Guanine and 7,8-Dihydro-8-Oxo-Guanine-Specific Oxidation in DNA by Chromium(V)

Total Page:16

File Type:pdf, Size:1020Kb

Guanine and 7,8-Dihydro-8-Oxo-Guanine-Specific Oxidation in DNA by Chromium(V) University of Montana ScholarWorks at University of Montana Chemistry and Biochemistry Faculty Publications Chemistry and Biochemistry 10-2002 Guanine and 7,8-Dihydro-8-Oxo-Guanine-Specific Oxidation in DNA by Chromium(V) Kent D. Sugden University of Montana - Missoula, [email protected] Brooke Martin University of Montana - Missoula, [email protected] Follow this and additional works at: https://scholarworks.umt.edu/chem_pubs Part of the Biochemistry Commons, and the Chemistry Commons Let us know how access to this document benefits ou.y Recommended Citation Sugden, Kent D. and Martin, Brooke, "Guanine and 7,8-Dihydro-8-Oxo-Guanine-Specific Oxidation in DNA by Chromium(V)" (2002). Chemistry and Biochemistry Faculty Publications. 22. https://scholarworks.umt.edu/chem_pubs/22 This Article is brought to you for free and open access by the Chemistry and Biochemistry at ScholarWorks at University of Montana. It has been accepted for inclusion in Chemistry and Biochemistry Faculty Publications by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected]. Metals Toxicity Guanine and 7,8-Dihydro-8-Oxo-Guanine–Specific Oxidation in DNA by Chromium(V) Kent D. Sugden and Brooke D. Martin Department of Chemistry, The University of Montana, Missoula, Montana, USA chromate. Cellular data have implied that this The hexavalent oxidation state of chromium [Cr(VI)] is a well-established human carcinogen, pathway is a significant contributor to the although the mechanism of cancer induction is currently unknown. Intracellular reduction of overall mutagenic and carcinogenic potential Cr(VI) forms Cr(V), which is thought to play a fundamental role in the mechanism of DNA dam- of this metal (13). Specifically, the reaction of age by this carcinogen. Two separate pathways of DNA damage, an oxidative pathway and a chromium with the nucleic acid base guanine metal-binding pathway, have been proposed to account for the lesions observed in cell systems. is of interest because of the number of studies We have used a model Cr(V) complex, N,N´-ethylenebis(salicylidene-animato)oxochromium(V) that have indicated a preference for high- [Cr(V)-Salen], to investigate the oxidative pathway of DNA damage and to elucidate the lesions valent chromium to react at this site (14–16). generated from this oxidation process. Reaction of Cr(V)-Salen with synthetic oligonucleotides In this study, we examined the base-speci- produced guanine-specific lesions that were not 8-oxo-2´-deoxyguanosine, based on the inability ficity of oxidation of DNA when reacted with of iridium(IV) to further oxidize these sites. Oxidation products were identified using a 7,8-dihy- a model high-valent chromium(V) complex dro-8-oxo-2´-deoxyguanosine (8-oxo-G) containing oligonucleotide to increase the yields of prod- and have identified candidate lesions formed uct for identification by electrospray ionization mass spectrometry. The guanine-based lesions from this reaction. A profound specificity of observed by mass spectrometry corresponded to the lesions guanidinohydantoin and spiroiminodi- oxidation toward guanine residues within the hydantoin. The effects of these Cr(V)-Salen–induced lesions on DNA replication fidelity was DNA strand was observed. The guanine- assayed using a polymerase-based misincorporation assay. These lesions produced G→T transver- based lesions of guanidinohydantoin (GH) sion mutations and polymerase stops at levels greater than those observed for 8-oxo-G. These data and spiroiminodihydantoin (SH) were identi- suggest a model by which chromate can cause DNA damage leading to mutations and cancer. Key fied when the reactions were carried out using words: chromate, chromium(V), 7,8-dihydro-8-oxo-2´-deoxyguanine, guanidinohydantoin, oxida- a 7,8-dihydro-8-oxo-2´-deoxyguanosine tive damage, spiroiminodihydantoin. Environ Health Perspect 110(suppl 5):725–728 (2002). (8-oxo-G)–containing