Disruption of ETV6 in Intron 2 Results in Upregulatory and Insertional Events in Childhood Acute Lymphoblastic Leukaemia

Home , BAZ2A, BCL11B

Disruption of ETV6 in intron 2 results in upregulatory and insertional events in childhood acute lymphoblastic leukaemia

GR Jalali1,2,QAn1, ZJ Konn, H Worley, SL Wright, CJ Harrison, JC Strefford1 and M Martineau1

Leukaemia Research Cytogenetics Group, Cancer Sciences Division, University of Southampton, Southampton, UK

We describe four cases of childhood B-cell progenitor acute more often involved when the 12p rearrangements are balanced lymphoblastic leukaemia (BCP-ALL) and one of T-cell (T-ALL) rather than unbalanced, the latter often being associated with a with unexpected numbers of interphase signals for ETV6 with complex karyotype.10,11 The inherent instability of the ETV6 an ETV6–RUNX1 fusion probe. Three fusion negative cases each had a telomeric part of 12p terminating within intron 2 of gene has been demonstrated in several different studies by the ETV6, attached to sequences from 5q, 7p and 7q, respectively. use of cosmid probes to its individual exons. However, the series Two fusion positive cases, with partial insertions of ETV6 into of probes used have not always covered the complete gene, so chromosome 21, also had a breakpoint in intron 2. Fluores- the significance of some findings is unclear.3,6–8 Although ETV6 cence in situ hybridisation (FISH), array comparative genomic is an attractive candidate for the main target of the deletions and hybridization (aCGH) and Molecular Copy-Number Counting translocations associated with 12p, its central role remains (MCC) results were concordant for the T-cell case. Sequences 12 downstream of TLX3 on chromosome 5 were deleted, leaving unproven. the intact gene closely apposed to the first two exons of ETV6 The fusion partners of ETV6, of which over twenty have been and its upstream promoter. qRT-PCR showed a significant described, are either protein tyrosine kinases in which the upregulation of TLX3. In this study we provide the first majority of ETV6 breakpoints occur in intron 4 or 5 of the gene, incontrovertible evidence that the upstream promoter of ETV6 or transcription factors of which the commonest is the fusion attached to the first two exons of the gene was responsible for with RUNX1 in B-cell progenitor acute lymphoblastic leukae- the ectopic expression of a proto-oncogene that became abnormally close as the result of deletion and translocation. mia (BCP-ALL), with a breakpoint in intron 5. A third group of We have also shown breakpoints in intron 2 of ETV6 in two cases in which the ‘fusion’ does not always result in a 13 cases of insertion with ETV6–RUNX1 fusion. meaningful protein product, has a breakpoint in intron 2. Leukemia (2008) 22, 114–123; doi:10.1038/sj.leu.2404994; The rearrangements resulting from intron 2 breakpoints are of published online 1 November 2007 two types. The first of these includes both of the conserved Keywords: childhood ALL; ETV6; intron 2; TLX3; upregulation; domains of the ETV6 gene. Examples are the t(4;12)(q11– insertion q12;p13) involving the CHIC2 gene, and the t(5;12)(q31;p13) the ACS2 gene,14 the t(7;12)(q36;p13) involving the HLXB9 gene,15–17 the t(9;12)(q11;p13) the PAX5 gene18,19 and the t(12;22)(p13;q11) the MN1 gene.20–22 These are all recurrent translocations but only some of the fusions are in frame. Introduction The other type of ETV6 abnormality with an intron 2 breakpoint, joins the first two exons of the 50 end of ETV6 to a growing list of partners which include MDS2,23 MDS1/ The instability of the short arm of chromosome 12 (12p) in 24,25 26 27 28 29 30 haematological malignancies, was first highlighted in a study EVI1, STL, AF7p15, GOT1, BAZ2A and CDX2. which included three patients with myeloid disorders in whom This group comprises both unique and rare recurrent examples. fluorescence in situ hybridization (FISH), revealed translocation None appeared to result in a fusion protein to which an of terminal 12p probes, while the proximal probes only oncogenic potential could be attributed, demanding an alter- hybridized to the normal 12Fan indication of an interstitial native explanation that implicated an upregulatory function for deletion from the abnormal homologue.1 These findings were the truncated gene. confirmed in 16 patients with a variety of 12p abnormalities, of Insertion of genetic material from one chromosome into whom ten had interstitial deletions not suspected from the another is a recurrent phenomenon in many types of acute cytogenetics. However, direct involvement of ETV6 was only leukaemia. Surprisingly, given the incidence of the proved in two cases.2 Subsequently it has been shown that ETV6 t(12;21)(p13;q22) translocation, there are only three published is involved in a significant number of cases with visible examples of insertions which have created an ETV6–RUNX1 fusionFone of material from chromosome 21 into 12p31 and cytogenetic abnormalities of 12p or loss of heterozygosity 32,33 (LOH) in that region.3–9 There is some evidence that the gene is two reporting the reverse. Secondary insertional events associated with the fusion include a case with chromosome 3 Correspondence: Dr M Martineau, Leukaemia Research Cytogenetics material inserted into the derived chromosome 12 (der(12)) and Group, Cancer Sciences Division, University of Southampton, MP822, four cases in which the reciprocal part of the RUNX1 gene was Duthie Building, Southampton General Hospital, Tremona Road, inserted into chromosomes other than 12.34,35 The formation of Southampton SO16 6YD, UK. an ETV6–ABL1 fusion by insertion was reported in two E-mail: [email protected] cases.36,37 As for the RUNX1 gene, its involvement in insertions 1These authors contributed equally to this work. 2 which result in a t(8;21)(q22;q22) translocation, is well Current address: Division of Human Genetics and Molecular Biology, 38,39 The Children’s Hospital of Philadelphia, Philadelphia, PA, USA. established. Received 16 July 2007; revised 12 September 2007; accepted 13 The five cases which are presented here were identified September 2007; published online 1 November 2007 during routine diagnostic interphase FISH screening for the Disruption of ETV6 in intron 2 in childhood ALL GR Jalali et al 115 ETV6–RUNX1 fusion.40 Each had a different number of ETV6 RP11-210K16, RP11-35O10 (5q34); RP11-15F10, RP11-9I14 signals to that expected. The purpose of the study, performed (5q35.1); RP11-88L12 (5q35.2); RP11-423H2, RP11-47L17, with FISH and other molecular techniques where possible, was RP11-26G19, RP11-39H3, RP11-233O11 (5q35.3); RP11-34J24 to clarify the role of ETV6 by looking for features that the cases (7p11 to 7p12); RP11-109N2 (7p13); RP11-243E12, shared. RP11-273L18 (7p14.1); RP11-246L12, RP11-426J23 (7q34) (Sanger Centre, Cambridge, UK).

