Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. aegopo 4seisfudi eta n ot America. South and Central in found Subgenus species South 14 in of group diverse rate most is and Subgenus filaments, multi- America. coronal with of flowers series large ple having Subgenus by 2004). characterized impor- MacDougal generally economic and sub- have the (Ulmer species of tance best-known some and because largest partly the genera, is and species 250 Subgenus ca. five. to subgenera of number the eonzdsubgenus recognized and Mast., (DC.) rpia itiuino n ftesbeea ti h only the is it subgenera: the of and any Australia, of distribution Asia, graphical States, subgenus America, United Pacific, South the the and in species Central and With Mexico, species), species). (56 (40 Colombia subgenus by Guatemala for followed diversity species), (59 of Mexico center subgenus The rivals diversity. flowers, small yet as tically dozen a than subgenus more species, and undescribed Zealand. recognized 230 New ca. and with Guinea, Lastly, in New found the Papua lianas dioecious Australia, in of northeast species diverse three Subgenus with most smallest, America. the are South is northern that of trees lowlands medium-sized to small h aii.I h otrcn nrgnrccasfcto of classification infrageneric subgenera: and recent Asia most Southeast the Passiflora, to South In endemic and Pacific. are Central the species primar- and 24 is but Mexico genus America, The throughout shrubs. distributed and trees, ily lianas, vines, of cies O 10.1600/036364413X670359 DOI 3 © Botany Systematic arsSoeSaeUiest,Dprmn fMteaisadNtrlSine,32 ald,S.Lus isui613U .A. S. U. 63103 Missouri Louis, St. Laclede, 3026 Sciences, Natural and Mathematics of Department University, State Harris-Stowe oyih 03b h mrcnSceyo ln Taxonomists Plant of Society American the by 2013 Copyright Passiflora 1 Tetrapathea Multiflora Decaloba htsubgenus that cp ncpGS, nrITS, otbslybacig olwdb supersection by supersection followed branching, basally most supersection subgenus of comprised clade a by followed genus, the in Polyanthea, lineage Tetrastylis, branching basally most ee ao iegsta eeal orsodt urnl eonzdspretos ihnsubgenus Within supersections. recognized currently to correspond generally that lineages major seven yaoopisaedsusdfrtemjrcae,dcmnigapteno eakbeeouinr aiiyi eea oal characters. notable several in lability evolutionary remarkable of pattern a documenting for clades, origin major the World for New discussed a are synapomorphies supports phylogeny molecular The otenAkna nvriy eateto ilg,10Es nvriySre,Mgoi,Akna 15 .S A. S. U. 71753 Arkansas Magnolia, Street, University East 100 Biology, of Department University, Arkansas Southern Abstract— Keywords— Astrophea eiltadMcogl(03 eonzdfour recognized (2003) MacDougal and Feuillet 6 .i ag n ies eu fmr hn50spe- 560 than more of genus diverse and large a is L. h l ol subgenus World Old The . asfoa Deidamioides Passiflora, 21) 83:p.692–713 pp. 38(3): (2013), ohatoscnrbtdeulyt hswr.Atosfrcrepnec skonc@amgeuor ([email protected] correspondence for Authors work. this to equally contributed authors Both 5 2 sprpyei ihrsett supersection to respect with paraphyletic is acoSnaAaBtncGre,10 ot olg vne lrmn,Clfri 15 .S A. S. U. 71753 California Claremont, Avenue, College North 1500 Garden, Botanic Ana Santa Rancho ,and en tt olg,Dprmn fBooy 2 anSre,Kee e aphr 33 .S A. S. U. 03435 Hampshire New Keene, Street, Main 229 Biology, of Department College, State Keene Decaloba hlgntcrltosisof relationships Phylogenetic Multiflora srpe,Diaiie,Tetrapathea Deidamioides, Astrophea, Deidamioides Decaloba e nihsit h vlto of Evolution the into Insights New Passiflora Deidamioides trnL-F, ossso a 0seiso insand lianas of species 60 ca. of consists 4 w ancae r eovd )section 1) resolved: are clades main two , Tetrapathea hw .Krosnick, E. Shawn isuiBtnclGre,Ps fieBx29 t oi,Msor 36 .S A. S. U. 63166 Missouri Louis, St. 299, Box Office Post Garden, Botanical Missouri Decaloba and srsle ssse oamnpyei l ol supersection World Old monophyletic a to sister as resolved is , r netgtd saerltosisaogteegtspretoswti subgenus within supersections eight the among relationships are as investigated, are ) and D. cb rsike l (2009) al. et Krosnick Rchb. (DC.) Deidamioides sntmnpyei.Subgenus monophyletic. not is ndhF Decaloba lohstebods geo- broadest the has also Psilrca) hlgntcRelationships Phylogenetic (Passifloraceae): samrhlgclydispa- morphologically a is D. .S re,raising Green, S. P. (DC.) Tetrapathea eainhp fsubgenus of Relationships . Hrs Killip, (Harms) ee .Jørgensen, M. Peter ). n opooia Synapomorphies Morphological and asfoaobovata Passiflora ihischaracteris- its with , Passiflora Passiflora Passiflora omnctn dtr ui .Lohmann G. Lucia Editor: Communicating sspotda itrt subgenus to sister as supported is 1,6 oeua hlgn,NwWrd l World. Old World, New phylogeny, molecular , Hahniopathanthus rse .Porter-Utley, E. Kristen subgenus Passiflora Decaloba Tetrapathea [email protected]). nspecies in Auriculata Astrophea includes Astrophea (subgenus Passiflora Xerogona Decaloba 4 is is Supersections . Decaloba n uid .McDade A. Lucinda and 692 subgenus + + Deidamioides ihtoidpnetrdain oteOdWrd Morphological World. Old the to radiations independent two with , .obovata P. eeeaie sn 4 aaadfu oeua akr:nuclear markers: molecular four and taxa 148 using examined were section + Sal .M aDua eilt(2seis,and Feuille species), & (22 MacDougal species), M. Feuillet (22 J. & (DC.) Feuillet MacDougal M. species), & J. (21 MacDougal (Small) Feuillet M. & J. MacDougal (Harms) M. J. (Labill.) Cieca ae lvtdtescint ugnrcrn.Mses(1871) Masters rank. subgeneric subgenus to established (1828) section Reichenbach the elevated peduncles. floral later absent single-flowered or reduced and petals, five bracts, and sepals five having as 12)a eto within section a as (1822) species. these of World history evolutionary Old and in (NW) genus World Although New species. both (OW) have to subgenus h Wseiswr o eie ni eWle(1972) subgenus Wilde of De part until as revised them not subgenus treated of were formally part species as OW spe- recognized contained The now five are these, that of cies subgenera; additional subgenus 21 nized maintained He NW (1938). of treatment including comprehensive Passifloraceae, most The subgenus existed. realizing already not 1872), (Masters taxa same the diinlsubgenus, additional aDua)J .Mcogl& species), MacDougal M. Hahniopathanthus and J. 2003) MacDougal) (1999, supersections eight subgenus species MacDougal recognized within (2004) Colombian and Feuillet single and Feuillet MacDougal a 1989). containing (Escobar 1989, in established Passiflora oteohrfour other the to Subgenus Mdk)J .Mcogl&Fule 1 species), (19 Feuillet & MacDougal M. J. (Medik.) Deidamioides Decaloba h e ol species World New The . Cieca Decaloba Auriculata section 2,6 Passiflora, , Decaloba onM MacDougal, M. John Disemma Bryonioides Subgenus . r at n )termidro section of remainder the 2) and parte pro Mayapathanthus subgenus Decaloba Hrs .M aDua eilt(six Feuillet & MacDougal M. J. (Harms) (section Passiflora Passiflora .M aDua eilt(ih species), (eight Feuillet & MacDougal M. J. h eane ftefre supersection former the of remainder The . oprtvl itei nw bu the about known is little comparatively a rgnlydsrbdb eCandolle de by described originally was ,and Porphyropathanthus Plectostemma 5 Decaloba Tryphostemmatoides Decaloba : Passiflora Decaloba Decaloba, ugnr ( subgenera Decaloba Pterosperma subgenus + srsle spr fsubgenus of part as resolved is ) asfoamultiflora Passiflora Decaloba smnpyei n contains and monophyletic is 10seis.Tesubgenus The species). (130 t supersection a opee yKillip by completed was , ercgie hsgroup this recognized He . r oohltc Within monophyletic. are stescn ags sub- largest second the is Decaloba Plectostemma at otiigalmost containing Mast. 3 Astrophea eilt(orspecies), (four Feuillet Deidamioides L .Glet&J M. J. & Gilbert E. (L. oehrfr the form together ) .K soa,was Escobar, K. L. eut indicate Results . , Pterosperma Deidamioides h yeof type the , Decaloba. Decaloba (sections n recog- and Bryonioides Multiflora Decaloba Disemma Decaloba Decaloba is , . One . Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. pce lcdi te ugnr,particularly subgenera, other in placed subgenus species to sister clade and resolved subgenus to sister of as resolved rest the to with defined, currently as 20a,subgenus (2004a), nnw.Pyoeei nlsso N eunedt for data sequence DNA Passiflora of analyses Phylogenetic unknown. n ao 04) hl nHan(06,i a resolved was it (2006), Hearn to in sister while as 2004a), Nadot 2009). subgenus and within al. resolved et of was Krosnick part however, 2006; be Hearn 2004a; to Nadot shown were Rchb. genera monotypic supersection that to regard showed with (2005) problematic be may subgenus (2003) MacDougal and fsubgenus of Tetrapathea, supersection and 2006), Krosnick Decaloba 2005; 693 Freudenstein and Bryonioides subgenus within lineages four al. Decaloba only et (1938), Hansen in Killip 2005; Since species Freudenstein 2006). 230 and the Krosnick of 2004a; 39 Nadot most at included subgenus have studies genus phylogenetic the Previous of limited. or remains levels position nomic and petals, nectaries. petiolar or of laminar seed of absence absence morphology, DECALOBA SUBGENUS trichome ornamentation, PASSIFLORA tips, AL.: coat ET shoot KROSNICK gravita- of leaves, orientation juvenile of tional variegation as ad such on combinations based distinguished subgenus be (vs. may the filamentous) filaments groups within Several coronal or more). of or series smooth four three usually (vs. to two membranous and operculum, plicate a in eter), elsewhere found not characteristics Passiflora unique of suite a has 2013] o h ao iegsspotdi h oeua analysis. molecular the in lineages. supported lineages problematic major the of for revision identified are synapomorphies taxonomic morphological putative Lastly, for recommendations and made subgenus the are for sample taxon dense infrageneric that fact the by complicated in is relationships This genus. subgenus of relationship supersection to respect with super- largest, remaining the the including between and sections, within Relationships hr,Fule n aDua’ 20)casfcto fsub- of classification in subgenus (2003) genus to MacDougal’s resulting and lineage Feuillet clarified, sister Third, the are of subgenera identification rela- the Second, the subgenera. other among four tionships the to relative subgenus evolutionary genus the subgenus of of understanding increase history to order in goals studies. comparative for supersection press), in 2007, 2003, Utley hlgntckoldeo subgenus of knowledge Phylogenetic nte su hthsntbe ul drse sthe is addressed fully been not has that issue Another h rsn td ek oadessvrlimportant several address to seeks study present The .cirrhiflora P. Decaloba Decaloba section eaieysalfoes(generally flowers small relatively : aebe tde ndti hsfr supersection far: thus detail in studied been have .deidamioides P. niaeta set ftecasfcto fFeuillet of classification the of aspects that indicate Decaloba Decaloba and Mcogl19) supersection 1994), (MacDougal Decaloba Decaloba spretosadscin)i etdwt a with tested is sections) and (supersections Passiflora stse odtrietebudre fthe of boundaries the determine to tested is Deidamioides Xerogona Passiflora (subgenus o xml,Konc n Freudenstein and Krosnick example, For . Hollrungia Deidamioides nterslso okegadNadot and Yockteng of results the In . Mshe ta.20;Yctn and Yockteng 2003; al. et (Muschner Decaloba n oietf prpit outgroups appropriate identify to and Harms, and .cirrhiflora P. Rf)Kli Bz ta.i press). in al. et (Boza Killip (Raf.) Decaloba r tl oryudrto.The understood. poorly still are Decaloba. snee ots h monophyly the test to needed is , Deidamioides Auriculata. .Shm and Schum. K. is,temnpyyo sub- of monophyly the First, . Astrophea .tryphostemmatoides P. per ob paraphyletic be to appears .ovalis P. iinluiu character unique ditional Multiflora Decaloba Passiflora otermidro the of remainder the to nrae apigof sampling Increased us eovda sister as resolved Juss. asne l (2006) al. et Hansen . samonophyletic a as ) Decaloba Disemma Decaloba el xM Roem., M. ex Vell. r essentially are , Tetrapathea < sparaphyletic is Yctn and (Yockteng Cieca 4cmindiam- Tetrapathea taltaxo- all at (Yockteng Astrophea, (Krosnick Decaloba (Porter- Harms (DC.) , . Peyr., yYctn n ao 20a o s nsubgenus in (5 