oligonucleotide. The http://ehpnet1.niehs.nih.gov/docs/2002/suppl-5/725-728sudgen/abstract.html impact that these modified guanine lesions have on mutations was determined using a polymerase stop assay. Significant levels of Exposure of cellular systems to the human process, and the variety of lesions observed G→T transversions and polymerase stops carcinogen chromate [Cr(VI)] results in a upon cellular treatment with this metal. were observed. wide variety of DNA lesions. Some of the The endogenous reductant responsible for lesions formed from chromate treatment are activation of chromate toward DNA damage Materials and Methods strand breaks, nucleic acid base modifica- in cellular systems continues to be a con- Cr(V) Synthesis tions, DNA interstrand and intrastrand cross- tentious issue. Various cellular reductants such links, and DNA–protein cross-links (1–4). as glutathione, ascorbate, NADPH and cys- N,N´-ethylenebis(salicylidene-animato) Although these lesions have been demon- teine have all been observed to reduce chro- oxochromium(V), or Cr(V)-Salen was syn- strated in a variety of cellular and noncellular mate in vitro and in vivo (8–10). These thesized in the trivalent oxidation state as the systems, little is known about the fundamen- reduction pathways form the highly reactive hexafluorophosphate salt, followed by oxida- tal mechanism of interaction between chro- Cr(V) oxidation state, although many also tion to the pentavalent form with iodosylben- mate and DNA that give rise to the specific form radical species. It is the confounding co- zene (17). The structure was confirmed by lesions formed from this reaction. With few generation of radical species that has led to the UV-visible spectroscopy and electron spin exceptions (5), biomarkers corresponding to different mechanistic descriptions for DNA resonance spectroscopy. specific lesions derived from chromate expo- damage by chromate. However, it has recently sure have not been adequately described. been shown that many types of DNA damage Cr(V) Reactions with DNA Chromate is unidirectionally accumulated and markers of oxidative stress can also be Unmodified oligonucleotides used for this into cells by active transport through anion formed through a direct oxidation mechanism study were synthesized using standard auto- channels on the basis of its structural similar- involving transient high-valent oxidation mated solid-state methods. The 8-oxo-G con- ity to sulfate and phosphate (6). Once inter- states of chromium such as Cr(V) (11,12). taining oligonucleotide was synthesized by nalized, chromate is reduced by endogenous A broad mechanistic description of DNA Trilink Biotechnology Inc. (San Diego, CA, cellular reductants to form a variety of poten- damage from chromate exposure has postu- USA). Oligonucleotides used in these studies tial DNA-damaging species, including the lated a bifurcated pathway whereby various were based on the 25-mer oligo sequence highly reactive Cr(V) oxidation state of the DNA-damaging species result from either an metal and oxygen-, carbon-, or sulfur-cen- oxidative pathway or a metal-binding path- This article is part of the monograph Molecular tered radical species (7). The final stable state way. The oxidative pathway would account Mechanisms of Metal Toxicity and Carcinogenicity. of chromium intracellularly is Cr(III), and for the frank strand breaks, abasic sites, and Address correspondence to K.D. Sugden, Dept. of this oxidation state may also play a role in the base modifications observed with this car- Chemistry, University of Montana, 32 Campus Dr., DNA damage associated with the metal. cinogen, whereas the metal-binding pathway Missoula, MT 59812 USA. Telephone: (406) 243- A confounding factor in the determina- would account for the interstrand and intra- 4193. Fax: (406) 243-4227. E-mail: sugden@sel- way.umt.edu tion of a mechanism(s) of DNA damage by strand cross-linking and the DNA–protein Funding for this study was provided by National chromate is the large number of potential cel- cross-linking observed for chromate. Institute