Materials and methods Array-based comparative genomic hybridization Patients (aCGH) (cases 3912 and 5944) The five patients in this study with a diagnosis of ALL had been Test DNA samples were sex-matched with normal genomic entered to one of the Medical Research Council treatment reference DNA (Promega, Madison, USA). aCGH was per- trialsFALL97 or the MRD Pilot Trial for patients aged 1–18 formed according to the manufacturers’ instructions.43 Samples years inclusive. White blood cell (WBC) counts and immuno- were processed with 185K whole genome oligonucleotide phenotypes were determined locally and the data collected by arrays and analysed with proprietary software (Agilent Technol- the Clinical Trial Service Unit in Oxford. The patients were ogies, Santa Clara, California, USA). Preliminary analysis among 2027 tested for ETV6–RUNX1 fusion by FISH. identified statistically significant groups of probes, based on a 2 Mb genomic window size and a z-score beyond 6.0. The aberration detection method 1 (ADM1, Agilent Technologies) Cytogenetics algorithm was used for a robust estimation of the position and Diagnostic bone marrow samples, obtained with consent, were extent of the aberration, defined as a minimum of five processed by established short-term culture methods. The fixed consecutive probes that deviated by ±0.25 from a normalized cell suspensions were used for conventional chromosomal ratio of zero. analysis and for FISH. The cases were initially investigated in the UK regional cytogenetic centres and their findings were then reviewed by the Leukaemia Research Cytogenetics Group Molecular copy-number counting (MCC) (case 3912) (formerly the Leukaemia Research Fund/United Kingdom MCC was carried out as described with slight modifications.44 Cancer Cytogenetics Group Karyotype Database in acute Human male genomic DNA (Promega) was used to determine lymphoblastic leukaemia).41 The karyotypes were described the working concentration of DNA by making a series of according to the International System for Human Cytogenetic dilutions to give B0.25–8 genomes of DNA per aliquot. Using Nomenclature.42 96-well plates, a clear copy number change of genomic loci for the PAX5 and MGC39900 genes (two and one copy per genome, respectively), was observed at 0.03 genomes mlÀ1 FISH (0.09 pg mlÀ1) of genomic DNA. This concentration was FISH was carried out according to the manufacturers’ instructions employed for MCC analyses of the patient (data not shown). and 200 interphase nuclei were scored for each sample. The Eleven markers in ETV6 intron 2 were chosen according to commercial probes used included: LSI TEL/AML1 ES (Vysis FISH and aCGH data to screen the genomic region of B42 kb Abbott Diagnostics, Maidenhead, UK); split signal probes for between 11833359 and 11875231 bp on 12p. Three PCR ETV6 and TLX3 (Dakocytomation, Glostrup, Denmark); whole primers were designed for each marker (Table 1). Markers chromosome paints (STAR*FISH Human Whole Chromosome- 1–5, with intervals B11 kb apart, were used for the first round of Specific Probes, Cambio, Cambridge, UK); arm specific paints MCC, markers 6–9, B1.7 kb apart, for the second and markers (Qbiogene, California, USA); Multiplex FISH (M-FISH) in 10 and 11, B500 bp apart, for the third. combination with the Spectra Vysion 24-color chromosome Semi-nested PCR assays were performed. The master mix for painting kit (Vysis); centromeric probes (Cambio) and subtelo- the first PCR contained B0.09 pg mlÀ1 of genomic DNA, meric probes (Qbiogene). The non-commercial probes used 0.15 mM of each oligo of the external forward and common included: cosmid probes to the ETV6 gene: 179A6 (exon 1), 15A4 reverse PCR primers of the chosen markers, 200 mM of each À1 (intron 1), 50F4 (exon 2), 132B11 (intron 2), 242E1 (introns 2–3), dNTP and 1 Â GoTaq Flexi buffer, 1.5 mM of MgCl2, 0.05 U ml 163E7 (exon 3-intron 5), 54D5 (exons 5–8), 148B6 (exon 8); of GoTaq Flexi DNA polymerase (Promega). A 10 ml aliquot of YACs: 693F4 (5q33), 802F5 (5q34), 889G5 (5q35); BACs: this mixture was dispensed into each of 88 wells of a 96-well

Table 1 The primers used for MCC analysis

Marker Genomic location (bp) External forward primer Internal forward primer Common reverse primer

1 11833359–11833603 GAGTAGCTGGGATTACAGG CAAACTCCTGACCTCACG GAGGAGAGTGAGGCAGG 2 11835489–11835739 CTTCACTGTTACTTTAGAGG CTAGAGCTTCTCAGGAGG CTTACAGGAATCTTTATGG 3 11854415–11854643 GAGTGAGAATATACAGAGG GAATGTAAACCCGTGAAG GCACCCTCCATACCTAAG 4 11859095–11859330 GTGAACTGCCATCCAAGG GGAGAAGGAAACAGAGG CACTAAGTCCTAAGTAGG 5 11874941–11875231 CTTCAGCTACATGCATGG GTAGAAATGATAGCAGAGG CAGCATTCAGATCATGAG 6 11847625–11847886 AAGGGAGCTGCTTATTGG GCTGTCCTCGTGATTGAG CTTATTCTTCCTCTGAGTG 7 11849014–11849287 CACCTGTAGGGTAATTGG CATGAAGATTTCCACTGAG CCTGCACCTCCTTGCAG 8 11850567–11850812 GGCAATTAGAGGTTAAAGG GGCACCAAGGAAAGATGG GCTAGACACATTGTCAGG 9 11852343–11852568 GATAACAAGGATGGCATACG GTCATGTGAGTAACTCCAG GACTGTATACCTTGTCAGG 10 11849482–11849698 GTCAGATACCAATTGTCCG CTCTATCTGGTTTAGTGGG CTGTACTGCTACATCAATG 11 11849895–11850189 GGCATTCATTGAATTTGCTG GCAACAAGCATCCGTGTC CTTCATATCCATGAGTTGAG

Leukemia Disruption of ETV6 in intron 2 in childhood ALL GR Jalali et al 116 plate and the same mix but without the DNA, into the remaining included: normal bone marrow, two BCP-cell lines SEM, 8 wells as negative controls. An MJ PTC-225 Thermal Cycler (MJ RCH-ACV and two T-ALL patients, cases 8956 and 11216 Research, Genetic Research Instrumentation Ltd, Braintree, UK) (negative controls) and HPB-ALL, a TLX3 overexpressing T-ALL was used for PCR. Reaction conditions were as follows: cell line (positive control). denaturation at 95 1C for 2 min followed by 30 cycles of denaturation at 95 1C for 30 s, annealing at 52 1C for 30 s, extension at 72 1C for 1 min and a final extension for 7 min Results at 72 1C. The second PCR was performed with 2 ml of each 1st-PCR Patient data reaction diluted to 200 ml with water. The concentration of The clinical, laboratory and cytogenetic data for the five patients reagents was the same as that for the 1st-PCR, except that 0.5 mM are shown in Table 2. Four patients had BCP-ALL while one had of each of the oligos of the internal forward and common T-ALL. The median age of the patients was four years (range 2– reverse primers of the chosen markers were used. Thermo- 10 years) and the median WBC was 13 Â 109 lÀ1 (range 4– cycling was identical to that of the 1st-PCR. 14 Â 109 lÀ1). Following PCR, 3 ml of each 2nd-PCR product was mixed with 2 ml of formamide dye mix (98% formamide, 10 mM EDTA/pH 8.0, 0.015% xylene cyanol FF), and loaded into a 192-well Interphase FISH horizontal 7.5% polyacrylamide gel (MadgeBio Ltd, Grantham, The interphase FISH pattern for the three ETV6–RUNX1 negative Lincolnshire, UK). The amplified 2nd-PCR products were patients showed three green signals for the ETV6 gene and two separated by electrophoresis for 15 min at 200 V. The gel was red signals for the RUNX1 gene (Figure 1a). The two fusion Â stained in 1 SYBR Gold (Invitrogen, Paisley, UK) for 10 min positive patients had a single red signal, two green ones and and scanned using a Typhoon Trio Imager (Amersham, UK). The a fusion signal which appeared as a small yellow spot inside a presence or absence of the PCR product in each well was scored larger red one (Figure 1b). using microplate array diagonal gel electrophoresis (MADGE)- specific gel image analysis software (Phoretix Ltd, Newcastle, UK) and MCC data were analysed as described. Determination of karyotypes Karyotypes were established by conventional cytogenetics and Long-distance inverse PCR (LDI–PCR) cloning (case refined by FISH (Figures 1c–f and Table 2). The karyotypic 3912) abnormality in case 3912 was cryptic by conventional LDI–PCR was carried out as previously described,45 using the cytogenetics. It was revealed when the three ETV6 signals were following PCR primers: first round forward PCR (GGCATT seen on metaphases (Figure 1c). There were no suitable cells in CATTGAATTTGCTG), second round forward PCR/sequencing case 6816 for metaphase FISH. (GCAACAAGCATCCGTGTC), and common reverse PCR/ sequencing (CTGTACTGCTACATCAATG). ETV6 breakpoint analysis The presence or absence on metaphases of the eight overlapping Quantitative real-time PCR (qRT-PCR) (case 3912) cosmid probes covering the ETV6 gene is shown in Table 3. It Total RNA was isolated from cell pellets and cDNA prepared seemed likely that when a chromosome was positive for 132B11 according to protocol (Promega). mRNA levels of TLX3, and for 242E1 but negative for 163E7 that the breakpoint in the RANBP17, NPM1 and ETV6 were assessed using the Taqman gene was in the 30 end of intron 2, close to exon 3. In the two gene Expression Assays (Applied Biosystems, Foster City, fusion positive cases, the 50 breakpoint of the inserted fragment California, UK) in patient 3912 and in a series of controls appeared to be in intron 2 in case 6106 and proved to be so in according to standard methodologies.46 The control samples case 6816. The 30 breakpoint was in cosmid 54D5 in both cases.

