Opioid-Mediated Modulation of Acid-Sensing Ion Channel Currents in Adult Rat Sensory Neurons
Total Page：16
File Type：pdf, Size：1020Kb
1521-0111/95/5/519–527$35.00 https://doi.org/10.1124/mol.118.114918 MOLECULAR PHARMACOLOGY Mol Pharmacol 95:519–527, May 2019 Copyright ª 2019 by The American Society for Pharmacology and Experimental Therapeutics Opioid-Mediated Modulation of Acid-Sensing Ion Channel Currents in Adult Rat Sensory Neurons Malgorzata Zaremba and Victor Ruiz-Velasco Ruiz-Velasco Laboratory, Department of Anesthesiology and Perioperative Medicine, Penn State College of Medicine, Hershey, Pennsylvania Received October 16, 2018; accepted February 20, 2019 Downloaded from ABSTRACT Muscle ischemia, associated with peripheral artery disease resulted in potentiation of the sustained ASIC currents. On the (PAD), leads to the release of proinflammatory mediators that other hand, the potentiation was not observed in DRG neurons decrease extracellular pH and trigger the activation of proton- from ASIC3 knockout rats. Further, the enhancement of the activated acid-sensing ion channels (ASIC). Claudication pain, ASIC currents was resistant to pertussis toxin treatment, suggesting linked with low blood flow, can be partially relieved by endogenous that Gai/Gao G-proteins are not involved. Additionally, the opioid peptide release. However, we previously reported that potentiation of sustained ASIC currents was greater in DRG molpharm.aspetjournals.org sustained ASIC currents in dorsal root ganglion (DRG) neurons neurons isolated from rats with ligated femoral arteries (a were enhanced by naturally occurring endomorphin-1 and -2 modelofPAD).Theeffectofallthree opioids on the transient opioid peptides, indicating a role of opioid involvement in ASIC peak current was mixed (increase, decrease, no effect). The hyperalgesia. The present study examined whether clinically inhibitory action appears to be mediated by the presence of ASIC1 employed synthetic (fentanyl, remifentanil) and the semisyn- isoform, while the potentiating effect is primarily due to ASIC3 thetic opioid (oxycodone) would also potentiate sustained isoform expression. These findings reveal that, under certain ASIC currents, which arise from ASIC3 channel isoforms. conditions, these three opioids can increase ASIC channel Here, we show that exposure of each opioid to DRG neurons activity, possibly giving rise to opioid-induced hyperalgesia. at ASPET Journals on September 30, 2021 1 Introduction H ion sensitivity, and their threshold for activation occurs when the extracellular pH reaches 7.2 (Gründer and Pusch, Acid-sensing ion channels (ASIC) belong to the epithelial 1 2015; Kellenberger and Schild, 2015). ASIC3 channel stimula- Na channel/degenerin (ENaC/DEG) family and are primarily tion results in a biphasic current that is unique to this subunit. Na1-selective channels that open in response to a drop in There is an initial rapidly inactivating current that is followed extracellular pH. In mammals, there are six ASIC isoforms by a sustained current that lasts as long as the external (ASIC1a and 1b, ASIC2a and 2b, ASIC3, and ASIC4) produced environment remains acidic (Gründer and Pusch, 2015). The by four genes (Baron and Lingueglia, 2015; Kellenberger and inactivation time constants (t)forASIC1aandASIC3are1.2– Schild, 2015). A functional ASIC channel is made up of three 3.4 and 0.3 seconds, respectively (Kellenberger and Schild, 2015). subunits and is either homomeric or heteromeric (Kellenberger The difference in this biophysical parameter provides a con- and Schild, 2015). ASIC1–3 are expressed primarily in central venient way to distinguish ASIC1 from ASIC3. and peripheral nervous systems (Deval and Lingueglia, 2015). Recent studies have shown modulation of ASIC currents by In the peripheral nervous system, ASIC1 and ASIC3 are found signaling molecules that are released during chronic inflamma- in trigeminal and dorsal root ganglion (DRG) sensory neurons (Deval and Lingueglia, 2015). tory conditions. For instance, lactic acid can enhance ASIC1 and Although DRG neurons express primarily ASIC1 and ASIC3 peak current in sensory neurons (Immke and McCleskey, ASIC3 isoforms, their stoichiometry is not known. Moreover, 2001; Molliver et al., 2005). Enhancement of sustained ASIC3 under ischemic conditions the expression levels of both isoforms currents by arachidonic acid and lysophosphatidylcholine has have been reported to be altered (Liu et al., 2010; Walder et al., been described elsewhere (Smith et al., 2007; Marra et al., 2016). 