of Environmental Health Sciences grant lular reductants, the associated myriad oxidiz- Our interest has focused primarily on ES10437 awarded to K.D.S. ing species formed during the reduction the oxidative pathway of DNA damage by Received 28 January 2002; accepted 20 May 2002. Environmental Health Perspectives • VOLUME 110 | SUPPLEMENT 5 | OCTOBER 2002 725 Metals Toxicity • Sudgen and Martin 5´-d[ATGGCGTAATCATXGTCATAGCT 50 µM Cr(V)-Salen as described above. The Cr(V)-Salen complex with an oligonucleotide GT]-3´, where X at position G14 is either primer extension assay was run directly after incorporating the oxidatively labile 8-oxo-G 8-oxo-G or the unmodified G base. removal of chromium through a NENSORB group, the putative intermediate in the forma- Purification of the oligonucleotides prior to purification cartridge, or the products of the tion of further oxidized guanine lesions. reaction and after oxidation with Cr(V)-Salen oxidation were separated and purified by was accomplished by high-performance liquid HPLC as discussed above. The modified Reaction of Cr(V) with 8-Oxo-G– chromatography (HPLC) using a Dionex oligonucleotide was lyophilized to dryness and Modified Oligonucleotides Nucleopac PA-100 4 × 250-mm anion- redissolved in 10 µL 10.0 mM Tris-HCl (pH Reaction of Cr(V)-Salen was carried out with a exchange column (Dionex Corp., Sunnyvale, 7.5) containing 5.0 mM MgCl2 and 7.5 mM modified oligonucleotide identical to that used CA, USA). dithiothreitol. A 5´-32P-labeled primer with in Figure 1, with the exception that the gua- Reactions between 50–250 µM Cr(V)- the template complementary sequence of nine at position 14 was substituted with an 8- Salen and 10–100 µM oligonucleotide were 5´-d[TGATAGCACTGATATACCGA]-3´ oxo-G. The reaction was carried out with carried out in 10 mM sodium phosphate was added at a template/primer ratio of 9:1 50–250 µM Cr(V)-Salen and yielded base-spe- buffer (pH 6.0–7.0) in 100-µL volumes. and annealed by heating to 90°C for 5 min, cific oxidation at the site of modification on Reactions were allowed to proceed at room followed by slow cooling to room temperature the DNA (Figure 2; lanes 2–4).
Recommended publications
  • The Two Faces of the Guanyl Radical: Molecular Context and Behavior
    molecules Review The Two Faces of the Guanyl Radical: Molecular Context and Behavior Chryssostomos Chatgilialoglu 1,2 1 ISOF, Consiglio Nazionale delle Ricerche, 40129 Bologna, Italy; [email protected]; Tel.: +39-051-6398309 2 Center of Advanced Technologies, Adam Mickiewicz University, 61-712 Pozna´n,Poland Abstract: The guanyl radical or neutral guanine radical G(-H)• results from the loss of a hydrogen atom (H•) or an electron/proton (e–/H+) couple from the guanine structures (G). The guanyl radical exists in two tautomeric forms. As the modes of formation of the two tautomers, their relationship and reactivity at the nucleoside level are subjects of intense research and are discussed in a holistic manner, including time-resolved spectroscopies, product studies, and relevant theoretical calculations. Particular attention is given to the one-electron oxidation of the GC pair and the complex mechanism of the deprotonation vs. hydration step of GC•+ pair. The role of the two G(-H)• tautomers in single- and double-stranded oligonucleotides and the G-quadruplex, the supramolecular arrangement that attracts interest for its biological consequences, are considered. The importance of biomarkers of guanine DNA damage is also addressed. Keywords: guanine; guanyl radical; tautomerism; guanine radical cation; oligonucleotides; DNA; G-quadruplex; time-resolved spectroscopies; reactive oxygen species (ROS); oxidation 1. The Guanine Sink Citation: Chatgilialoglu, C. The Two The free radical chemistry associated with guanine (Gua) and its derivatives, guano- Faces of the Guanyl Radical: sine (Guo), 2’-deoxyguanosine (dGuo), guanosine-50-monophosphate (GMP), and 20- Molecular Context and Behavior. deoxyguanosine-50-monophosphate (dGMP), is of particular interest due to its biological Molecules 2021, 26, 3511.