Table 2 Clinical, Laboratory and Cytogenetic Data for ﬁve patients with an unexpected interphase FISH signal pattern for ETV6

Patient number Sex/age WBC Â 109 lÀ1 Immunophenotype Interphase FISH Karyotype

3912 M/10 13 T cell 2R3G[82%] 46,XY,der(5)t(5;12)(q35;p13)/45,idem,ÀY.nuc 2R2G[18%] ish(TELx3),(AML1x2)[164/200]/(TEL,AML1)x2[36/200] 4008 M/5 7 c-ALL 2R3G[57%] 46,XY,der(7)t(7;12)(p12 or p13;p13), 2R2G[43%] der(12)t(12;12)(p1?;qter)t(7;12)(p12 or p13;q1?),der(12)ins(12;12)(p?;q?q?) .nuc ish(TELx3),(AML1x2)[114/200]/(TEL,AML1)x2[86/200] 5944 F/2 14 c-ALL 2R3G[35%] 46,XX,der(7)(del)(7)(q3?;q34)t(7;9)(p?;p?), 2R2G[63%] del(9)(p?),der(9)t(7;12)(p1?;p13)ins(12;7) (p13;q34q3?)ins(9;7)(q?;q3?q3?), del(12)(p?p?),der(12)t(7;12)(p14;p13),inc.nuc ish(TELx3),(AML1x2)[70/200]/(TEL,AML1)x2[126/200] 6106 F/3 4 c-ALL 1R2G1F[66%] 46,XX.nuc ish(TELx3),(AML1x2),(TEL con 2R2G[25%] AML1x1)[132/200]/(TEL,AML1)x2[50/200] 6816 M/4 13 c-ALL 1R2G1F[36%] 46–48,XY,À1,der(4)t(1;4)(p13;q3?), 2R2G[63%] add(6)(q1?),?add(12)(p11),+16,À18,+2mar,+ 2r,inc.nuc ish(TELx3),(AML1x2),(TEL con AML1x1) [72/200]/(TEL,AML1)x2[126/200]

Leukemia Disruption of ETV6 in intron 2 in childhood ALL GR Jalali et al 117 Case 3912 The third interphase ETV6 signal seen in 82% of the nuclei, was produced by the telomeric part of 12p translocated to the long arm of chromosome 5 which extended in a centromeric direction and included at least part of the region covered by the 242E1 cosmid. The two normal copies of chromosome 12 each had signals for the complete set of the eight ETV6 cosmid probes (Figures 1c and d, Tables 2 and 3). A series of ten bacterial artifical chromosome probes (BACs) extending from 5q34 to 5q35.3 showed that 5q had been deleted from 5q35.1 between two probes RP11-15F10 (Mb position 169.07) and RP11-9I14 (Mb position 171.1). The Mb position of TLX3 (170.67) thus fell between them. The telomeric part of the commercial dual colour probe to TLX3 was missing, confirming the deletion. Interphase FISH with probes to chromosome 12 centromere and yeast artificial chromosome (YAC) 889G5 mapping to 5q35, showed a 10% normal population with two signals for each, a 10–15% population with three signals for 12 centromere and two for the 5q YAC and an B80% population with two signals for 12 centromere and one for the 5q YAC. The same YAC 889G5 was used in conjunction with a Y chromosome centromeric probe. All cells which had lost the Y (B35%) had only one signal for the 5q YAC, whereas those that had retained the Y (B65%), had either one or two signals, proving that the loss of Y was a secondary event. Array CGH revealed eight copy number changes involving chromosomes 4, 5, 12, 15, 21 and Y, ranging from a 0.07 Mb deletion at 12p11.22 to the loss of the entire Y chromosome. A gain of 12p encompassing the region from 12pter to 12p13 (genomic position 0–11847532 bp) was observed, where the centromeric breakpoint was positioned between array features A_14_P128751 (11847473–11847532 bp) and A_16_P12994461 (11861497– 11861556 bp) within intron 2 of ETV6. A loss of 5q35 to 5qter (170677140–180644869 bp) showed that the centromeric breakpoint was 30 (telomeric) of TLX3 (Figures 2a and b). A 1.5 Mb deletion of chromosome band 21q22.12 was observed that resulted in the loss of the 50 telomeric end of RUNX1 (35276320–36793708 bp). The MCC technique used to locate and map the unbalanced der(5)t(5;12)(q35;p13) is based on the fact that nonreciprocal translocations result in a copy number change. The first round of MCC showed a shift in relative copy number between markers 2 (11835489–11835739 bp) and 3 (11854415–11854643 bp), consistent with the aCGH results. A combination of these results located the possible breakpoint within a region of B7kb (11847533–11854643 bp) in ETV6 intron 2 that was subsequently covered by markers 6–9 for the second round of MCC. These results in their turn revealed a change in copy number between markers 7 (11849014–11849287 bp) and 8 Figure 1 FISH analysis. (a) Case 3912: TEL/AML1 ES probe shows (11850567–11850812 bp), further refining the breakpoint region three green interphase signals for TEL and two red ones for AML1. (b) B Case 6106: TEL/AML1 ES probe shows two green signals for TEL, one to within 1.5 kb. The third round of MCC was carried out red for AML1 and a fusion appearing as a tiny yellow spot inside a using the new markers 10 and 11 (located between markers 7 larger red one, indicative of an insertion. (c) Case 3912: probe 179A6 and 8), in addition to all the second round markers. The putative to exon 1 (green) and probe 148B6 to exon 8 (red) of ETV6 and wcps breakpoint was finally located within a B600 bp region for chromosomes 5 (red) and 12 (blue) show part of 12p and probe between markers 11 (11849895–11850189 bp) and 8 179A6 on 5q. (d) case 3912: wcps and subtelomeric probes for chromosomes 5 and 12 show a third copy of the 12p subtelomere on (11850567–11850812 bp) (Figure 2c). chromosome 5 replacing a 5q subtelomere. (e) case 4008: wcps and LDI–PCR was then used with primers designed to clone the subtelomeric probes for chromosomes 7 and 12 show a 7p junction of chromosomes 5 and 12 in the der(5)t(5;12)(q35;p13). subtelomere on 12q, a 12p subtelomere on 7p and a 12q subtelomere The sequence of the second PCR product (B1.4 kb) revealed the on 12p (f) case 5944: wcps and subtelomeric probes for chromosomes fusion of ETV6 (12p13) to LOC391847 (5q35; B40 kb telomeric 7, 9 and 12 show a 7p subtelomere on 12p, a 9p subtelomere on 7p to TLX3). The genomic location of the breakpoint in ETV6 was at and a12p subtelomere on 9p. 11 850 627 bp (intron 2; within marker 8), and of that in LOC391847 at 170 675 801 bp (intron 8) (Figures 2d and e). qRT-PCR showed that TLX3 was highly upregulated in comparison to normal bone marrow both in case 3912