designed species, use ncpGS-IntF 1056R primers for these (2004a) and Nadot In 839F and primers 2004a). Yockteng using by Nadot Nadot targeted and specifically and (Yockteng was ncpGS ncpGS Yockteng of (cytGS; instead 2004b) synthetase glutamine cytosol-expressed Decaloba, genera and (Emshwiller 994 and followed 687 in nrITS primers 1999) for using Doyle synthe- amplified protocols glutamine was reaction expressed (ncpGS) Nuclear PCR tase (2005). The Freudenstein 4. and and and Krosnick PCR, of 5 round initial primers In an using primers (1990). in used the al. were achieved, 1994) et al. 0.2–1 readily White et (Sun not of 26SE was 4 and 17SE amplification and direct 5 where primers ITS2, and cases using gene, amplified 5.8S the directly ITS1, was including (nrITS) region spacer transcribed n ruesen20;Hne ta.20) i aawr chosen were taxa Six 2006). al. et Hansen of outside 2005; Freudenstein and monophyletic a support etdPRratos h cG mlfcto ecin contained reactions amplification ncpGS The 40 reactions. PCR nested 0.5 rsHlp .,3 MMgCl mM 35 8.8, pH Tris-HCl o i,floe y3 ylso 95 of cycles 35 by followed min, 5 for C uiiainkt(IGNIc) rb rcpttn h N – times NH 2–3 mM DNA 10 the precipitating with by or Inc.), QIAquick (QIAGEN the kit Jersey), purification Elu-Quik PCR New Piscataway, the Inc., using (Whatman purified kit purification further DNA were samples DNA necessary, When 72 ( ( triloba Basananthe Koord., (Blume) nR(5 IntR h mlfcto rga o cG a igeiiilcceo 95 of cycle initial single a was ncpGS for program amplification The eesmldt nueta l ao iegswithin lineages major all that ensure to sampled were ersne.Sxseis(f20seis rmsubgenus from species) 250 (of species Six represented. fti td a oadesrltosiswti subgenus within relationships address to was from study this 60) of (of seven were as included, t oiinrltv oteqetoal lcdsubgenera placed questionably the to and relative position its he ftefu oiwr vial.Attlo 9sqecswere sequences used specimen 19 taxa all of herbarium for total numbers includes analysis. A accession this 1 in GenBank available. and Appendix information were GenBank. voucher loci from least four at from obtained the available, sequences unless of not analyses analyses multi-locus the were in three the included in accessions were to possi- data taxa alternative as missing no used but with complete If were included as sampled. were were taxon taxa loci taxon those same all given a the for for for of ble data amplify accessions sequence not that alternative did of ensure isolations loci, sequencing DNA four older cases direct In all or Purification). via samples and Extraction herbarium generated DNA where (see were material leaf sequenced Sequences were from taxa DNA loci. 148 from of four total representatives A including subgenus. across the species, within 14 sections five of all seven by represented was subgenus of species five), Decaloba Auriculata genus oimaeaead06 oueo 0%iorpnlfr35w t–20 at wk 3–5 for isopropanol 100% of volume M 0.65 3 and of acetate volume chloroform- sodium 0.04 24:1 diameter in a precipitated mm following was DNA pestles; 2.3 precipitation, and alcohol with isoamyl mortars in volume standard in 1/3 Oklahoma) or a to beads filled silicon Bartlesville, using tubes homogenized microcentrifuge Inc., ml was 1.5 Products tissue (BioSpec leaf dry Mini-Beadbeater-8 with protocol modifications: CTAB from following the DNA using the California). isolated Valencia, was Inc., 1987) material Doyle specimen (Qiagen and herbarium kits (Doyle Mini geno- method Plant CTAB Total DNeasy the or institution). using lending extracted was spec- the DNA herbarium of mic or permission gel, with silica in (sampled preserved imens tissue material, leaf fresh from unr ulmifolia Turnera lanceolata Malesherbia ao apigadOtru Selection— Outgroup and Sampling Taxon N mlfcto n Sequencing— and Amplification DNA N xrcinadPurification— and Extraction DNA m o i,floe yafnl5mnetnina 72 at extension min 5 final a by followed min, 2 for C m lHPLCwater,1 l Tetrapathea, m Taq Multiflora Turnera fPRpoutwsue satmlt nasbeun reaction subsequent a in template a as used was product PCR of l Decaloba 0 asfoa edmods Astrophea, Deidamioides, Passiflora, CTACCATGTT 3 ACATCACCTCAATTGGTTTTG 6 fc.130), ca. of (64 hs aepiesapiytemlicp ula encoded nuclear multi-copy the amplify primers same these oyeae n 0.5 and polymerase, fu fegtspecies), eight of (four Passiflora . and L., Adenia 4 a ersne yalegtspretos including supersections, eight all by represented was A n7%EtOH. 76% in OAc 1 f2) and 22), of (10 ..Within L.). apigwsms xesv nteegop.Sub- groups. these in extensive most was sampling Blse ciz .J eWle,toMalesherbiaceae two Wilde), de J. W. Schinz) ex (Bolus aosamadagascariensis Paropsia nldn he asfoaee( Passifloraceae three including , aeil n Methods and Materials m Tetrapathea 0 Ricardi, leachof10 ACACCCTTCTC 3 CATCAAACTCACCTTTTCTTTCC Forssk., Malesherbia Passiflora Disemma Passiflora, .weberbaueri M. 2 Paropsia m 5 MKl,0.5 KCl), mM 250 , lof10 eeicue.Subgenus included. were Pterosperma Yctn n ao 04;Krosnick 2004a; Nadot and (Yockteng 1 f21), of (13 m Bryonioides uz&Pv ape swl ssub- as well as samples Pav. & Ruiz rmr 5 primer, m Astrophea. oa eoi N a isolated was DNA genomic Total subgenera o i,50 min, 1 for C m ooh xThouars, ex Noronha g/ h ula iooa internal ribosomal nuclear The and m 0 eedsge o s in use for designed were ) lofbovineserumalbumen. ig,adoeTurneraceae one and Gilg), Hahniopathanthus treo or.Althree All four). of (three Ms. .Prir and Perrier, H. (Mast.) 1 f22), of (11 eetaaye strongly analyses Recent Tetrapathea. ic h rmr focus primary the Since m Passiflora l10 m Decaloba lof0.20 dnaheterophylla Adenia

+ Cfor1min,and ufr(0 mM (100 buffer Passiflora Cieca Passiflora C. and 0 h internal The . Decaloba n ncpGS- and ) nsubgenus In Deidamioides Deidamioides m Basananthe mdNTPs, Astrophea 7o 19), of (7 treof (three were were and C. C Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 9 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 694 fclrpatDAwsapiiduigpies55 n 02 of 10.2R readily, and amplify not 5.5F would that primers DNAs Pass- For using primers 2001). the al. amplified et (Davis was Nyffeler R. DNA chloroplast of CC3 ACCC hs ulndi rsikadFednti 20) The (2005). followed Freudenstein complete conditions obtain and amplification to Krosnick PCR PCR in The nested (Taberlet outlined for “e” region. and necessary those the “d” as primers for used Internal were sequences (1991). 1991) al. al. et et Taberlet of “f” and f94 of PCwtr 1 water, HPLC idb rcpttn ih50 with precipitating by fied n Pass- and i xeso t72 at extension min 7 rsHlp .,3 MMgCl mM 35 8.8, pH Tris-HCl lsa Topo ta.19)uigtedfutainetparameters. alignment default the ncpGS, using The 1994) al. et (Thompson W Clustal Sequencher or 2011) 2000). Corporation al. Codes et (Gene (Drummond 4.1.1 5.0.3 v. v. Sciences Pro Genome Geneious and using of assembled edited were Department contigs Washington, sequence Bidirectional of Washington). (Seattle, University Solu- Sequencing at High-Throughput lab the Biosystemstions at Applied sequencer Ana an automated Santa using 3730XL Rancho or California), at (Claremont, sequencer Garden automated Botanic 3100 on analyzed Biosystems were Applied reactions Terminator Sequencing an volume. BigDye reaction scaled California) quarter City, (Qiagen used to Foster down Biosystems, kits reactions (Applied chemistry purification 3.1 sequencing PCR version cycle Qiagen or Dideoxy California) Inc.). Clara, Santa (Affymetrix/ ExoSAP-IT USB, using by precipitations or ethanol two by followed 0.5 rT,ncpGS, nrITS, o l nlss aaeswr nlzdsprtl nIS ncpGS, (nrITS, separately analyzed were were deactivated and characters Datasets were All analyses. characters all 2002). uninformative for and (Nixon non-additive, 1.00.08 as ver. treated (BETA) Winclada trees using 100 to up with hold*). swapping, for includ- of trees initiations, phase (# four this retained of set during to each fol- generated trees from was those trees (# This ing shortest retained all initiation. trees of each TBR 20 after by to swapping lowed TBR up during and initia- rep) parti- reps/replication) search hundred hold/mult four mult character comprising five of random replicate (# (2004), of each tions with replications) al. performed, of analyses. were et (# tions ILD Davis parsimony analyses the All replicate of to paired datasets. recommendations prior chloroplast the deactivated and Following as were nuclear matrices performed characters gene the uninformative was single between individual NONA, as of to well combinations submitted pairwise all and among WinClada in and 1). implemented Appendix 12855) (see number GenBank combined (study in and deposited TreeBASE individual were in sequences Both deposited all alignment. were adjust- the used manual improve datasets analysis as adjustment not phylogenetic further did for without ments Clustal used by alignment output as nrITS was The 2000). (Rambaut for nlsswsasse sn 000jckierpiae M K in JK) (MP searches replicates Heuristic 37%. jackknife at set 10,000 removal MP character the using random for with assessed Winclada, support was Branch were characters. both analyses (CI) including trees uninformative calculated consistency MP were and dataset The All each informative for consensus. 500,000). indices (max strict (RI) number retention trees through the and 500,000 summarized on limit to and upper set saved the retained with trees out) NONA of to (max submitted in swapping then retained (max were additional were these trees runs for and Ratchet Winclada, 100,000 loci within the buffer all of to tree result and the set a nuclear, as retained the (chloroplast, obtained trees trees analyses with combined), locus of out) were combined number (max these For the swapping 100,000). and additional on Winclada, for limit within NONA upper buffer Ratchet to tree the of submitted the result then in a as retained obtained a trees were trees using All re-weighted, runs two 10. were of holding characters level the replication, constraint of random 10% per which iterations in replication, search 500 per primary with were locus ratchets each the sequential single 20 For performed, used: as matrices. were parameters combined used following and the was in individual analyses, the implemented NONA, both as to for (1999), strategy submitted Nixon and of ratchet Winclada parsimony The combined). aae ogune hlgntcAaye,adBac Support— Branch and Analyses, Phylogenetic Congruence, Dataset The mlfcto rdcso rT,ncpGS, nrITS, of products Amplification negtdmxmmprioy(P nlsswr undertaken were analyses (MP) parsimony maximum Unweighted as (1994), al. et Farris of Test (ILD) difference length incongruence The ndhF m trnL-F l o 5sc 55 sec, 45 for C Taq trnL-F 0 a igeiiilcceo 94 of cycle initial single a was eeue.The used. were ) ndhF oyeae n 0.5 and polymerase, n ncmiain(hools oi ula oi n l loci all and loci, nuclear loci, (chloroplast combination in and ) trnL-F eino hools N a mlfe ihpies“c” primers with amplified was DNA chloroplast of region BK2 (5 -BAK-2R trnL-F, m ndhF lofeachof10 ,and o 5sc n 72 and sec, 45 for C BK1 (5 -BAK-1F C. and ndhF 0 ndhF ndhF ACAGAGTAAATTCTACAAACTCTCTTAT arcswr dutdmnal sn Se-Al using manually adjusted were matrices m 2 f2%plehln lcl25MNaCl M glycol-2.5 polyethylene 20% of l m ,250mMKCl),0.5 fDS.Teapiiainprogram amplification The DMSO. of l mlfcto ecin otie 40 contained reactions amplification 0 eune eeiiilyaindusing aligned initially were sequences m GTGATACATTG 3 TGGTTGTATTCACCTATTTTCGC rmr 5 primer, m o i,floe y2 cycles 25 by followed min, 5 for C o i,floe yafinal a by followed min, 1 for C trnL-F, m l10 m and lof0.20 + ufr(0 mM (100 buffer ndhF ndhF m eepuri- were mdNTPs, region ndhF, All m 0 ) l asmn nlsso h niiulnIS ncpGS, nrITS, individual the and of analysis parsimony n upr o eainhp mn h ugnr and subgenera the among relationships subgenus within for support and PICs fewest the nrITS), with of nuclear dataset. inclusion dataset, chloroplast the The the four-locus in to observed total. the (due in by PICs most followed accessions the 148 had most dataset with had dataset included, four-locus combined taxa The 1999). Doyle and ln h akoeo h readfrmost for and tree equally 100,188 the produced dataset of ncpGS The backbone and supersections. subgenus the of level along support locus the this jackknife 3,051 0.74); at with = resolution supersection, of RI most 0.31, trees the = CI provided