    [Show full text]
  • Tautomerization-Dependent Recognition and Excision of Oxidation Damage in Base-Excision DNA Repair
    Tautomerization-dependent recognition and excision of oxidation damage in base-excision DNA repair Chenxu Zhua,1, Lining Lua,1, Jun Zhangb,c,1, Zongwei Yuea, Jinghui Songa, Shuai Zonga, Menghao Liua,d, Olivia Stoviceke, Yi Qin Gaob,c,2, and Chengqi Yia,d,f,2 aState Key Laboratory of Protein and Plant Gene Research, School of Life Sciences, Peking University, Beijing 100871, China; bInstitute of Theoretical and Computational Chemistry, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871, China; cBiodynamic Optical Imaging Center, Peking University, Beijing 100871, China; dPeking-Tsinghua Center for Life Sciences, Peking University, Beijing 100871, China; eUniversity of Chicago, Chicago, IL 60637; and fSynthetic and Functional Biomolecules Center, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871, China Edited by Suse Broyde, New York University, New York, NY, and accepted by Editorial Board Member Dinshaw J. Patel June 1, 2016 (received for review March 29, 2016) NEIL1 (Nei-like 1) is a DNA repair glycosylase guarding the mamma- (FapyA and FapyG), spiroiminodihydantoin (Sp), and guanidino- lian genome against oxidized DNA bases. As the first enzymes in hydantoin (Gh) (23–27). Among these lesions, Tg is the most the base-excision repair pathway, glycosylases must recognize common pyrimidine base modification produced under oxidative the cognate substrates and catalyze their excision. Here we stress and ionizing radiation (28)—arising from oxidation of thy- present crystal structures of human NEIL1 bound to a range of mine and 5-methylcytosine—and is also a preferred substrate of duplex DNA. Together with computational and biochemical NEIL1 (3).
    [Show full text]
  • The Role of Oxidative Stress in Alzheimer's Disease Robin Petroze University of Kentucky
    Kaleidoscope Volume 2 Article 15 2003 The Role of Oxidative Stress in Alzheimer's Disease Robin Petroze University of Kentucky Follow this and additional works at: https://uknowledge.uky.edu/kaleidoscope Part of the Medical Biochemistry Commons Right click to open a feedback form in a new tab to let us know how this document benefits you. Recommended Citation Petroze, Robin (2003) "The Role of Oxidative Stress in Alzheimer's Disease," Kaleidoscope: Vol. 2, Article 15. Available at: https://uknowledge.uky.edu/kaleidoscope/vol2/iss1/15 This Beckman Scholars Program is brought to you for free and open access by the The Office of Undergraduate Research at UKnowledge. It has been accepted for inclusion in Kaleidoscope by an authorized editor of UKnowledge. For more information, please contact [email protected]. BECKMAN ScHOLARS PROGRAM Abstract Over four million individuals in the United States currently suffer from Alzheimer's disease (AD), a devastating disorder of progressive dementia. Within the next several decades, AD is expected to affect over 22 million people globally. AD can only be definitively diagnosed by postmortem exami­ nation. Thus, investigation into the specific patho­ genesis of neuronal degeneration and death in AD on a biochemical level is essential for both earlier diagnosis and potential treatment and prevention options. Overproduction of amyloid [3-peptide (A[3) in the brain leads to both free radical oxidative stress and toxicity to neurons in AD. My under­ graduate biochemical studies with regard to AD explore the various ways in which free radical oxi­ dative stress might contribute to the pathology of AD.