Leukemia Disruption of ETV6 in intron 2 in childhood ALL GR Jalali et al 118 Table 3 Presence (shaded) or absence (blank) on metaphase chromosomes of cosmid probes to the ETV6 gene and the subtelomeres involved

15A4 50F4 132B11 163E7 148B6

179A6 242E1 54D5

Tel Cen Exon 3 Exon 4 Exon 6 Exon 7 Exon 8 Exon 1 Exon 5 Exon 2

Case Chromosome Cosmid ProbesTelomeres 179A6 15A4 50F4 132B11 242E1 163E7 54D5 148B6 3912 normal 5 5p:5q der(5)t(5;12) 5p:12p normal 12 12p:12q second normal 12 12p:12q

4008 normal 7 7p:7q der(7)t(7;12) 12p:7q der(12)ins (12;12) 12p:12q der(12)t(12;12)t(7;12) 12q:7p

5944 normal 7 7p:7q der(7)del(7)t(7;9) 9p:7q del(9p) 9p:9q der(9)t(7;9)t(7;12)ins(9;7) 12p:9q del(12p) 12p:12q der(12)t(7;12) 7p:12q

6106 normal 12 12p:12q der(12)del(12)ins(21;12) 12p:12q normal 21 21q der(21)ins (21;12) 21q

6816 normal 12 12p:12q der(12)del(12)ins(21;12) 12p:12q normal 21 21q der(21)ins(21;12) 21q

(515.56-fold) and in the HPB-ALL cell line (484.38-fold). In The mRNA levels of ETV6 exons 1–2 and exons 5–6 showed contrast, the two BCP-ALL cell lines (SEM and RCH-ACV) and no signiﬁcant difference as compared with other samples, the two T-ALL patients (cases 8956 and 11216) showed a lower suggesting that the translocated fragment of ETV6 containing expression of the gene than in normal bone marrow (0.4-, 0.5-, exons 1–2 was not expressed. 0.62- and 0.29-fold, respectively). The expression levels of the upstream RANBP17 and the downstream NPM1 genes located close to TLX3, were also Case 4008 analysed by quantitative PCR. The results showed similar The third interphase ETV6 signal, seen in 57% of the nuclei, was expression levels of RANBP17 and NPM1 in the three T-ALL the result of an insertion of 12q sequences into the short arm of patients. The expression levels of these two genes were also one copy of chromosome 12, dividing the green signal for ETV6 similar between the three cell-lines analysed, but there was a into two. The part of 12p on the der(7)t(7;12) showed signals for lower level of RANBP17 and a higher one of NPM1 compared the 12p subtelomere and for cosmid probes extending in a with the patient samples (Figure 2f). centromeric direction to 242E1. The reciprocal der(12) had no

Leukemia ou mdl)adtesqecsflnigtebekon ftedr5 hoooe(otm.( (bottom). chromosome der(5) ( the line). of (bottom breakpoint 5 the and flanking line) sequences (top the 12 and chromosome (middle) of locus sequences normal the against line) ( algorithm. q xrsini hw sfl change. fold as shown is Expression a 5q. to ( according model. change aberration number mathematical copy a of using of duplication regions change a number define and copy areas 5q of of shaded deletion regions in the A precise breakpoint number. where the copy value, show normal ratio for profiles 0.0 the normal of this ratio log from a deviation following as line dark shown a are as shown 12p profile the with vertically positioned 2 Figure oeua nlsso ain 92 ( 3912. patient of analysis Molecular b h aeaG nlsselre o the for enlarged analysis aCGH same The ) ETV6 d e c a Derivative chromosome5 Chromosome 5 Chromosome 12 q35.2 q34 q33.2 q32 q31.2 q23.3 q23.1 q21.3 q21.1 q14.3 q14.1 q13.2 q12.1 p12 p13.2 p14.1 p15.2 chr 12 der(5) nrn2 rm1 b(on )t . b(on )t . b(on ) ( 3). (round kb 0.5 to 2) (round kb 1.7 to 1) (round kb 11 from 2, intron chr 5 Copy number 1 2345678 (genomes/aliquot) 1 23 1 23 0.2 0.4 0.6 5 TAAGCATTTGATAGTGTTCTAGCTATACTGCAAAATGAAN ||||||||||||||||||||||||||||||||||||||| |||||| TAAGCATTTGATAGTGTTCTAGCTATACTGCAAAATGAATGCTGCATGAAGGCTAACTGAGAAGCTTATCAGTTGGTAGT CCCAGTACAAAGAGCGCTTGCTTTAGGGGCGAGAGCGCGGGGCCGCCACCGCTGCACGACCCAGAACTATTATCAGAGCT 0 183M 11.875Mb 11.833 Mb Round-1 -2 TLX3 TLX3 ~11-kb intervals 0+2 | |||||||||||||||||||||||||||||||||||||||| ETV6 a h CHpols(o osae o hoooe n 2 h hoooeiigasare idiograms chromosome The 12. and 5 chromosomes for scale) to (not profiles aCGH The ) q24.32 q24.21 q23.3 q23.1 q21.33 q21.31 q21.1 q14.1 q13.2 q13.12 q12 p11.22 p12.1 p12.3 p13.2 p13.32 LOC391847 2 1 TLX3 ETV6 12 eeo hoooe5adthe and 5 chromosome on gene 188M 11.853Mb 11.848 Mb Round-2 -2 0+2 ~1.7-kb intervals f 200 400 600 20 0 RJalali GR of Disruption NNCCGCCACCGCTGCACGACCCAGAACTATTATCAGAGCT