parsimonious 1A; Fig. most (Supplemental steps equally 100,411 duced for used primers the to subgenus compared outside gene ncpGS taxa the of tion oteueo rmr 3/06(okegadNdt2004a) Nadot and (Yockteng 839/1056 subgenus primers for of use owing ncpGS the for to missing were data many sequences Similarly, full-length difficult. mono- obtaining the dis- and made ingroup, that between for the repeats nucleotide differences with genera greatest sequence outgroup related large was tantly to data owing missing dataset, of percentage rvddtegets ubro parsimony-informative of ncpGS, by number followed (PICs), greatest characters the provided niiuldtst ayi h ubro aaincluded. followed taxa taxa, of of number number greatest the by the the for loci, obtained the in was nrITS across vary amplifications datasets PCR individual in success variable ula oi(rT cG) obndclrpatloci chloroplast combined ncpGS), + (nrITS ( loci nuclear sebe:idvda rT,ncpGS, nrITS, individual assembled: sn 0 aoiyrl osnu reo l h otbr-ntrees. post-burn-in the all summarized of was tree consensus distribution majority-rule posterior 50% a combined using The burn-in. gener- 1,000 as initial using the ations four branch from summarized trees excluding and MrBayes, resulting were in command prior, topology The sumt the rate consensus generations. variable and 1,000 probabilities a genera- every posterior using 10,000,000 sampled tree of models chains run starting same one Markov random of the a consisted using from and done analyses tions was treated ML al. analysis the region et for Each gene (Miller used each partition. with cluster separate dataset a CIPRES molecular as the combined the on for 2001) 2010) Ronquist and (Huelsenbeck bootstrap con- 100 rule 2002). from (Swofford majority 4.0b10 as v. estimated PAUP* summarized in were were trees trees sensus Saved BS) GARLI. like- (ML in Maximum replicates missing. values as search bootstrap treated per indels lihood generations with 5,000,000 replicates), using search and (five GARLI trees in random generated concatenated were from the searches starting tree of for analyses topologies par- likelihood Starting obtained independent maximum alignment. configure multipliers for to GARLI rate used in were and titions jModelTest parameters from locus Model each 2006). for were (Zwickl analyses 2.0 ML GTR. ncpGS, v. or nrITS, TVM, combined the TPM, for TIM, performed of Q-matrices selected variants The all models heterogeneity. were All rate selected 2008). for distribution (Posada gamma 0.1.1 the v. incorporated jModelTest in (AIC) criterion oeua vlto oe aaeeswr siae rmteindivid- the from ncpGS, estimated nrITS, ual were of parameters model frequency evolution a molecular tree. with consensus with jackknife (mult*2), clades the in Only replicate retained (hold/2). were per higher replicate or trees per 50% starting held trees two two using performed were ndhF hlgntcAaye fIdvda Datasets— Individual of Analyses Phylogenetic oeua aae Characteristics— Dataset Molecular aeinaaye eepromdi rae nT .3.1.2 v. TG on MrBayes in performed were analyses Bayesian o aiu ieiod(L n aeinifrne(I analyses, (BI) inference Bayesian and (ML) likelihood maximum For ndhF trnL-F , trnL-F cG,and ncpGS, , aaesrvae aibelvl fresolution of levels variable revealed datasets ,adfu oicmie Tbe1.Oigto Owing 1). (Table combined loci four and ), Decaloba. ndhF Decaloba ,and trnL-F. hs rmr mlf hre por- shorter a amplify primers These trnL-F Decaloba Results Tbe1.TenISdtstpro- dataset nrITS The 1). (Table fteidvda aaes nrITS datasets, individual the Of aaesuigteAak information Akaike the using datasets ie 8/9;Emshwiller 687/994; (i.e. ndhF trnL-F ³ ndhF ,and ee aaeswere datasets Seven 0 o otclades most for 70% , and , trnL-F ndhF trnL-F. combined , sn GARLI using Maximum Decaloba trnL-F ndhF The , Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. genus groups f225ses(upeetlFg C I=03,R 0.70). rela- ( = genera for Basananthe, RI outgroup resolution 0.39, the greatest among = provided tionships CI data 2C; chloroplast Fig. The (Supplemental steps ( 2,285 of dataset generally chloroplast were trnL-F taxa combined remaining The The unresolved. data. these by resolved subgenera of of 0.71). resolution support = for RI signal subgenus jackknife 0.59, strong within = provide CI not relationships 2B; did Fig. region trees (Supplemental This parsimonious steps most 1,362 equally of 100,264 produced dataset ugoprltosiswr eovda xetdwt the with expected of as exception resolved were relationships Outgroup subgenus within placed were which htwr nieylcigfrta ou.C n Iwr acltdfo asmn nlsso niiuladcmie datasets. combined and individual taxa placeholder of include analysis not parsimony do from datasets calculated combined were for RI values and data CI Missing locus. 1). that Appendix for (see lacking loci four entirely the were between that differed sampling Taxon datasets. T cG 4 ,6 0 1 2% 4 4% 6 1,9 .407 4,166 905 3,051 0.74 0.74 0.83 0.34 0.31 0.54 and with 513,095 monophyletic 100,441 supersections as 100,188 supported several subgenus resolution no within but was There sections relationships, 0.74). = (Supple- outgroup RI steps 0.34, for = produced 4,166 26% CI ncpGS) of 1C; 22% Fig. 34% trees + mental parsimonious (nrITS equally dataset 513,095 nuclear combined (47%) 742 The (56%) (38%) 452 290 supersection within (20%) as 318 (14%) relationships, (26%) 117 group 201 695 Jackknife most below. Decaloba. showed and consensus supersection was of strict 506 support level ncpGS 237 the 269 The = at CI 0.83). resolution 1B; = Fig. (Supplemental RI steps 0.54, 905 of trees parsimonious 1,566 806 760 148 142 loci 133 All ndhF ncpGS + ITS DECALOBA SUBGENUS trnL-F PASSIFLORA AL.: ET KROSNICK ndhF ncpGS ITS 2013] h ordtst,nISpoie h raetresolution, greatest the provided ncpGS, nrITS by Across followed datasets, subgenera). and four (genera clades the deeper the to respect subgenus in section and the supersection Decaloba of whereas level rela- Thus, the for at support higher. tionships and resolution or greatest provide 70% data of nuclear supported values also were jackknife clades with terminal some although tree, the Decaloba. (except outgroups most ( provided among support locus supersection, jackknife this and good subgenus 0.87); of providing = level RI the at 0.44, resolution = greatest CI 2A; Fig. plemental ariecmaioso oi swl sbtentecom- the between as well as loci, of comparisons pairwise The Table vlaino noguneBtenteDatasets— the Between Incongruence of Evaluation combined Locus + trnL-F rdcd5000eulyms asmnostrees parsimonious most equally 500,040 produced ) ndhF Astrophea Passiflora, Malesherbia .Caatrsiso h oridvda nIS ncpGS, (nrITS, individual four the of Characteristics 1. h hools aapoie otsga with signal most provided data chloroplast the , ld upr a raetaogtebcbn of backbone the along greatest was support Clade h cG aae i o upr xetdout- expected support not did dataset ncpGS The asfoa edmods Astrophea, Deidamioides, Passiflora, and aae rdcd1021teso 1 tp (Sup- steps 916 of trees 100,201 produced dataset Decaloba Adenia, ³ Number Paropsia ftaxa of 0 o eea uescin nsubgenus in supersections several for 70% n otoso subgenus of portions and 4 ,7 7 6 2% 4 2% 3 0,4 .907 2,285 916 1,362 0.70 0.71 0.87 0.39 0.59 0.44 500,040 100,264 100,201 23% 37% 10% (29%) 544 (27%) 310 (31%) 234 (24%) 462 (25%) 292 (22%) 170 873 526 347 1,879 1,128 751 147 129 135 4 ,4 ,7 8 2% ,8 3% 4 10403 .16,797 0.71 0.34 41,024 24% (37%) 1,286 (22%) 780 1,379 3,445 148 n oemmeso subgenus of members some and , ndhF Turnera hc a eovdwti subgenus within resolved was which ³ eepae aal within basally placed were Adenia ,a ela o eainhp among relationships for as well as ), 0 o eainhp mn out- among relationships for 70% and , Decaloba Aligned length and , trnL-F and ³ Decaloba, Paropsia. 0 aknf support. jackknife 70% Basananthe Malesherbia ³ eewl eovdand resolved well were . 0)frrelationships for 70%) Constant Decaloba sites aehri,Turnera, Malesherbia, Deidamioides u i provide did but nadto,sub- addition, In and eeresolved were .The ). and Tetrapathea ndhF Variable ie (%) sites Passiflora. Decaloba Adenia, trnL-F trnL-F were and All . and informative Parsimony ndhF LadB nlss oeso euneeouinwere: the For evolution G; 71). sequence + = ncpGS—TIM2 of G; RI + models 0.34, I + analyses, = nrITS—TPM2uf BI (CI parsi- steps and was 6,797 equally ML of dataset 41,024 trees combined produced monious the analyses within Parsimony data 34%. per- missing The of 1). (Table centage informative parsimony which were of (37%) characters, 1,286 nucleotide 3,445 and taxa 148 contained aaest ervae narbs hlgn constructed phylogeny robust a data. combined in the from revealed be the within to signal secondary datasets allow inter- to full Data and permit characters to of hybridization. together action analyzed or addi- were loci out heteroplasmy four behaved all rule as from that to such taxa cloning factors any for tional However, prioritized matrix. were the anomalously into data miss- additional ing difficult, introduced that alignment lengths sequence shorter unambiguous or sequence made of levels which high either divergence to to conflicting due of sister primarily cases were but these placement that dataset, revealed nrITS study Further the dataset. in 93%) = sagasteguii JK (MP Killip tenella Passiflora to the the of was either incongruence in cases, at data significant these missing still only In no compared. including taxon were being run in there matrices differences which were of for analyses impact taxa for additional 2002; test size, Lutzoni To and sample 2004). of Barker al. amount 2000; et al. and Hipp et dataset, (Dolphin each size, data within matrix missing size, homoplasy and of sample amount taxon chance error) in the I differences (type increase including erroneously that differences factors significant several detecting of to susceptible be to signifi- ( revealed incongruence loci nuclear cant combined vs. chloroplast bined e elspotdcnlcseitaogtria aa For taxa. terminal among example, exist conflicts well-supported few deeper revealed the in of and resolution nodes loci in differences individual supported strongly by no produced strict the trees in present consensus topologies the among made jackknife indi- were of the support Comparisons signal. that limited suggesting have datasets 2), vidual 1, poorly individual Figs. dataset, nrITS (Supplemental the the resolved of from exception generated the with trees were, analyses MP of The consensus incongruence. homoplasy genuine strict and/or or signal datasets, weak individual to the due within is ILD the by detected ie (%) sites obndMlclrDataset— Molecular Combined .vespertilio P. n he obnd(ula,clrpat n orgn combined) four-gene and chloroplast, (nuclear, combined three and ) ndhF aae M K=99%), = JK (MP dataset dnaheterophylla Adenia Passiflora kaa egn M K=8% ntencpGS the in 83%) = JK (MP Weigend & Skrabal Missing data .(PJ 7)i h cG topology. ncpGS the in 97%) = JK (MP L. ilpwssse osection to sister was Killip p .0,sgetn htteincongruence the that suggesting 0.002, = p sbeea uescin) oee,a However, supersections). (subgenera, .0) h L ethsbe shown been has test ILD The 0.002). = eoee IRI CI recovered #MP trees a itrto sister was .helleri P. h obnddataset combined The trnL-F .multiflora P. er a sister was Peyr. Xerogona TM+G; + —TVM (Raf.) .in L. length tree MP P. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. itrt ld ,wihcnandtrescin fsubgenus of sections three contained Deidamioides which subgenus B, of clade to consisted sister lineage branching next The 9 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 696 ybt LadB nlss(ld :M S= analysis, BS ML MP E: the (clade In analyses 98%). BI 0.79). 1.0, and ML 100%, both D: by (clade clade Subgenus 0.99, well-supported 64%, a subgenus C: formed (clade Next, support weak 77%). somewhat with though in clade branching section subgenus basally of The comprised Subgenera tree. locations different the trees. three Subgenus in in placed BI analyses. species three with and polyphyletic, all ML in lineages MP, the Astrophea across resolved 99%). 