., by analyzing tissue using PCR or antibody-based degenerative disease or disorder (e.g., Alzheimer's Disease detection methods. (AD), Huntington's disease, Parkinson's disease, Amyo 0092 A preferred embodiment of the present invention trophic Lateral Sclerosis (ALS), Multiple Sclerosis, and dis provides a composition for skin treatment and/or a cosmetic orders caused by polyglutamine aggregation); skeletal application comprising SIRT antisense oligonucleotides, muscle disease (e.g., Duchene muscular dystrophy, skeletal muscle atrophy, Becker's dystrophy, or myotonic dystrophy): e.g., to upregulate expression of SIRT in the skin. Examples a metabolic disease or disorder (e.g., insulin resistance, dia of antisense oligonucleotides are set forth as SEQID NOS: 4 betes, type 2 diabetes, obesity, impaired glucose tolerance, to 16. U.S. Pat. No. 7,544.497, “Compositions for manipu metabolic syndrome, adult-onset diabetes, diabetic nephr lating the lifespan and stress response of cells and organisms.” opathy, hyperglycemia, diabetic nephropathy, Hypercholes incorporated herein by reference, describes potential cos terolemia, dyslipidemia hyperlipidemia and an age-related metic use for agents that modulate Sirtuin activity by reduc metabolic disease etc.), a disease or disorder associates) with ing the K of the Sirtuin protein for its substrate. In embodi impaired regulation of insulin level, neuropathy (e.g., sensory ments, cells are treated in vivo with the oligonucleotides of neuropathy, autonomies neuropathy, motor neuropathy, ret the present invention, to increase cell lifespan or prevent inopathy), a disease or disorder associated with a ketogenic apoptosis. For example, skin can be protected from aging, condition, a disease or disorder associated with impaired e.g., developing wrinkles, by treating skin, e.g., epithelial energy homeostasis, a disease or disorder associated with cells, as described herein. In an exemplary embodiment, skin impaired Acetyl-CoA synthetase 2 activity, a disease or dis is contacted with a pharmaceutical or cosmetic composition order associated with metabolic homeostasis, a lipid metabo comprising a SIRT antisense compound as described herein. lism disease or disorder, a disease or disorder associated with Exemplary skin afflictions or skin conditions include, disor impaired thermogenesis, a disease or disorder associated with ders or diseases associated with or caused by inflammation, mitochondrial dysfunction, neuropathy (e.g., sensory neur Sun damage or natural aging. For example, the compositions opathy, autonomic neuropathy, motor neuropathy, retinopa find utility in the prevention or treatment of contact dermatitis thy), a liver disease (e.g., due to alcohol abuse or hepatitis, (including irritant contact dermatitis and allergic contact der fatty liver disease etc.); age-related macular degeneration, matitis), atopic dermatitis (also known as allergic eczema), bone disease (e.g., osteoporosis), a blood disease (e.g., a actinic keratosis, keratinization disorders (including leukemia); liver disease (e.g.: due to alcohol abuse or hepa eczema), epidermolysis bullosa diseases (including penfi titis); Obesity, bone resorption, age-related macular degen gus), exfoliative dermatitis, seborrheic dermatitis, erythemas eration, AIDS related dementia, ALS, Bell's Palsy, athero (including erythema multiforme and erythema nodosum), Sclerosis, a cardiac disease (e.g., cardiac dysrhymias, chronic damage caused by the Sun or other light Sources, discoid lupus congestive heart failure, ischemic stroke, coronary artery dis erythematosus, dermatomyositis, skin cancer and the effects ease and cardiomyopathy), chronically degenerative disease of natural aging. (e.g., cardiac muscle disease), chronic renal failure, type 2 (0093 Sirtuin has been reported to interfere with dihy diabetes, ulceration, cataract, presbiopia, glomerulonephri drotestosterone-induced androgen receptor signaling. (See, tis, Guillan-Barre Syndrome, hemorrhagic stroke, rheumatoid e.g., Fu, et al., 2006, "Hormonal Control of Androgen Recep arthritis, inflammatory bowel disease, SLE, Crohn's disease, tor Function through SIRT1 Molecular and Cellular Biology osteoarthritis, osteoporosis, Chronic Obstructive Pulmonary 26(21): 8122-8135, incorporated herein by reference.) In Disease (COPP), pneumonia, skin aging, urinary inconti embodiments of the present invention, a composition com nence, a disease or disorder associated with mitochondrial prising SIRT antisense oligonucleotides, e.g., to upregulate dysfunction (e.g., mitochondrial myopathy, encephalopathy, expression of SIRT in the scalp and inhibit androgen receptor Leber's disease, Leigh encephalopathia, Pearson's disease, signaling, thereby preventing androgenetic alopecia (hair lactic acidosis, mitochondrial encephalopathy, lactic acidosis loss). In embodiments, a patient Suffering from alopecia is and stroke like symptoms (MELAS) etc.) and a disease or administered either a topical or systemic formulation. disorder associated with neuronal cell death, degenerative 0094. In an embodiment, an antisense oligonucleotide syndrome, aging, a disease or disorder associated with telom described herein is incorporated into a topical formulation ere dysfunction, a disease or disorder associated with containing a topical carrier that is generally Suited to topical impaired chromatin regulation, a disease or disorder associ drug administration and comprising any such material known ated with premature cellular senescence, a disease or disorder in the art. The topical carrier may be selected so as to provide associated with impared SIRT6 mediated DNA repair and a the composition in the desired form, e.g., as an ointment, condition characterized by unwanted cell loss. lotion, cream, microemulsion, gel, oil, Solution, or the like, 0090. In another embodiment, the antisense oligonucle and may be comprised of a material of either naturally occur otides modulate the normal expression and/or normal func ring or synthetic origin. It is preferable that the selected tion of a Sirtuin (SIRT) in patients suffering from or at risk of carrier not adversely affect the active agent or other compo developing diseases or disorders associated with Sirtuin nents of the topical formulation. Examples of suitable topical (SIRT). carriers for use herein include water, alcohols and other non 0091. In embodiments of the present invention, therapeu toxic organic solvents, glycerin, mineral oil, silicone, petro tic and/or cosmetic regimes and related tailored treatments leum jelly, lanolin, fatty acids, vegetable oils, parabens, are provided to subjects requiring skin treatments or at risk of waxes, and the like. Formulations may be colorless, odorless developing conditions for which they would require skin ointments, lotions, creams, microemulsions and gels. US 2012/O252869 A1 Oct. 4, 2012

0095 Antisense oligonucleotides of the invention may be are useful in the preparation of emulsions, e.g., emulsifiers incorporated into ointments, which generally are semisolid that are typically used in the preparation of creams. The preparations which are typically based on petrolatum or other co-surfactant (or “co-emulsifer') is generally selected from petroleum derivatives. The specific ointment base to be used, the group of polyglycerol derivatives, glycerol derivatives as will be appreciated by those skilled in the art, is one that and fatty alcohols. Preferred emulsifier/co-emulsifier combi will provide for optimum drug delivery, and, preferably, will nations are generally although not necessarily selected from provide for other desired characteristics as well, e.g., emol the group consisting of glyceryl monostearate and polyoxy liency or the like. As with other carriers or vehicles, an oint ethylene Stearate; polyethylene glycol and ethylene glycol ment base should be inert, stable, nonirritating and nonsen palmitostearate; and caprilic and capric triglycerides and ole sitizing. As explained in Remington's Pharmaceutical oyl macrogolglycerides. The water phase includes not only Sciences (Mack Pub. Co.), ointment bases may be grouped water but also, typically, buffers, glucose, propylene glycol, into four classes: oleaginous bases; emulsifiable bases; emul polyethylene glycols, preferably lower molecular weight sion bases; and water-soluble bases. Oleaginous ointment polyethylene glycols (e.g., PEG 300 and PEG 400), and/or bases include, for example, vegetable oils, fats obtained from glycerol, and the like, while the oil phase will generally animals, and semisolid hydrocarbons obtained from petrC comprise, for example, fatty acid esters, modified vegetable leum. Emulsifiable ointment bases, also known as absorbent oils, silicone oils, mixtures of mono- di- and triglycerides, ointment bases, contain little or no water and include, for mono- and di-esters of PEG (e.g., oleoyl macrogol glycer example, hydroxyStearin Sulfate, anhydrous lanolin and ides), etc. hydrophilic petrolatum. Emulsion ointment bases are either 0.098 Antisense oligonucleotides of the invention may be water-in-oil (W/O) emulsions or oil-in-water (O/W) emul incorporated into gel fomutilations, which generally are semi sions, and include, for example, cetyl alcohol, glyceryl Solid systems consisting of either Suspensions made up of monostearate, lanolin and Stearic acid. Exemplary water Small inorganic particles (two-phase systems) or large soluble ointment bases are prepared from polyethylene gly organic molecules distributed stibstantially uniformly cols (PEGs) of varying molecular weight (see, e.g., Reming throughout a carrier liquid (single phase gelS). Single phase ton's, Supra). gels can be made, for example, by combining the active agent, 0096 Antisense oligonucleotides of the invention may be a carrier liquid and a suitable gelling agent Such as tragacanth incorporated into lotions, which generally are preparations to (at 2 to 5%), sodium alginate (at 2-10%), gelatin (at 2-15%), be applied to the skin surface without friction, and are typi methylcellulose (at 3-5%), sodium carboxymethylcellulose cally liquid or semiliquid preparations in which solid par (at 2-5%), carbomer (at 0.3-5%) or polyvinyl alcohol (at ticles, including the active agent, are present in a water or 10-20%) together and mixing until a characteristic semisolid alcohol base. Lotions are usually suspensions of Solids, and product is produced. Other Suitable gelling agents include may comprise a liquid oily emulsion of the oil-in-water type. methylhydroxycellulose, polyoxyethylene-polyoxypropy Lotions are preferred formulations for treating large body lene, hydroxy-ethylcellulose and gelatin. Although gels com areas, because of the ease of applying a more fluid composi monly employ aqueous carrier liquid, alcohols and oils can be tion. It is generally necessary that the insoluble matter in a used as the carrier liquid as well. lotion be finely divided. Lotions will typically contain sus 0099 Various additives, known to those skilled in the art, pending agents to produce better dispersions as well as com may be included in formulations, e.g., topical formulations. pounds useful far localizing and holding the active agent in Examples of additives include, but are not limited to, solubi contact with the skin, e.g., methylcellulose, sodium car lizers, skin permeation enhancers, opacifiers, preservatives boxymethylcellulose, or the like. An exemplary lotion formu (e.g., anti-oxidants), gelling agents, buffering agents, Surfac lation for use in conjunction with the present method contains tants (particularly nonionic and amphoteric Surfactants), propylene glycol mixed with a hydrophilic petrolatum such as emulsifiers, emollients, thickening agents, stabilizers, that which may be obtained under the trademark Aquaphor. humectants, colorants, fragrance, and the like. Inclusion of sup.RTM from Beiersdorf, Inc. (Norwalk, Conn.). solubilizers and/or skin permeation enhancers is particularly 0097 Antisense oligonucleotides of the invention may be preferred, along with emulsifiers, emollients and preserva incorporated into creams, which generally are viscous liquid tives. An optimum topical formulation comprises approxi or semisolid emulsions, either oil-in-water or water-in-oil. mately: 2 wt.% to 60 wt.%, preferably 2 wt.% to 50 wt.%, Cream bases are water-washable, and contain an oil phase, an solubilizer and/or skin permeation enhancer, 2 wt.% to 50 wt. emulsifier and an aqueous phase. The oil phase is generally %, preferably 2 wt.% to 20 wt.%, emulsifiers; 2 wt.% to 20 comprised of petrolatum and a fatty alcohol Such as cetyl or wt.% emollient; and 0.01 to 0.2 wt.% preservative, with the Stearyl alcohol; the aqueous phase usually, although not nec active agent and carrier (e.g., water) making of the remainder essarily, exceeds the oil phase in Volume, and generally con of the formulation. tains a humectant. The emulsifier in a cream formulation, as 0100. A skin permeation enhancer serves to facilitate pas explained in Remington's, Supra, is generally a nonionic, sage of therapeutic levels of active agent to pass through a anionic, cationic or amphoteric Surfactant Antisense oligo reasonably sized area of unbroken skin. Suitable enhancers nucleotides of the invention may be incorporated into micro are well known in the art and include, for example: lower emulsions, which generally are thermodynamically stable, alkanols such as methanol ethanol and 2-propanol; alkyl isotropically clear dispersions of two immiscible liquids, methyl sulfoxides such as dimethylsulfoxide (DMSO), such as oil and water, stabilized by an interfacial film of decylmethylsulfoxide (C. sub.10 MSO) and tetradecylmethyl surfactant molecules (Encyclopedia of Pharmaceutical Tech sulfoxide: pyrrolidones such as 2-pyrrolidone, N-methyl-2- nology (New York: Marcel Dekker, 1992), volume 9). For the pyrrolidone and N-(-hydroxyethyl)pyrrolidone: urea; N.N- preparation of microemulsions, Surfactant (emulsifier), co diethyl-m-toluamide: C. sub.2-C. Sub.6 alkanediols; miscella Surfactant (co-emulsifier), an oil phase and a water phase are neous solvents such as dimethyl formamide (DMF), N.N- necessary. Suitable Surfactants include any surfactants that dimethylacetamide (DMA) and tetrahydrofurfuryl alcohol: US 2012/O252869 A1 Oct. 4, 2012 and the 1-substituted azacycloheptan-2-ones, particularly 0108. In some embodiments, homology, sequence identity 1-n-dodecylcyclazacycloheptan-2-one (laurocapram; avail or complementarity; between the antisense compound and able under the trademark AZone. Sup.RTM from Whitby target is from about 50% to about 60%. In some embodi Research Incorporated, Richmond, Va.). ments, homology, sequence identity or complementarity, is 0101 Examples of solubilizers include, but are not limited from about 60% to about 70%. In some embodiments, homol to, the following: hydrophilic ethers such as diethylene glycol ogy, sequence identity or complementarity, is from about monoethyl ether (ethoxydiglycol, available commercially as 70% to about 80%. In some embodiments, homology, Transcutol.sup.RTM) and diethylene glycol monoethyl ether sequence identity or complementarity, is from about 80% to oleate (available commercially as Soficutol.sup.RTM); poly about 90%. In some embodiments, homology, sequence iden ethylene castor oil derivatives such as polyoxy 35 castor oil, tity or complementarity, is about 90%, about 92%, about polyoxy 40 hydrogenated castor oil, etc.; polyethylene gly 94%, about 95%, about 96%, about 97%, about 98%, about col, particularly lower molecular weight polyethylene glycols 99% or about 100%. such as PEG 300 and PEG 400, and polyethylene glycol 0109 An antisense compound is specifically hybridizable derivatives such as PEG-8 caprylic/capric glycerides (avail when binding of the compound to the target nucleic acid able commercially as Labrasol.sup.RTM); alkyl methyl sul interferes with the normal function of the target nucleic acid foxides such as DMSO; pyrrolidones such as 2-pyrrolidone to cause a loss of activity, and there is a Sufficient degree of and N-methyl-2-pyrrolidone; and DMA. Many solubilizers complementarity to avoid non-specific binding of the anti can also act as absorption enhancers. A single solubilizer may sense compound to non-target nucleic acid sequences under be incorporated into the formulation, or a mixture of solubi conditions in which specific binding is desired. Such condi lizers may be incorporated therein. tions include, i.e., physiological conditions in the case of in 0102 Suitable emulsifiers and co-emulsifiers include, Vivo assays or therapeutic treatment, and conditions in which without limitation, those emulsifiers and co-emulsifiers assays are performed in the case of in vitro assays. described with respect to microemulsion formulations. Emol 0110. An antisense compound, whether DNA, RNA, chi lients include, for example, propylene glycol, glycerol, iso meric, substituted etc., is specifically hybridizable when bind propyl myristate, polypropylene glycol-2 (PPG-2) myristyl ing of the compound to the target DNA or RNA molecule ether propionate, and the like. interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a Sufficient degree of 0103). Other active agents may also be included in formu complementarily to avoid non-specific binding of the anti lations, e.g., other anti-inflammatory agents, analgesics, anti sense compound to non-target sequences under conditions in microbial agents, antifungal agents, antibiotics, vitamins, which specific binding is desired, i.e., under physiological antioxidants, and Sunblock agents commonly found in Sun conditions in the case of in vivo assays or therapeutic treat screen formulations including, but not limited to, anthra ment, and in the case of in vitro assays, under conditions in nilates, benzophenones (particularly benzophenone-3), cam which the assays are performed. phor derivatives, cinnamates (e.g., octyl methoxycinnamate), 0111. In another embodiment, targeting of a Sirtuin dibenzoyl methanes (e.g., butyl methoxydibenzoyl methane), (SIRT) including without limitation, antisense sequences p-aminobenzoic acid (PABA) and derivatives thereof, and which are identified and expanded, using for example, PCR, salicylates (e.g., octyl salicylate). hybridization etc., one or more of the sequences set forth as 0104. In one embodiment the oligonucleotides are specific SEQID NO: 5 to 14, and the like, modulate the expression or for polynucleotides of a Sirtuin (SIRT), which includes, with function of a Sirtuin (SIRT). In one embodiment, expression out limitation noncoding regions. The Sirtuin (SIRT) targets or function is up-regulated as compared to a control. In comprise variants of a Sirtuin (SIRT); mutants of a Sirtuin another embodiment, expression or function is down-regu (SIRT), including SNPs; noncoding sequences of a Sirtuin lated as compared to a control. (SIRT); alleles, fragments and the like. Preferably the oligo 0112. In another embodiment, oligonucleotides comprise nucleotide is an antisense RNA molecule. nucleic acid sequences set forth as SEQ ID NOS: 15 to 94 0105. In accordance with embodiments of the invention, including antisense sequences which are identified and the target nucleic acid molecule is not limited to a Sirtuin expanded, using for example, PCR, hybridization etc. These (SIRT) polynucleotides alone but extends to any of the iso oligonucleotides can comprise one or more modified nucle forms, receptors, homologs, non-coding regions and the like otides, shorter or longer fragments, modified bonds and the of a Sirtuin (SIRT). like. Examples of modified bonds or internucleotide linkages 0106. In another embodiment, an oligonucleotide targets a comprise phosphorothioate, phosphorodithioate or the like. natural antisense sequence (natural antisense to the coding In another embodiment, the nucleotides comprise a phospho and non-coding regions) of a Sirtuin (SIRT) targets, includ rus derivative. The phosphorus derivative (or modified phos ing, without limitation, variants, alleles, homologs, mutants, phate group) which may be attached to the Sugar or Sugar derivatives, fragments and complementary sequences analog moiety in the modified oligonucleotides of the present thereto. Preferably the oligonucleotide is an antisense RNA invention may be a monophosphate, diphosphate, triphos or DNA molecule. phate, alkylphosphate, alkanephosphate, phosphorothioate 0107. In another embodiment, the oligomeric compounds and the like. The preparation of the above-noted phosphate of the present invention also include variants in which a analogs, and their incorporation into nucleotides, modified different base is present at one or more of the nucleotide nucleotides and oligonucleotides, per se, is also known and positions in the compound. For example, if the first nucleotide need not be described here. is an adenine, variants may be produced which contain thy 0113. The specificity and sensitivity of antisense is also midine, guanosine, cytidine or other natural or unnatural harnessed by those of skill in the art for therapeutic uses. nucleotides at this position. This may be done at any of the Antisense oligonucleotides have been employed as therapeu positions of the antisense compound. tic moieties in the treatment of disease states in animals and US 2012/O252869 A1 Oct. 4, 2012 man. Antisense oligonucleotides have been safely and effec I0121. In another embodiment, oligonucleotide com tively administered to humans and numerous clinical trials pounds comprise sequences set forth as SEQID NOS: 15 to are presently underway. It is thus established that oligonucle 94, antisense sequences which are identified and expanded, otides can be useful therapeutic modalities that can be con using for example, PCR, hybridization etc. These oligonucle figured to be useful in treatment regimes for treatment of otides can comprise one or more modified nucleotides, cells, tissues and animals, especially humans. shorter or longer fragments, modified bonds and the like. 0114. In embodiments of the present invention oligomeric Examples of modified bonds or internucleotide linkages com antisense compounds, particularly oligonucleotides, bind to prise phosphorothioate, phosphorodithioate or the like. In target nucleic acid molecules and modulate the expression another embodiment, the nucleotides comprise a phosphorus and/or function of molecules encoded by a target gene. The derivative. The phosphorus derivative (or modified phosphate functions of DNA to be interfered comprise, for example, group) which may be attached to the Sugar or Sugar analog replication and transcription. The functions of RNA to be moiety in the modified oligonucleotides of the present inven interfered comprise all vital functions such as, for example, tion may be a monophosphate, diphosphate, triphosphate, translocation of the RNA to the site of protein translation, alkylphosphate, alkanephosphate, phosphorothioate and the translation of protein from the RNA, splicing of the RNA to like. The preparation of the above-noted phosphate analogs, yield one or more mRNA species, and catalytic activity which and their incorporation into nucleotides, modified nucle may be engaged in or facilitated by the RNA. The functions otides and oligonucleotides, per se, is also known and need may be up-regulated or inhibited depending on the functions not be described here. desired. 0.122 Since, as is known in the art, the translation initia 0115 The antisense compounds, include, antisense oligo tion codon is typically 5'-AUG (in transcribed mRNA mol meric compounds, antisense oligonucleotides, external guide ecules: 5'-ATG in the corresponding DNA molecule), the sequence (EGS) oligonucleotides, alternate splicers, primers, translation initiation codon is also referred to as the AUG probes, and other oligomeric compounds that hybridize to at codon, the “start codon’ or the AUG start codon’. A minor least a portion of the target nucleic acid. As such, these com ity of genes has a translation initiation codon having the RNA pounds may be introduced in the form of single-stranded, sequence 5'-GUG, 5'-UUG or 5'-CUG.; and 5'-AUA, 5'-ACG double-stranded, partially single-stranded, or circular oligo and 5'-CUG have been shown to function in vivo. Thus, the meric compounds. terms “translation initiation codon’ and “start codon’ can 0116 Targeting an antisense compound to a particular encompass many codon sequences, even though the initiator nucleic acid molecule, in the context of this invention, can be amino acid in each instance is typically methionine (in a multistep process. The process usually begins with the eukaryotes) or formylmethionine (in prokaryotes). Eukary identification of a target nucleic acid whose function is to be otic and prokaryotic genes may have two or more alternative modulated. This target nucleic acid may be, for example, a start codons, any one of which may be preferentially utilized cellular gene (or mRNA transcribed from the gene) whose for translation initiation in a particular cell type or tissue, or expression is associated with a particular disorder or disease under a particular set of conditions. In the context of the state, or a nucleic acid molecule from an infectious agent. In invention, “start codon’ and “translation initiation codon’ the present invention, the target nucleic acid encodes a Sirtuin refer to the codon or codons that are used in vivo to initiate (SIRT). translation of an mRNA transcribed from a gene encoding a 0117 The targeting process usually also includes determi Sirtuin (SIRT), regardless of the sequence(s) of such cottons. nation of at least one target region, segment, or site within the A translation termination codon (or 'stop codon”) of a gene target nucleic acid for the antisense interaction to occur Such may have one of three sequences, i.e., 5'-UAA, 5'-UAG and that the desired effect, e.g., modulation of expression, will 5'-UGA (the corresponding DNA sequences are 5'-TAA, result. Within the context of the present invention, the term 5'-TAG and 5'-TGA, respectively). “region' is defined as a portion of the target nucleic acid I0123. The terms “start codon region' and “translation ini having at least one identifiable structure, function, or charac tiation cotton region” refer to a portion of such an mRNA or teristic. Within regions of target nucleic acids are segments. gene that encompasses from about 25 to about 50 contiguous 'Segments' are defined as Smaller or Sub-portions of regions nucleotides in either direction (i.e., 5' or 3') from a translation within a target nucleic acid. “Sites” as used in the present initiation codon. Similarly, the terms "stop codon region' and invention, are defined as positions withina target nucleic acid. “translation termination cotton region” refer to a portion of 0118. In one embodiment, the antisense oligonucleotides Such an mRNA or gene that encompasses from about 25 to bind to the natural antisense sequences of a Sirtuin (SIRT) and about 50 contiguous nucleotides in either direction (i.e., 5' or modulate the expression and/or function of a Sirtuin (SIRT) 3') from a translation termination cotton. Consequently, the (SEQ ID NO: 1 to 3). Examples of antisense sequences “start codon region' (Or “translation initiation codon include SEQID NOS: 4 to 29. region') and the “stop codon region’ (or “translation termi 0119. In another embodiment, the antisense oligonucle nation codon legion') are all regions that may be targeted otides bind to one or more segments of a Sirtuin (SIRT) effectively with the antisense compounds of the present polynucleotide and modulate the expression and/or function invention. of a Sirtuin (SIRT). The segments comprise at least five 0.124. The open reading frame (ORF) or “coding region.” consecutive nucleotides of a Sirtuin (SIRT) sense orantisense which is known in the art to refer to the region between the polynucleotides. translation initiation codon and the translation termination 0120 In another embodiment, the antisense oligonucle codon, is also a region which may be targeted effectively. otides are specific for natural antisense sequences of a Sirtuin Within the context of the present invention, a targeted region (SIRT) Wherein binding of the oligonucleotides to the natural is the intragenic region encompassing the translation initia antisense sequences of a Sirtuin (SIRT) modulate expression tion or termination codon of the open reading frame (ORF) of and/or function of a Sirtuin (SIRT). a gene. US 2012/O252869 A1 Oct. 4, 2012