RANBP17 Fold-Change b tal et 172.6Mb 170.8Mb 169.0Mb 12.3Mb 11.7Mb 11.3Mb e iga ftenormal the of Diagram ) ETV6 d lgmn ftedr5 rapitsqec (middle sequence breakpoint der(5) the of Alignment ) nito ncidodALL childhood in 2 intron in ETV6 f 189M 11.851Mb 11.849 Mb xrsinaayi o he ee oiindon positioned genes three for analysis Expression ) L3NPM1 TLX3 Round-3 ETV6 TLX3 eeo hoooe1.Tesae ra of areas shaded The 12. chromosome on gene c ~0.5-kb intervals C nlssrfie h oiino the of position the refines analysis MCC ) ETV6 RCH ACV SEM T-ALL-(8956) T-ALL-(11216) HPB-ALL Case 3912 BM ou tp,tenormal the (top), locus z -score TLX3 Leukemia 119 Disruption of ETV6 in intron 2 in childhood ALL GR Jalali et al 120 signals for ETV6 exons: whole arm paints demonstrated that 7p sized insertions into the long arm of chromosome 21, small material was translocated to 12q while 12p terminated in the enough to leave a residual green signal for ETV6 on the short 12q subtelomere. The second der(12) had a 12p subtelomeric arm of the der(12). signal and the signals for the cosmid probes 242E1 to 148B6 Case 3912 had a third copy of the telomeric region of 12p, split by the insertion (Figure 1e, Tables 2 and 3). Two BAC terminating in an incomplete copy of ETV6 translocated to 5q. probes to 7p showed that the breakpoint on chromosome 7 was Case 4008 had large deletions of ETV6, and no complete copy between 7p12 and 7p13. of the gene. Only one set of 50 exons was present on 7p and only one of 30 exons on the second 12. The general instability of the whole of chromosome 12 was evident from the insertion of 12q Case 5944 material into 12p and by a 12q telomere on 12p and 7p The third interphase ETV6 signal, seen in 35% of the nuclei, was sequences on 12q. Such radical losses and rearrangements due to a translocation between the short arms of chromosomes 7 compare with those reported for two cases of acute myelogen- and 12 with the 7p breakpoint telomeric to 7p14, as FISH ous leukaemia (AML).7 Case 5944 had a split in ETV6 suggesting showed that the TRG@ gene was intact. Further rearrangements a reciprocal translocation, although the 50 exons attached to 7p had produced a der(9) chromosome with sequences from 12p, had undergone a further translocation with 9p. The visibly 7p, 7q, 7p, 9p, 9q, 7q and 9q between its short and long arm deleted second copy of chromosome 12 with an intact 12p subtelomeres of which the 12p component extended in a telomere, had surprise interstitial deletions from ETV6. A similar centromeric direction to cosmid probe 242E1 of ETV6. BAC unexpected loss of ETV6 exons has been reported in several probe RP11-246L12 from 7q34 (including the 50 portion of the other cases of ALL.3,4,6,9,11,32 aCGH confirmed the balanced TRB@ gene), split the red signal of the ETV6 Dakocytomation nature of the t(7;12) but did not reveal any loss of ETV6. The probe into two, by its probable insertion into intron 2 of ETV6. apparent discrepancy between FISH and aCGH results may Material from 7q was also inserted into the long arm of this have been because of the population size. It has been reported der(9). The second copy of chromosome 12 had an interstitial that a 40–50% population is needed for detection of an deletion including part of ETV6. (Figure 1f, Tables 2 and 3). One abnormality with aCGH,46,47 whereas in our case the popula- copy of CDKN2A was deleted from 50% of interphase nuclei. tion comprised only 35% of the cells. FISH showed a aCGH revealed a 0.078 Mb deletion of chromosome 4q13.2 monoallelic deletion of CKDN2A from 50% of interphase cells (genomic position 70305861–70384008 Mb) and a 7.7 Mb that was clearly visible by aCGH, in support of this interpreta- deletion of chromosome 9p22.2 (genomic position 19997631– tion. 27721327 Mb) for this patient. As for the partner chromosomes, the FISH, aCGH and MCC results for the position of the telomeric breakpoint on chromosome 5 were in close accord in case 3912. This case proved an Cases 6106 and 6816 exception in that the unbalanced nature of the translocation The second interphase ETV6 signal in these ETV6–RUNX1 allowed MCC to be used for the first time in a haematological fusion positive patients occurred in 66 and 36% of nuclei, malignancy, to define the breakpoints both in intron 2 of ETV6 respectively. The inserted 12p fragments appeared roughly and on chromosome 5, at the level of the base pairs involved. equal in size as they extended between the same two LDI–PCR was then employed to identify the partner sequences, cosmidsF132B11 and 54D5 (Table 3). The presence of the followed by qRT-PCR to measure the expression of genes that subtelomeric probe to 21q on the der(21)ins(21;12) in both could have been affected by the abnormal apposition of the cases, confirmed that the fusions had occurred by insertion. truncated ETV6 gene to the telomeric region of chromosome 5. FISH showed that the 7p breakpoint in case 4008 was somewhere between 7p12 and 7p13, but lack of material Discussion prevented a finer definition. In case 5944, the 7p breakpoint with 12p was clearly more telomeric, as the TRG@ gene at The five cases in our study each had an unexpected number of 7p14.1 was present. The insertion of 50TRB@ sequences from 7q signals for the ETV6 gene when the probe defining the ETV6– into the 12p fragment attached to 7p meant that the 50 RUNX1 fusion was applied to interphase cells. The fusion sequences of ETV6 were probably attached to 7q rather than negative cases had three rather than two, while the fusion to 7p. positive ones had two rather than the one that normally RT–PCR for case 6816 was negative for the ETV6–RUNX1 represents the copy of ETV6 not involved in the fusion. In fusion, possibly because of the use of inappropriate primers. The addition, when cosmid probes to ETV6 were applied to intron 2 cosmid was split between chromosomes 12 and 21 metaphases, there appeared to be a break in intron 2 of the indicating that the 50 break was probably closer to exon 2 than gene in each case. The cosmid probes provided a more accurate in the three fusion negative cases. In case 6106, it was picture of the actual involvement of the gene than the impossible to be certain that the 50 breakpoint was in intron 2, commercial probe, which was expressly designed to identify because of the deletion of the exon 2 cosmid. It is plausible that the fusion and thus only covered part of the gene and sequences the 50 breakpoints of the inserted fragments might be related to telomeric to it. The cases were rare, occurring among more than the presence of the alternative exon 1B of ETV6 in intron 2.48 2000 tested, with an incidence of 0.2%. The 30 breakpoint of the inserted fragment was in cosmid 54D5 Although each of the fusion negative cases had three green in both patients, suggesting a location in intron 5, as in the ETV6 signals at interphase, the mechanisms underlying their majority of cases with ETV6–RUNX1 fusion. formation were different. A duplication of part of the ETV6 gene The apparent rarity of insertions causing ETV6–RUNX1 had occurred in one, a division of the signal into two by an fusions, may, with hindsight, be due to the difficulty in seeing insertion in another and a complex reciprocal translocation in the fusion when the insertions are as small as we have reported the third. However, one signal in each case was produced by here. Tiny reciprocal constitutional insertions required the same 50 cosmid probes of ETV6. In contrast, the second spectral karyotyping (SKY) and aCGH to define them.49 In signals in the two fusion positive cases were the result of similar haematological malignancies with a t(9;22)(q34;q11) or a