1.0, (95%, monophyletic in as presented genus supported be well the will was similarly, values subsequently); support order 93%; same = this JK MP 1.0, to = sister BPP analyses as all In supported family. strongly the of was rest the to leads that grade oohltcwt h xeto fsupersections of and exception the as supported with were monophyletic (2003) MacDougal and Feuillet by ognized subgenus of members two other Tetrapathea, these to while relative 97%) unresolved = JK (MP sisters as greatest subgenus ML the within yielding the relationships thus Second, into resolved, MP). insight most then the BI, the was being by topology (ML followed resolution only resolved, of the amount most congruent, the are in topologies being BI reasons. and differences two ML, for MP, approaches the analytical First, three all from results generations. 350,000 by achieved ade- was mixed stability had all and Comparison that quately, trees. showed runs burn-in independent post the among 8,000 retained runs MCMC s i n gndhF l em o s t - l i k e l yt r e e( – l n Ls c o r e=4 6 , 5 1 7 ) .T h eB a y e s i a n and below resolved was JK) h aai h nlss nteM n Ianalyses, BI and ML the and In analysis. the in taxa root, the the as With ignated similarly. relationships resolved lyses below. discussed are and methods analytical JK, of MP presentation and for probabili- BS thresholds posterior with Bayesian (BPP) and JK) ties (ML (MP bootstrap jackknife ML MP Support include BS), topology genera N–Y. ML outgroup clades the on presenting the shown 3 values spanning Fig. and 2 M, Fig. all clade through with divided across is were figures phylogeny two identification ML importance detailed into The particular their text. the of facilitate in and Clades figures to 1. letters dataset Fig. assigned molecular as combined shown the relationships of is phylogenetic analysis ML of by diagram resolved simplified A genus. n subgenus and analysis, MP the in whereas 0.84), = BPP section ugnrcrltosisin relationships Subgeneric h Ltplg a hsnt ersn n discuss and represent to chosen was topology ML The ihnsubgenus Within ana- BI and ML, MP, the genera, outgroup to regard With .aurantioides P. Paropsia GR+G aiu ieiodaaye ile a yielded analyses likelihood Maximum G. + —GTR Auriculata, Decaloba Tryphostemmatoides Tetrapathea and omn oyoywith polytomy a forming sections : eewal eovda itr M S= BS (ML sisters as resolved weakly were Decaloba. Passiflora h es eludrto ru ntesub- the in group well-understood least the , hc eersle sprpyei with paraphyletic as resolved were which K cu. rsikwr well-supported were Krosnick Schum.) (K. Decaloba ³ Turnera a ekyspotda monophyletic as supported weakly was oynha Tetrastylis, Polyanthea, .0frBP nogune between Incongruences BPP. for 0.50 Astrophea Basananthe Tetrapathea eespotda monophyletic as supported were .kuranda P. am caeA 2,10 99%). 1.0, 92%, A: (clade Harms caeF,alspretosrec- supersections all F), (clade a itrt h eane of remainder the to sister was .tetrandra P. Passiflora subgenus + .kuranda P. Passiflora 5%M K nabasal a in JK) MP (54% subgenus + rsik&A .Ford J. A. & Krosnick eecongruently were ak xD.was DC. ex Banks Paropsia Deidamioides and Malesherbia Decaloba M S=98%, = BS (ML + ³ Passiflora .aurantioides P. Deidamioides, < Deidamioides 0 o ML for 50% 0;BP= BPP 50%; Basananthe Multiflora 9%MP (99% Passiflora Passiflora Decaloba Adenia < super- 50%, des- was was 2) h Ite a iia oteM rewt epc to respect with tree 1.0, ML 100%, the to supersection P: similar within (clade was relationships tree monophyletic BI The as 92%). supported well was smnpyei caeO 0% .,10) olwdby 93%). followed 1.0, 95%, 100%), Q: (clade 1.0, letic 100%, O: supersection (clade monophyletic as Supersection the MP. along by confidence with member. basal-most the multiflora 6,BP=10;ti ld a neovda h aeof base the at unresolved was analysis. clade MP the this in S 1.0); clade = BPP 56%, and hltc(0% .,9%.I h Ltopology, ML the In 99%). mono- Mast., as 1.0, supported of strongly (100%, was consists phyletic relatives, and which DC. ex V, Balb. supported Clade moderately clade both monophyletic. were the 99%) as of 1.0, (71%, base U the clade at and Section unresolved analysis. MP also 54%, the was = in BS but (ML 1.0) S clade = of BPP remainder the to sister as supported 3,10 3;caeW 0% .,9%.Wti ld ,the S, clade of Within consisted 99%). diverge 1.0, to 100%, clade S: W: first (clade clade monophyletic 83%; as 1.0, supported 93%, strongly supersection were for W, and tree S ML The resolved polytomies. Decaloba less several much had was topology and MP the overall; resolution eovdwscaeM hc nlddalsmldmem- lineage sampled next all the included K, supersections which of clade M, bers After clade was 92%). resolved 1.0, (99%, phyletic rvddmdrt upr o ld 7% .,MP 1.0, (75%, X analyses clade BI 1.0, for (62%, and Y and support ML unresolved) The well moderate not supported. analyses. were provided this strongly MP W or but or clade BI within resolved W, the relationships clade in remaining supported The within not grade was arrangement basal supported weakly init vltoayrltosiswithin relationships evolutionary into tion Supersection n h eane fteseispae nta eto by section that in placed species Within (2003). the MacDougal and of Feuillet remainder the ing addition, supersection In result, supersection analyses. a to sister three as resolved all was in multiflora another Passiflora one to respect Disemma clades. same those between regard relationships with backbone analyses unresolved the BI was to topology and MP ML remaining base the the the the supersections, between Whereas at relationships tree. unresolved for MP was resolution the provided but in 0.77), H = clade BPP of 63%, = BS (ML 99%). 1.0, supersection 100%, obovata I: (clade clade Passiflora supported strongly subgenus a of remainder formed the + Feuillet) & MacDougal caeG 0% .,100%). 1.0, genus 100%, G: (clade Pterosperma Supersection h td rsne eerpeet h ags investiga- largest the represents here presented study The h etlnaet ieg a h Wsupersection OW the was diverge to lineage next The .pavonis P. Deidamioides .urnifolia P. niae httomi lds eintda clades as designated clades, main two that indicated LB 7,BP=09) with 0.97), = BPP 57%, = BS ML ; +NW Decaloba a elspotda h otbslclade basal most the as well-supported was Bryonioides, Hahniopathanthus Disemma at,adwswal upre M S= BS (ML supported weakly was and Mast., Decaloba, .multiflora P. ub,and Rusby, a ekyspotda itrto sister as supported weakly was akoe n a togysupported strongly was and backbone, . h yeo supersection of type the L., section Auriculata Multiflora a togyspotda mono- as supported strongly was Discussion asfoaholosericea Passiflora lowl upre smonophy- as supported well also h ags nsubgenus in largest the asfoatenella Passiflora Xerogona < Mayapathanthus 0)a oohltclineages. monophyletic as 50%) asfoaobovata Passiflora .(ld :7% .;75%). 1.0; 73%, K: (clade L. nteM n Itopology BI and ML the in eoe ooyi exclud- monotypic becomes and .misera P. .lutea P. Decaloba, caeT 0,10 58%) 1.0; 80%, T: (clade Multiflora Disemma Decaloba, Cieca L., ilpwsweakly was Killip .holosericea P. ut omda formed Kunth Passiflora huhwt less with though .filipes P. a o placed not was ilpe .M. J. ex Killip iegdnext diverged (exception caeK.As K). (clade supersection .berteroana P. ilp(sub- Killip .tricuspis P. Multiflora, Decaloba, Decaloba odate, to Benth., .as L. P. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 03 RSIKE L:PSILR UGNSDCLB 697 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK 2013] R Boender); (R. r etrdfloigdsrpin ntx;nmeso pce e ld niae ihnec rage(.p r at;spret supersectio = supersect. credit: parte; photo pro and = species p. with (p. listed triangle bottom, each to incarnata within top P. right, indicated to clade left per from species labeled of numbers supersection text; in indicates descriptions following lettered are Fig. .Oeve frltosisin relationships of Overview 1. E Leiter); (E. .sexocellata P. Multiflora .aurantioides P. A Herna (A. minus ´ ndez); A Ford); (A. .multiflora P. Passiflora .pterocarpa P. .microstipula P. ae ntecmie rT,ncpGS, nrITS, combined the on based mg ffoe o pce yia fec ieg hw otergto ahcae Photos clade. each of right the to shown lineage each of typical species for flower of Image . A MacVean); (A. J MacDougal); (J. .cisnana P. .arbelaezii P. R Boender); (R. .quetzal P. R Boender); (R. J MacDougal); (J. trnL-F .sp. P. ,and A Herna (A. .arborea P. ndhF ´ .cochinchinensis P. ndez). L Escobar); (L. aae.Sbeeaadsupersections and Subgenera dataset. .deidamioides P. S Krosnick); (S. L Gilbert); (L. .rufa P. ) * n); Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 9 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 698 ugnr n uescin niae otergto h emnl spret uescin.Setx o ulepaaino ahltee clad lettered each of explanation full for text See supersection). = (supersect. terminals the of right the to ( indicated values supersections and jackknife Subgenera parsimony ( and values left, bootstrap likelihood the maximum with shown topology Fig. .Pyoeei eainhp in relationships Phylogenetic 2. Passiflora ³ 0)t h ih *=10 LB,BP rM Kspot = – support; JK MP or BPP, BS, ML 100% = (* right the to 50%) ae ntecmie rT,ncpGS, nrITS, combined the on based ³ 0)aoebac;udrbac,Bysa neec otro rbblte ( probabilities posterior inference Bayesian branch, under branch; above 50%) trnL-F ,and ndhF aae:cae -.Mxmmlikelihood Maximum A-M. clades dataset: < 0 LB,BP rM Ksupport). JK MP or BPP, BS, ML 50% ³ e. .0 to 0.50) Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. aiu ieiodtplg hw ihmxmmlklho otta aus( values bootstrap likelihood maximum ( with probabilities shown topology likelihood Maximum 03 RSIKE L:PSILR UGNSDCLB 699 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK 2013] PJ upr) uescin n etosidctdt h ih ftetrias(uesc.=spreto) e etfrfl xlnto feach of explanation full for text See supersection). = (supersect. terminals the of right the to indicated sections and clade. lettered Supersections support). JK MP Fig. .Pyoeei eainhp in relationships Phylogenetic 3. ³ .0 otelf,adprioyjckievle ( values jackknife parsimony and left, the to 0.50) Passiflora subgenus Decaloba ³ 0)t h ih *=10 LB,BP rM Kspot = – support; JK MP or BPP, BS, ML 100% = (* right the to 50%) ae ntecmie rT,ncpGS, nrITS, combined the on based ³ 0)aoebac;udrbac,Bysa neec posterior inference Bayesian branch, under branch; above 50%) trnL-F ,and ndhF < aae:cae N–Y. clades dataset: 0 LB,BP or BPP, BS, ML 50% Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. fpeec fmlil ois rT aasol continue should data nrITS copies, are indication multiple excluding other sequences of or (i.e. presence and polymorphisms of cautiously for of hybrids), done screened deal is and/or carefully great data polyploids a nrITS known that acquisition of the advantage If use locus. the this and for has exists already also data sequence it risk, some ( taxa two for omitted or criteria, were sequence these data polymorphisms nrITS Following if disagreement. analysis nucleotide significant of the frequent regions from displayed eliminated contigs were To taxa in identified. taxon polyploidy ploid been to each owing among have copies evolution for non-concerted copies nrITS of amplicons unique possibility the nrITS all for account clone that ensure to to practical not is h s fnISa oeua akrin marker molecular While a as characters. nrITS analysis, of informative current use the the phylogenetically for 56% valu- signal a phylogenetic Proceeding with be to of cloning. proved source dataset for nrITS able the prioritized way, this and in cautiously analysis the from and aDua 93 eMl ta.20;Hne ta.2006), al. et Hansen 2001; al. subgenus in et also and Melo de 1993; MacDougal section So n aDua 93.Plpod a endocu- been subgenus has Polyploidy in 1993). mented MacDougal and (Snow generally subgenus 2 is and data), of unpubl. MacDougal, count J. count; one from known Subgenus 2006). is hra subgenus whereas cies, hoooecut,btmybe may but count), chromosome td ofcso eovn h lcmn fsubgenera of placement the resolving on Deidamioides focus to study rvdn e rmwr o xmnto fmorphologi- transformations. of character examination cal for framework of new analysis a providing comprehensive subgenus more in a for relationships char- and allowed taxa has both the (i.e. acters) locus; matrix expanded per This new. species entirely used 30–80 commonly by most expanded the for in data markers molecular studies, earlier to pared eu ipassbtnilvraini hoooenum- Subgenus well. chromosome as in ber variation subgenus substantial in displays genome subgenus genus sized that average showed the (2011) than subgenera. al. the et Passiflora across Yotoko size example, genome For in differences nificant te aclrpatgnr AvrzadWne 2003; Wendel evolution