0.125. Another target region includes the 5' untranslated ants of that pre-mRNA or mRNA. Those transcripts that use region (5' UTR), known in the art to refer to the portion of an an alternative stop codon are known as 'alternative stop vari mRNA in the 5' direction from the translation initiation ants of that pre-mRNA or mRNA. One specific type of codon, and thus including nucleotides between the 5' cap site alternative stop variant is the “polyA variant in which the and the translation initiation codon of an mRNA (or corre multiple transcripts produced result from the alternative sponding nucleotides on the gene). Still another target legion selection of one of the “polyA stop signals' by the transcrip includes the 3' untranslated region (3'UTR), known in the art tion machinery, thereby producing transcripts that terminate to refer to the portion of an mRNA in the 3' direction from the at unique polyA sites. Within the context of the invention, the translation termination codon, and thus including nucleotides types of variants described herein are also embodiments of between the translation termination codon and 3' end of an target nucleic acids. mRNA (or corresponding nucleotides on the gene). The 5' cap I0133. The locations on the target nucleic acid to which the site of an mRNA comprises an N7-methylated guanosine antisense compounds hybridize are defined as at least a residue joined to the 5'-most residue of the tRNA via a 5'-5' 5-nucleotide long portion of a target region to Which an active triphosphate linkage. The 5' cap region of an mRNA is con antisense compound is targeted. sidered to include the 5' cap structure itself as well as the first I0134. While the specific sequences of certain exemplary 50 nucleotides adjacent to the cap site. Another target region target segments are set forth herein, one of skill in the art will for this invention is the 5' cap region. recognize that these serve to illustrate and describe particular 0126 Although some eukaryotic mRNA transcripts are embodiments within the scope of the present invention. Addi directly translated, many contain one or more regions, known tional target segments are readily identifiable by one having as “introns,” which are excised from a transcript before it is ordinary skill in the art in view of this disclosure. translated. The remaining (and therefore translated) regions 0.135 Target segments 5-100 nucleotides in length com are known as “exons' and are spliced together to form a prising a stretch of at least five (5) consecutive nucleotides continuous mRNA sequence. In one embodiment, targeting selected from within the illustrative target segments are con splice sites, i.e., intron-exon junctions or exon-intron junc sidered to be suitable for targeting as well. tions, is particularly useful in situations where aberrant splic 0.136 Target segments can include DNA or RNA ing is implicated in disease, or where an overproduction of a sequences that comprise at least the 5 consecutive nucleotides particular splice product is implicated in disease. Anaberrant from the 5'-terminus of one of the illustrative target segments fusion junction due to rearrangement or deletion is another (the remaining nucleotides being a consecutive stretch of the embodiment of a target site. mRNA transcripts produced via same DNA or RNA beginning immediately upstream of the the process of splicing of two (or more) mRNAs from differ 5'-terminus of the target segment and continuing until the ent gene Sources are known as “fusion transcripts”. Introns DNA or RNA contains about 5 to about 100 nucleotides). can be effectively targeted using antisense compounds tar Similarly target segments are represented by DNA or RNA geted to, for example, DNA or pre-mRNA. sequences that comprise at least the 5 consecutive nucleotides 0127. In another embodiment, the antisense oligonucle from the 3'-terminus of one of the illustrative target segments otides bind to coding and/or non-coding regions of a target (the remaining nucleotides being a consecutive stretch of the polynucleotide and modulate the expression and/or function same DNA or RNA beginning immediately downstream of of the target molecule. the 3'-terminus of the target segment and continuing until the 0128. In another embodiment, the antisense oligonucle DNA or RNA contains about 5 to about 100 nucleotides). One otides bind to natural antisense polynucleotides and modulate having skill in the art armed with the target segments illus the expression and/or function of the target molecule. trated herein will be able, without undue experimentation, to 0129. In another embodiment, the antisense oligonucle identify further target segments. otides bind to sense polynucleotides and modulate the expres 0.137. Once one or more target regions, segments or sites sion and/or function of the target molecule. have been identified, antisense compounds are chosen which 0130. Alternative RNA transcripts can be produced from are sufficiently complementary to the target, i.e., hybridize the same genomic region of DNA. These alternative tran sufficiently well and with sufficient specificity, to give the Scripts are generally known as “variants'. More specifically, desired effect. “pre-mRNA variants' are transcripts produced from the same 0.138. In embodiments of the invention the oligonucle genomic DNA that differ from other transcripts produced otides bind to an antisense Strand of a particular target. The from the same genomic DNA in either their start or stop oligonucleotides are at least 5 nucleotides in length and can be position and contain both intronic and exonic sequence. synthesized so each oligonucleotide targets overlapping 0131 Upon excision of one or more exon or intron sequences such that oligonucleotides are synthesized to cover regions, or portions thereof during splicing, pre-mRNA vari the entire length of the target polynucleotide. The targets also ants produce smaller “mRNA variants”. Consequently, include coding as well as non coding regions. mRNA variants are processed pre-mRNA variants and each 0.139. In one embodiment, specific nucleic acids are tar unique pre-mRNA variant must always produce a unique geted by antisense oligonucleotides. Targeting an antisense mRNA variant as a result of splicing. These mRNA variants compound to a particular nucleic acid, is a multistep process. are also known as 'alternative splice variants. If no splicing The process usually begins with the identification of a nucleic of the pre-mRNA variant occurs then the pre-mRNA variant acid sequence whose function is to be modulated. This may is identical to the mRNA variant. be, for example, a cellular gene (or mRNA transcribed from 0132 Variants can be produced through the use of alter the gene) whose expression is associated with a particular native signals to start or stop transcription. Pre-mRNAS and disorder or disease state, or anon coding polynucleotide Such mRNAS can possess more than one start codon or stop codon. as for example, non coding RNA (ncRNA). Variants that originate from a pre-mRNA or mRNA that use 0140 RNAs can be classified into (1) messenger RNAs alternative start codons are known as 'alternative start Vari (mRNAS), which are translated into proteins, and (2) non US 2012/O252869 A1 Oct. 4, 2012

protein-coding RNAs (ncRNAs). IncRNAs comprise microR DNA, RNA, DNA-like, RNA-like, or mixtures thereof, or NAS, antisense transcripts and other Transcriptional Units may be mimetics of one or more of these. These compounds (TU) containing a high density of stop codons and lacking any may be single-stranded, doublestranded, circular or hairpin extensive “Open Reading Frame'. Many ncRNAs appear to oligomeric compounds and may contain structural elements start from initiation sites in 3' untranslated regions (3'UTRs) Such as internal or terminal bulges, mismatches or loops. of protein-coding loci.ncRNAs are often rare and at least half Antisense compounds are routinely prepared linearly but can of the nckNAs that have been sequenced by the FANTOM be joined or otherwise prepared to be circular and/or consortium seem not to be polyadenylated. Most researchers branched. Antisense compounds can include constructs Such have for obvious reasons focused on polyadenylated mRNAs that are processed and exported to the cytoplasm. Recently, it as, for example, two strands hybridized to form a wholly or was shown that the set of non-polyadenylated nuclear RNAs partially double-stranded compound or a single strand with may be very lame, and that many Such transcripts arise from sufficient self-complementarity to allow for hybridization intergenic regions. The mechanism by which incRNAS may and formation of a fully or partially double-stranded com regulate gene expression is by base pairing with target tran pound. The two strands can be linked internally leaving free 3' scripts. The RNAs that function by base pairing can be or 5' termini or can be linked to form a continuous hairpin grouped into (1) cis encoded RNAs that are encoded at the structure or loop. The hairpin structure may contain an over same genetic location, but on the opposite strand to the RNAS hang on either the 5' or 3' terminus producing an extension of they act upon and therefore display perfect complementarity single Stranded character. The double stranded compounds to their target, and (2) trans-encoded RNAs that are encoded optionally can include overhangs on the ends. Further modi at a chromosomal location distinct from the RNAs they act fications can include conjugate groups attached to one of the upon and generally do not exhibit perfect base-pairing poten termini, selected nucleotide positions, Sugar positions or to tial with their targets. one of internucleoside linkages. Alternatively, the two strands 0141. Without wishing to be bound by theory, perturbation can be linked via a non-nucleic acid moiety or linker group. of an antisense polynucleotide by the antisense oligonucle When formed from only one strand, dsRNA can take the form otides described herein can alter the expression of the corre of a self-complementary hairpin-type molecule that doubles sponding sense messenger RNAS. However, this regulation back on itself to form a duplex. Thus, the dsRNAs can be fully can either be discordant (antisense knockdown results in mes or partially double stranded. Specific modulation of gene senger RNA elevation) or concordant (antisense knockdown expression can be achieved by stable expression of dsRNA results in concomitant messenger RNA reduction). In these hairpins in transgenic cell lines, however, in Some embodi cases, antisense oligonucleotides can be targeted to overlap ments, the gene expression or function is up regulated. When ping or non-overlapping parts of the antisense transcript formed from two strands, or a single Strand that takes the farm resulting in its knockdown or sequestration. Coding as well as of a self-complementary hairpin-type molecule doubled back non-coding antisense can be targeted in an identical manner on itself to form a duplex, the two strands (or duplex-forming and that either category is capable of regulating the corre regions of a single Strand) are complementary RNA strands sponding sense transcripts—either in a concordant or discon that base pair in Watson-Crick fashion. cordant manner. The strategies that are employed in identify 0145 Once introduced to a system, the compounds of the ing new oligonucleotides for use against a target can be based invention may elicit the action of one or more enzymes or on the knockdown of antisense RNA transcripts by antisense structural proteins to effect cleavage or other modification of oligonucleotides or any other means of modulating the the target nucleic acid or may work via occupancy-based desired target. mechanisms. In general, nucleic acids (including oligonucle 0142 Strategy 1: In the case of discordant regulation, otides) may be described as “DNA-like” (i.e., generally hav knocking down the antisense transcript elevates the expres ing one or more 2'-deoxy Sugars and, generally, T rather than sion of the conventional (sense) gene. Should that latter gene U bases) or “RNA-like' (i.e., generally having one or more encode for a known or putative drug target, then knockdown 2'-hydroxyl or 2'-modified Sugars and, generally Urather than of its antisense counterpart could conceivably mimic the Tbases). Nucleic acid helices can adopt more than one type of action of a receptor agonist or an enzyme stimulant. structure, most commonly the A- and B-forms. It is believed 0143 Strategy 2: In the case of concordant regulation, one that, in general, oligonucleotides which have B-form-like could concomitantly knock down both antisense and sense structure are “DNA-like' and those which have A-formlike transcripts and thereby achieve Synergistic reduction of the structure are “RNA-like.” In some (chimeric) embodiments, conventional (sense) gene expression. If for example, an anti an antisense compound may contain both A- and B-form sense oligonucleotide is used to achieve knockdown, then this regions. strategy can be used to apply one antisense oligonucleotide 0146 In another embodiment, the desired oligonucle targeted to the sense transcript and another antisense oligo otides or antisense compounds, comprise at least one of nucleotide to the corresponding antisense transcript, or a antisense RNA, antisense DNA, chimeric antisense oligo single energetically symmetric antisense oligonucleotide that nucleotides, antisense oligonucleotides comprising modified simultaneously targets overlapping sense and antisense tran linkages, interference RNA (RNAi), short interfering RNA Scripts. (siRNA); a micro, interfering RNA (miRNA); a small, tem 0144. According to the present invention, antisense com poral RNA (stRNA); or a short, hairpin RNA (shRNA); small pounds include antisense oligonucleotides, ribozymes, exter RNA-induced gene activation (RNAa); small activating nal guide sequence (EGS) oligonucleotides, siRNA com RNAs (saRNAs), or combinations thereof. pounds, single- or double-stranded RNA interference (RNAi) 0147 dsRNA can also activate gene expression, a mecha compounds Such as siRNA compounds, and other oligomeric nism that has been termed “small RNA-induced gene activa compounds which hybridize to at (east a portion of the target tion” or RNAa. dsRNAs targeting gene prompters induce nucleic acid and modulate its function. As such, they may be potent transcriptional activation of associated genes. RNAa US 2012/O252869 A1 Oct. 4, 2012

was demonstrated in human cells using synthetic dsRNAS, 0153. In a embodiment, an antisense oligonucleotide tar termed “small activating RNAs (saRNAs). gets Sirtuin (SIRT) polynucleotides (e.g. accession numbers 0148 Small double-stranded RNA (dsRNA), such as NM 0122383, NM 001159589, NM 012239, small interfering RNA (siRNA) and microRNA (miRNA), NM 016539), variants, alleles, isoforms, homologs, have been found to be the trigger of an evolutionary con mutants, derivatives, fragments and complementary served mechanism known as RNA interference (RNAi). sequences thereto. Preferably the oligonucleotide is an anti RNAi invariably leads to gene silencing. However, in sense molecule. instances described in detail in the examples section which 0154. In accordance with embodiments of the invention, follows, oligonucleotides are shown to increase the expres the target nucleic acid molecule is not limited to Sirtuin sion and/or function of the Sirtuin (SIRT) polynucleotides (SIRT) alone but extends to any of the isoforms, receptors, and encoded products thereof dsRNAS may also act as Small homologs and the like of a Sirtuin (SIRE) molecule. activating RNAs (saRNA). Without wishing to be bound by 0.155. In another embodiment, an oligonucleotide targets a theory, by targeting sequences in gene promoters, SaRNAS natural antisense sequence of a Sirtuin (SIRT) polynucle would induce target gene expression in a phenomenon otide, for example, polynucleotides set forth as SEQID NO: referred to as dsRNA-induced transcriptional activation 5 to 14, and any variants, alleles, homologs, mutants, deriva (RNAa). tives, fragments and complementary sequences thereto. 0149. In a further embodiment, the “target segments’ Examples of antisense oligonucleotides are set forth as SEQ identified herein may be employed in a screen for additional ID NOS:15 to 94. compounds that modulate the expression of a Sirtuin (SIRT) 0156. In one embodiment, the oligonucleotides are polynucleotide. “Modulators' are those compounds that complementary to or bind to nucleic acid sequences of a decrease or increase the expression of a nucleic acid molecule Sirtuin (SIRT) antisense, including without limitation non encoding a Sirtuin (SIRT) and which comprise at least a coding sense and/or antisense sequences associated with a 5-nucleotide portion that is complementary to a target seg Sirtuin (SIRT) polynucleotide and modulate expression and/ ment. The screening method comprises the steps of contact or function of a Sirtuin (SIRT) molecule. ing a target segment of a nucleic acid molecule encoding 0157. In another embodiment, the oligonucleotides are sense or natural antisense polynucleotides of a Sirtuin (SIRT) complementary to or bind to nucleic acid sequences of a with one or more candidate modulators, and selecting for one Sirtuin (SIRT) natural antisense, set forth as SEQID NO: 5 to or more candidate modulators which decrease or increase the 14 and modulate expression and/or function of a Sirtuin expression of a nucleic acid molecule encoding a Sirtuin (SIRT) molecule. (SIRT) polynucleotide, e.g. SEQID NOS: 15 to 94. Once it is 0158. In a embodiment, oligonucleotides comprise shown that the candidate modulator or modulators are sequences of at least 5 consecutive nucleotides of SEQ ID capable of modulating (e.g. either decreasing or increasing) NOS: 15 to 94 and modulate expression and/or function of a the expression of a nucleic acid molecule encoding a Sirtuin Sirtuin (SIRT) molecule. (SIRT) polynucleotide, the modulator may then be employed 0159. The polynucleotide targets comprise Sirtuin (SIRT), in further investigative studies of the function of a Sirtuin including family members thereof, variants of a Sirtuin (SIRT) polynucleotide, or for use as a research, diagnostic, or (SIRT); mutants of a Sirtuin (SIRT), including SNPs; non therapeutic agent in accordance with the present invention. coding sequences of a Sirtuin (SIRT): alleles of a Sirtuin 0150 Targeting the natural antisense sequence modulates (SIRT); species variants, fragments and the like. Preferably the function of the target gene. For example, the Sirtuin (SIRf) the oligonucleotide is an antisense molecule. (e.g. accession numbers NM 012238.3, NM 001159589, 0160. In another embodiment, the oligonucleotide target NM 012239, NM 16539), in a embodiment, the target is an ing Sirtuin (SIRT) polynucleotides, comprise: antisense antisense polynucleotide of the Sirtuin (SIRT). In a embodi RNA, interference RNA (RNAi), short interfering RNA ment, an antisense oligonucleotide targets sense and/or natu (siRNA); micro interfering RNA (miRNA); a small, temporal ral antisense sequences of a Sirtuin (SIRT) polynucleotide RNA (stRNA); or a short, hairpin RNA (shRNA); small (e.g. accession numbers NM, 0122383, NM 001159589, RNA-induced gene activation (RNAa); or, small activating NM 012239, NM 416539), variants, alleles, isoforms, RNA (saRNA). homologs, mutants, derivatives, fragments and complemen 0.161. In another embodiment, targeting of a Sirtuin tary sequences thereto. Preferably the oligonucleotide is an (SIRT) polynucleotide, e.g. SEQID NO:5 to 14 modulate the antisense molecule and the targets include coding and non expression or function of these targets. In one embodiment, coding regions of antisense and/or sense Sirtuin (SIRT) poly expression or function is up-regulated as compared to a con nucleotides. trol. In another embodiment, expression or function is down 0151. The target segments of the present invention may be regulated as compared to a control. also be combined with their respective complementary anti 0162. In another embodiment, antisense compounds com sense compounds of the present invention to form stabilized prise sequences set forth as SEQ ID NOS: 15 to 94. These double-stranded (duplexed) oligonucleotides. oligonucleotides can comprise one or more modified nucle 0152 Such double stranded oligonucleotide moieties have otides, shorter or longer fragments, modified bonds and the been shown in the art to modulate target expression and like. regulate translation as well as RNA processing via an anti (0163. In another embodiment, SEQ ID NOS: 0.15 to 94 sense mechanism. Moreover, the double-stranded moieties comprise one or more LNA nucleotides. may be subject to chemical modifications. For example, Such 0164. The modulation of a desired target nucleic acid can double-stranded moieties have been shown to inhibit the tar be carried out in several ways known in the art. For example, get by the classical hybridization of antisense strand of the antisense oligonucleotides, siRNA etc. Enzymatic nucleic duplex to the target, thereby triggering enzymatic degrada acid molecules (e.g., ribozymes) are nucleic acid molecules tion of the target. capable of catalyzing one or more of a variety of reactions, US 2012/O252869 A1 Oct. 4, 2012 including the ability to repeatedly cleave other separate cleave specific target sequences and indicates that catalytic nucleic acid molecules in a nucleotide base sequence-specific RNAs designed according to the “hammerhead model may manner. Such enzymatic nucleic acid molecules can be used, possibly cleave specific substrate RNAs in vivo. for example, to target virtually any RNA transcript. (0171 RNA interference (RNAi) has become a powerful 0.165 Because of their sequence-specificity, trans-cleav tool for modulating gene expression in mammals and mam ing enzymatic nucleic acid molecules show promise as thera malian cells. This approach requires the delivery of Small peutic agents for human disease. Enzymatic nucleic acid mol interfering RNA (siRNA) either as RNA itself or as DNA, ecules can be designed to cleave specific RNA targets within using an expression plasmid or virus and the coding sequence the background of cellular RNA. Such a cleavage event ren for small hairpin RNAs that are processed to siRNAs. This ders the mRNA non-functional and abrogates protein expres system enables efficient transport of the pre-siRNAs to the sion from that RNA. In this manner, synthesis of a protein cytoplasm where they are active and permit the use of regu associated with a disease state can be selectively inhibited. lated and tissue specific promoters for gene expression. 0166 In general, enzymatic nucleic acids with RNA 0172. In one embodiment, an oligonucleotide or antisense cleaving activity act by first binding to a target RNA. Such compound comprises an oligomer or polymer of ribonucleic binding occurs through the target binding portion of a enzy acid (RNA) and/or deoxyribonucleic acid (DNA), or a matic nucleic acid which is held in close proximity to an mimetic, chimera, analog or homolog thereof. This term enzymatic portion of the molecule that acts to cleave the includes oligonucleotides composed of naturally occurring target RNA. Thus, the enzymatic nucleic acid first recognizes nucleotides, Sugars and covalent internucleoside (backbone) and then binds a target RNA through complementary base linkages as well as oligonucleotides having non-naturally pairing, and once bound to the correct site, acts enzymatically occurring portions which function similarly. Such modified to cut the target RNA. Strategic cleavage of such a target RNA or substituted oligonucleotides are often desired over native will destroy its ability to direct synthesis of an encoded pro forms because of desirable properties such as, for example, tein. After an enzymatic nucleic acid has bound and cleaved enhanced cellular uptake, enhanced affinity for a target its RNA target, it is released from that RNA to search for nucleic acid and increased Stability in the presence of another target and can repeatedly bind and cleave new targets. nucleases. 0167. Several approaches such as in vitro selection (evo 0173 According to the present invention, the oligonucle lution) strategies have been used to evolve new nucleic acid otide or “antisense compounds’ include antisense oligo catalysts capable of catalyzing a variety of reactions, such as nucleotides (e.g. RNA, DNA, mimetic, chimera, analog or cleavage and ligation of phosphodiester linkages and amide homolog thereof), ribozymes, external guide sequence (EGS) linkages. oligonucleotides, siRNA compounds, single- or double 0168 The development of ribozymes that are optimal for stranded RNA interference (RNAi) compounds such as catalytic activity would contribute significantly to any strat siRNA compounds, snRNA, aRNA, and other oligomeric egy that employs RNA-cleaving ribozymes for the purpose of compounds which hybridize to at least a portion of the target regulating gene expression. The hammerhead ribozyme, for nucleic acid and modulate its function. AS Such they may be example, functions with a catalytic rate (kcat) of about 1 DNA, RNA, DNA-like, RNA-like, or mixtures thereof, or min-1 in the presence of Saturating (10 mM) concentrations may be mimetics of one or more of these. These compounds of Mg2+ cofactor. An artificial “.RNA ligase' ribozytne has may be single-stranded, double-stranded, circular or hairpin been shown to catalyze the corresponding self-modification oligomeric compounds and may contain structural elements reaction with a rate of about 100 min-1. In addition, it is Such as internal or terminal bulges, mismatches or loops. known that certain modified hammerhead ribozymes that Antisense compounds are routinely prepared linearly but can have substrate binding arms made of DNA catalyze RNA be joined or otherwise prepared to be circular and/or cleavage with multiple rum-over rates that approach 100 min branched. Antisense compounds can include constructs Such 1. Finally, replacement of a specific residue within the cata as, for example, two strands hybridized to form a wholly or lytic core of the hammerhead with certain nucleotide ana partially double-stranded compound or a single strand with logues gives modified ribozymes that show as much as a sufficient self-complementarity to allow for hybridization 10-fold improvement in catalytic rate. These findings dem and formation of a fully or partially double-stranded com onstrate that ribozymes can promote chemical transforma pound. The two strands can be linked internally leaving free 3' tions with catalytic rates that are significantly greater than or 5' termini or can be linked to form a continuous hairpin those displayed in vitro by most natural self-cleaving structure or loop. The hairpin structure may contain an over ribozymes. It is then possible that the structures of certain hang on either the 5' or 3' terminus producing an extension of Selibleaving ribozymes may be optimized to give maximal single Stranded character. The double stranded compounds catalytic activity, or that entirely new RNA motifs can be optionally can include overhangs on the ends. Further modi made that display significantly faster rates for RNA phos fications can include conjugate groups attached to one of the phodiester cleavage. termini, selected nucleotide positions, Sugar positions or to 0169 Intermolecular cleavage of an RNA substrate by an one of the internucleoside linkages. Alternatively, the two RNA catalyst that fits the “hammerhead' model was first Strands can be linked via anon-nucleic acid moiety or linker shown in 1987. The RNA catalyst was recovered and reacted group. When formed from only one strand, dsRNA can take with multiple RNA molecules, demonstrating that it was truly the form of a self-complementary hairpin-type molecule that catalytic. doubles back on itself to forma duplex. Thus, the dsRNAs can 0170 Catalytic RNAs designed based on the “hammer be fully or partially double stranded. Specific modulation of head' motif have been used to cleave specific target gene expression can be achieved by stable expression of sequences by making appropriate base changes in the cata dsRNA hairpins in transgenic cell lines. When formed from lytic RNA to maintain necessary base pairing with the target two strands, or a single strand that takes the form of a self sequences. This has allowed use of the catalytic RNA to complementary hairpin-type molecule doubled back on itself US 2012/O252869 A1 Oct. 4, 2012

