University of Montana ScholarWorks at University of Montana Chemistry and Biochemistry Faculty Publications Chemistry and Biochemistry 10-2002 Guanine and 7,8-Dihydro-8-Oxo-Guanine-Specific Oxidation in DNA by Chromium(V) Kent D. Sugden University of Montana - Missoula, [email protected] Brooke Martin University of Montana - Missoula, [email protected] Follow this and additional works at: https://scholarworks.umt.edu/chem_pubs Part of the Biochemistry Commons, and the Chemistry Commons Let us know how access to this document benefits ou.y Recommended Citation Sugden, Kent D. and Martin, Brooke, "Guanine and 7,8-Dihydro-8-Oxo-Guanine-Specific Oxidation in DNA by Chromium(V)" (2002). Chemistry and Biochemistry Faculty Publications. 22. https://scholarworks.umt.edu/chem_pubs/22 This Article is brought to you for free and open access by the Chemistry and Biochemistry at ScholarWorks at University of Montana. It has been accepted for inclusion in Chemistry and Biochemistry Faculty Publications by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected]. Metals Toxicity Guanine and 7,8-Dihydro-8-Oxo-Guanine–Specific Oxidation in DNA by Chromium(V) Kent D. Sugden and Brooke D. Martin Department of Chemistry, The University of Montana, Missoula, Montana, USA chromate. Cellular data have implied that this The hexavalent oxidation state of chromium [Cr(VI)] is a well-established human carcinogen, pathway is a significant contributor to the although the mechanism of cancer induction is currently unknown. Intracellular reduction of overall mutagenic and carcinogenic potential Cr(VI) forms Cr(V), which is thought to play a fundamental role in the mechanism of DNA dam- of this metal (13). Specifically, the reaction of age by this carcinogen. Two separate pathways of DNA damage, an oxidative pathway and a chromium with the nucleic acid base guanine metal-binding pathway, have been proposed to account for the lesions observed in cell systems. is of interest because of the number of studies We have used a model Cr(V) complex, N,N´-ethylenebis(salicylidene-animato)oxochromium(V) that have indicated a preference for high- [Cr(V)-Salen], to investigate the oxidative pathway of DNA damage and to elucidate the lesions valent chromium to react at this site (14–16). generated from this oxidation process. Reaction of Cr(V)-Salen with synthetic oligonucleotides In this study, we examined the base-speci- produced guanine-specific lesions that were not 8-oxo-2´-deoxyguanosine, based on the inability ficity of oxidation of DNA when reacted with of iridium(IV) to further oxidize these sites. Oxidation products were identified using a 7,8-dihy- a model high-valent chromium(V) complex dro-8-oxo-2´-deoxyguanosine (8-oxo-G) containing oligonucleotide to increase the yields of prod- and have identified candidate lesions formed uct for identification by electrospray ionization mass spectrometry. The guanine-based lesions from this reaction. A profound specificity of observed by mass spectrometry corresponded to the lesions guanidinohydantoin and spiroiminodi- oxidation toward guanine residues within the hydantoin. The effects of these Cr(V)-Salen–induced lesions on DNA replication fidelity was DNA strand was observed. The guanine- assayed using a polymerase-based misincorporation assay. These lesions produced G→T transver- based lesions of guanidinohydantoin (GH) sion mutations and polymerase stops at levels greater than those observed for 8-oxo-G. These data and spiroiminodihydantoin (SH) were identi- suggest a model by which chromate can cause DNA damage leading to mutations and cancer. Key fied when the reactions were carried out using words: chromate, chromium(V), 7,8-dihydro-8-oxo-2´-deoxyguanine, guanidinohydantoin, oxida- a 7,8-dihydro-8-oxo-2´-deoxyguanosine tive damage, spiroiminodihydantoin. Environ Health Perspect 110(suppl 5):725–728 (2002). (8-oxo-G)–containing oligonucleotide. The http://ehpnet1.niehs.nih.gov/docs/2002/suppl-5/725-728sudgen/abstract.html impact that these modified guanine lesions have on mutations was determined using a polymerase stop assay. Significant levels of Exposure of cellular systems to the human process, and the variety of lesions observed G→T transversions and polymerase stops carcinogen chromate [Cr(VI)] results in a upon cellular treatment with this metal. were observed. wide variety of DNA lesions. Some of the The endogenous reductant responsible for lesions formed from chromate treatment are activation of chromate toward DNA damage Materials and Methods strand breaks, nucleic acid base modifica- in cellular systems continues to be a con- Cr(V) Synthesis tions, DNA interstrand and intrastrand cross- tentious issue. Various cellular reductants such links, and DNA–protein cross-links (1–4). as glutathione, ascorbate, NADPH and cys- N,N´-ethylenebis(salicylidene-animato) Although these lesions have been demon- teine have all been observed to reduce chro- oxochromium(V), or Cr(V)-Salen was syn- strated in a variety of cellular and noncellular mate in vitro and in vivo (8–10). These thesized