Leukemia Disruption of ETV6 in intron 2 in childhood ALL GR Jalali et al 121 t(15;17)(q22;q21) translocation, there were insertions which HPB-ALL cell line, when compared to a series of controls. The were microscopically visible and others which needed FISH upstream RANBP17 and the downstream NPM1 genes were not probes to define them on metaphases.50–52 Very large insertions upregulated. In addition, the fact that it was upregulation of associated with the RUNX1–ETO fusion occurred in B8% of TLX3 that was important was emphasized by the fact that we positive cases and varied between 2 and 44 megabases in were unable to show expression of the translocated fragment of size.38,39 A case that was positive for ETV6–RUNX1 fusion had ETV6. an insertion of most of the short arm of chromosome 12 into We have thus provided unequivocal evidence that the 21q. Thus the interphase FISH pattern of 1R1G1F/2R1G1F did truncated ETV6 gene had an upregulatory function in our case. not suggest anything out of the ordinary. It was only when the Previous examples have pointed in this direction, but here we probes were located on metaphases that the insertion came to have provided the surest proof to date. Upregulation of TLX3 is light, indicating that large insertions can also be missed if cells now known to be central to a significant 20% of T-ALL cases. are only examined at interphase.32 The positioning of the enhancer/promoter sequences of the Most of the reported cases in which the first two exons of ETV6 gene only 165 kb downstream of the promoter of TLX3 in ETV6 were attached to various different partners are single our case must make it the most likely causative agent for the examples. They cover a range of both chronic and acute deregulation of the proto-oncogene. The closest reported myeloid and lymphoid malignancies. The t(3;12)(q26;p13) in example is perhaps the upregulation of the intact CDX2 gene, myeloproliferative disorders involving the MDS1 gene is an which it was suggested, was the result of it having come under exception in that it has been proved to be recurrent. The MDS1 the control of the promoter of ETV6 located in intron 2 of the gene was itself fused to EVI1 while a direct fusion between ETV6 gene. The authors concluded that activation of proto-oncogenes and EVI1 has also been reported in the progression of chronic might be a more common phenomenon in ETV6 associated myelogenous leukaemia to myeloid blast crisis.24,25 Over- leukaemia than was previously thought.30,53 Our case was expression of EVI1 was proved. Other myeloid examples different in that the promoter in intron 2 was deleted, suggesting include a case of myelodysplastic syndrome (MDS) in which that the promoter upstream of exon 1 was the one involved. the fusion partner was the MDS2 gene at 1p36, with In conclusion, this study has added three lymphoid examples upregulation of the 30 flanking gene RPL11.23 The GOT1 gene to the expanding group of cases involving the first two exons of at 10q24 was involved in another case of MDS transforming to the ETV6 gene that have generated both negative and positive AML with upregulation of the upstream c10orf gene. Although explanations as to their significance. On the negative side, as the three cases of AML all had a t(12;13)(p13;q12) with a disrupted ETV6 component of the fusion lacks both its functional domains, ETV6 gene, only one of them showed a direct in-frame fusion a loss of function rather than a dominant effect has been between the second exons of ETV6 and CDX2, respectively. postulated. To counteract this we have been able to provide Both normal and fusion CDX2 transcripts were detected in this overwhelming positive evidence that the promoter region of the patient.30 The ectopic expression of intact CDX2 rather than the gene has induced the ectopic expression of a neighbouring ETV6–CDX2 fusion proved essential for leukaemogenesis.53 proto-oncogene. We have also added two regions of chromo- Reports of lymphoid malignancies include a B-cell precursor some 7 to the number of genomic sites that are probably cell line in which the STL gene at 6q23 was the partner26 and a susceptible to the same truncated sequences of ETV6. The two case of paediatric pre-B ALL, the BAZ2 gene at 12q13.29 Our insertion cases involving breakpoints in intron 2 of the gene are three cases thus add significantly to the lymphoid examples. the first of similar size to be reported in association with ETV6– The breakpoint in chromosome 5 in case 3912 was located RUNX1 fusion. As to whether the frequency of breakpoints in B7 kb downstream of the TLX3 gene, thus leaving it intact. The the second intron of the ETV6 gene is the result of structural or first description of the recurrent t(5;14)(q35;q32) of T-cell ALL biological constraints or merely due to chance is a question that found that most of the breakpoints in chromosome 5 were close still needs to be addressed. and within the RANBP17 gene 10 kb upstream of TLX3, while those in chromosome 14 were widely spread over a 700 kb region downstream of BCL11B. The authors concluded that the Acknowledgements ectopic activation of TLX3 rather than the dysregulation of BCL11B was the important consequence of the translocation.54 We thank Marina Lafage-Pochitaloff and David Grimwade for This explanation was clarified by use of the HPB-ALL cell line helpful discussion and Dr Peter Marynen for the ETV6 cosmid which suggested that the ectopic expression of TLX3 was due to probes. This work was supported by Leukaemia Research UK. elements posited in the 30 region of BCL11B, albeit far 55 downstream of the gene. Variant translocations which References included a recurrent t(5;7)(q35;q21) with the CDK2 gene involved, as well as insertions or deletions of sequences 1 Kobayashi H, Rowley JD. Identification of cytogenetically between the BCL11B and RANBP17/TLX3 loci, all of which undetected 12p13 translocations and associated deletions with resulted in the ectopic expression of TLX3, have provided fluorescence in situ hybridization. Genes Chromosomes Cancer additional support.56 The most recent research using DNAse1 1995; 12: 66–69. hypersensitive experiments identified T-lymphoid restricted cis- 2 Hoglund M, Johansson B, Pedersen-Bjergaard J, Marynen P, Mitelman F. Molecular characterization of 12p abnormalities in transcriptional regulatory elements downstream of BCL11B hematologic malignancies: deletion of KIP1, rearrangement of TEL, which are juxtaposed to the TLX3 locus as a result of the and amplification of CCND2. Blood 1996; 87: 324–330. t(5;14). Thus t(5;14) T-cell ALL provides a novel paradigm for 3 Raynaud SD, Cave H, Baens M, Bastard C, Cacheux V, Grosgeorge oncogene dysregulation.57,58 J et al. The 12;21 translocation involving TEL and deletion of the The T-ALL case which we have presented here showed, other TEL allele: two frequently associated alterations found that as in the recurrent t(5;14)(q35;q32) translocation of T-ALL, in childhood acute lymphoblastic leukemia. Blood 1996; 87: 2891–2899. the end result of the t(5;12)(q35;p13) was the ectopic expression 4 Berger R, Le Coniat M, Daniel M-T, Lessard M, Berthou C, Maryen P of TLX3. We were able to demonstrate that TLX3 was as highly et al. Chromosome abnormalities of the short arm of chromosome upregulated in our patient, as it was in the t(5;14) positive 12 in hematopoietic malignancies: a report including 3 novel