to form a duplex, the two strands (or duplex-forming regions target is from about 40% to about 60%. In some embodi of a single strand) are complementary RNA strands that base ments, homology, sequence identity or complementarity, is pair in Watson-Crick fashion, from about 60% to about 70%. In some embodiments, homol 0.174. Once introduced to a system, the compounds of the ogy; sequence identity or complementarity, is from about invention may elicit the action of one or more enzymes or 70% to about 80%. In some embodiments, homology: structural proteins to effect cleavage or other modification of sequence identity or complementarity, is from about 80% to the target nucleic acid or may work via occupancy-based about 90%. In some embodiments, homology, sequence iden mechanisms. In general, nucleic acids (including oligonucle tity or complementarity, is about 90%, about 92%, about otides) may be described as “DNA-like' (i.e., generally hav 94%, about 95%, about 96%, about 97%, about 98%, about ing one or more 2'-deoxy Sugars and, generally, T rather than 99% or about 100%. U bases) or “RNA-like' (i.e., generally having one or more 2'-hydroxyl or 2'-modified sugars and generally Urather than 0180. In another embodiment, the antisense oligonucle 1 bases). Nucleic acid helices can adopt more than one type of otides, such as for example, nucleic acid molecules set forth structure, most commonly the A- and B-forms. It is believed in SEQID NOS: 4 to 29 comprise one or more substitutions that, in general, oligonucleotides which have B-form-like or modifications. In one embodiment, the nucleotides are structure are “DNA-like' and those which have A-formlike substituted with locked nucleic acids (LNA). structure are “RNA-like.” In some (chimeric) embodiments, 0181. In another embodiment, the oligonucleotides target an antisense compound may contain both A- and B-form one or more regions of the nucleic acid molecules sense regions. and/or antisense of coding and/or non-coding sequences 0.175. The antisense compounds in accordance with this associated with Sirtuin (SIRT) and the sequences set forth as invention can comprise an antisense portion from about 5 to SEQID NOS: 1 to 14. The oligonucleotides are also targeted about 80 nucleotides (i.e. from about 5 to about 80 linked to overlapping regions of SEQID NOS: 1 to 14. nucleosides) in length. This refers to the length of the anti 0182 Certain oligonucleotides of this invention are chi sense Strand or portion of the antisense compound. In other meric oligonucleotides. “Chimeric oligonucleotides' or “chi words, a single-stranded antisense compound of the invention meras, in the context of this invention, are oligonucleotides comprises from 5 to about 80 nucleotides, and a double which contain two or more chemically distinct regions, each Stranded antisense compound of the invention (such as a made up of at least one nucleotide. These oligonucleotides dsRNA, for example) comprises a sense and an antisense typically contain at least one region of modified nucleotides strandorportion of 5 to about 80 nucleotides in length. One of that confers one or more beneficial properties (such as, for ordinary skill in the art will appreciate that this comprehends example, increased nuclease resistance, increased uptake into antisense portions of 5, 6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17. cells, increased binding affinity for the target) and a region 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34, that is a substrate forenzymes capable of cleaving RNA:DNA 35,36, 37,38, 39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, or RNA:RNA hybrids. By way of example, RNase H is a 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, cellular endonuclease which cleaves the RNA strand of an 69, 70, 71, 72,73, 74, 75, 76, 77, 78,79, or 80 nucleotides in RNA:DNA duplex. Activation of RNase H, therefore, results length, or any range therewithin. in cleavage of the RNA target, thereby greatly enhancing the 0176). In one embodiment, the antisense compounds of the efficiency of antisense modulation of gene expression. Con invention have antisense portions of 10 to 50 nucleotides in sequently, comparable results can often be obtained with length. One having ordinary skill in the art will appreciate that shorter oligonucleotides when chimeric oligonucleotides are this embodies oligonucleotides having antisense portions of used, compared to phosphorothioate deoxyoligonucleotides 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, hybridizing to the same target region. Cleavage of the RNA 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37,38, 39, 40, 41,42, 43, target can be routinely detected by gel electrophoresis and, if 44, 45,46, 47, 48,49, or 50 nucleotides in length, or any range necessary, associated nucleic acid hybridization techniques therewithin. In some embodiments, the oligonucleotides are known in the art. In one embodiment, a chimeric oligonucle 15 nucleotides in length. otide comprises at least one region modified to increase target 0177. In one embodiment, the antisense or oligonucle binding affinity, and, usually, a region that acts as a Substrate otide compounds of the invention have antisense portions of for RNAse H. Affinity of an oligonucleotide for its target (in 12 or 13 to 30 nucleotides in length. One having ordinary skill this case, a nucleic acid encoding ras) is routinely determined in the art will appreciate that this embodies antisense com by measuring the Tm of an oligonucleotide/target pair, which pounds having antisense portions of 12, 13, 14, 15, 16, 17, 18. is the temperature at which the oligonucleotide and target 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in dissociate; dissociation is detected spectrophotometrically. length, or any range therewithin. The higher the Tm, the greater is the affinity of the oligonucle 0178. In another embodiment, the oligomeric compounds otide for the target. of the present invention also include variants in which a 0183 Chimeric antisense compounds of the invention different base is present at one or more of the nucleotide may be formed as composite structures of two or more oligo positions in the compound. For example, if the first nucleotide nucleotides, modified oligonucleotides, oligonucleosides is an adenosine, variants may be produced which contain and/or oligonucleotides mimetics as described above. Such; thymidine, guanosine or cytidine at this position. This may be compounds have also been referred to in the an as hybrids or done at any of the positions of the antisense or dsRNA com gapmers. Representative United States patents that teach the pounds. These compounds are then tested using the methods preparation of Such hybrid structures comprise, but are not described herein to determine their ability to inhibit expres limited to, U.S. Pat. Nos. 5,013,830; 5,149,797: 5,220,007: sion of a target nucleic acid. 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350, 0179. In some embodiments, homology, sequence identity 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of or complementarity, between the antisense compound and which is herein incorporated by reference. US 2012/O252869 A1 Oct. 4, 2012

0184. In another embodiment, the region of the oligo C10C lower alkyl, alkoxyalkoxy, substituted lower alkyl, nucleotide which is modified comprises at least one nucle alkaryl or aralkyl: Cl; Br: CN; CF3; OCF3; O. , S: , or otide modified at the 2' position of the sugar, most preferably N-alkyl: O , S: , or N-alkenyl; SOCH3; SO2CH3; ONO2: a 2'-Oalkyl. 2'-O-alkyl-O-alkyl or 2'-fluoro-modified nucle NO2; N3; NH2: heterocycloalkyl; heterocycloalkaryl; ami otide. In other embodiments, RNA modifications include noalkylamino: polyalkylamino; substituted silyl; an RNA 2'-fluoro. 2'-amino and 2 O-methyl modifications on the cleaving group; a reporter group; an intercalator, a group for ribose of pyrimidines, abasic residues or an inverted base at improving the pharmacokinetic properties of an oligonucle the 3' end of the RNA. Such modifications are routinely otide; or a group for improving the pharmacodynamic prop incorporated into oligonucleotides and these oligonucle erties of an oligonucleotide and other Substituents having otides have been shownto have a higher Tm (i.e., higher target similar properties. A modification includes 2'-methoxy binding affinity) than; 2'-deoxyoligonucleotides against a ethoxy. 2-O-CH2 CH2 OCH3, also known as 2'-O-(2- given target The effect of such increased affinity is to greatly methoxyethyl). Other modifications include 2'-methoxy(2'- enhance RNAi oligonucleotide inhibition of gene expression. O CH3), 2'-propoxy(2'-OCH2CH2CH3) and 2'-fluoro (2'- RNAse H is a cellular endonuclease that cleaves the RNA F). Similar modifications may also be made at other positions strand of RNA:DNA duplexes; activation of this enzyme on the oligonucleotide, particularly the 3' position of the Sugar therefore results in cleavage of the RNA target, and thus can on the 3' terminal nucleotide and the 5' position of 5' terminal greatly enhance the efficiency of RNAi inhibition. Cleavage nucleotide. Oligonucleotides may also have Sugar mimetics of the RNA target can be routinely demonstrated by gel elec Such as cyclobutyls in place of the pentofuranosyl group. trophoresis. In another embodiment, the chimeric oligonucle 0186 Oligonucleotides may also include, additionally or otide is also modified to enhance nuclease resistance. Cells alternatively, nucleobase (often referred to in the art simply as contain a variety of exo- and endo-nucleases which can “base') modifications or substitutions. As used herein, degrade nucleic acids. A number of nucleotide and nucleoside “unmodified’ or “natural nucleotides include adenine (A), modifications have been shown to make the oligonucleotide guanine (G), thymine (T), cytosine (C) and uracil (U). Modi into which they are incorporated more resistant to nuclease fied nucleotides include nucleotides found only infrequently digestion than the native oligodeoxynucleotide. Nuclease or transiently in natural nucleic acids, e.g., hypoxanthine, resistance is routinely measured by incubating oligonucle 6-methyladenine. 5-Me pyrimidines, particularly 5-methyl otides with cellular extracts or isolated nuclease solutions and cytosine (also referred to as 5-methyl-2' deoxycytosine and measuring the extent of intact oligonucleotide remaining over often referred to in the art as 5-Me—C), 5-hydroxymethyl time, usually by gel electrophoresis. Oligonucleotides which cytosine (HMC), glucosyl HMC and gentobiosyl HMC, as have been modified to enhance their nuclease resistance Sur well as synthetic nucleotides, e.g., 2-aminoadenine, 2-(me Vive intact for a longer time than unmodified oligonucle thylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(ami otides. A variety of oligonucleotide modifications have been noalklyamino)adenine or other heterosubstituted alkylad demonstrated to enhance or confer nuclease resistance. Oli enines, 2-thiouracil, 2-thiothymine, 5-bromouracil, gonucleotides which contain at least one phosphorothioate 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 modification are presently more preferred. In some cases, (6-aminohexyl)adenine and 2,6-diaminopurine. A “univer oligonucleotide modifications which enhance target binding sal base known in the art, e.g., inosine, may be included. affinity are also, independently, able to enhance nuclease 5-Me-C substitutions have been shown to increase nucleic resistance. Some desirable modifications can be found in De acid duplex stability by 0.6-1.2°C. (Sanghvi, V.S., in Crooke, Mesmaeker et al. (1995) Acc. Chem. Res., 28:366-374. S. T. and Lebleu, B., eds. Antisense Research and Applica 0185. Specific examples of some oligonucleotides envi tions, CRC Press, Boca Raton, 1993, pp. 276-278) and are Sioned for this invention include those comprising modified presently base Substitutions. backbones, for example, phosphorothioates, phosphotri 0187. Another modification of the oligonucleotides of the esters, methyl phosphonates, short chain alkyl or cycloalkyl invention involves chemically linking to the oligonucleotide interSugar linkages or short chain heteroatomic or heterocy one or more moieties or conjugates which enhance the activ clic interSugarlinkages. Most are oligonucleotides with phos ity or cellular uptake of the oligonucleotide. Such moieties phorothioate backbones and those with heteroatom back include but are not limited to lipid moieties such as a choles bones, particularly CH2-NH-O CH2, CH, -N(CH3)- terol moiety; a cholesteryl moiety, a thioether, e.g., hexyl-S- O—CH2 (known as a methylene(methylimino) or MMI tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecan backbone), CH2-O N(CH3)-CH2, CH2-N(CH3)-N(CH3)- diol or undecyl residues, a phospholipid, e.g., di-hexadecyl CH2 and O N(CH3)-CH2-CH2 backbones, wherein the rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac native phosphodiester backbone is represented as O—P glycero-3-H-phosphonate, a polyamine or a polyethylene O—CH). The amide backbones disclosed by De Mesmaeker glycol chain, or adamantane acetic acid. Oligonucleotides et al. (1995) Acc. Chem. Res. 28:366-374 are also preferred. comprising lipophilic moieties, and methods for preparing Also are oligonucleotides having morpholino backbone Such oligonucleotides are known in the art, for example, U.S. structures (Summerton and Weller, U.S. Pat. No. 5,034,506). Pat. Nos. 5,138,045, 5,218,105 and 5,459.255. In other embodiments, such as the peptide nucleic acid (PNA) 0188 It is not necessary for all positions in a given oligo backbone, the phosphodiester backbone of the oligonucle nucleotide to be uniformly modified, and in fact more than otide is replaced with a polyamide backbone, the nucleotides one of the aforementioned modifications may be incorporated being bound directly or indirectly to the or) nitrogenatoms of in a single oligonucleotide or even at within a single nucleo the polyamide backbone. Oligonucleotides may also com side within an oligonucleotide. The present invention also prise one or more Substituted Sugar moieties oligonucleotides includes oligonucleotides which are chimeric oligonucle comprise one of the following at the 2' position: OH, SH, otides as hereinbefore defined. SCH3, F, OCN, OCH3, OCH3 O(CH2)n CH3, O(CH2)n (0189 In another embodiment, the nucleic acid molecule NH2 or O(CH2)n CH3 where n is from 1 to about 10; C1 to of the present invention is conjugated with another moiety US 2012/O252869 A1 Oct. 4, 2012 20 including but not limited to abasic nucleotides, polyether, those having morpholino linkages (formed in part from the polyamine, polyamides, peptides, carbohydrates, lipid, or Sugar portion of a nucleoside); siloxane backbones; Sulfide, polyhydrocarbon compounds. Those skilled in the art will sulfoxide and sulfone backbones; formacetyl and thiofor recognize that these molecules can be linked to one or more of macetyl backbones; methylene formacetyl and thiofor any nucleotides comprising the nucleic acid molecule at sev macetylbackbones; alkene containing backbones; Sulfamate eral positions on the Sugar, base orphosphate group. backbones; methyleneimino and methylenehydrazino back 0190. The oligonucleotides used in accordance with this bones; Sulfonate and Sulfonamide backbones; amide back invention may be conveniently and routinely made through bones; and others having mixed N, O, S and CH2 component the well-known technique of Solid phase synthesis. Equip parts. ment for Such synthesis is sold by several vendors including 0.195 Representative United States patents that teach the Applied Biosystems. Any other means for Such synthesis may preparation of the above oligonucleosides comprise, but are also be employed; the actual synthesis of the oligonucleotides not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185, is well within the talents of one of ordinary skill in the art. It 444; 5,214,134: 5,216,141; 5,235,033: 5,264,562; 5, 264, is also well known to use similar techniques to prepare other 564; 5,405,938; 5.434,257;5,466,677:5,470,967: 5489,677; oligonucleotides such as the phosphorothioates and alkylated 5,541,307: 5,561.225; 5,596,086; 5,602,240; 5,610,289; derivatives. It is also well known to use similar techniques and 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; commercially available modified amidites and controlled 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of pore glass (CPG) products such as biotin, fluorescein, acri which is herein incorporated by reference. dine or psoralen-modified amidites and/or CPG (available 0196. In other oligonucleotide mimetics, both the sugar from Glen Research, Sterling Va.) to synthesize fluorescently and the internucleoside linkage, i.e., the backbone, of the labeled, biotinylated or other modified oligonucleotides such nucleotide units are replaced with novel groups. The base as cholesterol-modified oligonucleotides. units are maintained for hybridization with an appropriate 0191 In accordance with the invention, use of modifica nucleic acid target compound. One Such oligomeric com tions such as the use of LNA monomers to enhance the pound, an oligonucleotide mimetic that has been shown to potency, specificity and duration of action and broaden the have excellent hybridization properties, is referred to as a routes of administration of oligonucleotides comprised of peptide nucleic acid (PNA). In PNA compounds, the sugar current chemistries such as MOE, ANA, FANA, PS etc. This backbone of an oligonucleotide is replaced with an amide can be achieved by Substituting some of the monomers in the containing backbone, in particular an aminoethylglycine current oligonucleotides by LNA monomers. The LNA modi backbone. The nucleobases are retained and are bound fied oligonucleotide may have a size similar to the parent directly or indirectly to azo nitrogen atoms of the amide compound or may be larger or preferably smaller. It is that portion of the backbone. Representative United States patents Such LNA-modified oligonucleotides contain less than about that teach the preparation of PNA compounds comprise, but 70%, more preferably less than about 60%, most preferably are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and less than about 50% LNA monomers and that their sizes are 5219,262, each of which is herein incorporated by reference. between about 5 and 25 nucleotides, more preferably between Further teaching of PNA compounds can be found in Nielsen, about 12 and 20 nucleotides. et al. (1991) Science 254.1497-1500. 0.192 Modified oligonucleotide backbones comprise, but 0.197 In another embodiment of the invention the oligo are not limited to, phosphorothioates, chiral phosphorothio nucleotides with phosphorothioate backbones and oligo ates, phosphorodithioates, phosphotriesters, aminoalky nucleosides with heteroatom backbones, and in particular— lphosphotriesters, methyl and other alkyl phosphonates com CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2-known as prising 3'alkylene phosphonates and chiral phosphonates, a methylene (methylimino) or MMI backbone. —CH2-O- phosphinates, phosphoramidates comprising 3'-amino phos N(CH3)-CH2-, -CH2N(CH3)-N(CH3) CH2- and O N phoramidate and aminoalkylphosphoramidates, thionophos (CH3)-CH2-CH2- wherein the native phosphodiester back phoramidates, thionoalkylphosphonates, thionoalkylphos bone is represented as —O—P O—CH2- of the above photriesters, and boranophosphates having normal 3'-5' referenced U.S. Pat. No. 5,489,677, and the amide backbones linkages. 2'-5' linked analogs of these, and those having of the above reference U.S. Pat. No. 5,602,240. Also are inverted polarity wherein the adjacent pairs of nucleoside oligonucleotides having morpholino backbone structures of units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, the above-referenced U.S. Pat. No. 5,034,506. mixed salts and free acid forms are also included. 0198 Modified oligonucleotides may also contain one or 0193 Representative United States patents that teach the more substituted Sugar moieties oligonucleotides comprise preparation of the above phosphorus containing linkages one of the following at the 2' position: OH: F: O , S: , or comprise, but are not limited to, U.S. Pat. Nos. 3,687,808; N-alkyl; O—, S , or N-alkenyl; O-, S- or N-alkynyl; or O 4,469,863; 4,476,301: 5,023,243; 5,177, 196; 5,188,897; alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be 5,264,423: 5,276,019; 5,278.302: 5,286,717: 5,321,131; substituted or unsubstituted C to CO alkyl or C2 to CO alk 5,399,676; 5,405,939; 5.453,496; 5,455,233; 5,466,677; enyl and alkynyl. Particularly are O (CH2)n OmCH3, 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; O(CH2)n, OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2) 5,563,253: 5,571,799: 5,587,361; and 5,625,050, each of nCNH2, and O(CH2nON(CH2)nCH3)2 where n and m can which is herein incorporated by reference. be from 1 to about 10. Other oligonucleotides comprise one of 0194 Modified oligonucleotide backbones that do not the following at the 2' position: C to CO, (lower alkyl, sub include a phosphorus atom therein have backbones that are stitute lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, formed by short chain alkyl or cycloalkyl internucleoside SH, SCH3, OCN, C1, Br, CN, CF3, OCF3, SOCH3, SO2CH3, linkages, mixed heteroatom and alkyl or cycloalkyl inter ONO2, NO2, N3, NH2, heterocycloalkyl, heterocy nucleoside linkages, or one or more short chain heteroatomic cloalkaryl, aminoalkylamino, polyalkylamino, Substituted or heterocyclic internucleoside linkages. These comprise silyl, an RNA cleaving group, a reporter group, an intercala US 2012/O252869 A1 Oct. 4, 2012