    [Show full text]
  • Evidence for Dna Oxidation in Single Molecule Fluorescence
    EVIDENCE FOR DNA OXIDATION IN SINGLE MOLECULE FLUORESCENCE STUDIES A thesis presented to the faculty of the College of Arts and Sciences of Ohio University In partial fulfillment of the requirements for the degree Master of Science Douglas Wylie August 2006 This thesis entitled EVIDENCE FOR DNA OXIDATION IN SINGLE MOLECULE FLUORESCENCE STUDIES by DOUGLAS WYLIE has been approved for the Department of Physics and Astronomy and the College of Arts and Sciences by Ido Braslavsky Assistant Professor of Physics and Astronomy Benjamin M. Ogles Dean, College of Arts and Sciences WYLIE, DOUGLAS, M.S., August 2006. Physics and Astronomy EVIDENCE FOR DNA OXIDATION IN SINGLE MOLECULE FLUORESCENCE STUDIES (103 pp.) Director of Thesis: Ido Braslavsky Single molecule fluorescence microscopy is a powerful tool to investigate local environments at the nanometer scale. Oxidation of DNA is an important problem that leads to DNA mutations. In this project, single molecule fluorescence measurements were used to study the interaction between covalently bound nucleotides (dNTP) and fluorophores (Cyanine dye), dNTP-Cy3 that have been incorporated into DNA. By tracing changes in the fluorescence signal, evidence for single events of DNA oxidation were found that could otherwise not be observed at the ensemble level. The differences between the nucleotides and their quenching properties are shown here especially guanine’s ability to temporarily quench the fluorescence of Cy3 completely. After some illumination time, the quenching of the dye by the guanine changes dramatically. We interpret this change to possible oxidation of the guanine base. This work could lead to a method for monitoring and investigating important DNA oxidation processes which are essential to Genomic and Cancer research.
    [Show full text]
  • Dna Glycosylases Remove Oxidized Base Damages from G-Quadruplex Dna Structures Jia Zhou University of Vermont
    University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2015 Dna Glycosylases Remove Oxidized Base Damages From G-Quadruplex Dna Structures Jia Zhou University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Biochemistry Commons, and the Molecular Biology Commons Recommended Citation Zhou, Jia, "Dna Glycosylases Remove Oxidized Base Damages From G-Quadruplex Dna Structures" (2015). Graduate College Dissertations and Theses. 529. https://scholarworks.uvm.edu/graddis/529 This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. DNA GLYCOSYLASES REMOVE OXIDIZED BASE DAMAGES FROM G-QUADRUPLEX DNA STRUCTURES A Dissertation Presented by Jia Zhou to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Specializing in Microbiology and Molecular Genetics May, 2015 Defense Date: March 16, 2015 Dissertation Examination Committee: Susan S. Wallace, Ph.D., Advisor Robert J. Kelm, Jr., Ph.D., Chairperson David S. Pederson, Ph.D. Mercedes Rincon, Ph.D. Markus Thali, Ph.D. Cynthia J. Forehand, Ph.D., Dean of the Graduate College ABSTRACT The G-quadruplex DNA is a four-stranded DNA structure that is highly susceptible to oxidation due to its G-rich sequence and its structure. Oxidative DNA base damages can be mutagenic or lethal to cells if they are left unrepaired.