in non-concerted and copies of problem nrITS (Alvarez The of 2003). genera in al. et and plant Bailey 2010) al. in vascular et both Mader other 2004; documented Hansen well 2003; 2006). (Porter-Utley for been nrITS Hearn in data has 2005; variation intra-individual sequences of Freudenstein of and problem sources (Muschner the Krosnick However, primary Passifloraceae 2003; the al. in et of relationships one reconstructing been has nrITS ih19seisof species 139 with swl so eainhp ihnsubgenus within relationships on as well as ncsso yrdzto n/rplpodzto (Porter- polyploidization 2004). and/or Hansen 2003; hybridization Utley of cases in 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 700 o ag ao apesc sta nlddhr,it here, included that as such sample taxon large a For hlgntcUiiyo oeua Markers— Molecular of Utility Phylogenetic n .suberosa P. 2(aradBuebr 99.Subgenus 1959). Beuzenberg and (Hair 12 = Bryonioides n a eoeapoiaeytretmslarger times three approximately genome a has ,tog n on nabsllnaeis lineage basal a in count one though 6, = and ssp. Deidamioides Tetrapathea Passiflora n supersection and , litoralis Passiflora Passiflora Passiflora Decaloba Passiflora Astrophea .Teeacsin eeremoved were accessions These ). Passiflora Decaloba per ob otproblematic most be to appears eaiet subgenus to relative n section Hne 2004). (Hansen included.Itisalsothefirst (nrITS, 2(ioi chromosome (mitotic 22 = supersection sgenerally is n is =10or11inafewspe- scaatrzdb sig- by characterized is Passiflora .suberosa P. andalliedsubgenera, n Tryphostemmatoides trnL-F Decaloba 2(asne al. et (Hansen 12 = Passiflora ndhF N Decaloba n cG)is ncpGS) and , n nw poly- known , Decaloba. UCLEAR Cieca =9(meiotic ssp. So and (Snow Decaloba Tetrapathea aae is dataset Passiflora Decaloba, ,super- suberosa .Com- carries L n OCI The =9 — is is osrea aubeto o hlgntcreconstruction phylogenetic for tool valuable a in as serve to xrse oyo ltmn yteae(mhilrand reconstruction phylogenetic (Emshwiller for within 2003) al. synthetase et Doyle glutamine 1999; Doyle of copy expressed cosotru eeaa ela within as well as genera outgroup across ceieteesqecs(..peec fmlil oisor copies multiple hybridization). of char- of presence evidence further (e.g. to sequences cloning these future acterize primer for unexpected selected in with to were taxa differences due placements Any regions. by be gap large to caused and/or hypothesized location lengths are sequence these dataset; shorter ncpGS subgenus the in by supersections among variation Decaloba charac- most informative with 38% analy- supersectional provided ters current matrix the and data In ncpGS subgeneric the terminals. sis, the the among than provided at rather Yockteng gene levels signal this In from strongest analysis. data current the analysis, the (2004a) in Nadot’s explored and though characters, not indel was as useful that be could that gaps discrete diin hr eesvrleape flkl erroneous likely subgenus of within examples several placements were there subgenus addition, within resolved ously aa hools oims eue atosya phyloge- as cautiously used nrITS of in be markers use must netic the loci to chloroplast easily similar direct data, in Thus, most is morphology. are taxon with specific cases the conflict of suspected these placement the to that when due detected noted analyses and prior heteroplasmy, cited in (2007) positions al. phylogenetic et not Hansen of may examples events. or several may hybridization that from heteroplasmy stem or biparental variation individual in modes or relationships interpretation three complicate phylogenetic The to paternal, of 2007). potential the al. have et maternal, inheritance Hansen of 2006; al. be et (Muschner may chloroplast in complex h s fnpSfrrcntuto fpyoeei relation- phylogenetic within of support reconstruction strongly ships for gene, ncpGS nuclear of copy use single the a that apparently fact of is the it proportion with coupled high characters, informative The parsimony characters. informative parsimony ih“.itiaa p o.ie.(supersection ined. nov. and Republic), sp. Dominican intricata” “P. with altebilobata taxa, outgroup the of two However, weberbaueri 2A). Malesherbia Fig. level within the mental subgenera at and genera resolution outgroup substantial of provided and charac- generally characters informative and parsimony of The variable ters. source and primary substitutions quite the nucleotide Wurdack is single being 1995; with region align Jansen to 1995; and The straightforward Reeves Kim 2009). and 1995; Davis (Olmstead al. et compared regions evolution Scotland chloroplast of rate other high relatively to its to due chosen in relationships reconstructing for supersection supersection Xerogona, okegadNdt(04)frtue h chloroplast- the used first (2004a) Nadot and Yockteng C hsi h is td ouse to study first the is This Passiflora. HLOROPLAST Passiflora. e aawr eovdi nxetdpositions unexpected in resolved were taxa few A . ndhF odrsadGaeaa srsle within resolved is Guatemala) and Honduras es.(supersection Hemsl. Passiflora Disemma Cieca Passiflora lgmn ile 1 asmn informative parsimony 31% yielded alignment L Passiflora. OCI nta nta td,npSpoie 40% provided ncpGS study, initial that In sntspotda oohltcb the by monophyletic as supported not is Passiflora Teueo hools akr is markers chloroplast of use —The eas h oeo neiac fthe of inheritance of mode the because S sa uta aii) naddition, In Pacific). Austral Asia, (SE ti losrihfradt align to straightforward also is It . and .citrina P. dnaheterophylla, Adenia pce eovdi unexpected in resolved species ndhF Decaloba. Disemma, Passiflora Passiflora. Decaloba sapyoeei marker phylogenetic a as .M aDua (section MacDougal M. J. Passiflora hn)i resolved is China) Passiflora yyedn intra- yielding by o example, For yti ee In gene. this by hsmre was marker This eespuri- were tef with itself, Auriculata, (Supple- P. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 03 RSIKE L:PSILR UGNSDCLB 701 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK 2013] ihsrn upr ntecmie nlss o example, For analysis. combined the of in placement support for strong resolved were with support species same weak these whereas species, or individual resolution no provided analysis. combined the in 98% subgenus to alone) to sister subgenus for as support and analysis, for combined Support the F). 99% clade has clade 2, Deidamioides same (Fig. this support analysis, jackknife combined subgenus the resolves in phylogeny, whereas relation- the for across levels Decaloba resolution all and at support ships which greatest dataset, higher the nrITS the the did provided had example, than For analysis clades partitions. resolved individual molecular identically analyses. for the combined values locus of jackknife the single many the general, eliminate in In to com- present enough the topologies in strong alternative present is signal total analysis the bined that suggests MP 47,032 This produced trees. dataset combined the whereas trees, MP and analysis ndhF individual analysis. combined the the in in clade same clade the particular for be support could a sup- branch signal for between hidden differences 1996). port the that at Carpenter looking suggested by and (1999) quantified Nixon al. in et resulting 1989; often Gatesy (Kluge datasets, topologies among interact new to approach to signal combined important a allows is but It datasets, tree. individual relationships the the investigate within resolves levels satisfactorily all at none simultaneously levels genus, taxonomic varying the at across support and resolution provide n oeioae emnlcae nsubgenus in clades subgenus terminal isolated some and in reconstruction genetic unexpectedly region placed the of Taxa cloning of for amplified. copy prioritized were selectively paralogous a was or that heteroplasmy true of reflect may cases anomalies apparent analy- these MP alternatively, data; single-locus supported the in well of 70% are sis > but of values morphology jackknife and with markers other by group. this of monophyly the support do here ndhF h titcness(upeetlFg B,wt h excep- the with subgenus 2B), of the Fig. tions (Supplemental at consensus relationships strict reconstructing the genera. outgroup in of valuable level most the be analysis, to The unresolved. current generally strict was the the consensus yet characters, informative In parsimony 27% (2006). included Krosnick and al. (2005) Freudenstein et and Krosnick by later and ntegns h akrwl tl evlal o phyloge- for data. valuable of be sources tional still nodes will deeper in marker reconstruction at netic the data genus, other the on in based relationships established tionships Because taxa. the by be these would resolved for inheritance plastid interesting of pollina- mode extremely Controlled the placement. determine erroneous to tions their of cause the nsvrlcss titcnesso h niiuldatasets individual the of consensus strict cases, several In ncpGS, nrITS, molecular the of analyses individual The hs eut r nxetdbsdo eouinprovided resolution on based unexpected are results These C region chloroplast The OMBINED and , aa hl l te igelcstplge examined topologies single-locus other all while data, ndhF smnpyei ih8%jckiesupport jackknife 83% with monophyletic as Tetrapathea. trnL-F hs eut eems ieydet missing to due likely most were results These . M rmtenISdtst(1)icesst 9 in 99% to increases (81%) dataset nrITS the from OLECULAR ndhF aaesec rdcdmr hn100,000 than more produced each datasets Astrophea, einaeoealcnretwt rela- with congruent overall are region Passiflora Decaloba D Passiflora ATA trnL-F Passiflora Wieteidvda datasets individual the —While at fsubgenus of parts ndhF fue ncnetwt addi- with concert in used if a is tlzdfrphylo- for utilized first was nrae rm8%(nrITS 83% from increases yMshe ta.(2003), al. at Muschner by mlcn oinvestigate to amplicons slreyursle in unresolved largely is trnL-F trnL-F Deidamioides, Decaloba aaappear data Astrophea Tetrapathea dataset and + h oohl ftie aoseeadPsilra,as Passifloreae, and Paropsieae tribes Basananthe of monophyly the to study, sister present as the In genera. containing clade a h Pte.I ouk (2012), Tokuoka In tree. MP the 02.I diin h P I lsiiainrecognizes classification Passifloraceae Although 2009). of III al. part et (Bremer APG + as s.l. Turneraceae the Passifloraceae and addition, Malesherbiaceae to In Tokuoka 2009; sister al. et 2012). Korotkova is 2005; al. whereas et 2003), Malesherbiaceae (Davis al. Turneraceae et Sosa others, 2002; al. et in groups Chase sister 2000; are al. they et (Chase studies, some In studies. phylogenetic genus Tryphostemmatoides— Section Deidamioides fruits. fragrant large from coat, seed seed of unrecaulesced reticulate dispersal corolla, mammal and and and small calyx subequal two bracts, with floral Krosnick 2005) (sensu Freudenstein peduncle primary and a none of bud, nectaries presence vegetative marginal, laminar nectaries, or the petiolar on two prophylls stipules, small two of include presence may of glabrous, whole number chromosome a habit, as liana genus the genus. the the unite of that monophyly Characteristics support strongly topologies BI and ML, MP, the subgenera, recognized all representing species 139 the in analysis. another one present in to relative genera and sampling subfamilies of tions generic-level of monophyly the Passiflora, test limited to used primarily the was Passifloraceae As (Paropsieae). upre sssesi h LadB ooois u are but topologies, BI with and grade basal ML a the as in resolved sisters as study, genera supported current 15 the containing with In densest clade s.s., larger the Passifloraceae a analysis, provides that for In date represented. (2012) to and Tokuoka sampling (Feuillet under- However, poorly recognized been have stood. currently Passifloraceae in genera 2007) MacDougal 17 the among MacDougal and Basananthe Feuillet 1974; and 1971, 2007). Passifloreae Wilde recognized: (De are Paropsieae Turneraceae tribes Within and two sampling. greater Passifloraceae, Malesherbiaceae much require of will Passifloraceae resolution to relationships confident analysis, the present the of in outgroup the as hl h IadM re aemc rae eesof levels greater of placement much The have support. trees strong with ML it of and much least resolution, the BI is methods subgenus tree the of MP backbone analyses while the the three, combined to different the respect The Of with three resolved BI). together. and the