tor, a group for improving the pharmacokinetic properties of Press, Boca Raton, 1993, pp. 276-278) and are presently base an oliganucleotide, or a group for improving the pharmaco substitutions, even more particularly when combined with dynamic properties of an oligonucleotide, and other Substitu 2'-Omethoxyethyl Sugar modifications. ents having similar properties. A modification comprises 0202 Representative United States patents that teach the 2-methoxyethoxy(2'-O-CH2OCH3, also known as 2'-O- preparation of the above noted modified nucleotides as well (2-methoxyethyl) or 2-MOE) i.e., an alkoxyalkoxy group. A as other modified nucleotides comprise, but are not limited to, further modification comprises 2'-dimethylaminooxyethoxy, U.S. Pat. Nos. 3,687,808, as well as 4,845,205; 5,130,302: 5,134,066; 5,175.273; 5,367,066; 5,432,272; 5.457,187; i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, 5,459,255; 5,484,908: 5,502,177; 5,525,711; 5,552,540: as described in examples hereinbelow, and 2', -dimethylami 5,587,469: 5,596,091; 5,614,617; 5,750,692, and 5,681,941, noethoxyethoxy (also known in the art as 2'-O-dimethylami each of which is herein incorporated by reference. noethoxyethyl or 2'-DMAEOE), 2'-O-CH2-O-CH2-N 0203. Another modification of the oligonucleotides of the (CH2)2. invention involves chemically linking to the oligonucleotide 0199. Other modifications comprise 2'-methoxy(2'-O one or more moieties or conjugates, which enhance the activ CH3), 2-aminopropoxy (2'-O CH2CH2CH2NR2) and ity, cellular distribution, or cellular uptake of the oligonucle 2'-fluoro (2'-F). Similar modifications may also be made at otide. other positions on the oligonucleotide, particularly the 3' 0204 Such moieties comprise but are not limited to, lipid position of the sugar on the 3' terminal nucleotide or in 2'-5' moieties such as a cholesterol moiety, cholic acid, a thioether, linked oligonucleotides and the 5' position of 5' terminal e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, nucleotide. Oligonucleotides may also have Sugar mimetics e.g., dodecandiol, or undecyl residues, a phospholipid, e.g., Such as cyclobutyl moieties in place of the pentofuranosyl di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- sugar. Representative United States patents that teach the hexadecyl-rac-glycero-3-H-phosphonate a polyamine or a preparation of Such modified Sugar structures comprise, but polyethylene glycol chain, or adarnantane acetic acid, a are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319, palmityl moiety, oran octadecylamine or hexylamino-carbo 080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; nyl-t oxycholesterol moiety. 5,519,134: 5,567,811: 5,576.427: 5,591,722; 5,597,909; 0205 Representative United States patents that teach the 5,610,300; 5,627,053: 5,639,873; 5,646,265; 5,658,873; preparation of Such oligonucleotides conjugates comprise, 5,670,633; and 5,700,920, each of which is herein incorpo but are not limited to, U.S. Pat. Nos. 4,828,979: 4,948,882; rated by reference. 5,218,105: 5,525,465; 5,541,313; 5,545,730; 5,552,538; 0200 Oligonucleotides may also comprise nucleobase 5,578,717, 5,580,731: 5,580,731: 5,591,584; 5,109,124; (often referred to in the art simply as “base') modifications or 5,118,802; 5,138,045; 5,414,077; 5,486,603: 5,512,439; substitutions. As used herein, “unmodified’ or “natural 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; nucleotides comprise the purine bases adenine (A) and gua 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; nine (O), and the pyrimidine bases thymine (T), cytosine (C) 4,904,582: 4,958,013; 5,082,830; 5,112,963: 5,214,136; and uracil (U). Modified nucleotides comprise other synthetic 5,082,830; 5,112,963: 5,214,136; 5,245,022: 5,254,469; and natural nucleotides such as 5-methylcytosine (5-me-C), 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098: 5-hydroxymethyl cytosine, Xanthine, hypoxanthine, 2-ami 5,371,241, 5,391,723; 5,416.203, 5,451,463: 5,510,475; 5,512,667: 5,514,785; 5,565,552; 5,567,810: 5,574,142: noadenine, 6-methyl and other alkyl derivatives of adenine 5,585,481: 5,587,371; 5,595,726; 5,597.696; 5,599,923; and guanine, 2-propyl and other alkyl derivatives of adenine 5,599.928 and 5,688,941, each of which is herein incorpo and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, rated by reference. 5-halouracil and cytosine, 5-propynyl uracil and cytosine, (0206 Drug Discovery: 6-aZO uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 0207. The compounds of the present invention can also be 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hy applied in the areas of drug discovery and target validation. droxyl and other 8-Substituted adenines and guanines, 5-halo The present invention comprehends the use of the compounds particularly 5-bromo, 5-trifluoromethyl and other 5-substi and target segments identified herein in drug discovery efforts tuted uracils and cytosine, 7-methylguanine and 7-methylad to elucidate relationships that exist between a Sirtuin (SIRT) enine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and polynucleotide and a disease state, phenotype, or condition. 7-deaZaadenine and 3-deazaguanine and 3-deaZaadenine. These methods include detecting or modulating a Sirtuin 0201 Further, nucleotides comprise those disclosed in (SIRT) polynucleotide comprising contacting a sample, tis U.S. Pat. No. 3,687,808, those disclosed in The Concise Sue, cell, or organism with the compounds of the present Encyclopedia of Polymer Science And Engineering, pages invention, measuring the nucleic acid or protein level of a 858-859, Kroschwitz, J. I., ed. John. Wiley & Sons, 1990, Sirtuin (SIRT) polynucleotide and/or a related phenotypic or those disclosed by Englisch et at, Angewandle Chemic, chemical endpoint at Some time after treatment, and option International Edition, 1991, 30, page 613, and those dis ally comparing the measured value to a non-treated sample or closed by Sanghvi, Y. S., Chapter 15, Antisense Researchand sample treated with a further compound of the invention. Applications, pages 289-302, Crooke, S. T. and Lebleu, B. These methods can also be performed in parallel or in com ea. CRC Press, 1993. Certain of these nucleotides are par bination with other experiments to determine the function of ticularly useful for increasing the binding affinity of the oli unknown genes for the process of target validation or to gomeric compounds of the invention. These comprise 5-Sub determine the validity of a particular gene product as a target stituted pyrimidines, 6-azapyrimidines and N2, N-6 and 0-6 for treatment or prevention of a particular disease, condition, Substituted purines, comprising 2-aminopropyladenine, or phenotype. 5-propynyluracil and 5-propynyleytosine. 5-methylcytosine Substitutions have been shown to increase nucleic acid duplex Assessing Up-Regulation or Inhibition of Gene Expression: stability by 0.6-1.2°C. (Sanghvi, Y. S., Crooke, S. T. and 0208 Transfer of an exogenous nucleic acid into a host Lebleu, B., eds, Antisense Research and Applications, CRC cell or organism can be assessed by directly detecting the US 2012/O252869 A1 Oct. 4, 2012 22 presence of the nucleic acid in the cell or organism. Such (SIRT) protein or nucleic acid in a treated vs. an untreated detection can be achieved by several methods well known in sample can be compared with the difference in expression of the art. For example, the presence of the exogenous nucleic a different nucleic acid (including any standard deemed acid can be detected by Southern blot or by a polymerase appropriate by the researcher, e.g., a housekeeping gene) in a chain reaction (PCR) technique using primers that specifi treated sample vs. an untreated sample. cally amplify nucleotide sequences associated with the 0212. Observed differences can be expressed as desired, nucleic acid. Expression of the exogenous nucleic acids can e.g., in the form of a ratio or fraction, for use in a comparison also be measured using conventional methods including gene with control. In embodiments, the level of a Sirtuin (SIRT) expression analysis. For instance, mRNA produced from an mRNA or protein, in a sample treated with an antisense oli exogenous nucleic acid can be detected and quantified using gonucleotide of the present invention, is increased or a Northern blot and reverse transcription PCR (RT-PCR). decreased by about 1.25-fold to about 10-fold or more relative 0209 Expression of RNA from the exogenous nucleic to an untreated Sample or a sample treated with a control acid can also be detected by measuring an enzymatic activity nucleic acid. In embodiments, the level of a Sirtuin (SIRT) or a reporter protein activity. For example, antisense modu mRNA or protein is increased or decreased by at least about latory activity can be measured indirectly as a decrease or 1.25-fold, at least about 1.3-fold, at least about 1.4-fold, at increase in target nucleic acid expression as an indication that least about 1.5-fold, at least about 1.6-fold, at least about the exogenous nucleic acid is producing the effector RNA. 1.7-fold, at least about 1.8-fold, at least about 2-fold, at least Based on sequence conservation, primers can be designed about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at and used to amplify coding regions of the target genes. Ini least about 4-fold, at least about 4.5-fold, at least about 5-fold, tially, the most highly expressed coding region from each at least about 5.5-fold, at least about 6-fold, at least about gene can be used to build a model control gene, although any 6.5-fold, at least about 7-fold, at least about 7.5-fold, at least coding or noncoding region can be used. Each control gene is about 8-fold, at least about 8.5-fold, at least about 9-fold, at assembled by inserting each coding region between a reporter least about 9.5-fold, or at least about 10-fold or more. coding region and its poly(A) signal. These plasmids would produce an mRNA with a reporter gene in the upstream Kits, Research Reagents, Diagnostics, and Therapeutics portion of the gene and a potential RNAi target in the 3' 0213. The compounds of the present invention can be uti non-coding region. The effectiveness of individual antisense lized for diagnostics, therapeutics, and prophylaxis, and as oligonucleotides would be assayed by modulation of the research reagents and components of kits. Furthermore, anti reporter gene. Reporter genes useful in the methods of the sense oligonucleotides, which are able to inhibit gene expres present invention include acetohydroxyacid synthase sion with exquisite specificity, are often used by those of (AHAS), alkaline phosphatase (AP), beta galactosidase ordinary skill to elucidate the fimetion of particular genes or (LacZ), beta glucoronidase (GUS), chloramphenicol acetyl to distinguish between functions of various members of a transferase (CAT), green fluorescent protein (GFP), red fluo biological pathway. rescent protein (RFP), yellow fluorescent protein (YFP), cyan 0214. For use in kits and diagnostics and in various bio fluorescent protein (CFP), horseradish peroxidase (HRP), logical systems, the compounds of the present invention, luciferase (Luc), nopaline synthase (NOS), octopine synthase either alone or in combination with other compounds or (OCS), and derivatives thereof. Multiple selectable markers therapeutics, are useful as tools in differential and/or combi are available that confer resistance to amplicillin, bleomycin, natorial analyses to elucidate expression patterns of a portion chloramphenicol, gentamycin, hygromycin, kanamycin, lin or the entire complement of genes expressed within cells and comycin, methotrexate, phosphinothricin, puromycin, and tissues. tetracycline. Methods to determine modulation of a reporter 0215. As used herein the term “biological system” or “sys gene are well known in the art, and include, but are not limited tem’ is defined as any organism, cell, cell culture or tissue that to, fluorometric methods (e.g. fluorescence spectroscopy, expresses, or is made competent to express products of the Fluorescence Activated Cell Sorting (FACS), fluorescence Sirtuin (SIRT). These include, but are not limited to, humans, microscopy), antibiotic resistance determination. transgenic animals, cells, cell cultures, tissues, Xenografts, 0210 SIRT1, SIRT3 and SIRT6 proteins and mRNA transplants and combinations thereof. expression can be assayed using methods known to those of 0216. As one non limiting example, expression patterns skill in the art and described elsewhere herein. For example, within cells or tissues treated with one or more antisense immunoassays such as the ELISA can be used to measure compounds are compared to control cells or tissues not protein levels. Sirtuin (SIRT) antibodies for ELISAs are treated with antisense compounds and the patterns produced available commercially, e.g., from R&D Systems (Minne are analyzed for differential levels of gene expression as they apolis, Minn.), Abeam, Cambridge, Mass. pertain, for example, to disease association, signaling path 0211. In embodiments, SIRT1, SIRT3 and SIRT6 expres way, cellular localization, expression level, size, structure or sion (e.g., mRNA or protein) in a sample (e.g., cells or tissues function of the genes examined. These analyses can be per in vivo or in vitro) treated using an antisense oligonucleotide formed on stimulated or unstimulated cells and in the pres of the invention is evaluated by comparison with Sirtuin ence or absence of other compounds that affect expression (SIRT) expression in a control sample. For example, expres patterns. sion of the protein or nucleic acid can be compared using 0217 Examples of methods of gene expression analysis methods known to those of skill in the art with that in a known in the art include DNA arrays or microarrays (Brazma mock-treated or untreated Sample. Alternatively, comparison and Vilo, (2000) FEBS Lett., 480, 17-24: Celis, et al., (2000) with a sample treated with a control antisense oligonucleotide FEBS Lett., 480, 2-16), SAGE (serial analysis of gene expres (e.g., one having an altered or different sequence) can be sion) (Madden, et al., (2000) Drug Discov. Today, 5, 415 made depending on the information desired. In another 425), READS (restriction enzyme amplification of digested embodiment, a difference in the expression of the Sirtuin eDNAs) (Prashar and Weissman, (1999) Methods Enzymol, US 2012/O252869 A1 Oct. 4, 2012