Leukemia Disruption of ETV6 in intron 2 in childhood ALL GR Jalali et al 122 translocations involving the ETV6 gene. Leukemia 1997; 11: myeloid cells and causes myeloid malignancy in mice. Leukemia 1400–1403. 2006; 20: 1582–1592. 5 Takeuchi S, Seriu T, Bartram CR, Golub TR, Reiter A, Miyoshi I 23 Odero MD, Vizmanos JL, Roman JP, Lahortiga I, Panizo C, et al. TEL is one of the targets for deletion on 12p in many cases of Calasanz MJ et al. A novel gene, MDS2, is fused to ETV6/TEL in a childhood B-lineage acute lymphoblastic leukemia. Leukemia t(1;12)(p36.1;p13) in a patient with myelodysplastic syndrome. 1997; 11: 1220–1223. Genes Chromosomes Cancer 2002; 35: 11–19. 6 Sato Y, Bohlander SK, Kobayashi H, Reshmi S, Suto Y, Davis EM 24 Peeters P, Wlodarska I, Baens M, Criel A, Selleslag D, Hagemeijer A et al. Heterogeneity in the breakpoints in balanced rearrangements et al. Fusion of ETV6 to MDS1/EVI1 as a result of t(3;12)(q26;p13) in involving band 12p13 in hematologic malignancies identified by myeloproliferative disorders. Cancer Res 1997; 57: 564–569. fluorescence in situ hybridization: TEL (ETV6) is involved in only 25 Nakamura Y, Nakazato H, Sato Y, Furusawa S, Mitani K. one half. Blood 1997; 90: 4886–4893. Expression of the TEL/EVI1 fusion transcript in a patient with 7 Andreasson P, Johansson B, Billstrom R, Garwicz S, Mitelman F, chronic myelogenous leukemia with t(3;12)(q26;p13). Am J Hoglund M. Fluorescence in situ hybridization analyses of Hematol 2002; 69: 80–82. hematologic malignancies reveal frequent cytogenetically unrec- 26 Suto Y, Sato Y, Smith SD, Rowley JD, Bohlander SK. A ognized 12p rearrangements. Leukemia 1998; 12: 390–400. t(6;12)(q23;p13) results in the fusion of ETV6 to a novel gene, 8 Wlodarska I, La Starza R, Baens M, Dierlamm J, Uyttebroeck A, STL, in a B-cell ALL cell line. Genes Chromosomes Cancer 1997; Selleslag D et al. Fluorescence in situ hybridization characteriza- 18: 254–268. tion of new translocations involving TEL (ETV6) in a wide spectrum 27 Yuji K, Mitani K, Ueno H, Sato Y, Ikawa S, Qiao Y et al. A new of hematologic malignancies. Blood 1998; 91: 1399–1406. partner gene of the TEL/ETV6, AF7p15, cloned in acute myeloid 9 Sato Y, Kobayashi H, Suto Y, Olney HJ, Davis EM, Super HG et al. leukemia with t(7;12)(p15;p13). Blood 2000; 96: 693a (abstract Chromosomal instability in chromosome band 12p13: multiple 2986). breaks leading to complex rearrangements including cytogeneti- 28 Janssen H, Wlodarska I, Mecucci C, Hagemeijer A, Vandenberghe cally undetectable sub-clones. Leukemia 2001; 15: 1193–1202. P, Marynen P et al. Fusion of ETV6 to GOT1 in a case with 10 Odero MD, Carlson K, Calasanz MJ, Lahortiga I, Chinwalla V, myelodysplastic syndrome and t(10;12)(q24;p13). Haematologica Rowley JD. Identification of new translocations involving ETV6 in 2006; 91: 949–951. hematologic malignancies by fluorescence in situ hybridization 29 Panagopoulos I, Strombeck B, Isaksson M, Heldrup J, Olofsson T, and spectral karyotyping. Genes Chromosomes Cancer 2001; 31: Johansson B. Fusion of ETV6 with an intronic sequence of the 134–142. BAZ2A gene in a paediatric pre-B acute lymphoblastic leukaemia 11 Odero MD, Carlson K, Lahortiga I, Calasanz MJ, Rowley JD. with a cryptic chromosome 12 rearrangement. Br J Haematol Molecular cytogenetic characterization of breakpoints in 19 2006; 133: 270–275. patients with hematologic malignancies and 12p unbalanced 30 Chase A, Reiter A, Burci L, Cazzaniga G, Biondi A, Pickard J et al. translocations. Cancer Genet Cytogenet 2003; 142: 115–119. Fusion of ETV6 to the caudal-related homeobox gene CDX2 in 12 Vieira L, Marques B, Cavaleiro C, Ambrosio AP, Jorge M, Neto A acute myeloid leukemia with the t(12;13)(p13;q12). Blood 1999; et al. Molecular cytogenetic characterization of rearrangements 93: 1025–1031. involving 12p in leukemia. Cancer Genet Cytogenet 2005; 157: 31 Reddy KS, Yang X, Mak L, Wang S, Johnston M. A child with ALL 134–139. and ETV6/AML1 fusion on a chromosome 12 due to an insertion 13 Bohlander SK. ETV6: a versatile player in leukemogenesis. Semin of AML1 and loss of ETV6 from the homolog involved in Cancer Biol 2005; 15: 162–174. a t(12;15)(p13;q15). Genes Chromosomes Cancer 2000; 29: 14 Cools J, Mentens N, Odero MD, Peeters P, Wlodarska I, Delforge M 106–109. et al. Evidence for position effects as a variant ETV6-mediated 32 Jalali GR, Martineau M, Ford AM, Greaves M, Stevens RF, Harrison CJ. leukemogenic mechanism in myeloid leukemias with a A unique variant of ETV6/AML1 fusion in a child with acute t(4;12)(q11–q12;p13) or t(5;12)(q31;p13). Blood 2002; 99: lymphoblastic leukemia. Leukemia 2003; 17: 993–995. 1776–1784. 33 Poppe B, Cauwelier B, Van LH, Yigit N, Philippe J, Verhasselt B 15 Beverloo HB, Panagopoulos I, Isaksson M, van Wering E, et al. Novel cryptic chromosomal rearrangements in childhood van Drunen E, de Klein A et al. Fusion of the homeobox gene acute lymphoblastic leukemia detected by multiple color fluor- HLXB9 and the ETV6 gene in infant acute myeloid leukemias with escent in situ hybridization. Haematologica 2005; 90: 1179–1185. the t(7;12)(q36;p13). Cancer Res 2001; 61: 5374–5377. 34 Douet-Guilbert N, Morel F, Le Bris MJ, Herry A, Le Calvez G, 16 Tosi S, Hughes J, Scherer SW, Nakabayashi K, Harbott J, Haas OA Marion V et al. Translocation (12;21) followed by insertion of et al. Heterogeneity of the 7q36 breakpoints in the t(7;12) chromosome 3 material in the derivative chromosome 12 in a case involving ETV6 in infant leukemia. Genes Chromosomes Cancer of childhood acute lymphoblastic leukemia. Cancer Genet 2003; 38: 191–200. Cytogenet 2003; 142: 120–123. 17 von Bergh AR, van DE, van Wering ER, van Zutven LJ, Hainmann I, 35 Mathew S, Shurtleff SA, Raimondi SC. Novel cryptic, complex Lonnerholm G et al. High incidence of t(7;12)(q36;p13) in infant rearrangements involving ETV6-CBFA2 (TEL-AML1) genes identi- AML but not in infant ALL, with a dismal outcome and ectopic fied by fluorescence in situ hybridization in pediatric patients with expression of HLXB9. Genes Chromosomes Cancer 2006; 45: acute lymphoblastic leukemia. Genes Chromosomes Cancer 2001; 731–739. 32: 188–193. 18 Cazzaniga G, Daniotti M, Tosi S, Giudici G, Aloisi A, Pogliani E 36 Andreasson P, Johansson B, Carlsson M, Jarlsfelt I, Fioretos T, et al. The paired box domain gene PAX5 is fused to ETV6/TEL in Mitelman F et al. BCR/ABL-negative chronic myeloid leukemia an acute lymphoblastic leukemia case. Cancer Res 2001; 61: with ETV6/ABL fusion. Genes Chromosomes Cancer 1997; 20: 4666–4670. 299–304. 19 Strehl S, Konig M, Dworzak MN, Kalwak K, Haas OA. PAX5/ETV6 37 Meyer-Monard S, Muhlematter D, Streit A, Chase AJ, Gratwohl A, fusion defines cytogenetic entity dic(9;12)(p13;p13). Leukemia Cross NC et al. Broad molecular screening of an unclassifiable 2003; 17: 1121–1123. myeloproliferative disorder reveals an unexpected ETV6/ABL1 20 Buijs A, Sherr S, van Baal S, van Bezouw S, van der Plas D, fusion transcript. Leukemia 2005; 19: 1096–1099. Geurts van Kessel A et al. Translocation (12;22) (p13;q11) in 38 Gamerdinger U, Teigler-Schlegel A, Pils S, Bruch J, Viehmann S, myeloproliferative disorders results in fusion of the ETS-like TEL Keller M et al. Cryptic chromosomal aberrations leading to an gene on 12p13 to the MN1 gene on 22q11. Oncogene 1995; 10: AML1/ETO rearrangement are frequently caused by small inser- 1511–1519. tions. Genes Chromosomes Cancer 2003; 36: 261–272. 21 Buijs A, Van Rompaey L, Molijn AC, Davis JN, Vertegaal AC, 39 Specchia G, Albano F, Anelli L, Zagaria A, Liso A, La SR et al. Potter MD et al. The MN1-TEL fusion protein, encoded by the Insertions generating the 50RUNX1/30CBFA2T1 gene in acute translocation (12;22)(p13;q11) in myeloid leukemia, is a transcrip- myeloid leukemia cases show variable breakpoints. Genes tion factor with transforming activity. Mol Cell Biol 2000; 20: Chromosomes Cancer 2004; 41: 86–91. 9281–9293. 40 Harrison CJ, Moorman AV, Barber KE, Broadfield ZJ, Cheung KL, 22 Carella C, Bonten J, Rehg J, Grosveld GC. MN1-TEL, the product of Harris RL et al. Interphase molecular cytogenetic screening for the t(12;22) in human myeloid leukemia, immortalizes murine chromosomal abnormalities of prognostic significance in child-