ML, to analyzed (MP, used robust are is loci phylogeny dataset four strongly-supported a all datasets produce when individual to analysis the resolution combining within and combined is signal support jackknife hidden the in that in increase suggests The among support 3). relationships 2, jackknife (Figs. of resolved fully strong are resolution taxa with same no these whereas shows genera, outgroup 1C) Fig. Supplemen- ncpGS; and tal (nrITS dataset nuclear combined the asfoaSbeu srpe itrt Subgenus to Sister Astrophea Subgenus Passiflora Passiflora— Genus The hlgntcRltosisAogOtru Genera— Outgroup Among Relationships Phylogenetic Astrophea Paropsia ti o osbet ofdnl eov h posi- the resolve confidently to possible not is it and Psilra)i eovda itrto sister as resolved is (Passifloreae) Passiflora Passiflora eog otiePrpia,while Paropsieae, tribe to belongs Fg ld )cnit f6 pce of species 60 of consists A) Clade 2 (Fig. asfoa Basananthe Passiflora, Malesherbia h Ltplg osntsupport not does topology ML The . Basananthe eogt asfoee Relationships Passifloreae. to belong ihatxnsml htincluded that sample taxon a With aaate Passiflora Basananthe, Paropsia and Adenia Adenia Paropsia Malesherbia Turnera and srsle ssse to sister as resolved is ssrnl supported strongly is n eea additional several and srsle ssse to sister as resolved is Paropsia n below 2 lnsnearly plants 12, = a aidacross varied has a designated was Passiflora Basananthe and r weakly are Decaloba, Paropsia Adenia. Adenia, sub- in Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 702 noeseisi subgenus in species one in r loosre nafwseisi subgenus leaves in Compound species whole. few a a in as observed genus leaves, also the operculum are compound in plicate have condition a also rare they and a comm.); tendril pers. a Feuillet, in (C. gla- ending pedunculate completely cymes have species are simple two these species interestingly, Both and brous, here. presented to analyses sister as ported hr hs pce eersle ssse osubgenus (2006) to al. sister et as Hansen resolved ovalis in Passiflora were clade Decaloba. species same these the where of placement subgenus the to sister cirrhiflora, as supported P. ovalis, P. eemnpyei ihmdrt otta support. bootstrap moderate with monophyletic were ot asne l 20)icue l he pce,and species, three all included (2006) al. that found et Hansen port. ( sections three of Deidamioides, consisting Subgenus lineage pedicel. supported per of bracts recaulescence three and Deidamioides in flowers, resulting and bracts presence bracts, floral peduncle, stipules, primary large the of of synapo- loss potential including with morphies analysis, current the in monophyletic Tetrastylis— and genus Deidamioides, Polyanthea, Sections filaments coronal peduncle, outer or color. and primary in absent series, yellow the mostly base, 2–3 in of blade filaments the retention coronal at pubescence, nectaries scar- reduced petiolar include may sessile A like clade for characteristics morphological 4752GR within made MacDougal been has (section count A clade chromosome small one with Only climbers section slender leaves. generally in are and morphology: disks species adhesive tendrils, to without Tryphostemmatoides respect trees with small–medium A divergent clade of in whereas monophyly extremely plants However, the 2004). are MacDougal as and unexpected (Ulmer not are subgenus anal- their results in Yockteng result is These similar genus. and a the with found of lineage ysis, also remainder (2004a) monophyletic the Nadot to a and sister as as supported resolved strongly is Astrophea analysis, current the In 1971). subgenus Wilde (De Passifloreae tribe for in nei oSuhAeiawt hoooecut of 2 counts or trees chromosome medium with America to South small to and endemic shrubs, lianas, shrubby or woody n ao 20a nlddonly included (2004a) subgenus Nadot In to sister and confidence. as resolved only with was it (2003), place and al. to et difficult Muschner been are and therefore analysis morphologically, current another have the one from in divergent sampled extremely species three The Vitta. tion ( eovda itrt h etof rest the to sister as resolved .cirrhiflora P. ihncaeB, clade Within ugnsPsilr itrt ugnsDeidamioides Subgenus to Sister Passiflora Subgenus Astrophea n Tetrastylis 4(er 97 eMl ta.20) oete species tree Some 2001). al. et Melo De 1987; (Berry 24 = Passiflora Astrophea +subgenus Astrophea .tryphostemmatoides P. Deidamioides .oai,P cirrhiflora, P. ovalis, P. ,a ssection is as ), aehge re rnhn,asynapomorphy a branching, order higher have per gi ncaeB hstm sawell- a as time this B, clade in again appears and otistospecies, two contains Fg ldsB )i togyspotdas supported strongly is C) B, Clades 2 (Fig. Tryphostemmatoides Tetrastylis .Mcogl nul aa.Shared data). unpubl. MacDougal, J. ; r inswt nrnhdtnrl or tendrils unbranched with lianas are sspotda oohltc Subgenus monophyletic. as supported is asfoacirrhiflora Passiflora aebace ediswt terminal with tendrils branched have .deidamioides P. Deidamioides a eni ob o oetime some for doubt in been has and n h lsl allied closely the and Deidamioides Decaloba .Section ). .deidamioides, P. asfoaovalis Passiflora Passiflora itrt subgenus to sister and Passiflora. section : ld ,wihcontains which B, Clade . .cirrhiflora, P. nbt h LadBI and ML the both in P. .ovalis P. Polyanthea .deidamioides P. aff. ( .deidamioides P. smdrtl sup- moderately is ihmdrt sup- moderate with Passiflora. Tryphostemmatoides gracillima hsdfesfrom differs This and smoderately is a included was Passiflora smonotypic is .contracta P. hc was which .contracta P. Polyanthea, Astrophea Yockteng ,2 together n .Sec- ). n =22, Sub- =12 and . ltosfrteepat,oea eitdi i.2 h other the subgenus the 2, In non-monophyletic Fig. in a low. depicted indicating as is one res- plants, support alternative these two though for show olutions trees analyses, individual BI the analysis, and MP ML the in 0sre,a oasalnme fseisnse elsewhere nested species of subgenus. number the small in a do as series, 10 ooa iaet rmfu rmr eist uttoor supersections of two just reduction subgenus of to bers by series more marked or subgenus also three: four is from filaments D coronal Clade character. this subgenus of subgenus Polyanthea skonfo igecutof count single 12) = a Supersection 1959). (n Beuzenberg from subgenus this known for a is number lack stria- chromosome that vertical The has lianas tions). operculum canopy the dioecious (instead, are operculum plicate species subgenus three from the distinguished as This readily Zealand. New is and subgenus Guinea, New Papua Australia, from ( species three subgenus a bandb rsikadFednti 20) who (2005), Freudenstein and but Krosnick genus, result included by the same This in obtained related. lineages distantly was only OW are the groups of in two clade these both OW contains other only thus the D is K) clade 2 Fig. obndmlclrdtst(i.2Cae ,E strongly E) subgenus D, OW subgenus Clades of 2 placement (Fig. supports dataset molecular combined hrce sntosre ncaeC(subgenus C clade in observed not is character Astrophea rmsupersection from ncaeC n a olnto tlattie uhgreater Much completely. twice. patterns these least ment at subgenus pollination in bat sampling and times C, multiple sug- clade evolved here in pollination presented hummingbird phylogeny that The gests these taxa. among relationships divergent of highly understanding our clarify ther ihhge re rnhn ihnterinflorescences. are in but their Passifloraceae, rare the within relatively in common branching are species cymes includes order Compound also higher D Clade with Austral-Pacific. have the and OW Asia, supersection the in resulted to dispersals supersection Tetrapathea separate within of two occurred monophyly that the appears testing on ld .Otiigcrmsm onsfrtefu species four in the species for the sections counts of in chromosome any Obtaining for B. available clade are (corona counts chromosome series more or genus five in in corona reduced well-developed presence the a and inflorescence, of the in branching order higher deidamioides rms(øgne ta.21) olntr o h tesin others the for syn- unknown. pollinators are pollination 2012); B bat clade al. evolved et both (Jørgensen have dromes here) sampled (not Subgenus ugnsTtaahaSse oSbeu Decaloba— Subgenus to Sister Tetrapathea Subgenus yaoopista unite that Synapomorphies Passiflora .kuranda P. Decaloba .Hge re rnhn saanosre in observed again is branching order Higher ). caeA aebace nlrsecs u this but inflorescences, branched have A) (clade Deidamioides Tetrapathea, .ovalis P. oynha Deidamioides, Polyanthea, nteAsrlPcfcadascn vn that event second a and Austral-Pacific the in ihsubgenus with Tetrapathea Decaloba, .krna .aurantioides, P. kuranda, P. Pterosperma is Tetrapathea Passiflora: Decaloba. n Passiflora: Disemma caeD.Subgenus D). (clade .Tebs hoooenme o sub- for number chromosome base The ). So n aDua 93,btno but 1993), MacDougal and (Snow 9 = and Passiflora mligmlil an rlse of losses or gains multiple implying n ste beti te lineages other in absent then is and sections caeE srsle smonophyletic as resolved is E) (clade .tetrandra P. Disemma Passiflora napeiiayaayi focused analysis preliminary a in oee,tebslybranching basally the However, and a w eisa oms mem- most do as series two has n htrsle nsubgenus in resulted that one oete pce nsubgenus in species tree some .crhfoa .ovalis, P. cirrhiflora, P. Disemma ersyi,Deidamioides, Tetrastylis, ol erqie odocu- to required be would Hahniopathanthus nIdcia Southeast Indochina, in and .tetrandra P. a nld h osof loss the include may swl snn species nine as well as Tetrapathea Tetrapathea (subgenus Tetrastylis and Tetrapathea Passiflora. Disemma. .tetrandra P. Passiflora Hi and (Hair comprises a fur- may Decaloba, ae3– have itrto sister Decaloba and Clade with and The P. It + ) Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. oiino hsseiswsfrteaie yKrosnick by examined first here. obtained those was to similar results species obtained who (2006), this of subgenus position in placed (2003) MacDougal and Feuillet that America Central and Mexico from subgenus known in poorly the Killip places analysis current the ingly, fteeseisso aito ncre ubramong number carpel 1994; in ( three variation (Endress all plants show 2006), angiosperms individual species al. et in these Krosnick of 1997; rare Igersheim and extremely three Endress phenom- these is this Though by number. enon pro- carpel shared in is deter- variability synapomorphy fruit is be species if second only observing The can and duced. crosses sex performing that by such mined However, exagger- dioecious plant. less the functionally or of is sex more the are on organs depending ated these though present, are Interestingly, In 2009). al. endemics. et (Krosnick dioecy Zealand of relatively New aurantioides is P. condition tetrandra, the in as species, this common in dioecy of lution subgenus of isolation that 1994), hypothesized (MacDougal Tetrapathea andromonoecious tionally aDua 93 asne l 06.Telwrcount lower within The sublineage of large discussion 2006). (see a subgenus for al. the synapomorphy a et be to Hansen appears nor- is 1993; clade MacDougal this for number mally chromosome on violet The or derived). corona. purple, red, secondarily the of bands considered multiple have three then species to Many more, two just (rarely to corona series the of membranous reduction plicate a operculum, of floral presence var- leaves, including juvenile synapomorphies, in of iegation number Hansen a Subgenus by 2004a; here. supported supported Nadot is strongly is and and 2006) Yockteng al. 2003; et al. et (Muschner 03 RSIKE L:PSILR UGNSDCLB 703 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK 2013] lentv eouin euti rcooyi h MP the in (i.e. trichotomy tetrandra consensus a in subgenus strict result of resolutions remainder the alternative to sister turn genus have flowers female and In carpels stamens. aborted rudimentary only have some While genus. the within of outside Passifloraceae Tetrapathea subgenus mono- for clade. support the reducing of may phyly not, thus does autapomorphies, analysis many MP the that while indicate analysis, current the subgenus resolve analyses BI subgenera was species tetrandra this P. that subgenus found within (2004a) resolved Nadot and Yockteng tetrandra asthelonerepresentativeofsubgenus kuranda P. 3–5; ssse otegenus supported the analyses to BI sister that as showed (2006) al. et w