303, 258-72), TOGA (total gene expression analysis) (Sutc by at least 50%, by at least 60%, by at least 70%, by at least liffe, et al., (2000) Proc. Natl. Acad. Set. USA.,97, 1976-81), 75%, by at least 80%, by at least 85%, by at least 90%, by at protein arrays and proteomics (Cells, et al., (2000) FEBS least 95%, by at least 98%, by at least 99%, or by 100% as Lett., 480, 2-16; Jungblut, et at, Electrophoresis, 1999, 20, compared to a control. 2100-10), expressed sequence tag (PST) sequencing (Celis, 0221. In one embodiment, the activity or expression of a et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotech Sirtuin (SIRT) and/or in an animal is increased by about 10% nol., 2000, 80, 143-57), subtractive RNA fingerprinting as compared to a control. Preferably, the activity or expres (SURF) (Fuchs, et at, (2000) Anal. Biochem. 286, 91-98: sion of a Sirtuin (SIRT) in an animal is increased by about Larson, et al., (2000) Cytomeiry 41, 203-208), subtractive 30%. More preferably, the activity or expression of a Sirtuin cloning, differential display (DD) (Jurecic and Belmont, (SIRT) in an animal is increased by 50% or more. Thus, the (2000) Curr. Opin. Microbial. 3, 3.16-21), comparative oligomeric compounds modulate expression of a Sirtuin genomic hybridization (Carulli, et al., (1998) J. Cell Bio (SIRT) mRNA by at least 10% by at least 50%, by at least chem. Suppl., 31, 286-96), FISH (fluorescent in situ hybrid 25%, by at least 30%, by at least 40%, by at least 50%, by at ization) techniques (Going and Gusterson, (1999) Eur: J. least 60%, by at least 70%, by at least 75%, by at least 80%, Cancer, 35, 1895-904) and mass spectrometry methods (To, by at least 85%, by at least 90%, by at least 95%, by at least Comb. (2000) Chem, High Throughput Screen, 3, 235-41). 98%, by at least 99%, or by 100% as compared to a control. 0218. The compounds of the invention are useful for 0222 For example, the reduction of the expression of a research and diagnostics, because these compounds hybrid Sirtuin (SIRT) may be measured in serum, blood, adipose ize to nucleic acids encoding a Sirtuin (SIRT). For example, tissue, liver or any other body fluid, tissue or organ of the oligonucleotides that hybridize with such efficiency and animal. Preferably, the cells contained within said fluids, under such conditions as disclosed herein as to be effective tissues or organs being analyzed contain a nucleic acid mol Sirtuin (SIRT) modulators are effective primers or probes ecule encoding Sirtuin (SIRT) peptides and/or the Sirtuin under conditions favoring gene amplification or detection, (SIRT) protein itself. respectively. These primers and probes are useful in methods 0223) The compounds of the invention can be utilized in requiring the specific detection of nucleic acid molecules pharmaceutical compositions by adding an effective amount encoding a Sirtuin (SIM) and in the amplification of said of a compound to a suitable pharmaceutically acceptable nucleic acid molecules for detection or for use in further diluent or carrier. Use of the compounds and methods of the studies of a Sirtuin (SIRT). Hybridization of the antisense invention may also be useful prophylactically. oligonucleotides, particularly the primers and probes, of the 0224 Conjugates: invention with a nucleic acid encoding a Sirtuin (SIRT) can be 0225. Another modification of the oligonucleotides of the detected by means known in the art. Such means may include invention involves chemically linking to the oligonucleotide conjugation of an enzyme to the oligonucleotide, radiolabel one or more moieties or conjugates that enhance the activity, ing of the oligonucleotide, or any other suitable detection cellular distribution or cellular uptake of the oligonucleotide. means. Kits using such detection means for detecting the level These moieties or conjugates can include conjugate groups of a Sirtuin (SIRT) in a sample may also be prepared. covalently bound to functional groups such as primary or 0219. The specificity and sensitivity of antisense are also secondary hydroxyl groups. Conjugate groups of the inven harnessed by those of skill in the art for therapeutic uses. tion include intercalators, reporter molecules, polyamines, Antisense compounds have been employed as therapeutic polyamides, polyethylene glycols, polyethers, groups that moieties in the treatment of disease states in animals, includ enhance the pharmacodynamic properties of oligomers, and ing humans. Antisense oligonucleotide drugs have been groups that enhance the pharmacokinetic properties of oligo safely and effectively administered to humans and numerous mers. Typicalconjugate groups include cholesterols, lipids, clinical trials are presently underway. It is thus established phospholipids, biotin, phenazine, folate, phenanthridine, that antisense compounds can be useful therapeutic modali anthraquinone, acridine, fluoresceins, rhodamines, cou ties that can be configured to be useful in treatment mimes for marins, and dyes. Groups that enhance the pharmacodynamic the treatment of cells, tissues and animals, especially humans. properties, in the context of this invention, include groups that 0220. For therapeutics, an animal, preferably a human, improve uptake, enhance resistance to degradation, and/or Suspected of having a disease or disorder which can be treated strengthen sequence-specific hybridization with the target by modulating the expression of a Sirtuin (SIRT) polynucle nucleic acid. Groups that enhance the pharmacokinetic prop otide is treated by administering antisense compounds in erties, in the context of this invention, include groups that accordance with this invention. For example, in one non improve uptake, distribution, metabolism or excretion of the limiting embodiment, the methods comprise the step of compounds of the present invention. Representative conju administering to the animal in need of treatment, a therapeu gate groups are disclosed in International Patent Application tically effective amount of a Sirtuin (SIRT) modulator. The No. PCT/US92109196, filed Oct. 23, 1992, and U.S. Pat. No. Sirtuin (SIRT) modulators of the present invention effectively 6,287,860, which am incorporated herein by reference. Con modulate the activity of a Sirtuin (SIRT) or modulate the jugate moieties include, but are not limited to, lipid moieties expression of a Sirtuin (SIRT) protein. In one embodiment, Such as a cholesterol moiety, cholic acid, a thioether, e.g., the activity or expression of a Sirtuin (SIRT) in an animal is hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., inhibited by about 10% as compared to a control. Preferably, dodecandiol or undecyl residues, a phospholipid, e.g., di the activity or expression of a Sirtuin (SIRT) in an animal is hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexa inhibited by about 30%. More preferably, the activity or decyl-rac-glycero-3-Hphosphonate, a polyamine or a poly expression of a Sirtuin (SIRT) in an animal is inhibited by ethylene glycol chain, or adamantane acetic acid, a palmityl 50% or more. Thus, the oligomeric compounds modulate moiety, or an octadecylamine or hexylamino-carbonyl-oxy expression of a Sirtuin (SIRT) mRNA by at least 10%, by at cholesterol moiety. Oligonucleotides of the invention may least 50%, by at least 25%, by at least 30%, by at least 40%, also be conjugated to active drug Substances, for example, US 2012/O252869 A1 Oct. 4, 2012 24 aspirin, warfarin, phenylbutaZone, ibuprofen, Suprofen, fen One HIV based viral vector comprises at least two vectors bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyl wherein the gag and poigenes are from an HIV genome and sarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic the env gene is from another virus. DNA viral vectors are acid, a benzothiadiazide, chlorothiazide, a diazepine, preferred. These vectors include pox vectors such as Orthopox indomethicin, a barbiturate, a cephalosporin, a Sulfa drug, an oravipox vectors, herpesvirus vectors such as a herpes sim antidiabetic, an antibacterial or an antibiotic. plex 1 virus (HSV) vector, Adenovirus Vectors and Adeno 0226 Representative United States patents that teach the associated Virus Vectors). preparation of Such oligonucleotides conjugates include, but 0233. The antisense compounds of the invention encom are not limited to, U.S. Pat. Nos. 4,828,979: 4,948,882; 5,218, pass any pharmaceutically acceptable salts, esters, or salts of 105:5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, Such esters, or any other compound which, upon administra 5,580,731: 5,580,731: 5,591,584; 5,109,124; 5,118,802: tion to an animal, including a human, is capable of providing 5,138,045; 5,414,077; 5,46,603: 5,512.439; 5,578,718; (directly or indirectly) the biologically active metabolite or 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; residue thereof. 4,789,737; 4,824.941; 4,835,263; 4,876,335; 4,904,582: 0234. The term “pharmaceutically acceptable salts' refers 4,958,013; 5,082,830; 5,112,963: 5,214,136; 5,082,830; to physiologically and pharmaceutically acceptable salts of 5,112,963: 5,214,136: 5,245,022: 5,254,469; 5,258,506; the compounds of the invention: i.e., salts that retain the 5,262,536; 5,272,250; 5,292,873; 5,317,098: 5,371,241, desired biological activity of the parent compound and do not 5,391,723; 5,416.203, 5,451,463: 5,510,475; 5,512,667; impart undesired toxicological effects thereto. For oligo 5,514,785: 5,565,552; 5,567,810; 5,574,142: 5,585,481; nucleotides, examples of pharmaceutically acceptable salts 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and and their uses are further described in U.S. Pat. No. 6,287, 5,688,941. 860, which is incorporated herein by reference. 0227. Formations: 0235. The present invention also includes pharmaceutical 0228. The compounds of the invention may also be compositions and formulations that include the antisense admixed, encapsulated, conjugated or otherwise associated compounds of the invention. The pharmaceutical composi with other molecules, molecule structures or mixtures of tions of the present invention may be administered in a num compounds, as for example, liposomes, receptor-targeted ber of ways depending upon whether local or systemic treat molecules, oral, rectal, topical or other formulations, for ment is desired and upon the area to be treated. assisting in uptake, distribution and/or absorption. Represen Administration may be topical (including ophthalmic and to tative United States patents that teach the preparation of such mucous membranes including Vaginal and rectal delivery), uptake, distribution and/or absorption-assisting formulations pulmonary, e.g., by inhalation or insufflation of powders or include, but are not limited to, U.S. Pat. Nos. 5,108,921; aerosols, including by nebulizer, intratracheal, intranasal, 5,354,844; 5,416,016; 5,459,127: 5,521,291; 5,543,165; epidermal and transdermal), oral or parenteral. Parenteral 5,547,932; 5,583,020; 5,591,721: 4,426,330; 4,534,899; administration includes intravenous, intraarterial, Subcutane 5,013,556; 5,108,921; 5,213,804: 5,227,170, 5,264,221; ous, intraperitoneal or intramuscular injection or infusion; or 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5.462,854; intracranial, e.g., intrathecal or intraventricular, administra 5,469,854: 5,512.295: 5,527,528: 5,534,259; 5,543,152: tion. 5,556,948: 5,580,575; and 5,595,756, each of which is herein 0236. For treating tissues in the central nervous system, incorporated by reference. administration can be made by, e.g., injection or infusion into 0229. Although, the antisense oligonucleotides do not the cerebrospinal fluid. Administration of antisense RNA into need to be administered in the context of a vector in order to cerebrospinal fluid is described, e.g., in U.S. Pat. App. Pub. modulate a target expression and/or function, embodiments No. 2007/0117772, “Methods for slowing familial ALS dis of the invention relates to expression vector constructs for the ease progression, incorporated herein by reference in its expression of antisense oligonucleotides, comprising pro entirety. moters, hybrid promoter gene sequences and possess a strong 0237 When it is intended that the antisense oligonucle constitutive promoter activity, or a promoter activity which otide of the present invention be administered to cells in the can be induced in the desired case. central nervous system, administration can be with one or 0230. In an embodiment, invention practice involves more agents capable of promoting penetration of the Subject administering at least one of the foregoing antisense oligo antisense oligonucleotide across the blood-brain barrier. nucleotides with a suitable nucleic acid delivery system. In Injection can be made, e.g., in the entorhinal cortex or hip one embodiment, that system includes a non-viral vector pocampus. Delivery of neurotrophic factors by administra operably linked to the polynucleotide. Examples of such non tion of an adenovirus vector to motor neurons in muscle tissue viral vectors include the oligonucleotide alone (e.g. any one is described in, e.g., U.S. Pat. No. 6,632,427, Adenoviral or more of SEQID NOS: 15 to 94) or in combination with a vector-mediated gene transfer into medullary motor neu Suitable protein, polysaccharide or lipid formulation. rons, incorporated herein by reference. Delivery of vectors 0231. Additionally suitable nucleic acid delivery systems directly to the brain, e.g., the striatum, the thalamus, the include viral vector, typically sequence from at least one of an hippocampus, or the Substantia nigra, is known in the art and adenovirus, adenovirus-associated virus (AAV), helper-de described, e.g., in U.S. Pat. No. 6,756.523, Adenovirus vec pendent adenovirus, retrovirus, or hemagglutinatin virus of tors for the transfer of foreign genes into cells of the central Japan-liposome (HVJ) complex. Preferably, the viral vector nervous system particularly in brain, incorporated herein by comprises a strong eukaryotic promoter operably linked to reference. Administration can be rapid as by injection or the polynucleotide e.g., a cytomegalovirus (CMV) promoter. made over a period of time as by slow infusion or adminis 0232. Additionally vectors include viral vectors, fusion tration of slow release formulations. proteins and chemical conjugates. Retroviral vectors include 0238. The subject antisense oligonucleotides can also be Moloney murine leukemia viruses and HIV-based viruses. linked or conjugated with agents that provide desirable phar US 2012/O252869 A1 Oct. 4, 2012 maceutical orpharmacodynamic properties. For example, the the Suspension including, for example, Sodium carboxymeth antisense oligonucleotide can be coupled to any Substance, ylcellulose, Sorbitol and/or dextran. The Suspension may also known in the art to promote penetration or transport across the contain stabilizers. blood-brain bather, such as an antibody to the transferrin 0243 Pharmaceutical compositions of the present inven receptor, and administered by intravenous injection. The anti tion include, but are not limited to, Solutions, emulsions, sense compound can be linked with a viral vector, for foams and liposome-containing formulations. The pharma example, that makes the antisense compound more effective and/or increases the transport of the antisense compound ceutical compositions and formulations of the present inven across the blood-brain barrier. Osmotic blood brain barrier tion may comprise one or more penetration enhancers, carri disruption can also be accomplished by, e.g., infusion of ers, excipients or other active or inactive ingredients. Sugars including, but not limited to, mesoerythritol. Xylitol, 0244 Emulsions are typically heterogeneous systems of D(+) galactose, D(+) lactose, D(+) Xylose, dulcitol, myo one liquid dispersed in another in the form of droplets usually inositol. L(-) fructose, D(-) marmitol, D(+) glucose, D(+) exceeding 0.1 um in diameter. Emulsions may contain addi arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) tional components in addition to the dispersed phases, and the raffinose, rhamnose, D(+) melibiose, D(-) ribose, adonitol, active drug that may be present as a solution in either the D(+) arabitol. L(-) arabitol, D(+) fucose, L(-) fucose, D(-) aqueous phase, oily phase or itself as a separate phase. Micro lyxose, I(+) lyxose, and L(-)lyxose, or amino acids includ emulsions are included as an embodiment of the present ing, but not limited to, glutamine, lysine, arginine, aspar invention. Emulsions and their uses are well known in the art agine, aspartic acid, cysteine, glutamic acid, glycine, histi and are further described in U.S. Pat. No. 6,287,860. dine, leucine, methionine, phenylalanine, proline, serine, 0245. Formulations of the present invention include lipo threonine, tyrosine, Valine, and taurine. Methods and materi Somal formulations. As used in the present invention, the term als for enhancing blood brain barrier penetration are "liposome” means a vesicle composed of amphiphilic lipids described, e.g., in U.S. Pat. No. 4,866,042, “Method for the arranged in a spherical bilayer or bilayers. Liposomes are delivery of genetic material across the blood brain barrier.” unilamellar or multilamellar vesicles which have a membrane U.S. Pat. No. 6.294,520, “Material for passage through the formed from a lipophilic material and an aqueous interior that blood-brain barrier, and U.S. Pat. No. 6,936,589, “Parenteral contains the composition to be delivered. Cationic liposomes delivery systems, all incorporated herein by reference in are positively charged liposomes that are believed to interact their entirety. with negatively charged DNA molecules to form a stable 0239. The subject antisense compounds may be admixed, complex. Liposomes that are pH-sensitive or negatively encapsulated, conjugated or otherwise associated with other charged are believed to entrap DNA rather than complex with molecules, molecule structures or mixtures of compounds, it. Both cationic and noncationic liposomes have been used to for example, liposomes, receptor-targeted molecules, oral, deliver DNA to cells. rectal, topical or other formulations, for assisting in uptake, 0246 Liposomes also include “sterically stabilized' lipo distribution and/or absorption. For example, cationic lipids Somes, a term which, as used herein, refers to liposomes may be included in the formulation to facilitate oligonucle comprising one or more specialized lipids. When incorpo otide uptake. One such composition shown to facilitate rated into liposomes, these specialized lipids result in lipo uptake is LIPOFECTIN (available from GIBCO-BRL, somes with enhanced circulation lifetimes relative to lipo Bethesda, Md.). Someslacking such specialized lipids. Examples of sterically 0240 Oligonucleotides with at least one 2'-O-methoxy stabilized liposomes are those in which part of the vesicle ethyl modification are believed to be particularly useful for forming lipid portion of the liposome comprises one or more oral administration. Pharmaceutical compositions and for glycolipids or is derivatized with one or more hydrophilic mulations for topical administration may include transdermal polymers, such as a polyethylene glycol (PEG) moiety. Lipo patches, ointments, lotions, creams, gels, drops, supposito somes and their uses are further described in U.S. Pat. No. ries, sprays, liquids and powders. Conventional pharmaceu 6,287,860. tical carriers, aqueous, powder or oily bases, thickeners and 0247 The pharmaceutical formulations and compositions the like may be necessary or desirable. Coated condoms, of the present invention may also include Surfactants. The use gloves and the like may also be useful. of Surfactants in drug products, formulations and in emul 0241 The pharmaceutical formulations of the present sions is well known in the art. Surfactants and their uses are invention, which may conveniently be presented in unit dos further described in U.S. Pat. No. 6,287,860, which is incor age form, may be prepared according to conventional tech porated herein by reference. niques well known in the pharmaceutical industry. Such tech 0248. In one embodiment, the present invention employs niques include the step of bringing into association the active various penetration enhancers to effect the efficient delivery ingredients with the pharmaceutical carriers) or excipient(s). of nucleic acids, particularly oligonucleotides. In addition to In general, the formulations are prepared by uniformly and aiding the diffusion of non-lipophilic drugs across cell mem intimately bringing into association the active ingredients branes, penetration enhancers also enhance the permeability with liquid carriers or finely divided solid carriers or both, and of lipophilic drugs. Penetration enhancers may be classified then, if necessary, shaping the product. as belonging to one of five broad categories, i.e., Surfactants, 0242. The compositions of the present invention may be fatty acids, bile salts, chelating agents, and non-chelating formulated into any many possible dosage forms such as, but nonsurfactants. Penetration enhancers and their uses are fur not limited to, tablets, capsules, gel capsules, liquid syrups, ther described in U.S. Pat. No. 6,287,860, which is incorpo softgels, Suppositories, and enemas. The compositions of the rated herein by reference. present invention may also be formulated as Suspensions in 0249. One of skill in the art will recognize that formula aqueous, non-aqueous or mixed media. Aqueous Suspensions tions are routinely designed according to their intended use, may further contain Substances that increase the Viscosity of i.e. route of administration. US 2012/O252869 A1 Oct. 4, 2012 26

0250 formulations for topical administration include gemcitabine, teniposide, cisplatin and diethylstilbestrol those in which the oligonucleotides of the invention are in (DES). When used with the compounds of the invention, such admixture with a topical delivery agent such as lipids, lipo chemotherapeutic agents may be used individually (e.g., Somes, fatty acids, fatty acid esters, steroids, chelating agents 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oli and Surfactants lipids and liposomes include neutral (e.g. gonucleotide for a period of time followed by MTX and dioleoyl-phosphatidyl DOPE ethanolamine, dimyris oligonucleotide), or in combination with one or more other toylphosphatidyl choline DMPC, distearolyphosphatidyl such chemotherapeutic agents (e.g., 5-FU, MTX and Oligo choline) negative (e.g. dimyristoylphosphatidyl glycerol nucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl inflammatory drugs, including but not limited to nonsteroidal DOTAP and dioleoyl-phosphatidyl ethanolamine DOTMA). anti-inflammatory drugs and corticosteroids, and antiviral 0251 For topical or other administration, oligonucle drugs, including but not limited to ribivirin, Vidarabine, acy otides of the invention may be encapsulated within liposomes clovirand ganciclovir, may also be combined in compositions or may form complexes thereto, in particular to cationic lipo of the invention. Combinations of antisense compounds and Somes. Alternatively, oligonucleotides may be complexed to other non-antisense drugs are also within the scope of this lipids, in particular to cationic lipids bay acids and esters, invention. Two or more combined compounds may be used pharmaceutically acceptable salts thereof, and their uses are together or sequentially. further described in U.S. Pat. No. 6,287,860. 0255. In another related embodiment, compositions of the 0252 Compositions and formulations for oral administra invention may contain one or more antisense compounds, tion include powders or granules, microparticulates, nanopar particularly oligonucleotides, targeted to a first nucleic acid ticulates, Suspensions or solutions in water or non-aqueous and one or more additional antisense compounds targeted to media, capsules, gel capsules Sachets, tablets or minitablets. a second nucleic acid target. For example, the first target may Thickeners, flavoring agents, diluents, emulsifiers, dispersing be a particular antisense sequence of a Sirtuin (STRT), and aids or binders may be desirable, oral formulations are those the second target may be a region from another nucleotide in which oligonucleotides of the invention are administered in sequence. Alternatively, compositions of the invention may conjunction with one or more penetration enhancers Surfac contain two or more antisense compounds targeted to differ tants and dictators surfactants include fatty acids and/or esters ent regions of the same Sirtuin (SIRT) nucleic acid target. or salts thereof, bile acids and/or salts thereof bile acids/salts Ntunerous examples of antisense compounds are illustrated and fatty acids and their uses are further described in U.S. Pat. herein and others may be selected from among Suitable com No. 6,287,860, which is incorporated herein by reference. pounds known in the at Two or more combined compounds Also are combinations of penetration enhances, for example, may be used together or sequentially. fatty acids/salts in combination with bile acids/salts. A par ticularly combination is the Sodium salt of laurie acid, cupric Dosing: acid and UDCA. Further penetration enhancers include poly 0256 The formulation of therapeutic compositions and oxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. their Subsequent administration (dosing) is believed to be Oligonucleotides of the invention may be delivered orally, in within the skill of those in the art. Dosing is dependent on granular form including sprayed dried particles, or com severity and responsiveness of the disease State to be treated, plexed to form micro or nanoparticles. Oligonucleotide com with the course of treatment lasting from several days to plexing agents and their uses are further described in U.S. Pat. several months, or until a cure is effected or a diminution of No. 6,287,860, which is incorporated herein by reference. the disease state is achieved. Optimal dosing schedules can be 0253 Compositions and formulations for parenteral, calculated from measurements of drug accumulation in the intrathecal or intraventricular administration may include body of the patient. Persons of ordinary skill can easily deter sterile aqueous Solutions that may also contain buffers, dilu mine optimum dosages, dosing methodologies and repetition ents and other suitable additives such as, but not limited to, rates. Optimum dosages may vary depending on the relative penetration enhancers, carrier compounds and other pharma potency of individual oligonucleotides, and can generally be ceutically acceptable carriers or excipients. estimated based on EC50s found to be effective in invitro and 0254 Certain embodiments of the invention provide phar in vivo animal models. In general, dosage is from 0.01 ug to maceutical compositions containing one or more oligomeric 100g per kg of body weight, and may be given once or more compounds and one or more other chemotherapeutic agents daily, weekly, monthly or yearly, or even once every 2 to 20 that function by a non-antisense mechanism. Examples of years. Persons of ordinary skill in the art can easily estimate Such chemotherapeutic agents include but are not limited to repetition rates for dosing based on measured residence times cancer chemotherapeutic drugs such as daunorubicin, dauno and concentrations of the drug in bodily fluids or tissues. mycin, dactinomycin, doxorubicin, epirubicin, idarubicin, Following successful treatment, it may be desirable to have esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine the patient undergo maintenance therapy to prevent the recur arabinoside, bischloroethyl-nitroSurea, buSulfan, mitomycin rence of the disease state, wherein the oligonucleotide is C, actinomycin D. mithramycin, prednisone, hydroxyproges administered in maintenance doses, ranging from 0.01 ug to terone, testosterone, tamoxifen, dacarbazine, procarbazine, 100g per kg of body weight, once or more daily; to once every hexamethylmelamine, pentamethylmelamine, mitoxantrone, 20 years. amsacrine, chlorambucil, methylcyclohexylnitroSurca, nitro 0257. In embodiments, a patient is treated with a dosage of gen mustards, melphalan, cyclophosphamide, 6-mercaptopu drug that is at least about 1, at least about 2, at least about 3. rine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, at least about 4, at least about 5, at least about 6, at least about deoxycoformycin, 4-hydroxyperoxycyclo-phosphoramide, 7, at least about 8, at least about 9, at least about 10, at least 5-fluorouracil (5-FU), 5-fluotndeoxyuridine (5-FUdR), about 15, at least about 20, at least about 25, at least about 30, methotrexate (MTX), colchicine, enrol, Vincristine, vinblas at least about 35, at least about 40, at least about 45, at least tine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, about 50, at least about 60, at least about 70, at least about 80, US 2012/O252869 A1 Oct. 4, 2012 27 at least about 90, or at least about 100 mg/kg body weight. 0263. An antisense compound is “specifically hybridiz Certain injected dosages of antisense oligonucleotides are able' when binding of the compound to the and nucleic acid described, e.g., in U.S. Pat. No. 7,563,884, Antisense modu interferes with the normal function of the target nucleic acid lation of PTPIB expression, incorporated herein by refer to cause a modulation of function and/or activity, and there is ence in its entirety. a sufficient degree of complementarity to avoid non-specific 0258 While various embodiments of the present invention binding of the antisense compound to non-target nucleic acid have been described above, it should be understood that they sequences under conditions in which specific binding is have been presented by way of example only, and not limita desired, i.e., under physiological conditions in the case of in tion. Numerous changes to the disclosed embodiments can be made in accordance with the disclosure herein without Vivo assays or therapeutic treatment, and under conditions in departing from the spirit or scope of the invention. Thus, the which assays are performed in the case of in vitro assays breadth and scope of the present invention should not be 0264. The hybridization properties of the oligonucleotides limited by any of the above described embodiments. described herein can be determined by one or more in vitro 0259 All documents mentioned herein are incorporated assays as known in the art. For example, the properties of the herein by reference. All publications and patent documents oligonucleotides described herein can be obtained by deter cited in this application are incorporated by reference for all mination of binding strength between the target natural anti purposes to the same extent as if each individual publication sense and a potential drug molecules using melting curve or patent document were so individually denoted. By their assay. citation of various references in this document, Applicants do 0265. The binding strength between the target natural anti not admit any particular reference is “prior art” to their inven sense and a potential drug molecule (Molecule) can be esti tion. Embodiments of inventive compositions and methods mated using any of the established methods of measuring the are illustrated in the following examples. strength of intermolecular interactions, for example, a melt EXAMPLES ing curve assay. 0266 Melting curve assay determines the temperature at 0260 The following non-limiting Examples serve to illus which a rapid transition from double-stranded to single trate selected embodiments of the invention. It will be appre Stranded conformation occurs for the natural antisense/Mol ciated that variations in proportions and alternatives in ele ecule complex. This temperature is widely accepted as a ments of the components shown will be apparent to those skilled in the art and are within the scope of embodiments of reliable measure of the interaction strength between the two the present invention. molecules. 0267 A melting curve assay can be performed using a Example 1 cDNA copy of the actual natural antisense RNA molecule or a synthetic DNA or RNA nucleotide corresponding to the Design of Antisense Oligonucleotides Specific for a binding site of the Molecule. Multiple kits containing all Nucleic Acid Molecule Antisense to a Sirtuin (SIRT) necessary reagents to perform this assay are available (e.g. and/or a Senses Strand of a Sirtuin (SIRT) Poly Applied Biosystems Inc. MeltDoctor kit). These kits include nucleotide a suitable buffer solution containing one of the double strand. 0261. As indicated above the term "oligonucleotide spe DNA (dsDNA) binding dyes (such as ABI HRM dyes, SYBR cific for or "oligonucleotide targets” refers to an oligonucle Green, SYTO, etc). The properties of the dsDNA dyes are otide having a sequence (i) capable of forming a stable com such that they emit almost no fluorescence in free form, but plex with a portion of the targeted gene, or (ii) capable of are highly fluorescent when hound to dsDNA. forming a stable duplex with a portion of an mRNA transcript of the targeted gene. 0268 To perform the assay the cDNA or a corresponding 0262 Selection of appropriate oligonucleotides is facili oligonucleotide are mixed with Molecule in concentrations tated by using computer programs that automatically align defined by the particular manufacturer's protocols. The mix nucleic acid sequences and indicate regions of identity or ture is heated to 95°C. to dissociate all pre-formed dsDNA homology. Such programs are used to compare nucleic acid complexes, then slowly cooled to room temperature or other sequences obtained, for example, by searching databases lower temperature defined by the kit manufacturer to allow Such as GenBank or by sequencing PCR products. Compari the DNA molecules to anneal. The newly formed complexes Son of nucleic acid sequences from a range of species allows are then slowly heated to 95°C. with simultaneous continu the selection of nucleic acid sequences that display an appro ous collection of data on the amount of fluorescence that is priate degree of identity between species. In the case of genes produced by the reaction. The fluorescence intensity is that have not been sequenced, Southern blots are performed to inversely proportional to the amounts of dsDNA present in allow a determination of the degree of identity between genes the reaction. The data can be collected using a real time PCR in target species and other species. By performing Southern instrument compatible with the kit (e.g. ABI's StepOne Plus blots at varying degrees of stringency, as is well known in the Real Time PCR System or LightTyper instrument, Roche art, it is possible to obtain an approximate measure of identity. Diagnostics, Lewes, UK). These procedures allow the selection of oligonucleotides that 0269 Melting peaks are constructed by plotting the nega exhibit a high degree of complementarity to target nucleic tive derivative of fluorescence with respect to temperature acid sequences in a subject to be controlled and a lower degree (-d(Fluorescence)/dT) on the y-axis) against temperature of complementarity to corresponding nucleic acid sequences (X-axis) using appropriate Software (for example LightTyper in other species. One skilled in the art will realize that there is (Roche) or SDS Dissociation Curve, ABU The data is ana considerable latitude in selecting appropriate regions of lyzed to identify the temperature of the rapid transition from genes for use in the present invention. dsDNA complex to single strand molecules. This temperature US 2012/O252869 A1 Oct. 4, 2012 28 is called Tm and is directly proportional to the strength of 0276. The results show that a significant increase in SIRT1 interaction between the two molecules. Typically, Tm will mRNA levels in HepG2 cells 48 hours after treatment with exceed 40° C. one of the oligonucleotides designed to SIRT antisense BE717453. (FIG. 10). Example 2 (0277. The results show that show that the levels of the Modulation of SIRT Polynticleotides SIRT1 mRNA in HepG2 cells are significantly increased 48 h. (0270 Treatment of HepG2 Cells with Antisense Oligo after treatment with three of the oligonucleotides designed to nucleotides SIRT1 antisense AV718812 respectively (FIG. 11). (0271 HepG2 cells from ATCC (cath. HB-8065) were 0278 Real time PCR results show that the levels of SIRT1 grown in growth media (MEM/EBSS (Hyclone cat it mRNA in HepG2 cells are significantly increased 48 h after SH30024, or Mediatech cat # MT-10-010-CV)+10% FBS treatment with two of the oligos designed to SIRT1 antisense (Mediatech cathi MT35-011-CV)+penicillin/streptomycin AW169958 (FIG. 12). (Mediatech cathi MT30-002-CI)) at 37° C. and 5% CO. One (0279 RT PCR results show that sirt3 levels in HepG2 cells day before the experiment the cells were replated at the den are increased 48 hours after treatment with phosphorothioate sity of 1.5x10/ml into 6 well plates and incubated at 37° C. antisense oligonucleotides designed to sirt3 antisense and 5% CO. On the day of the experiment the media in the 6 Hs.683117 (CUR-1545-1550) (FIG. 17). well plates was changed to fresh growth media. Allantisense oligonucleotides were diluted to the concentration of 20 uM. 0280 Real time PCR results show that the levels of SIRT6 Two ul of this solution was incubated with 400 ul of Opti mRNA in HepG2 cells are significantly increased 48 h after MEM media (Gihco catfi31985-070) and 4 ul of Lipo treatment with one of the oliogs designed to SIRT6 antisense fectamine 2000 (Invitrogen cati 11668019) at room tempera NM 133475 (FIG. 18). ture for 20 min and applied to each well of the 6 well plates (0281 Real time PCR results show that the levels of SIRT6 with HepG2 cells. A Similar mixture including 2 ul of water mRNA in HepG2 cells are significantly increased 48 h after instead of the oligonucleotide solution was used for the mock treatment with one of the oliogs designed to SIRT6 antisense transfected controls. After 3-18h of incubation at 37° C. and bf772662 (FIG. 19) 5% CO, the media was changed to fresh growth media. 48 h. Treatment of 373 Cells with Antisense Oligonucleotides after addition of antisense oligonucleotides the media was removed and RNA was extracted from the cells using SV (0282 3T3 cells from ATCC (cath CRL-1658) were grown Total RNA Isolation System from Promega (cathZ3105) or in growth media (MEM/EBSS (Hyclone cat #SH30024, or RNeasy Total RNA. Isolation kit from Qiagen (cati74181) Mediatech cat HMT-10-010-CV) +10% FBS (Mediatech following the manufacturers instructions. 600 ng of RNA catiMT35-011-CV)+penicillin/streptomycin (Mediatech was added to the reverse transcription reaction performed cathMT30-002-CI)) at 37° C. and 5% CO. One day before using Verso cDNA kit from Thermo Scientific the experiment the cells were replated at the density of 1.5x (cati AB 1453B) or High Capacity cINA Reverse Transcrip 10/ml into 6 well plates and incubated at 37° C. and 5% CO. tion Kit (cati4368813) as described in the manufacturer's On the day of the experiment the media in the 6 well plates protocol. The cDNA from this reverse transcription reaction was changed to flesh growth media. Allantisense oligonucle was used to monitor gene expression by real time PCR using otides were diluted to the concentration of 20 LM. Two ul of ABI Taqman Gene Expression Mix (cati4369510) and prim this solution was incubated with 400 ul of Opti-MEM media ers/probes designed by ABI (Applied. Biosystems ragman Gibco cati31985-070) and 4 ul of Lipofectamine 2000 (Invit Gene Expression Assay: Hs00202021 ml, Hs00202030 ml rogen cati 11668019) at room temperature for 20 min and and Hs002 1303.6 ml by Applied Biosystems Inc., Foster City applied to each well of the 6 well plates with 3T3 cells. A Calif.), The following PCR cycle was used: 50° C. for 2 min, Similar mixture including 2 ul of water instead of the oligo 95°C. for 10 min, 40 cycles of 95°C. for 0.15 seconds, 60° C. nucleotide solution was used for the mock-transfected con for 1 min) using StepOne Plus Real Time PCR Machine trols. After 3-18 h of incubation at 37° C. and 5% CO, the (Applied Biosystems). media was changed to fresh growth media. 48 h after addition 0272 Fold change in acne expression after treatment with of antisense oligonucleotides the media was removed and antisense oligonucleotides was calculated based on the dif RNA was extracted from the cells using SV Total RNA. Iso ference in 18S-normalized dOt values between treated and lation System from Promega (cathZ3105) or RNeasy Total mock-transfected samples. RNA. Isolation kit from Qiagen (cati74181) following the Results: manufacturers instructions. 600 ng of RNA was added to the reverse transcription reaction performed using Verso cDNA 0273 Real time PCR results show that the levels of the kit from Thermo Scientific (catiAB1453B) or High Capacity SIRT1 mRNA in HepG2 cells significantly increased 48 h. cDNA Reverse Transcription Kit (cathA368813) as described after treatment with some antisense oligonucleotides to in the manufacturer's protocol. The cDNA from this reverse SIRT1 antisense CV396200 (FIG. 3, 4). transcription reaction was used to monitor gene expression by 0274 Real Time PCR results show that levels of SIRT1 real time PCR using ABI Taqman Gene Expression Mix mRNA in HepG2 cells are significantly increased in one of (cati4369510) and primers/probes designed by ABI (Applied the oligonucleotides designed to SIRT1 antisense CV396.200 Biosystems Taqman Gene Expression Assay: Hs00202021 (FIG. 8). ml by Applied Biosystems Inc., Foster City Calif.). The fol 0275 Real Time PCR results show that levels of SIRT1 lowing PCR cycle was used: 50° C. for 2 min, 95°C. for 10 mRNA in HepG2 cells are significantly increased in two of min, 40 cycles of (95°C. for 0.15 seconds, 60° C. for 1 min) the oligonucleotides designed to SIRT1 antisense CV428275 using StepOne Plus Real Time PCR Machine (Applied Bio (FIG.9). systems). US 2012/O252869 A1 Oct. 4, 2012 29