Leukemia Disruption of ETV6 in intron 2 in childhood ALL GR Jalali et al 123 hood acute lymphoblastic leukaemia: a UK Cancer Cytogenetics 51 Grimwade D, Biondi A, Mozziconacci MJ, Hagemeijer A, Berger R, Group Study. Br J Haematol 2005; 129: 520–530. Neat M et al. Characterization of acute promyelocytic leukemia 41 Harrison CJ, Martineau M, Secker-Walker LM. The Leukaemia cases lacking the classic t(15;17): results of the European Working Research Fund/United Kingdom Cancer Cytogenetics Group Party. Groupe Francais de Cytogenetique Hematologique, Groupe Karyotype Database in acute lymphoblastic leukaemia: a valuable de Francais d’Hematologie Cellulaire, UK Cancer Cytogenetics resource for patient management. Br J Haematol 2001; 113: 3–10. Group and BIOMED 1 European Community-Concerted Action 42 ISCN. An International System for Human Cytogenetic Nomen- ‘Molecular Cytogenetic Diagnosis in Haematological Malignan- clature, 1st edn. S. Karger: Basel, 1995. cies’. Blood 2000; 96: 1297–1308. 43 Barrett MT, Scheffer A, Ben-Dor A, Sampas N, Lipson D, Kincaid R 52 Robinson HM, Martineau M, Harris RL, Barber KE, Jalali GR, et al. Comparative genomic hybridization using oligonucleotide Moorman AV et al. Derivative chromosome 9 deletions are a microarrays and total genomic DNA. Proc Natl Acad Sci USA significant feature of childhood Philadelphia chromosome positive 2004; 101: 17765–17770. acute lymphoblastic leukaemia. Leukemia 2005; 19: 564–571. 44 Daser A, Thangavelu M, Pannell R, Forster A, Sparrow L, Chung G 53 Rawat VP, Cusan M, Deshpande A, Hiddemann W, Quintanilla- et al. Interrogation of genomes by molecular copy-number Martinez L, Humphries RK et al. Ectopic expression of the counting (MCC). Nat Methods 2006; 3: 447–453. homeobox gene Cdx2 is the transforming event in a mouse model 45 Willis TG, Jadayel DM, Coignet LJ, Abdul-Rauf M, Treleaven JG, of t(12;13)(p13;q12) acute myeloid leukemia. Proc Natl Acad Sci Catovsky D et al. Rapid molecular cloning of rearrangements of USA 2004; 101: 817–822. the IGHJ locus using long-distance inverse polymerase chain 54 Bernard OA, Busson-LeConiat M, Ballerini P, Mauchauffe M, reaction. Blood 1997; 90: 2456–2464. Della VV, Monni R et al. A new recurrent and specific cryptic 46 Strefford JC, van Delft FW, Robinson HM, Worley H, Yiannikouris O, translocation, t(5;14)(q35;q32), is associated with expression of the Selzer R et al. Complex genomic alterations and gene expression in Hox11L2 gene in T acute lymphoblastic leukemia. Leukemia acute lymphoblastic leukemia with intrachromosomal amplification 2001; 15: 1495–1504. of chromosome 21. Proc Natl Acad Sci USA 2006; 103: 8167–8172. 55 MacLeod RA, Nagel S, Kaufmann M, Janssen JW, Drexler HG. 47 Hosoya N, Sanada M, Nannya Y, Nakazaki K, Wang L, Hangaishi A Activation of HOX11L2 by juxtaposition with 30-BCL11B in an et al. Genomewide screening of DNA copy number changes in acute lymphoblastic leukemia cell line (HPB-ALL) with chronic myelogenous leukemia with the use of high-resolution t(5;14)(q35;q32.2). Genes Chromosomes Cancer 2003; 37: 84–91. array-based comparative genomic hybridization. Genes Chromo- 56 Su XY, Busson M, Della VV, Ballerini P, Dastugue N, Talmant P somes Cancer 2006; 45: 482–494. et al. Various types of rearrangements target TLX3 locus in T-cell 48 Baens M, Peeters P, Guo C, Aerssens J, Marynen P. Genomic acute lymphoblastic leukemia. Genes Chromosomes Cancer 2004; organization of TEL: the human ETS-variant gene 6. Genome Res 41: 243–249. 1996; 6: 404–413. 57 Su XY, la-Valle V, ndre-Schmutz I, Lemercier C, Radford-Weiss I, 49 Matthaei A, Werner W, Gerlach EM, Koerner U, Tinschert S, Nitz I Ballerini P et al. HOX11L2/TLX3 is transcriptionally activated et al. Small reciprocal insertion detected by spectral karyotyping through T-cell regulatory elements downstream of BCL11B as a (SKY) and delimited by array-CGH analysis. Eur J Med Genet 2005; result of the t(5;14)(q35;q32). Blood 2006; 108: 4198–4201. 48: 328–338. 58 Nagel S, Scherr M, Kel A, Hornischer K, Crawford GE, Kaufmann M 50 Aurich J, Dastugue N, Duchayne E, Schlaifer D, Rigal-Huguet F, et al. Activation of TLX3 and NKX2-5 in t(5;14)(q35;q32) T-cell Caballin MR. Location of the BCR-ABL fusion gene on the 9q34 acute lymphoblastic leukemia by remote 30-BCL11B enhancers band in two cases of Ph-positive chronic myeloid leukemia. Genes and coregulation by PU.1 and HMGA1. Cancer Res 2007; 67: Chromosomes Cancer 1997; 20: 148–154. 1461–1471.

Leukemia