erdciecaatrsisspotmnpyyof monophyly support characteristics reproductive Two ugnsDclb CaeF)— (Clade Decaloba Subgenus .kuranda: P. n Decaloba eane fsubgenus of remainder , ,but 6, = a ensmlryusal nrcn analyses: recent in unstable similarly been has Tetrapathea. srpe,Deidamioides, Astrophea, + steol ld odslydoc.Gen(1972) Green dioecy. display to clade only the is sursle ttebs facaecontaining clade a of base the at unresolved as r l ieiu.Doc sosre in observed is Dioecy dioecious. all are .aurantioides P. .tetrandra P. 5–8). a enspotdi eetanalyses recent in supported been has n eaoa asfoaobovata Passiflora Decaloba. .tetrandra P. .aurantioides, P. a lobe eotd(nwand (Snow reported been also has 9 = Dilkea is,tetreseisi subgenus in species three the First, and .kuranda P. Passiflora behavesasalongbranchdueto aa to basal Decaloba, .kuranda P. at h atta h Land ML the that fact The Mast. Deidamioides. Tetrapathea .tetrandra P. Passiflora – carpels; 2–4 : n ru eo) Interest- below). group 6 = Decaloba and .tetrandra, P. ohsaesadcarpels and stamens both h oohl fsub- of monophyly The (e.g. .tetrandra, P. + er 20)showed (2006) Hearn ipa ayn levels varying display Decaloba, pce a efunc- be may species .aurantioides P. Adenia smnpyei in monophyletic as aiiae h evo- the facilitated .We included When ). h phylogenetic The Decaloba erpte,P. Tetrapathea, .aurantioides P. salreliana large a is ,bti rare is but ), aeflowers male n Hansen and .tetrandra P. hc sin is which .kuranda P. .obovata P. Decaloba .These , P. P. : n Iaaye,bti neovdi h Ptopology. MP the in unresolved Hahniopathanthus is but obovata Passiflora analyses, BI and comprises and monophyletic, as supersection supported I, clade strongly Decaloba— of is Rest the to Sister 1993). MacDougal and (Snow is number believed some Chromo- are 2000). MacDougal fruits and (Gilbert The bats by filaments. dispersed coronal be to of series 3–4 (2) peduncle, and primary a of retention seeds, winged conspicuously itrt supersection to sister of monophyly the I, clade Within supersection peduncle. primary the of subgenus Deidamioides in (lost petiole features, the along morphological pairs nectaries multiple extrafloral of tips, of shoot number cernuous leaves, a unlobed including by recognized easily ( Mallet ssmlrt pce nsubgenus in Superficially, species to filaments. similar coronal is of series two and Decaloba Hahniopathanthus, lrlbat ntepdcl n bec fcrnlbanding. three analysis, coronal of current of one absence the of and pedicel, In reduction the extreme stipules on or supersection foliose bracts floral loss large, in bracts; tips; floral shoot placed and cernuous of Species presence ters: data. molecular Hahniopathanthus the by pedicellaris Meerman, America: Central sub- and Mexico southeastern of to endemic MacDougal member species four a of consists section and as recognized been Gilbert since genus has 1999; 2003; it but MacDougal subgenus 2000), al. in and group et clas- this Earlier (Feuillet 2006). placed (Muschner al. had et Hansen sifications analyses 2004a; Nadot previous and Yockteng within in lineage branching obtained basally most the subgenus is and analysis, Pterosperma yahsv ik,a nsubgenus in climb as Juveniles operculum. disks, erect adhesive an of by presence and form the not was contamination placement. unexpected of that this of isolation confirm cause DNA to second sequenced a was analysis, current the ssse otermiigtx nsection subgenus in taxa remaining from the to one sister as schemes, by inclusion taxon all one Under sis. investi- species was removing Pterosperma attraction long-branch by possible gated study, placement; that same this in for support weak found (2006) Krosnick etre.Jvnl evsaeplae saetelae in leaves the are as peltate, of laminar species are marginal most of leaves presence Juvenile and nectaries. peduncle primary the of supersection with tures obovata Tryphostemmatoides uescinHhiptatu asfoaobovata Passiflora + Hahniopathanthus Supersection uescinPeopra(ld G)— (Clade Pterosperma Supersection Although Decaloba oee,ti pce ossaesm oal fea- notable some share does species this However, . .eueidipabulum P. sspotdb rsneo lct operculum plicate a of presence by supported is Decaloba. .microstipula P. .M aDua,and MacDougal, M. J. Decaloba. and swl upre smnpyei ntecurrent the in monophyletic as supported well is .obovata P. section Hahniopathanthus McogladHne 03.Ti super- This 2003). Hansen and (MacDougal Hahniopathanthus Hahniopathanthus n aesvrlntbemrhlgclcharac- morphological notable several have sqiedfeetfo pce nsection in species from different quite is ihrgr omrhlgclcharacters. morphological to regard with u edisaentbace in branched not are tendrils but , lcmn fti pce nsubgenus in species this of placement rmasnl on of count single a from 9 = ld sdsigihdb h absence the by distinguished is H Clade Mayapathanthus Hahniopathanthus asfoalancetillensisPassiflora hspaeeti iia oresults to similar is placement This Hahniopathanthus sqiedsic eaiet subgenus to relative distinct quite is o ape ee.Teeseisare species These here). sampled not Hahniopathanthus, .obovata P. .E ibr .M MacDougal, M. J. & Gilbert E. L. tefi togysupported strongly is itself ld Fg ldsH I) H, Clades 2 (Fig. H Clade Tetrapathea h hoooenumber chromosome The . uigpyoeei analy- phylogenetic during .eueidipabulum P. swal upre as supported weakly is ,pu h eane of remainder the plus ), .obovata P. + Deidamioides .obovata P. caeI yteML the by I) (clade Hahniopathanthus. .M aDua & MacDougal M. J. nldn absence including ae ngrowth on based .microstipula P. .pedicellaris P. a resolved was Supersection Deidamioides (subgenus .obovata P. .obovata P. np & Knapp section In P. P. ), Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 704 97 rgr18) n eio(rhm17) Recently, of 1976). seed (Graham fossil Mexico unambiguous (Ra an and Europe 1982), Eastern Gregor in 1967; Miocene and Eocene unconfirmed whereas on 2002), (based Passiflora Gengler-Nowak MYA Malesherbiaceae; 37 71– to of 2006) ca. age Hearn from the 2005; estimates range al. et s. age (Davis s. MYA Recent Passifloraceae 65 of America. emergence Central the to for endemic all are ie httosra iegsof lineages serial two that given in ships comm.). pers. Carvalho (M. Panama in discovered was relationships clade. clarify this to in help may studies cytological supersection future in (Hansen for those and for MacDougal species available this by are on ing counts count No ambiguous 2006). al. an et on based 12 supersection for oi Wacso o h eu n ldswti tuntil it within clades and (subgenus to genus E parsimonious the most for clades ancestor is NW it a Malesherbiaceae, posit are as NW, are supersection OW supersections the and Caribbean, to led multiflora of Passiflora that placement event The graphic lineage. the for the origin of remainder multiflora P. the to sister multiflora P. the Within information lineage. sig- this genetic a in occurred of that has reduction suggest or (Krosnick, preliminary, rearrangement clade while nificant data, this These multiple of prep.). outside whereas the in detected date, of been to species have sequenced in copies been present have is that (CRC) group CLAW copy CRABS single a of Similarly, data). unpubl. the Krosnick, S. of and outside Utley absent be may copy Passiflora subgenera and synthetase glutamine of the subgenus in amplified copy preferentially was cytosolic-expressed (cytGS) a that the Passiflora of makeup genetic genus. species the these of of rest the makeup to chromosomal relative the in shift distinguished of historical is number clade chromosome a this having dispersed however, by often notably, are Most small Seeds birds. to edges. by lianas forest forest at from climbers habit and the vines than in shorter reduction much and row row, inner outer the with rows the two of to reduction corona pubescence, conspicuous seeds, purple-black small small similarities, fruits, nectaries, one, laminar morphological to abaxial two or of from submarginal prophylls number vegetative of a reduction including share taxa These genus eetdatmt oapiyctSi h eane fsub- of remainder the in genus cytGS (ncpGS). amplify to copy attempts chloroplast-expressed Repeated the amplified primers hl nepii xmnto fboegahclrelation- biogeographical of examination explicit an While n The asfoamlilr itrt uescinDisemma)— Supersection to Sister multiflora Passiflora in differences confirm to begun has work molecular Recent Decaloba Decaloba = o xml,Yctn n ao 20b found (2004b) Nadot and Yockteng example, For . Passiflora aebe nucsfl ugsigta h cytGS the that suggesting unsuccessful, been have tefapae a 0MA(er 06.Several 2006). (Hearn MYA 40 ca. appeared itself Decaloba, Group— 6 n supersection + supersection + Passiflora ru Fg ld ,acaecontaining clade a K, Clade 2 (Fig. group 6 = (supersections n Fg ld )aersle ihncaeJ. clade within resolved are J) Clade 2 (Fig. ru caeJ,floe yabiogeo- a by followed J), (clade group 6 = Hahniopathanthus erpte,Diaiie,Astrophea Deidamioides, Tetrapathea, a o odce spr fti study, this of part as conducted not was sntv osuhrms lrd n the and Florida southernmost to native is hl nters ftegns h same the genus, the of rest the in while h eann i uescin fsub- of supersections six remaining The Tetrapathea osl aebe ecie rmthe from described been have fossils n ld eaiet h etof rest the to relative clade 6 = Disemma Pterosperma Pterosperma Disemma n (subgenus K and ) Passiflora Passiflora a oe as noted was n n ugssaNwWorld New a suggests ieg K Porter- (K. lineage 6 = ,idctn major a indicating 6, = swl upre as supported well is and .obovata, P. and Fg ldsA C) A, clades 2 (Fig. rmteMiocene the from n Hahniopathanthus Hahniopathanthus Hahniopathanthus ´ ebr of members 6 = k 90 Mai 1960; sky n u focus- but Disemma Decaloba =11or n and =6 ) . ie ttebs fteadoyohr.Hwvr this However, a androgynophore. of absence the and of maturity, base at the green at flower, are limen tube-shaped a that chamber, has fruits species, nectar and Australian larger five-lobed the Guinea the with as New common such Papua in features to of endemic number supersection is of species base the This at unresolved species this section Asian el n akalmna h aeo h androgynophore. the resolve of here base presented section analyses the monotypic BI at and ML limen a the a with Interestingly, sepals lack operculum, supersection. and erect the an keel, with flowers chamber, of tube-shaped nectar have remainder 5-lobed clade a the this in to species and three sister monophyletic All as as resolved supported strongly is is Australia) cies, u hstatas cusesweei the in elsewhere occurs also trait this but hti a ihybace nlrsecs etr htis that feature a inflorescences, supersection branched of characteristic highly has it to that super- distal in synapomorphies apparent section of supersections lack the of any because tify of multiflora P. position the supersection for lution support does analysis Disemma MP the that ye ol o eov h oiino hscaerltv to relative clade this of subgenus position of the rest the resolve not also could (2006) lyses of Krosnick monophyly the sampling, confirmed outgroup expanded much of of to sister as resolved was taxon NW limited to study, with sister (2005) that group among in the Freudenstein of even sampling; and monophyly observed Krosnick the the confirmed species. diversity high below, related the and morphological to closely due level of features sectional unifying level clear the no at has supersection apparent are sections: phies three been into divided they long Octandranthus, is features have group morphological The group unique display. the this Guinea. of New of because debated Papua affinities and phylogenetic Australia, The Asia, Southeast India, rbtdtruhu nohn,SuhatAi n the Passifloraceae for and estimates age Asia the and Southeast Taking Pacific. Indochina, Austral throughout tributed supersection ihcniec ilb difficult. be strong will confidence without hypotheses with of possible However, these among dispersal discerning 2004). evidence, long-distance fossil MacDougal most via and 3) that (Ulmer or given 2007), seeds, 1999; al. Sher 1981; et (Beringian al. Pleistocene Waltari et 1975; Hopkins the via 1981; during Colinvaux recently Bridge Wolfe hypothesis: more 2) Land 1993); Bering 1972; Luckow the and Lavin McKenna 1985; the Tiffney Eocene/Oligocene hypothesis: the via during from Pacific (Boreotropics Bridge moved Land three Asia/Austral of Atlantic have any to North may by America World species Old Central/South the 1) in mechanisms: arrived K possible and E clades of ihnsupersection Within h urn nlsssossrn upr o monophyly for support strong shows analysis current The Supersection .multiflora P. Disemma Passiflora Disemma Disemma 7%jckiespot,btde o rvd reso- provide not does but support), jackknife (75% n supersection and u oehtwae upr o placement for support weaker somewhat but Pterosperma. Disemma Octandranthus, noacut ti osbeta h ancestors the that possible is it account, into and ssse to sister as Disemma sawhole. a as ihfl apigo l 1seisand species 21 all of sampling full With . Hollrungiella Hollrungiella. Decaloba hc,a ecie bv,aedis- are above, described as which, ) Disemma, .holosericea P. ossso 1seisfo China, from species 21 of consists opooia etrssae by shared features Morphological Passiflora Disemma asfoamultiflora Passiflora nKonc (2006), Krosnick In . hra h Paayi leaves analysis MP the whereas Disemma Disemma, Disemma .multiflora P. ( .hollrungii P. section hl iie synapomor- limited While .multiflora P. caeK.I snotable is It K). (clade r nmldispersed animal are nta of instead section r ifcl oiden- to difficult are u asmn ana- parsimony but Disemma n group. 