0283 Fold change in acne expression after treatment with Treatment of DBS Cells with Antisense Oligonucleotides antisense oligonucleotides was calculated based on the dif 0290 DBS cells from ATCC (cathCCL-161) were grown ference in 18S-normalized dOt values between treated and in growth media (MEM/EBSS (Hyclone cat #SH30024, or mock-transfected samples. Mediatech cat HMT-10-010-CV) +10% FBS (Mediatech cat Results: MT35-011-CV)+penicillin/streptomycin (Mediatech 0284. Real time PCR results show that the levels of SIRT1 cathMT30-002-CI)) at 37° C. and 5% CO. One day before mRNA are significantly increased in 313 cells 48 h after the experiment the cells were replated at the density of treatment with three of the oligonucleotides designed to 15x10/ml into 6 well plates and incubated at 37° C. and 5% SIRT1 mouse antisense AK044604 (FIG. 13). CO. On the day of the experiment the media in the 6 well 0285 Real time PCR results show that the levels of SIRT1 plates was changed to fresh growth media. All antisense oli mRNA are significantly increased in 3T3 cells 48 h after gonucleotides were diluted to the concentration of 20 uM. treatment with five of the oligonucleotides designed to SIRT1 Two ul of this solution was incubated with 400 ul of Opti mouse antisense AK044604 (FIG. 14). MEM media (Gibco cath3.1985-070) and 4 ul of Lipofecut 0286 Real time PCR results show that the levels of SIRT1 mine 2000 (Invitrogen cati 11668019) at mom temperature mRNA are significantly increased in 3T3 cells 48 h after for 20 min and applied to each well of the 6 well plates with treatment with two of the oligonucleotides designed to SIRT1 3T3 cells. A. Similar mixture including 2 ul of water instead mouse antisense AK044604 (FIG. 15). of the oligonucleotide solution was used for the mock-trans 0287. Real time PCR results show that the levels of SIRT1 fected controls. After 3-18 h of incubation at 37° C. and 5% mRNA are significantly increased in 3T3 cells 48 h after CO the media was changed to fresh growth media. 48 h after treatment with two of the oligonucleotides designed to SIRT1 addition of antisense oligonucleotides the media was mouse antisense AK044604 (FIG. 16). Treatment of Vero76 Cells with Antisense Oligonucleotides: removed and RNA was extracted from the cells using SV 0288 Vero76 cells from ATCC (cath CRL-1587) were Total RNA. Isolation System from Promega (cathZ3105) or grown in growth media (MEM/EBSS (Hyclone cat RNeasy Total RNA. Isolation kit from Qiagen (cati74181) #SH30024, or Mediatech cat HMT-10-010-CV) +10% FBS following the manufacturers instructions. 600 ng of RNA (Mediatech cathi MT35-011-CV)+penicillin/streptomycin was added to the reverse transcription reaction performed (Mediatech cathi MT30-002-CI)) at 37° C. and 5% CO2. One using Verso cDNA kit from Thermo Scientific day before the experiment the cells were replated at the den (cati AB 1453B) or High Capacity cINA Reverse Transcrip sity of 1.5x10/ml into 6 well plates and incubated at 37° C. tion Kit (cati4368813) as described in the manufacturer's and 5% CO2. On the day of the experiment the media in the protocol. The cDNA from this reverse transcription reaction 6 well plates was changed to fresh growth media. All anti was used to monitor gene expression by real time PCR using sense oligonucleotides were diluted in water to the concen ABI Tacpnan Gene Expression Mix (cathA3695.10) and prim tration of 20 uM. 2 ul of this solution was incubated with 400 ers/probes designed by ABI (Applied Biosystems Taqman ul of Opti-MEM media (Caw cath3.1985-070) and 4 ul of Gene Expression Assay: Hs0021303.6 ml by Applied Bio Lipofectamine 2000 (Invitrogen cati 11668019) at room tem systems Inc., Foster City Calif.). The following PCR cycle perature for 20 min and applied to each well of the 6 well was used: 50° C. for 2 min, 95° C. for 10 min, 40 cycles of plates with Vero76 cells. Similar mixture including 2 ul of (95°C. for 15 seconds, 60° C. for 1 min) using StepOne Plus water instead of the oligonucleotide solution was used for the Real Time PCR Machine (Applied Biosystems). mock-transfected controls. After 3-18h of incubation at 37° 0291. Fold change in gene expression after treatment with C. and 5% CO2 the media was changed to fresh growth antisense oligonucleotides was calculated based on the dif media. 48 h after addition of antisense oligonucleotides the ference in 18S-normalized dOt values between treated and media was removed and RNA was extracted from the cells mock-transfected samples. using SV Total RNA. Isolation System from Promega (cat #Z3105) or RNeasy Total RNA. Isolation kit from Qiagen Results: (cati74181), following the manufacturers instructions. 600 ng of RNA was added to the reverse transcription reaction 0292 Real time PCR results show that the levels of SIRT6 performed using Verso cDNA kit from Thermo Scientific mRNA in DBS cells are significantly increased 48 h after (cate AB1453B) as described in the manufacturer's protocol. treatment with two of the oliogs designed to SIRT6 antisense The cDNA from this reverse transcription reaction was used bf772662 and one oligo designed to NM 133475 (FIG. 20). to monitor gene expression by real time PCR using ABI Taqman Gene Expression Mix (cathA3695.10) and primers/ Example 3 probes designed by ABI (Applied Biosystems Taqman Gene Expression Assay: Hs 00202021 ml by Applied Biosystems Modulation of SIRT Gene Expression Inc., Foster City Calif.). The following PCR cycle was used: Materials and Methods 50° C. for 2 min, 95°C. for 10 min, 40 cycles of (95° C. for 15 seconds, 60° C. for 1 min) using StepOne Plus Real Time 0293 Treatment of HepG2 Cells with Naked Antisense PCR Machine (Applied Biosystems). Fold change in gene Oligonucleotides expression after treatment with antisense oligonucleotides 0294. HepG2 cells from ATCC (catiHB-8065) were was calculated based on the difference in 18S-normalized dOt grown in growth media (MEM/EBSS (Hyclone cathSH30024, or Mediatech cat HMT-10-010-CV) +10% values between treated and mock-transfected Samples. FBS (Mediatech cathi MT35-011-CV)+penicillin/streptomy Results: cin (Mediatech cathi MT30-002-CI)) at 37° C. and 5% CO2. 0289 Real time PCR results show that the levels of the One day before the experiment the cells were replaced at the SIRT1 mRNA in Vero cells significantly increased 48 h after density of 0.5x10/ml into 6 well plates and incubated at 37° treatment with antisense oligonucleotides to SIRT1 antisense C. and 5% CO2. On the day of the experiment the media in the CV396200 (FIG. 5). 6 well plates was replaced with 1.5 ml/well of fresh growth US 2012/O252869 A1 Oct. 4, 2012 30 media. Allantisense oligonucleotides were diluted in water to William's Medium E (Siuma cathi W4128) supplemented with the concentration of 20 uM.2ul of this solution was incubated 5% FBS, 50 U/ml penicillin and 50 ug/ml streptomycin, 4 with 400 ul of Opti-MEM media (Gibco cath31985-070) and ug/ml insulin, 1 uM dexamethasone, 10 ug/ml Fungin (InVi 4 ul of Lipofectamine 2000 (Invitrogen cati 11668019) at Vogen, San Diego Calif.). Allantisense oligonucleotides were room temperature for 20 min and applied to each well of the diluted to the concentration of 20LM. 2 ul of this solution was 6 well plates with HepG2 cells. Similar mixture including 2 ul incubated with 400 ul of Opti-MEM media (Gibco of water instead of the oligonucleotide solution was used for cati3 1985-070) and 4 ul of Lipofectamine 2000 (Invitrogen the mock-transfected controls. After 3-18 h of incubation at cati 11668019) at room temperature for 20 min and applied to 37° C. and 5% CO2 the media was changed to fresh growth each well of the 6 well plates with cells. Similar mixture media. 72 h after addition of antisense oligonucleotides the including 2 ul of water instead of the oligonucleotide Solution cells were redosed as described in above. 48 hafter the second was used for the mock-transfected controls. After 3-18 h of dosing of antisense oligonucleotides the media was removed incubation at 37° C. and 5% CO2 the media was changed to and RNA was extracted from the cells using SV Total RNA fresh growth media. 48 h after addition of antisense oligo Isolation System from Promega (cat #Z3105) or RNeasy nucleotides the media was removed and RNA was extracted Total RNA isolation kit from Qiagen (cati74181) following from the cells using SV Total RNA. Isolation System from the manufacturers instructions. 600 ng of RNA was added to Promega (catiZ3105) or RNeasy Total RNA isolation kit the reverse transcription reaction performed using Verso from Qiagen (cati74181) following the manufacturers cDNA kit from Thermo Scientific (cathAB145313) as instructions. 600 ng of RNA was added to the reverse tran described in the manufacturer's protocol. The cDNA from scription reaction performed using Verso cDNA kit from this reverse transcription reaction was used to monitor gene Thermo Scientific (catfi AB 1453B) as described in the manu expression by real time PCR using ABI Taqman Gene facturer's protocol. The cDNA from this reverse transcription Expression Mix (cati43695.10) and primers/probes designed reaction was used to monitor gene expression by real time by ABI (Applied Biosystems Tacpuan Gene Expression PCR using ABI Taqman Gene Expression Mix Assay: Hs00202021 ml, Hs00202030 mland Hs00213036 (cati4369510) and primers/probes designed by ABI (Applied ml by Applied Biosystems Inc., Foster City Calif.). The fol Biosystems Taqman Gene Expression Assay: Hs00202021 lowing PCR cycle was used: 50° C. for 2 min, 95°C. for 10 ml. Hs00202030 ml and Hs00213036 ml by Applied Bio min, 40 cycles of (95°C. for 15 seconds, 60° C. for 1 min) systems Inc., Foster City Calif.). The following PCR cycle using StepOne Plus RealTime PCR. Machine (Applied Bio was used: 50° C. for 2 min, 95° C. for 10 min, 40 cycles of systems). Fold change in gene expression after treatment with (95° C. for 15 seconds, 60° C. for 1 min) using MX4000 antisense oligonucleotides was calculated based on the dif thermal cycler (Stratagene). Fold change in gene expression ference in 18S-normalized dOt values between treated and after treatment with antisense oligonucleotides was calcu mock-transfected samples. lated based on the difference in 18S-normalized dOt values 0295 Primers and probe for the custom designed ragman between treated and mock-transfected samples. assay for exon 4: AACTGGAGCTGGGGTGTCTGTTTCA (SEQ ID NO: 95) the SIRT1 natural antisense CV396200. Results: 0298. The results are shown in FIG. 7. Real time PCR Forward Primer Seq. results show an increase in SIRT1 mRNA levels after treat (SEQ ID NO: 96) ment with an oligonucleotide against SIRT1 antisense. CCATCAGACGACATCCCTTAACAAA Example 4 Reverse Primer Seq. (SEO ID NO: 97) Efficacy and Attrition of Action Study of CUR 963 ACATTATATCATAGCTCCTAAAGGAGATGCA in the African Green Monkey Reporter Seq. (SEO ID NO: 98) 0299 The objective of this study was to assess and com CAGAGTTTCAATTCCC pare the effect of antisense knockdown of the discordant noncoding antisense sequences that regulate the SERT1 genes following intravenous administration in a nonhuman Results: primate model. The antisense oligonucleotide test articles 0296. The results show that the levels of the SIRT1 mRNA designed to inhibit the SIRT1 regulatory sequences were in HepG2 cells are significantly increased 48 h after treatment designated as CUR 963. with one of the siRNAs designed to sirtas (sirtas 5, P=0.01). In the same samples the levels of sirtas RNA were signifi CUR 96.3 : cantly decreased after treatment with sirtas 5, but (SEO II) NO: 34) unchanged after treatment with sirtas 6 and sirtas 7, which --Gik-Tik C. kTikGik AikTikGik Gik-Atk--Gik-A. also had no effect on the SIRT1 mRNA levels (FIG. 2). sinas 5, sirtas 6 and sirtas 7 correspond to SEQ ID NO: CUR 962 (control) : (SEO ID NO: 99) 38:39 and 40 respectively. G'k-C kT k Ak G-kT kC kT kG kT kT k-G. Treatment of Primary Monkey Hepatocytes 0297 Primary monkey hepatocytes were introduced into Regulatory Test Guidelines culture by RxGen Inc. and plated in 6 well plates. They were 0300. This study was designed in accordance with treated with oligonucleotides as follows. The media in the 6 accepted toxicological principles and to comply with Inter well plates was changed to fresh growth media consisting of national Conference of Harmonization (ICH) Harmonized US 2012/O252869 A1 Oct. 4, 2012