    [Show full text]
  • Excision of Oxidatively Generated Guanine Lesions by Competitive DNA Repair Pathways
    International Journal of Molecular Sciences Review Excision of Oxidatively Generated Guanine Lesions by Competitive DNA Repair Pathways Vladimir Shafirovich * and Nicholas E. Geacintov Chemistry Department, New York University, New York, NY 10003-5180, USA; [email protected] * Correspondence: [email protected] Abstract: The base and nucleotide excision repair pathways (BER and NER, respectively) are two major mechanisms that remove DNA lesions formed by the reactions of genotoxic intermediates with cellular DNA. It is generally believed that small non-bulky oxidatively generated DNA base modifi- cations are removed by BER pathways, whereas DNA helix-distorting bulky lesions derived from the attack of chemical carcinogens or UV irradiation are repaired by the NER machinery. However, existing and growing experimental evidence indicates that oxidatively generated DNA lesions can be repaired by competitive BER and NER pathways in human cell extracts and intact human cells. Here, we focus on the interplay and competition of BER and NER pathways in excising oxidatively generated guanine lesions site-specifically positioned in plasmid DNA templates constructed by a gapped-vector technology. These experiments demonstrate a significant enhancement of the NER yields in covalently closed circular DNA plasmids (relative to the same, but linearized form of the same plasmid) harboring certain oxidatively generated guanine lesions. The interplay between the BER and NER pathways that remove oxidatively generated guanine lesions are reviewed and discussed in terms of competitive binding of the BER proteins and the DNA damage-sensing NER Citation: Shafirovich, V.; Geacintov, factor XPC-RAD23B to these lesions. N.E. Excision of Oxidatively Generated Guanine Lesions by Keywords: DNA damage; base excision repair; nucleotide excision repair; oxidative stress; reactive Competitive DNA Repair Pathways.
    [Show full text]
  • Genome-Wide Mapping of Oxidative DNA Damage Via Engineering of 8
    Communication Cite This: Biochemistry 2020, 59, 85−89 pubs.acs.org/biochemistry Genome-Wide Mapping of Oxidative DNA Damage via Engineering of 8‑Oxoguanine DNA Glycosylase † † ‡ § Yuxin Fang and Peng Zou*, , , † College of Chemistry and Molecular Engineering, Synthetic and Functional Biomolecules Center, Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Peking University, Beijing 100871, China ‡ Peking-Tsinghua Center for Life Sciences, Peking University, Beijing 100871, China § PKU-IDG/McGovern Institute for Brain Research, Peking University, Beijing 100871, China *S Supporting Information the binding affinity of antibodies was often impaired by the ABSTRACT: The occurrence of 8-oxo-7,8-dihydrogua- presence of DNA secondary structures, a chemical profiling nine (OG) in the genome, as one of the major DNA approach was developed, where OG was oxidatively con- oxidative damages, has been implicated in an array of jugated with a biotinylated amine probe, enriched via affinity biological processes, ranging from mutagenesis to tran- purification, and sequenced (OG-Seq).12 Alternatively, oxi- scriptional regulation. Genome-wide mapping of oxidative dized DNA fragments could be enriched by a locator code damages could shed light on the underlying cellular inserted through a combination of in vitro base excision repair mechanism. In the present study, we engineered the (BER) and click reaction (click-code-seq).13 While all of these hOGG1 enzyme, a primary 8-oxoguanine DNA glyco- techniques offer valuable information on the genomic sylase, into a guanine oxidation-profiling tool. Our distribution of DNA oxidative damages, some of their method, called enTRAP-seq, successfully identified more conclusions contradict with each other.
    [Show full text]
  • G-Quadruplex–Forming Promoter Sequences Enable Transcriptional Activation in Response to Oxidative Stress
    COMMENTARY G-quadruplex–formingpromotersequencesenable transcriptional activation in response to COMMENTARY oxidative stress Bogdan I. Fedelesa,b,1 Oxidative DNA damage is an implacable conse- area of extremely active research (12–16). Although quence of aerobic metabolism and often exacerbated G4 structures were initially described in the context in inflammatory processes that use reactive oxygen of telomeres, recent genomic data revealed tens of species (ROS) both as signaling molecules and as thousands of sequences throughout the genome chemical warfare against pathogens. An extensive (14, 17) that, in principle, could form G4 structures, body of work, recently reviewed in ref. 1, has high- called potential G-quadruplex–forming sequences lighted the deleterious consequences of oxidative (PQS). Many of these sequences, when folded as DNA damage, which involves oxidized nucleobases G4s, can bind with high-affinity cellular proteins or that, if left unrepaired, are either mutagenic or strong transcription factors (16), but the relevance and phys- replication blockers. Most oxidative DNA damage is iological role of such interactions are still actively in- efficiently processed by DNA repair pathways, primar- vestigated. In PNAS, Fleming et al. advance the ily base excision repair (BER), the molecular details of hypothesis that a subset of these PQS can function which are generally well understood (2). However, an as sensors of oxidative stress (8). Using the VEGF PQS emerging area of research posits that certain oxidative sequence as a model, the authors provide a mechanistic DNA lesions and their associated repair complexes connection between two previously known, but seem- are intermediates in a signaling transduction cascade ingly disparate characteristics of the VEGF promoter: that uses ROS as secondary messengers to ultimately (i) oxidative lesions (i.e., OG) in the promoter region effect transcriptional regulation (3–7).