in the trivalent oxidation state as the systems, little is known about the fundamen- reduction pathways form the highly reactive hexafluorophosphate salt, followed by oxida- tal mechanism of interaction between chro- Cr(V) oxidation state, although many also tion to the pentavalent form with iodosylben- mate and DNA that give rise to the specific form radical species. It is the confounding co- zene (17). The structure was confirmed by lesions formed from this reaction. With few generation of radical species that has led to the UV-visible spectroscopy and electron spin exceptions (5), biomarkers corresponding to different mechanistic descriptions for DNA resonance spectroscopy. specific lesions derived from chromate expo- damage by chromate. However, it has recently sure have not been adequately described. been shown that many types of DNA damage Cr(V) Reactions with DNA Chromate is unidirectionally accumulated and markers of oxidative stress can also be Unmodified oligonucleotides used for this into cells by active transport through anion formed through a direct oxidation mechanism study were synthesized using standard auto- channels on the basis of its structural similar- involving transient high-valent oxidation mated solid-state methods. The 8-oxo-G con- ity to sulfate and phosphate (6). Once inter- states of chromium such as Cr(V) (11,12). taining oligonucleotide was synthesized by nalized, chromate is reduced by endogenous A broad mechanistic description of DNA Trilink Biotechnology Inc. (San Diego, CA, cellular reductants to form a variety of poten- damage from chromate exposure has postu- USA). Oligonucleotides used in these studies tial DNA-damaging species, including the lated a bifurcated pathway whereby various were based on the 25-mer oligo sequence highly reactive Cr(V) oxidation state of the DNA-damaging species result from either an metal and oxygen-, carbon-, or sulfur-cen- oxidative pathway or a metal-binding path- This article is part of the monograph Molecular tered radical species (7). The final stable state way. The oxidative pathway would account Mechanisms of Metal Toxicity and Carcinogenicity. of chromium intracellularly is Cr(III), and for the frank strand breaks, abasic sites, and Address correspondence to K.D. Sugden, Dept. of this oxidation state may also play a role in the base modifications observed with this car- Chemistry, University of Montana, 32 Campus Dr., DNA damage associated with the metal. cinogen, whereas the metal-binding pathway Missoula, MT 59812 USA. Telephone: (406) 243- A confounding factor in the determina- would account for the interstrand and intra- 4193. Fax: (406) 243-4227. E-mail: sugden@sel- way.umt.edu tion of a mechanism(s) of DNA damage by strand cross-linking and the DNA–protein Funding for this study was provided by National chromate is the large number of potential cel- cross-linking observed for chromate. Institute of Environmental Health Sciences grant lular reductants, the associated myriad oxidiz- Our interest has focused primarily on ES10437 awarded to K.D.S. ing species formed during the reduction the oxidative pathway of DNA damage by Received 28 January 2002; accepted 20 May 2002. Environmental Health Perspectives • VOLUME 110 | SUPPLEMENT 5 | OCTOBER 2002 725 Metals Toxicity • Sudgen and Martin 5´-d[ATGGCGTAATCATXGTCATAGCT 50 µM Cr(V)-Salen as described above. The Cr(V)-Salen complex with an oligonucleotide GT]-3´, where X at position G14 is either primer extension assay was run directly after incorporating the oxidatively labile 8-oxo-G 8-oxo-G or the unmodified G base. removal of chromium through a NENSORB group, the putative intermediate in the forma- Purification of the oligonucleotides prior to purification cartridge, or the products of the tion of further oxidized guanine lesions. reaction and after oxidation with Cr(V)-Salen oxidation were separated and purified by was accomplished by high-performance liquid HPLC as discussed above. The modified Reaction of Cr(V) with 8-Oxo-G– chromatography (HPLC) using a Dionex oligonucleotide was lyophilized to dryness and Modified Oligonucleotides Nucleopac PA-100 4 × 250-mm anion- redissolved in 10 µL 10.0 mM Tris-HCl (pH Reaction of Cr(V)-Salen was carried out with a exchange column (Dionex Corp., Sunnyvale, 7.5) containing 5.0 mM MgCl2 and 7.5 mM modified oligonucleotide identical to that used CA, USA). dithiothreitol. A 5´-32P-labeled primer with in Figure 1, with the exception that the gua- Reactions between 50–250 µM Cr(V)- the template complementary sequence of nine at position 14 was substituted with an 8- Salen and 10–100 µM oligonucleotide were 5´-d[TGATAGCACTGATATACCGA]-3´ oxo-G. The reaction was carried out with carried out in 10 mM sodium phosphate was added at a template/primer ratio of 9:1 50–250 µM Cr(V)-Salen and yielded base-spe- buffer (pH 6.0–7.0) in 100-µL volumes. and annealed by heating to 90°C for 5 min, cific oxidation at the site of modification on Reactions were allowed to proceed at room followed by slow cooling to room temperature the DNA (Figure 2; lanes 2–4).