Tripartite Guidelines (Non-Clinical Safety Studies for the 0318 Sex: Conduct of Human Clinical Trials for Pharmaceuticals ICH 0319. The test animals were adult females. M3 (m), 2000 Nov. 9), and generally accepted procedures for 0320 Number of Animals: the testing of therapeutic agents. 0321 Ten animals were screened to ensure identification of 8 animals appropriate for enrollment in the study. Test and Control Articles 0322) Number on Study: Test Article Identity and Preparation 0323 Females: 8 0324 Justification for Number on Study: 0301 The testarticle, CUR-963, is a chemically stabilized 0325 This study was designed to use the fewest number of antisense oligonucleotide. The vehicle for intravenous deliv animals possible, consistent with the primary objective of ery is phosphate-buffered saline (PBS). evaluating the therapeutic efficacy of the test article in the African green monkey and prior studies of the systemic Vehicle Characterization administration of this type of oligonucleotide in this species. 0326 Animal Specification: 0302 For the PBS vehicle, the composition, batch num 0327 Ten adult African Green monkeys in the weight ber, expiry date and storage conditions (temperature and range of 3 to 4 kg, were employed in the study. The monkeys light/dark) was obtained from the supplier. were drug-naive adult animals humanely trapped from the Test Article Storage and Handling feral population that inhabits the island. Trapped monkeys were treated with antihelminthics to eliminate any possible 0303. The test substance and vehicle were stored accord intestinal parasite burden and were observed in quarantine for ing to the received storage conditions Supplied by the Sponsor a minimum of 4 weeks prior to screening for study enroll and manufacturer, accordingly. ment. The age of trapped monkeys were estimated by size and demotion, with the exclusion of older animals from the study. Analysis of the Test Article Formulations Prior to study enrollment, a clinical exam was performed on each monkey, including evaluation of locomotion and dexter 0304 Samples of the test article formulation will be cryo ity. Blood samples were taken and sent to AntechDiagnostics preserved for analysis of the concentration, stability and (Memphis, Tenn.) for comprehensive clinical chemistries and homogeneity of the test Substance formulations. a complete blood count and lipid profiles (see sections 9.2 and 319567928 for specifications). Monkeys with abnormal lab Test System Rationale values, as determined by comparison to the established nor 0305 The primate is a suitable non rodent species, accept mal range for monkeys in the St. Kitts colony, were excluded able to regulatory authorities as an indicator of potential from the study. In order to identify 8 monkeys that satisfy this hazards, and for which extensive background data are avail criterion, 10 monkeys were screened, with the screening of able. The African green monkey specifically is a highly clini additional animals as needed. Before study initiation, the cally relevant model of multiple human physiologic and dis selected monkeys will be transferred to individual cages to ease States. acclimate to individual housing for a one-week period. Only 0306 The intravenous route of administration corre animals deemed suitable for experimentation will be enrolled sponds to a possible human therapeutic route. The dose of the in the study. The actual (or estimated) age and weight ranges test articles was based on the results of the dose finding at the start of the study will be detailed in the raw data and studies of analogous compounds previously performed in the final report. African green monkey. 0328. Animal Health and Welfare: 0307 African green monkeys were chosen as the primate 0329. The highest standards of animal welfare were fol of choice as the test Substances target sequences are con lowed and adhered to guidelines stipulated by the St. Kitts served across species with 100% homology in primates. Department of Agriculture and the U.S. Department of Health Additionally, the test Substance is a synthetic oligonucleotide. and Human Services. All studies will be conducted in accor Consequently, dosing in primates allows for a Superior dance with these requirements and all applicable codes of assessment of the efficacy of these compounds that would be practice for the care and housing of laboratory animals. All more reflective of the uptake likely to be seen in humans than applicable standards for veterinary care, operation, and in any other species. review as contained in the NIH Guide for the Care and Use of Animals. The St Kitts facility maintains an animal research Animals committee that reviews the protocols and inspects the facili ties as required by the Guide. The Foundation has an 0308 Species: approved assurance filed with the Office of Laboratory Ani 0309 Chlorocebus Scthaeus, non-human primate mal Welfare, as required by the Guide, #A4384-01 (Axion 0310 Breed: Research Foundation/St. Kitts Biomedical Foundation). 0311 African green monkey indigenous to St. Kitts. There are no special nonhuman primate veterinary care issues and biohazard issues raised by the research specified in this 0312 Source: study. 0313 RxGcin, Lower Bourryeau, St. Kitts, West Indies. 0330 Housing and Environment: 0314 Expected Age: 0331. To allow detection of any treatment-related clinical 0315. The test animals were adults. signs, the animals were housed individually prior to Surgery 0316 Expected Weight. and postoperatively until sacrifice. The primate building in 0317. The monkeys weigh approximately 3-4 kg. The which the individual cages were situated were illuminated actual range may vary but will be documented in the data. entirely by ambient light, which at 17 degrees north latitude US 2012/O252869 A1 Oct. 4, 2012 32 approximates a 12hr:12hr light-dark cycle as recommended 0344) Food Consumption: in the U.S. D.H.H.S guidelines. The RxGen primate building 0345 Individual food consumption was not quantified. was completely ventilated to the outside. Additional air Feeding patterns were however monitored and a note made of movement was assured by ceiling fans to maintain a constant any major changes. target temperature of 23-35° C., as is typical of St. Kitts (0346 Mortality and Morbidity: throughout the year. Twenty-four hour extremes of tempera 0347 Mortality and morbidity will be recorded. Any deci ture and relative humidity (which also will not be controlled) sion regarding premature sacrifice will be made after consul were measured daily. During the study, the cages were tation with the Study Director and with the Sponsor's Moni cleaned at regular intervals. toring Scientist, if possible. Animals that are found dead or 0332 Diet and Water: killed prematurely will be subjected to necropsy with collec 0333 Each animal was offered approximately 90 grams tion of liver, kidney, heart and spleen lung tissues fed histo per day of a standard monkey chow diet (TekLad, Madison, pathology. In the event of premature sacrifice a blood sample Wis.). The specific nutritional composition of the diet was will also be taken (if possible) and the parameters determined. recorded. The water was periodically analyzed for microbio Animals that are found dead after regular working hours will logical purity. The criteria for acceptable levels of contami be refrigerated overnight and necropsies performed at the nants in stock diet and water Supply were within the analytical start of the next working day. If the condition of an animal specifications established by the diet manufacturer and the requires premature sacrifice, it will be euthanized by intrave periodic facility water evaluations, respectively. The water nous overdose of Sodium pentobarbital. All research is gov met all criteria necessary for certification as acceptable for erned by the Principles for Use of Animals. RxGenis required human consumption. by law to comply with the U.S. Department of Health and Human Services standards for primate facility, which dictate Experimental Design the levels of severity that the procedures within this study, specified as mild, must abide. 0334] Animal Identification and Randomization: 0335 Allocation was done by means of a stratified ran Clinical Laboratory Studies domization procedure basedan body-weight and plasma cho lesterol profiles. Prior to and after allocation to a group, each (0348. Fat Biopsies: animal was identified by a tattoo on the abdomen. Tattoos are 0349. A subcutaneous fat biopsy was performed on all placed on all colony animals as a means of identification in study monkeys except Y775 on study days 26 by tissue the course of routine health inspections. A cage plan was extraction through a 1 cm midline incision inferior to the drawn up to identify the individuals housed within, and indi umbilicus. Biopsies were immediately immersed in a labeled vidual monkeys were further identified by a labeled tag cryotube containing 2 mls of RNAlater (Qiagen) and incu attached to their respective cage. bated at 4°C. overnight, after which the RNAlater was aspi 0336 Group Sizes, Doses and Identification Numbers: rated and the sample tube flash frozen in liquid nitrogen. 0337 The animals were assigned to 2 treatment groups, Following transportation in liquid nitrogen total RNA was comprised of 4 monkeys in each group. Specific animal iden isolated for real-time qPCR of target genes. tification numbers were provided to each monkey according 0350 Results: to the facility numbering system. This system uniquely iden 0351 Real time PCR results show an increase in SIRT1 tifies each monkey by a letter followed by a three digit num mRNA levels in fat biopsies from monkeys dosed with CUR ber, e.g. Y032. 963, an oligonucleotide designed to SIRT1 antisense CV396200.1, compared to monkeys dosed with CUR-962 0338 Route and Frequency of Administration: (SEQID NO.: 99), an oligonucleotide which had no effect on 0339 Animals were dosed once daily on Days 1, 3, and 5 SIRT1 expression in vitro (designed to Apo A1 antisense delivered intravenously by manual infusion over ~10 min. The infusion rate will be 24 mL/kg/h. The animals were DA327409, data not shown). mRNA levels were determined sedated with ketamine and Xylazine prior to and during the by real time PCR (FIG. 6). dosing procedure. A venous catheter (Terumo mini vein infu sion set, 20 gauge needle, or similar appropriate infusion set) Example 5 was inserted into the Saphenous vein. Dosing took place in each monkey between 8:00 and 10:00 a.m. shortly after the In vivo Modulation of Sirtuin (SIRT) by Antisense animals wake and prior to feeding. A blood sample to assess DNA Oligonucleotides plasma cholesterol and other lipid levels as described in 0352 Treatment with Antisense DNA Oligonucleotides Blood Chemistry section below, was collected just prior to (ASO): each infusion. Blood collection preceded feeding at both 0353 Antisense oligonucleotides (ASO) specific for sampling intervals to minimize dietary effects on cholesterol SIRT1. AS are administered to C57B1/6J mice which are fed measurementS. a high fat diet for 12 weeks to induce obesity and diabetes. 0340 Clinical Observations: (Purushotham A. et al., (2009) Cell Metabolism 9, p. 327 0341 All visible signs of reaction to treatment were 338.). The treatment of the mice with ASO will start at the recorded on each day of dosing. In addition, the animals were time of the implementation of the high fat diet. Mice are examined at least once each week for physical attributes Such injected IP once a week with ASO prepared in normal saline, as appearance and general condition. at a concentration of 5 mg/kg. (0342 Body Weights: 0354 Measurements of Body Weight and Food Intake: 0343 Body weights were recorded at weekly intervals 0355 Body weight and food intake of mice are measured during the treatment and post-treatment periods. twice per week, prior to IP injection of the ASO. US 2012/O252869 A1 Oct. 4, 2012

0356 Blood Glucose Measurements: needle/lancet just passes through the skin. Blood samples are 0357 Fed and fasted blood glucose concentrations are collected using microhematocrit tubes. After blood has been measured each week by taking a sample of blood from the tail collected, the grip on the neck is loosened and pressure is W1. applied at the insertion site with a gauze sponge to ensure 0358 Glucose Tolerance Tests (GTT): hemostasis. 0.05-0.2 ml of blood will be collected by this 0359. The GTT will be done totally twice per mouse, method. This procedure will be performed only once in week halfway through the diet (at week 4) and near the end (at week 5 of the high fat diet and eventually in week 12 if the intrac 10) of the high fat diet. The GTT will inform us about the ardiac puncture is not working (see below). Blood hormones glucose tolerance of the mice that is the capacity to rapidly which regulate the metabolism of glucose and lipids (such as clear a glucose bolus from the blood stream. This is a measure insulin, adiponeetin and leptin) are measured using commer for diabetes. Mice are tasted overnight for 16 hours. Mice are cially available ELISA kits. (e.g., R&D Systems, Minneapo injected IPglucose 2 g/kg. This translates into a final Volume lis, Minn., Assay. Pro St. Charles, Mo., Mabtech, Mariemont, of 0.2 ml 30% (w/v) glucose solution for a mouse of 30 g Ohio) weight. Glucose measurements are taken prior to glucose 0364 Intracardiac Puncture: injection and at 5, 15, 30, 60.90 and 120 min post-injection. 0365. At the end of the 12 week high fat diet, mice will be Glucose is measured by cutting the tail tip 1 mm from the end anesthetized by continuous isoflurane inhalation. Anesthesia of the tail under isoflurane anesthesia prior to IP glucose is induced by placing the mice in an induction box, which is injection. The blood droplet is aspirated into a strip and glu supplied with isoflurane and oxygen. Mice will be restrained cose concentration is measured with a glucometer. The GTT on their back. The heart is punctured with a 27 G needle. will be done totally twice per mouse, halfway through the diet Following exsanguineation, the head is decapitated to ensure (at week 4) and near the end (at week 10) of the high fat diet. death. Tissues (liver, pancreas, white and brown adipose tis The GTT will inform us about the glucose tolerance of the Sue, and skeletal muscle) are collected for further investiga mice that is the capacity to rapidly clear a glucose bolus from tions (RNA and protein measurements and histology). the blood stream. This is a measure for diabetes. Around 0.5-1 ml of blood will be obtained and used to deter 0360 Insulin Tolerance Test (ITT): mine several critical parameters of glucose and lipid metabo 0361 Mice are tasted for 6 hours from 9am til 3 pm. Mice lism (glucose, insulin, cholesterol, triglycerides, free fatty are then injected IP 0.5-1 U Insulin/kg. The insulin concen acids, leptin, adipokines, corticosteroids, thyroid hormones). tration will be adjusted such that the final injected volume is If difficulties occur in this method, we will collect blood by 0.1-0.15 ml. Blood glucose measurements are taken prior to facial vein puncture under isoflurane anesthesia instead (see injection and at 5, 15, 30, 45, and 60 minutes post-injection. above). Blood is collected exactly as described under GTT. In addi 0366 Although the invention has been illustrated and tion to monitoring the glucose levels, the behavior of the mice described with respect to one or more implementations, is constantly observed during the ITT. Hypoglycemia can equivalent alterations and modifications will occur to others manifest as a change in behavior with the animals becoming skilled in the art upon the reading and understanding of this very quiet and showing discomfort. To prevent hypoglyce specification and the annexed drawings. In addition, while a mia, glucose (1 g/kg) is injected IP in a final Volume of particular feature of the invention may have been disclosed 0.1-0.15 ml as soon as the blood glucose concentration falls with respect to only one of several implementations, such below 50 mg/ml or signs of discomfort are observed. feature may be combined with one or more other features of 0362 Blood Collection by Facial Vein Puncture: the other implementations as may be desired and advanta 0363 Mice are restrained by the scruff of the neck and geous for any given or particular application. base of the tail, slightly compressing the blood vessels of the 0367 The Abstract of the disclosure will allow the reader neck through the tautness of the grip on the neck skin. The to quickly ascertain the nature of the technical disclosure. It is sampling site is on the jaw slightly in front of the angle of the submitted with the understanding that it will not be used to mandible. The skin at the sampling site is punctured with an interpret or limit the scope or meaning of the following 18 G needle or a lancet at a 90° angle until the tip of the claims.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 99

<21 Os SEQ ID NO 1 &211s LENGTH: 41. Of &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 3 O Os PUBLICATION INFORMATION: <3O8 DATABASE ACCESSION NUMBER: NMO 12238.3 &309s DATABASE ENTRY DATE: 2O08-11-3 O <313> RELEVANT RESIDUES IN SEO ID NO : (1) ... (4107)

<4 OOs SEQUENCE: 1 gtC gagcggg agcagaggag gC9agggagg agggc.ca.gag aggcagttgg aagatggcgg 60

acgaggcggc cctogcc ctt cago.ccggcg gctic cccCt c gg.cggcgggg gcc.gacaggg 12O

US 2012/O252869 A1 Oct. 4, 2012 35

- Continued aaggtgtaat atttataggit togg taaaata gattgtttitt catggataat ttitta acttic 246 O attatttctg tacttgtaca aact caacac taacttittitt ttttittaaaa aaaaaaaggit 252O actaagtatic ttcaat cago togttggtcaa gactaactitt cittittaaagg tt catttgta 2580 tgataaattic atatgtgitat atataattitt ttttgttttgtctagtgagt ttcaa.cattt 264 O ttaaagttitt caaaaa.gc.ca toggaatgtt aaattaatgt aaagggacag ctaatctaga 27 OO c caaagaatg g tattitt cac ttittctttgt aac attgaat gigtttgaagt act caaaatc 276 O tgttacgcta aacttittgat t ctittaacac aattatttitt aaacactggc attitt coaaa 282O actgtggcag cta actttitt aaaatctoaa atgacatgca gtgtgagtag aaggaagttca 288O acaatatgtggggaga.gcac toggttgtct ttact tittaa aagtaatact tdgtgctaag 294 O aattitcagga ttattg tatt tacgttcaaa tdaagatggc titttgtact t c ctdtggaca 3 OOO tgtag taatgtctatattgg ct cataaaac taacctgaaa aacaaataaa togctittggaa 3 O 6 O atgttt cagt togctittagaa acattagtgc ctdcctggat ccc cittagtt ttgaaatatt 312 O tgcc attgtt gtttaaatac citat cactgt gigtagagctt gcattgatct titt coacaag 318O tattaaactg ccaaaatgtgaatatgcaaa goctttctga atctataata atgg tacttic 324 O tactggggag agtgtaat at tittggactgc tigttitt C cat taatgaggag agcaa.caggc 33 OO c cct gattat acagttccaa agtaataaga tigittaattgt aatticagoca gaaagtacat 3360 gtct cocatt gggaggattt ggtgttaaat accaaactgc tagcc ctagt attatggaga 342O tgaacatgat gatgta actt gtaatagoag aatagittaat gaatgaaact agttcttata 3480 attitat ctitt atttaaaagc titagcctgcc ttaaaac tag agatcaact t t ct cagotgc 354 O aaaagcttct agt ctittcaa gaagttcata citt tatgaaa ttgcacagta agcatttatt 36OO titt cagacca tttittgaaca toacticcitaa attaataaag tatto citctg ttgctittagt 366 O attt attaca ataaaaaggg tttgaaatat agctgttctt tatgcataaa acacccagot 372 O aggaccatta citgc.ca.gaga aaaaaatcgt attgaatggc cattt coct a cittataagat 378 O gtct caatct gaatttattt ggctacacta aagaatgcag tatatttagt titt coatttg 384 O catgatgttt gtgtgctata gatgatattt taaattgaaa agtttgttitt aaattattitt 3900 tacagtgaag actgttitt ca gct citttitta tattgtacat agt cittittat gtaatttact 396 O ggcatatgtt ttgtag actg tittaatgact ggatat ctitc cittcaactitt togaaatacaa 4 O2O aaccagtgtt ttt tacttgt acactgttitt aaagttctatt aaaattgtca tttgacttitt 4 O8O ttctgttaaa aaaaaaaaaa aaaaaaa 41. Of

<210s, SEQ ID NO 2 &211s LENGTH: 3806 &212s. TYPE: DNA <213s ORGANISM: Mus musculus &3 OO PUBLICATION INFORMATION: <3O8 DATABASE ACCESSION NUMBER: NMOO1159589.1 309s. DATABASE ENTRY DATE: 2010-07-18 <313> RELEVANT RESIDUES IN SEO ID NO : (1) ... (3806)

<4 OOs, SEQUENCE: 2 gccagtgcc.g. c9cgt.cgagc ggagcagagg agg.cgagggc ggagggc.cag agaggcagtt 6 O ggaagatggc ggacgaggtg gcgct cqcco ttcaggcc.gc C9gct cocct tcc.gcggcgg 12 O cc.gc.catgga ggcc.gcgt.cg cagc.cggcgg acgagcc.gct ccdcaagagg ccc.cgc.cgag 18O

US 2012/O252869 A1 Oct. 4, 2012 40

- Continued

&212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 5 cittitt cactt gtgaatacca attaggtttc cagtttct ca taaagat cta acaaataccc 6 O aatttct c catcagactgac atcc.cittaac aaaag.ca.gag tittcaatticc ctd catcto c 12 O tittaggagct atgatataat gtagg tagaa atc.ttgcctt aactic cattt acc cactgtg 18O ctataaataa gcagaa.gcaa at atttittitt aaggctggag aggttittaaa aatctgaact 24 O aatttagcaa citgctgctgc acticagttitt tdgcagttcc caaac atcca ttat catgta 3OO aggataaatc cittctaaacc agaaaaatgt titcct acttig gaaaaggcat aagaaaatac 360 atatacgacc ticciccatgta ctagt cittac at accc.cago to cagttaga actataattit 42O ttittgcactic ttgcagtaat titcacagoat cittcaattgt attaatat ct tttcttttitt 48O t cctttittgg toggttctgaa aggat attaa taacaatctg. ccacagtgtc. atat catcca 54 O acticaggtgg agg tattgtt t cc.ggcaata aatctittaag aattgttcga ggatctgtgc 6OO Caat cataag atgttgctga acaaaagt at atggacctac aataaggggg aaaaggctta 660 aagttcaactt atcaagtaat tcaaaatcto atttatttitc tdaagtaatg agittagcatt 72 O ctgtgagggit tttittgcaaa gtaagaaaat gcaatttaat gig tattt cat t ct cqgtaca 78O

Ctcaga atta atgctatatc C caatgagat taggaagatc taatgaagag ttgggalagac 84 O cc cctt cago totaagtata tatttcaaga gtctaattaa ttaacaacca gaattaagtt 9 OO cittatggitta at atctagaa acacacacca taataccaaa agtatttaca aaagggttct 96.O acga cataga aaaatcgtac cagtic ctaaa agcct gtact actitat catt aaaac cacac 1 O2O aggaaaaa 1028

<210s, SEQ ID NO 6 &211s LENGTH: 429 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (7) . . (7) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (373) ... (373) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (400) ... (4 OO) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 6 cgacganaac ataagc actt ttaattitcct citct attatgctacagacaa gogo cqaagac 6 O tgggttttitt aggttgttta aggctgtaaa gaaaacaaag alacatatgac agaga.ccct a 12 O tgcagtctgc aaag.catact acatatttac taccaggc.cc tacct tact a cagaaagttt 18O gctgat coag ctgtgaac at at accc.cgat gcagatgaaa acaaatacaa aacaaac cta 24 O acttgc catt ttggtcacaa gagcaagtaa gtag cagagc cct gttittga tatgaaaatc 3OO cago actgga citgggcaa.ca toggcgaga cc ccatctotac caaaaatact aaaaaaatag 360 ccgggcatgg triggcacat Ctgtag tact agct acttgn gaggctgaga Caggaga at C 42O atttgagcc 429

US 2012/O252869 A1 Oct. 4, 2012 46

- Continued

<4 OOs, SEQUENCE: 15 ttgg tatt.ca caag 14

<210s, SEQ ID NO 16 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 16 aaactggaaa ccta 14

<210s, SEQ ID NO 17 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <4 OOs, SEQUENCE: 17 gatctittatg agaa 14

<210s, SEQ ID NO 18 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 18 gatggaga aa ttgg 14

<210s, SEQ ID NO 19 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 19 agtctgatgg agaa 14

<210s, SEQ ID NO 2 O &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 2O tgttaaggga tigt C 14

<210s, SEQ ID NO 21 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 21 aatctgcttt tott 14 US 2012/O252869 A1 Oct. 4, 2012 47

- Continued

<210s, SEQ ID NO 22 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 22 agggaattga aatc 14

<210s, SEQ ID NO 23 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 23 taaggcaaga titt c 14

<210s, SEQ ID NO 24 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 24 taaatggagt taag 14

<210s, SEQ ID NO 25 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 25 ttatttatag caca 14

<210s, SEQ ID NO 26 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 26 ttgcttctgc titat 14

<210s, SEQ ID NO 27 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 27 aaaaaaat at ttgc 14

<210s, SEQ ID NO 28 &211s LENGTH: 14 US 2012/O252869 A1 Oct. 4, 2012 48

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 28 cago cittaaa aaaa 14

<210s, SEQ ID NO 29 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 29 ttittaaaa.cc totC 14

<210s, SEQ ID NO 3 O &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 30 tagttcagat ttitt 14

<210s, SEQ ID NO 31 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 31 agcagttgct aaat 14

<210s, SEQ ID NO 32 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 32

Ctgagtgcag cagc 14

<210s, SEQ ID NO 33 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 33 gtctgatgga ga 12

<210s, SEQ ID NO 34 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide US 2012/O252869 A1 Oct. 4, 2012 49