    [Show full text]
  • DNA Base Excision Repair: Mutation Induction and Novel Functions
    DNA Base Excision Repair: Mutation Induction and Novel Functions by Izaskun Muruzábal-Lecumberri Thesis submitted in fulfillment of the requirements for the degree of PHILOSOPHIAE DOCTOR (PhD) Faculty of Science and Technology Department for Mathematics and Natural Sciences Centre for Organelle Research (CORE) 2015 University of Stavanger N-4036 Stavanger NORWAY www.uis.no © 2015 Izaskun Muruzábal-Lecumberri ISBN: 978-82-7644-608-1 ISSN: 1890-1387 PhD thesis no. 258 Abstract DNA is susceptible to chemical modifications corrupting its cellular information processing function, necessitating correction of such modifications. Cells are formed mostly by water – giving rise to hydrolytic reactions – and aerobic metabolism is a source of reactive oxygen species (ROS) – causing oxidation. Deamination of cytosine to uracil is an example of the former and oxidation of thymine to 5-formyluracil (f5U) is an example of the latter. In order to avoid the incorporation of wrong nucleosides into DNA, f5U must be eliminated and substituted by the correct base. The main mechanism for the repair of f5U is the base excision repair (BER) pathway, in which specific glycosylases recognize the damage and excise it from its ribose residue. Several glycosylases have been found to be involved in the repair of f5U in Escherichia coli, where 3-methyladenine DNA glycosylase II (AlkA) may be the most important. However, here we present evidence to indicate that the nucleotide excision repair protein UvrA is also involved in the repair of f5U, although the mechanism has yet to be elucidated. Interestingly, we have found that the AlkA glycosylase, in addition to alleviating is also able to promote mutation induction by 5-formyldeoxyuridine in E.
    [Show full text]
  • Repair and Effects of the 8-Oxog Lesion in Dna
    University of Montana ScholarWorks at University of Montana Graduate Student Theses, Dissertations, & Professional Papers Graduate School 2007 REPAIR AND EFFECTS OF THE 8-OXOG LESION IN DNA James Joseph Covino The University of Montana Follow this and additional works at: https://scholarworks.umt.edu/etd Let us know how access to this document benefits ou.y Recommended Citation Covino, James Joseph, "REPAIR AND EFFECTS OF THE 8-OXOG LESION IN DNA" (2007). Graduate Student Theses, Dissertations, & Professional Papers. 823. https://scholarworks.umt.edu/etd/823 This Thesis is brought to you for free and open access by the Graduate School at ScholarWorks at University of Montana. It has been accepted for inclusion in Graduate Student Theses, Dissertations, & Professional Papers by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected]. REPAIR AND EFFECTS OF THE 8-OXOG LESION IN DNA by James Joseph Covino II B.S. Chemistry, The University of Mary Washington, 2003 Thesis Presented in partial fulfillment of the requirements for the degree of Masters of Science in Chemistry The University of Montana Missoula, MT Autumn 2007 Approved by: Dr. David A. Strobel, Dean Graduate School Kent D. Sugden, Chair Department of Chemistry Brooke Martin Department of Chemistry Holly Thompson Department of Chemistry Nigel Priestly Department of Chemistry Fernando Cardozo Center for Environmental Health Sciences Covino, James J., M.S. November 2007 Chemistry Repair and Effects of the 8-oxoG Lesion in DNA Chairperson: Kent D. Sugden Eukaryotic DNA is packaged in a condensed state with histone proteins. The minimal structural unit within packaged eukaryotic DNA is the nucleosome core particle (NCP).