2010; Farrag et al., 2017). Both variants exhibit a high degree of Likewise, the endogenous opioid peptides, dynorphins, which stimulate kappa opioid receptors, have been reported to poten- This work was supported by grants from the National Institutes of Health tiate ASIC1 currents independent of G protein coupling National Institute of Arthritis and Musculoskeletal and Skin Diseases (Sherwood and Askwith, 2009). (NIAMS) [R01 AR-059397] and National Heart, Lung, and Blood Institute (NHLBI) [P01 HL-130987]. In addition, limb ischemia in people with peripheral artery https://doi.org/10.1124/mol.118.114918. disease (PAD) can lead to intermittent claudication–leg pain 2 4 ABBREVIATIONS: ASIC, acid-sensing ion channels; DAMGO, [D-Ala ,N-MePhe ,Gly-ol]-enkephalin; Dil, DilC12(3)-tetramethylindocarbocyanine perchlorate; DRG, dorsal root ganglion; E-1/2, endomorphin 1/2; EGFP, enhanced green fluorescent protein; Fen, fentanyl; FP, freely profused; KO, knockout; LIG, ligated; MOR, mu opioid receptor; OIH, opioid-induced hyperalgesia; Oxy, oxycodone; PAD, peripheral artery disease; PTX, pertussis toxin; Rem, remifentanil; t, inactivation time constant; WKY, Wistar-Kyoto. 519 520 Zaremba and Ruiz-Velasco induced by walking (Criqui and Aboyans, 2015). The pain (Fen), remifentanil (Rem), and oxycodone (Oxy) would also associated with claudication partly results from tissue acido- potentiate ASIC3 currents. The synthetic opioids Fen and Rem sis and inflammatory mediators, and is transduced by thin (see Fig. 1A) have been reported to induce OIH when muscle afferents. Prescription opioids make up one of the administered after surgery (Fletcher and Martinez, 2014, treatment modalities for PAD patients with claudication, but and references therein). Whether administration of the semi- their use is limited by their tendency to cause tolerance, synthetic opioid Oxy (Fig. 1A) can lead to OIH is unknown. physical dependence, and addiction resulting from the loss of MOR at the surface level. Moreover, the use of opioids for relief of either chronic pain or Materials and Methods postsurgical pain can, under certain conditions, lead to para- Animals. All experiments were approved by the Penn State doxical pain known as opioid-induced hyperalgesia (OIH). OIH, College of Medicine or Medical College of Wisconsin Institutional a nociceptive sensitization state, occurs when the administra- Animal Care and Use Committee (IACUC) and complied with the tion of opioids intended for pain relief leads to an increased National Institutes of Health guidelines. DRG neurons were isolated sensitivity to painful stimuli (Lee et al., 2011). from adult male Sprague-Dawley rats (125–175 g; Charles River, King Endogenous opioid peptides are known to be released at of Prussia, PA). For experiments shown in Fig. 3, Wistar-Kyoto (WKY) /2 ischemic or inflammatory sites (Mousa et al., 2002). Previ- and transgenic WKY ASIC3 knockout (KO) (ASIC3 )ratswere Downloaded from ously, we found that the high-affinity mu opioid receptor employed. Wild-type and mutant strain WKY rats were obtained from the Gene Editing Rat Resource Center (Melinda Dwinell, Ph.D., (MOR) peptides, endomorphin 1 (E-1) and endomorphin PI/NHLBI; Medical College of Wisconsin). This ASIC3 KO strain 2 (E-2), potentiated sustained ASIC3 currents in the absence (WKY-Asic3em6Mcwi; RGDID: 12790599) was generated by clustered of MOR stimulation and G protein signaling (Farrag et al., regularly interspaced short palindromic repeats (CRISPR)/Cas9 tech- 2017). Thus, the present study expands on these findings and nology, targeting the sequence GGCCCACAGCCCTCGGCGCAGGG determines whether the clinically employed opioids fentanyl (protospacer adjacent motif underlined) into WKY/NCrl (Charles molpharm.aspetjournals.org at ASPET Journals on September 30, 2021 Fig. 1. ASIC current activation protocol and analysis. (A) Opioid chemical struc- tures. (B) Protocol for ASIC current re- cording. Cells were exposed to control solution (pH 6.0) twice to verify stability of current. Thereafter, the cells were preincubated for 3 minutes in external solution containing opioid (pH 7.4). After- ward, the external solution was switched to pH 6.0 + opioid for 10 seconds, followed by a return to a solution of pH 7.4. (C) Data analysis of the pH-mediated potentiation of the sustained ASIC currents (IS), where IS(pre) is the sustained current amplitude in the control solution (pH 6.0) and IS(post) is the sustained current amplitude in the test solution (pH 6.0 + opioid). The current amplitude was measured as the average current amplitude obtained during the last second of the “test” pulse (shown in red). The transient peak ASIC current (IP) amplitude was measured at the peak of the current obtained at pH 6.0, IP(pre), and at pH 6.0 + opioid, IP(post). Opioid Modulation of ASIC3 and ASIC1 Channel Currents 521 River Laboratories) rat embryos, resulting in 61 base pair deletions in agents, with a gravity-fed perfusion system placed approximately exon 1 and predicted truncation of the normal ASIC3 open reading 100 mm from the cell. The complete solution exchange occurred within frame