- Continued

<4 OOs, SEQUENCE: 34 gtctgatgga ga 12

<210s, SEQ ID NO 35 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 35 gtctgatgga ga 12

<210s, SEQ ID NO 36 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 36 gmumctmgma timgmgamgma

<210s, SEQ ID NO 37 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 37 mgmumcmumg mamumgmgma mgma 24

<210s, SEQ ID NO 38 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 38 actgacacct aattgt attc acatgaa 27

<210s, SEQ ID NO 39 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 39 tgagcagcag ttgctaaatt agttca 26

<210s, SEQ ID NO 4 O &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 4 O tctacctaca ttatat cata gct cota 27 US 2012/O252869 A1 Oct. 4, 2012 50

- Continued

<210s, SEQ ID NO 41 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 41 ttgg tatt.ca caagtgaaa 19

<210s, SEQ ID NO 42 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 42 ttgctaaatt agttcagat 19

<210s, SEQ ID NO 43 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 43 gcagcagcag ttgctaaat 19

<210s, SEQ ID NO 44 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 44 gcagttgcta aattagttc 19

<210s, SEQ ID NO 45 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 45 gccatgttgc C cagtic cagt

<210s, SEQ ID NO 46 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 46 gggctctgct act tacttgc

<210s, SEQ ID NO 47 &211s LENGTH: 2O US 2012/O252869 A1 Oct. 4, 2012 51

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 47 cc.cagt ctitc agccttgtct

<210s, SEQ ID NO 48 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 48 gggit citctgt catatgttct t 21

<210s, SEQ ID NO 49 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 49 titcc tacct t c cct coat a 19

<210s, SEQ ID NO 50 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 50 attic citacct tcc ct coat 19

<210s, SEQ ID NO 51 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 51 CCttagggitt gcagotaatt

<210s, SEQ ID NO 52 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 52 atcc.ca.gcta ct caggaggc

<210s, SEQ ID NO 53 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide US 2012/O252869 A1 Oct. 4, 2012 52

- Continued

<4 OOs, SEQUENCE: 53 tctggctgag tec agtggct

<210s, SEQ ID NO 54 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 54 Cctgggagtt ggaggttgca

<210s, SEQ ID NO 55 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 55

Cagatcc.cat gaa.gc.caaga g 21

<210s, SEQ ID NO 56 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 56

Ctgactgc.ca t cagaagtgg 21

<210s, SEQ ID NO 57 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 57 gcc catctgc titgcttgat 19

<210s, SEQ ID NO 58 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 58 atcc to acca cagt cittgt 19

<210s, SEQ ID NO 59 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OO > SEQUENCE: 59 gct tactitcc toc tocctitt US 2012/O252869 A1 Oct. 4, 2012 53

- Continued

<210s, SEQ ID NO 60 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 60 cCaggtgata ggagcagaac t 21

<210s, SEQ ID NO 61 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 61 accct cottic ct coct cit ct

<210s, SEQ ID NO 62 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 62 ccactic tocc ttctgtcc to t 21

<210s, SEQ ID NO 63 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 63 cotcott.cct coctict ct ct

<210s, SEQ ID NO 64 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 64 gtctgtc.cca t catgcCagg

<210s, SEQ ID NO 65 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 65 tittctgat co togctgcct ct

<210s, SEQ ID NO 66 &211s LENGTH: 15 US 2012/O252869 A1 Oct. 4, 2012 54

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 66 accct cottic ct coc 15

<210s, SEQ ID NO 67 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 67 cit cott cotic cct c 14

<210s, SEQ ID NO 68 &211s LENGTH: 11 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 68 cit cott cotc. c. 11

<210s, SEQ ID NO 69 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 69 ct tcc tocct citctic 15

<210s, SEQ ID NO 70 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 7 O atcc togctgc ct ct 14

<210s, SEQ ID NO 71 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 71 cit cott cotic cct c 14

<210s, SEQ ID NO 72 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide US 2012/O252869 A1 Oct. 4, 2012 55

- Continued

<4 OOs, SEQUENCE: 72 accct cottic ct coc 15

<210s, SEQ ID NO 73 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 73 gttctggctic tictgtagga

<210s, SEQ ID NO 74 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 74 atgct cactic act tcc.ggcg

<210s, SEQ ID NO 75 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 75

Ctttgttggtg tdagcc tittg t 21

<210s, SEQ ID NO 76 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 76 aggtgtgagc gCaggg taca

<210s, SEQ ID NO 77 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 77 citcggittaca gcgcgt.ct ct

<210s, SEQ ID NO 78 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OO > SEQUENCE: 78 aact ct cogg C9tttgcag 19 US 2012/O252869 A1 Oct. 4, 2012 56

- Continued

<210s, SEQ ID NO 79 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OO > SEQUENCE: 79 tgttgtc.cca gttact cot 19

<210s, SEQ ID NO 8O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 80 gccaggagtt Caagagcagc

<210s, SEQ ID NO 81 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 81 ccttgttggc acct cactgt

<210s, SEQ ID NO 82 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 82 gttgttgcggit taatactic cc

<210s, SEQ ID NO 83 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 83 gtgagt ct cq aagtgg tagc t 21

<210s, SEQ ID NO 84 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 84 gact cittatc tacctgtggg a 21

<210s, SEQ ID NO 85 &211s LENGTH: 21 US 2012/O252869 A1 Oct. 4, 2012 57

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 85 toctitcto ct cittgttctotc c 21

<210s, SEQ ID NO 86 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 86 gcc.ctgtgtt tot cotct co

<210s, SEQ ID NO 87 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 87 actic cc.gtgg totctgttgtc. t 21

<210s, SEQ ID NO 88 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 88 tccago aacc ticact citccc

<210s, SEQ ID NO 89 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 89 gcgtgggtgt ggt cagtgta

<210s, SEQ ID NO 90 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 90 accaccitcct gct coagact

<210s, SEQ ID NO 91 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide US 2012/O252869 A1 Oct. 4, 2012 58

- Continued

SEQUENCE: 91 cctcitccctc. tctctgtc.to t 21

SEQ ID NO 92 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Antisense oligonucleotide SEQUENCE: 92 at cit to cotic to accott c 19

SEO ID NO 93 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Antisense oligonucleotide SEQUENCE: 93 ccctitctgtc. tcatct tccc t 21

SEQ ID NO 94 LENGTH: 2O TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Antisense Oligonucleotide SEQUENCE: 94 tctgtgtc.ca cct gtc.t.ccc

SEO ID NO 95 LENGTH: 25 TYPE: DNA ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 95 aactggagct ggggtgtctg titt.ca 25

SEO ID NO 96 LENGTH: 25 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Forward Primer Sequence SEQUENCE: 96 c catcagacg a catcc citta acaaa 25

SEO ID NO 97 LENGTH: 31 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Reverse Primer Sequence SEQUENCE: 97 acattatat catagotcc ta aaggagatgc a 31 US 2012/O252869 A1 Oct. 4, 2012 59

- Continued <210s, SEQ ID NO 98 &211s LENGTH: 16 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Reporter Sequence <4 OOs, SEQUENCE: 98 cagagttt ca attic cc 16

<210s, SEQ ID NO 99 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide

<4 OOs, SEQUENCE: 99 gctagt ctgt td 12

What is claimed is: or the expression of the Sirtuin (SIRT) polynucleotide in 1. A method of a function of and/or the expression of a patient cells or tissues in vivo or in vitro. Sirtuin (SIRT) polynucleotide in patient cells or tissues in 5. The method of claim 4, wherein a function of and/or the Vivo or in vitro comprising: contacting said cells or tissues expression of the Sirtuin (SIRT) is increased in vivo or in vitro with at least one antisense oligonucleotide 5 to 30 nucleotides with respect to a control. in length wherein said at least one oligonucleotide has at least 6. The method of claim 4, wherein the at least one antisense 50% sequence identity to a reverse complement of a poly oligonucleotide targets a natural antisense sequence of a Sir nucleotide comprising 5 to 30 consecutive nucleotides within tuin (SIRT) polynucleotide. nucleotides 1 to 1028 of SEQIDNO:5 or nucleotides 1 to 429 7. The method of claim 4, wherein the at least one antisense of SEQID NO: 6, or nucleotides 1 to 156 of SEQID NO: 7 or oligonucleotide targets a nucleic acid sequence comprising nucleotides 1 to 593 of SEQID NO:8, 1 to 373 of SEQID NO: coding and/or non-coding nucleic acid sequences of a Sirtuin 9, 1 to 1713 of SEQID NO: 10, 1 to 660 of SEQID NO:11, (SIRT) polynucleotide. 1 to 589 of SEQID NO: 12, 1 to 428 of SEQID NO: 13 and 1 to 4041 of SEQID NO: 14; thereby modulating a function 8. The method of claim 4, wherein the at least one antisense of and/or the expression of the Sirtuin (SIRT) polynucleotide oligonucleotide targets overlapping and/or non-overlapping in patient cells or tissues in vivo or in vitro. sequences of a Sirtuin (SIRT) polynucleotide. 2. A method of modulating a function of and/or the expres 9. The method of claim 4, wherein the at least one antisense sion of a Sirtuin (SIRT) polynucleotide in patient cells or oligonucleotide comprises one or more modifications tissues in vivo or in vitro comprising: contacting said cells or selected from: at least one modified Sugar moiety, at least one tissues with at least one antisense oligonucleotide 5 to 30 modified internucleoside linkage, at least one modified nucle nucleotides in length wherein said at least one oligonucle otide, and combinations thereof. otide has at least 50% sequence identity to a reverse comple 10. The method of claim 9, wherein the one or more modi ment of a natural antisense of a Sirtuin (SIRT) polynucle fications comprise at least one modified Sugar moiety selected otide; thereby modulating a function of and/or the expression from: a 2'-O-methoxyethyl modified sugar moiety, a 2'-meth of the Sirtuin (SIRT) polynucleotide in patient cells or tissues oxy modified Sugar moiety, a 2'-O-alkyl modified Sugar moi in vivo or in vitro. ety, a bicyclic Sugar moiety, and combinations thereof. 3. A method of modulating a function of and/or the expres 11. The method of claim 9, wherein the one or more modi sion of a Sirtuin (SIRT) polynucleotide in patient cells or fications comprise at least one modified internucleoside link tissues in vivo or in vitro comprising: contacting said cells or age selected from: a phosphorothioate, 2'-Omethoxyethyl tissues with at least one antisense oligonucleotide 5 to 30 (MOE), 2'-fluoro, alkylphosphonate, phosphorodithioate, nucleotides in length wherein said oligonucleotide has at least alkylphosphonothioate, phosphoramidate, carbamate, car 50% sequence identity to an antisense oligonucleotide to the bonate, phosphate triester, acetamidate, carboxymethyl ester, Sirtuin (SIRT) polynucleotide; thereby modulating a function and combinations thereof. of and/or the expression of the Sirtuin (SIRT) polynucleotide 12. The method of claim 9, wherein the one or more modi in patient cells or tissues in vivo or in vitro. fications comprise at least one modified nucleotide selected 4. A method of modulating a function of and/or the expres from: a peptide nucleic acid (PNA), a locked nucleic acid sion of a Sirtuin (SIRT) polynucleotide in patient cells or (LNA), an arabino-nucleic acid (FANA), an analogue, a tissues in vivo or in vitro comprising: contacting said cells or derivative, and combinations thereof. tissues with at least one antisense oligonucleotide that targets 13. The method of claim 1, wherein the at least one oligo a region of a natural antisense oligonucleotide of the Sirtuin nucleotide comprises at least one oligonucleotide sequences (SIRT) polynucleotide; thereby modulating a function of and/ set forth as SEQID NOS: 15 to 94. US 2012/O252869 A1 Oct. 4, 2012 60

14. A method of modulating a function of and/or the said modifications comprise modified nucleotides selected expression of a Sirtuin (SIRT) in mammalian cells or tissues from: peptide nucleic acids, locked nucleic acids (LNA), in vivo or in vitro comprising: contacting said cells or tissues analogues, derivatives, and a combination thereof. with at least one short interfering RNA (siRNA) oligonucle 24. The oligonucleotide of claim 17, wherein the oligo otide 5 to 30 nucleotides in length, said at least one siRNA nucleotide comprises at least one modified Sugar moiety oligonucleotide being specific for an antisense polynucle selected from: a 2'-O-methoxyethyl modified sugar moiety, a otide of a Sirtuin (SIRT) polynucleotide, wherein said at least 2-methoxy modified sugar moiety, a 2'-O-alkyl modified one siRNA oligonucleotide has at least 50% sequence iden Sugar moiety, a bicyclic Sugar moiety, and a combination tity to a complementary sequence of at least about five con thereof. secutive nucleic acids of the antisense and/or sense nucleic 25. The oligonucleotide of claim 17, wherein the oligo acid molecule of the Sirtuin (SIRT) polynucleotide; and, nucleotide comprises a plurality of modifications, wherein modulating a function of and/or the expression of a Sirtuin said modifications comprise modified Sugar moieties selected (SIRT) in mammalian cells or tissues in vivo or in vitro. from: a 2'-O-methoxyethyl modified sugar moiety, a 2'-meth 15. The method of claim 14, wherein said oligonucleotide oxy modified Sugar moiety, a 2'-O-alkyl modified Sugar moi has at least 80% sequence identity to a sequence of at least ety, a bicyclic Sugar moiety, and a combination thereof. about five consecutive nucleic acids that is complementary to 26. The oligonucleotide of claim 17, wherein the oligo the antisense and/or sense nucleic acid molecule of the Sirtuin nucleotide is of at least about 5 to 30 nucleotides in length and (SIRT) polynucleotide. hybridizes to an antisense and/or sense Strand of a Sirtuin 16. A method of modulating a function of and/or the (SIRT) polynucleotide wherein said oligonucleotide has at expression of a Sirtuin (SIRT) in mammalian cells or tissues least about 20% sequence identity to a complementary in vivo or in vitro comprising: contacting said cells or tissues sequence of at least about five consecutive nucleic acids of the with at least one antisense oligonucleotide of about 5 to 30 antisense and/or sense coding and/or noncoding nucleic acid nucleotides in length specific for noncoding and/or coding sequences of the Sirtuin (SIRT) polynucleotide. sequences of a sense and/or natural antisense strand of a 27. The oligonucleotide of claim 17, wherein the oligo Sirtuin (SIRT) polynucleotide wherein said at least one anti nucleotide has at least about 80% sequence identity to a sense oligonucleotide has at least 50% sequence identity to at complementary sequence of at least about five consecutive least one nucleic acid sequence set forth as SEQID NOS: 1 to nucleic acids of the antisense and/or sense coding and/or 14; and, modulating the function and/or expression of the noncoding nucleic acid sequence of the Sirtuin (SIRT) poly Sirtuin (SIRT) in mammalian cells or tissues in vivo or in nucleotide. vitro. 28. The oligonucleotide of claim 17, wherein said oligo 17. A synthetic, modified oligonucleotide comprising at nucleotide hybridizes to and modulates expression and/or least one modification wherein the at least one modification is function of at least one Sirtuin (SIRT) polynucleotide in vivo selected from: at least one modified Sugar moiety; at least one or in vitro, as compared to a normal control. modified internucleotide linkage; at least one modified nucle 29. The oligonucleotide of claim 17, wherein the oligo otide, and combinations thereof, wherein said oligonucle nucleotide comprises the sequences set forth as SEQID NOS: otide is an antisense compound which hybridizes to and 15 to 94. modulates the function and/or expression of a Sirtuin (SIRT) 30. A composition comprising one or more oligonucle in vivo or in vitro as compared to a normal control. otides specific for one or more Sirtuin (SIRT) polynucle 18. The oligonucleotide of claim 17, wherein the at least otides, said polynucleotides comprising antisense sequences, one modification comprises an internucleotide linkage complementary sequences, alleles, homologs, isoforms, vari selected from the group consisting of phosphorothioate, alky ants, derivatives, mutants, fragments, or combinations lphosphonate, phosphorodithioate, alkylphosphonothioate, thereof. phosphoramidate, carbamate, carbonate, phosphate triester, 31. The composition of claim 30, wherein the oligonucle acetamidate, carboxymethyl ester, and combinations thereof. otides have at least about 40% sequence identity as compared 19. The oligonucleotide of claim 17, wherein said oligo to any one of the nucleotide sequences set forth as SEQ ID nucleotide comprises at least one phosphorothioate inter NOS: 15 to 94. nucleotide linkage. 32. The composition of claim 30, wherein the oligonucle 20. The oligonucleotide of claim 17, wherein said oligo otides comprise nucleotide sequences set forth as SEQ NOS: nucleotide comprises a backbone of phosphorothioate inter 15 to 94. nucleotide linkages. 33. The composition of claim 32, wherein the oligonucle 21. The oligonucleotide of claim 17, wherein the oligo otides set forth as SEQ ID NOS: 15 to 94 comprise one or nucleotide comprises at least one modified nucleotide, said more modifications or Substitutions. modified nucleotide selected from: a peptide nucleic acid, a 34. The composition of claim 33, wherein the one or more locked nucleic acid (LNA), analogue, derivative, and a com modifications are selected from: phosphorothioate, meth bination thereof. ylphosphonate, peptide nucleic acid, locked nucleic acid 22. The oligonucleotide of claim 17, wherein the oligo (LNA) molecules, and combinations thereof. nucleotide comprises a plurality of modifications, wherein 35. A method of preventing or treating a disease associated said modifications comprise modified nucleotides selected with at least one Sirtuin (SIRT) polynucleotide and/or at least from: phosphorothioate, alkylphosphonate, phospho one encoded product thereof, comprising: administering to a rodithioate, alkylphosphonothioate, phosphoramidate, car patient a therapeutically effective dose of at least one anti bamate, carbonate, phosphate triester, acetamidate, car sense oligonucleotide that binds to a natural antisense boxymethyl ester, and a combination thereof. sequence of said at least one Sirtuin (SIRT) polynucleotide 23. The oligonucleotide of claim 17, wherein the oligo and modulates expression of said at least one Sirtuin (SIRT) nucleotide comprises a plurality of modifications, wherein polynucleotide; thereby preventing or treating the disease US 2012/O252869 A1 Oct. 4, 2012

associated with the at least one Sirtuin (SIRT) polynucleotide erulonephritis, Guillan-Barre Syndrome, hemorrhagic stroke, and/or at least one encoded product thereof. rheumatoid arthritis, inflammatory bowel disease, SLE, 36. The method of claim 35, wherein a disease associated Crohn's disease, osteoarthritis, osteoporosis, Chronic with the at least one Sirtuin (SIR) polynucleotide is selected Obstructive Pulmonary Disease (COPD), pneumonia, skin from cancer (e.g., breast cancer, colorectal cancer, CCL, aging, urinary incontinence, a disease or disorder associated CML, prostate cancer), a neurodegenerative disease or disor with mitochondrial dysfunction (e.g., mitochondrial myopa der (e.g., Alzheimer's Disease (AD), Huntington's disease, thy, encephalopathy, Leber's disease, Leigh encephalopathia, Parkinson's disease, Amyotrophic Lateral Sclerosis (ALS), Pearson's disease, lactic acidosis, mitochondrial encephal Multiple Sclerosis, and disorders caused by polyglutamine opathy: lactic acidosis and stroke like symptoms (MELAS) agwegation); skeletal muscle disease (e.g., Duchene muscu etc.) and a disease or disorder associated with neuronal cell lar dystrophy, skeletal muscle atrophy, Becker's dystrophy, or death, degenerative syndrome, aging, a disease or disorder myotonic dystrophy); a metabolic disease or disorder (e.g., associated with telomere dysfunction, a disease or disorder insulin resistance, diabetes, type 2 diabetes, obesity, impaired associated with impaired chromatin regulation, a disease or glucose tolerance, metabolic syndrome, adult-onset diabetes, disorder associated with premature cellular senescence, a diabetic nephropathy, hyperglycemia, diabetic nephropathy, disease or disorder associated with impared SIRT6 mediated Hypercholesterolemia, dyslipidemia hyperlipidemia and an DNA repair and a condition characterized by unwanted cell age-related metabolic disease etc.), a disease or disorder asso loss. ciated with impaired regulation of insulin level, neuropathy 37. A method of preventing or treating a skin condition (e.g., sensory neuropathy, autonomic neuropathy, motor neu associated with at least one Sirtuin (SIRT) polynucleotide ropathy, retinopathy), a disease or disorder associated with a and/or at least one encoded product thereof, comprising: ketogenic condition, a disease or disorder associated with administering to a patient having a skin condition or at risk of impaired energy homeostasis, a disease or disorder associated developing a skin conditionatherapeutically effective dose of with impaired Acetyl-CoA synthetase 2 activity, a disease or at least one antisense oligonucleotide that binds to a natural disorder associated with metabolic homeostasis, a lipid antisense sequence of said at least one Sirtuin (SIRT) poly metabolism disease or disorder, a disease or disorder associ nucleotide and modulates expression of said at least one ated with impaired thermogenesis, a disease or disorder asso Sirtuin (SIRT) polynucleotide; thereby preventing or treating ciated with mitochondrial dysfunction, neuropathy (e.g., sen the disease skin condition associated with the at least one sory neuropathy, autonomic neuropathy, motor neuropathy, Sirtuin (SIRT) polynucleotide and/or at least one encoded retinopathy), a liver disease (e.g., due to alcohol abuse or product thereof. hepatitis, fatty liver disease etc.); age-related macular degen 38. The method of claim 38, wherein the skin condition is eration, bone disease (e.g., osteoporosis), a blood disease caused by caused by inflammation, light damage or aging. (e.g., a leukemia); liver disease (e.g., due to alcohol abuse or 39. The method of claim 39, wherein the skin condition is hepatitis), obesity; bone resorption, age-related macular the development of wrinkles, contact dermatitis, ample der degeneration, AIDS related dementia, ALS, Bell's Palsy, ath matitis, actinic keratosis, keratinization disorders, an epider erosclerosis, a cardiac disease (e.g., cardiac dysrhymias, molysis bullosa disease, exfoliative dermatitis, seborrheic chronic congestive heart failure, ischemic stroke, coronary dermatitis, an erythema, discoid lupus erythematosus, der artery disease and cardiomyopathy), chronically degenera matomyositis, skin cancer, or an effect of natural aging. tive disease (e.g., cardiac muscle disease), chronic renal fail ure, type 2 diabetes, ulceration, cataract, presbiopia, glom c c c c c