    [Show full text]
  • Mechanisms and Dynamics of Oxidative DNA Damage Repair in Nucleosomes Wendy J
    University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2016 Mechanisms and Dynamics of Oxidative DNA Damage Repair in Nucleosomes Wendy J. Cannan University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Biochemistry Commons, Genetics and Genomics Commons, and the Molecular Biology Commons Recommended Citation Cannan, Wendy J., "Mechanisms and Dynamics of Oxidative DNA Damage Repair in Nucleosomes" (2016). Graduate College Dissertations and Theses. 628. https://scholarworks.uvm.edu/graddis/628 This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. MECHANISMS AND DYNAMICS OF OXIDATIVE DNA DAMAGE REPAIR IN NUCLEOSOMES A Dissertation Presented by Wendy Cannan to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Specializing in Microbiology and Molecular Genetics October, 2016 Defense Date: June 22, 2016 Dissertation Examination Committee: David S. Pederson, Ph.D., Advisor Stephen Everse, Ph.D., Chairperson Sylvie Doublié, Ph.D. Scott Morrical, Ph.D. Susan Wallace, Ph.D. Cynthia J. Forehand, Ph.D., Dean of the Graduate College ABSTRACT DNA provides the blueprint for cell function and growth, as well as ensuring continuity from one cell generation to the next. In order to compact, protect, and regulate this vital information, DNA is packaged by histone proteins into nucleosomes, which are the fundamental subunits of chromatin.
    [Show full text]
  • Oxidative Stress and DNA Damage in Chronic Disease and Environmental Studies
    International Journal of Molecular Sciences Editorial Oxidative Stress and DNA Damage in Chronic Disease and Environmental Studies Marco Peluso 1,* , Valentina Russo 1, Tommaso Mello 2 and Andrea Galli 2 1 Research Branch, Regional Cancer Prevention Laboratory, ISPRO-Study, Prevention and Oncology Network Institute, 50139 Florence, Italy; [email protected] 2 Department of Experimental and Clinical Biomedical Sciences, University of Florence, 50139 Florence, Italy; tommaso.mello@unifi.it (T.M.); [email protected]fi.it (A.G.) * Correspondence: [email protected] Received: 11 September 2020; Accepted: 18 September 2020; Published: 21 September 2020 Humans are continually exposed to a large number of environmental carcinogens [1], some of them share a specific toxicity model which acts via the enhancement of cellular levels of reactive oxygen species (ROS), such as superoxide anion and hydroxyl radicals [2]. ROS are chemicals capable of inducing oxidative stress, a condition where free radical generation overwhelms antioxidant protection in the body’s cells, causing oxidative damage of proteins, lipids and nucleic acids [2]. One biological consequence is the decline in physiological mechanisms designed to maintain cell repair and metabolic homeostasis, which can lead to tissue injury and cell transformation [3]. Oversensitive reactions to endogenous and extrinsic agents are associated with phenotypes characterized by elevated levels of genetic alterations [4,5], a process that can initiate carcinogenesis [6]. From a general perspective, the study of these factors can be useful to develop personalized medicine and to fill the knowledge gap of the molecular mechanisms behind the pathogenesis of chronic diseases. In this context, the current Special Issue’s challenge is to provide an overview on the topic of ROS, oxidative DNA damage and related-DNA repair factors in chronic diseases and environmental studies.
    [Show full text]