6 = a eovdas resolved was ssse othe to sister as ) Octandranthus, suuulin unusual is Disemma. .multiflora P. ssse to sister as trespe- (three Disemma. Disemma, Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 03 RSIKE L:PSILR UGNSDCLB 705 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK 2013] eane ftespreto.Mroe,teremaining and the supersection to Krosnick supersection Moreover, respect in supersection. 2003; the to the species unrelated al. be of to 2006) et remainder al. et Hansen (Muschner 2005; Freudenstein analyses Krosnick recent 2004; supersection of MacDougal type earlier, the and noted As 2005). (Ulmer Freudenstein and years several for supersection of monophyly the ld ,seblw ont h oso the of loss within The not. placed do (here below) supersection see M, the clade in species remaining whereas monophyletic: show not that is con- here also presented is results supersection character phylogenetic this Notably, with subgenus. gruent loss the single of a rest the supports analysis topol- present the the of the contrast, In in marker. obtained phylogenetic ogy a vagile as evolutionarily useful too be be to might intron subgenus, the the that across suggesting losses multiple hypothesize to monious of in analysis their the from present obtained topology be the However, to genus. shown was and intron the supersections analysis, their subgenus in In informative relationships interesting potentially for the a an as marker of (2006) L), phylogenetic al. loss et Clade Hansen is by 3 noted L first 2, clade (Figs. uniting analysis synapomorphy current the in with common in characteristics Section sepals. unkeeled some has Octandranthus, also species ruswr lcdi supersection in placed were groups Herna and (MacDougal bxa etre ctee ndfuelnsbtentepri- the within between (advanced lines veins diffuse mary in have scattered others nectaries inflores- whereas Passifloreae) abaxial the tribe within for some branching (primitive example, cences order For higher challenging. display placement species characteristics their plesiomorphic make and that apomorphic com- of with species binations 22 includes (2003), MacDougal and supersection Feuillet petals. contrast, reduced and the In androgynophore, between short lines a in veins, nor primary submarginal strictly nectaries neither laminar are nectaries, that of petiolar auriculate presence of M)— by pair distinguished single a species eight (Clade of consists (2003), Paraphyletic Auriculata, are Multiflora subgenus. the of rest the to ative 01 øgne n egn 04 n the and 2004) Weigend and Jørgensen 2001; supersection sion, supersections of position Hahniopathanthus, basal the supports obndaayi.Seisi hscaehv truncated species. some have in characters these clade of reversals with this operculum, the widened a in in and inflorescences, monophyletic branched extensively midveins, Species as supported analysis. strongly is combined Asia) SE and ruspooe rvosy the previously: proposed groups discussion. the of remainder supersection uescinArclt n omrSupersection Former and Auriculata Supersection igeLs fro1Intron— rpoC1 of Loss Single ihncaeM w iegsaecnitn ihinformal with consistent are lineages two M, clade Within trnL Hahniopathanthus, rpoC1 / trnT scrusrbdb eiltadMacDougal and Feuillet by circumscribed as nrn neetta itnuse ld from L clade distinguishes that event an intron, Auriculata Multiflora pcrrgo niae hti a otparsi- most was it that indicated region spacer utfoa uiuaa iem,Pterosperma, Disemma, Auriculata, Multiflora, oal nicre pruu n smooth, and operculum incurved an notably and Multiflora ´ Disemma n oti h eane ftesub- the of remainder the in lost and es eiltadMcogl(2003) MacDougal and Feuillet sensu Auriculata dz21) neetnl,wiethese while Interestingly, 2014). ndez ilb eerdt scaeMfrthe for M clade as to referred be will Multiflora Octandranthus Multiflora Multiflora, .multiflora P. ecuieof (exclusive Multiflora hc eanteito,rel- intron, the retain which , Passiflora lhuhwal supported weakly Although ssoni hsadother and this in shown is , caeM.T vi confu- avoid To M). (clade lobbii Multiflora r aahltcwith paraphyletic are 1 pce,Indochina species, (17 scrusrbdby circumscribed as ru Srble al. et (Skrabal group .Ntsurprisingly, Not ). a enquestioned been has asfoamultiflora, Passiflora a h nrn the intron, the has rpoC1 .multiflora P. yFule and Feuillet by rpoC1 Supersection apoda Pterosperma, nrnalso intron Decaloba. intron, group )+ ein fteO.Tespreto otistoproblem- two complexes, contains supersection species The atic OW. the species, of Two regions Caribbean. Central are the Mexico, suberosa clade and P. States, this America, United South in southern America, species the The in rec- supersection. distributed currently the species 19 in has the ognized clade The of press). seven This in sampled fewer. (2003, study Porter-Utley present or floral by and two depth in seedlings, to examined in been three shape from leaf reduction peltate bract petals, of includ- clade loss the ing unite that synapomorphies clear several has ei ihteicuinof inclusion the clade. with the letic for known Supersection are synapomorphies morphological supersection Porter- 1993; 2007). MacDougal 2003, and Utley (Snow events hybridization of suberosa P. he uescin ssrn.Supersection strong. is supersections three America. Central spe- northern exhibit across three all radiations these cies they by geographically shared although analy- are supersections, BI synapomorphies the apparent from No only ML sis. supersections the relation- three for in well the support so among is strong weakly ships only only N–R) is there but Clades Likewise, analysis, 3 topology. BI (Fig. the clade in large supported this of and monophyly species) 22 Q, eea yaoopiseitbetween exist (1994). synapomorphies MacDougal by suggested Several as member, basal-most the reua eicne rgtoag rl,oet eea pairs several to one arils, orange bright dehiscence, irregular supersection eovdi h PadB nlss(ld )cnit fthree of consists N) (clade analyses supersections: BI and MP the in resolved revision taxonomic that among clear is relationships it required. be but detailed will M, clade the will in sampling unravel species is the Greater M, to here. It clade necessary it material. place in be available might species study of future to lack and similar for morphologically study somewhat this in sampled subgenus monotypic Escobar’s ( Andes the in radiations occurred distinct clade two that this appears within it and American, South with result, similar a Dominican found the to (2003) from similar leaves species is with relative undescribed Republic closest an its where intricata,” M clade “P. of part as subgenus supported in well supersections several to places similarities topology MP the but holosericea short M, P. clade supersection unusually within relationships or with glands associated Auriculata. leaf features the auriculate in androgynophores, have species some groups (2003), MacDougal bec fla aigto n rsneo tagtsottip shoot straight of presence growth. and variegation leaf include of M absence clade for similarities Morphological relatives). and apoda to related to sister ld eovssupersection resolves P Clade ihncaeN upr o h oohl fec fthe of each of monophyly the for support N, clade Within uescin ic hog Decaloba— Through Cieca Supersections truncata Passiflora ru) ihadtoa oln pce ( species lowland additional with group), .rufa P. asfoasierrae Passiflora .and L. ope xiisplpod ugsigahistory a suggesting polyploidy exhibits complex .auriculata. P. h LadB nlssarewt eadto regard with agree analyses BI and ML The sursle ttebs fthe of base the at unresolved as Bryonioides Decaloba Bryonioides Cieca eilt&J .Mcogl pce closely species a MacDougal, M. J. & Feuillet .pallida P. Decaloba ee,apol nesodseiswith species understood poorly a Regel, caeO 9species), 19 O, (clade ihsrn upr nyfo I no BI; from only support strong with rsneo neogtdfutwith fruit elongated an of presence : .suberosa P. eryalseisi ld are M clade in species all Nearly caeQ srsle smonophy- as resolved is Q) (clade .K soa,teoeseisin species one the Escobar, K. L. . r lontrlzdi various in naturalized also are L., .gracilis P. caeR a 3 pce) The species). 130 ca. R, (clade .auriculata P. Porphyropathanthus and Bryonioides .truncata P. .coriacea P. .Jc.e ikas Link ex Jacq. J. Bryonioides lobbii ucnre al. et Muschner . lobbii h etbranch next The .gracilis P. n Cieca clade. 6 = ssse to sister as eovdas resolved Decaloba ru and group and a not was , caeO) (clade auriculata us The Juss. (clade apoda and ,is Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 706 sigi hscnetbcuetefut r iia nsaeto shape in similar are fruits the because fruit. context to this capsular in reduced a esting often and tips, corona series, a single shoot ridges, a cernuous smooth mostly slightly with only seeds having by characterized recognize etof rest horned shortly to portedasbasalwithinthisclade,itisquitedistinctfromthe whereas carinate However, and bands, sepals. filaments with violet coronal corona absent, multiple two-ranked to a with reduced lamina, highly the series of inner base the the at teeth of opeeygaru,weespat ftermidrof 1994). remainder (MacDougal trichomes the petiolar supersection of and in plants Notably, species reduced, whereas reduced. highly glabrous, somewhat completely are are bracts nectaries floral stip- and gynoecium, zygomorphic ules a with apetalous are flowers –)wti subgenus within R–Y) ut and the Kunth including poorly exist, Several complexes America. species South understood Central and geograph- in Caribbean, wide radiations the its species to America, multiple due with partly distribution, known, well ical least the is R), otissection contains section + section p.) super- lineages: (p. major mono- the support two strongly of within analyses phyly MP lineages and BI ML, major The section. among resolution producing some often ridges. veins, rugulose vein with lateral seeds central grooved the and laminar than leaf, bilobed nectaries, shorter several a or petiolar by to united of equal is loss and tips, cernuous analyses, shoot including MP synapomorphies and morphological BI, distinct ML, the the in species). within recognized currently sampling 130 Supersection of largest (64 date the to supersection incorporates here sections sented two contains 2003), Decaloba MacDougal supersection and The (Feuillet America. South the and Ecuador, nteM n Itplge.I h Psrc consensus, strict MP the In filipes topologies. P. BI lutea, and ML section the to in sister as supported series weakly a then as named species was (1995). in it MacDougal and three by (1938), lineage Killip these by this noted among first were of Similarities monophyly supported. weakly though species, traits remaining evolved have containing to appear 1994). subgroup 1983, clade (MacDougal number pollination this the A wasp with in bracts. associated in floral species of the except absence of U, and, clade by banding represented highly is coronal lineage this of nec- reduced characteristic Also extrafloral plant. of the absence on complete taries in read- the diverse is by S most distinguished Clade is ily America. Central S and clade Caribbean, the America, Mexico, South in occurred have section and and 1989a) (MacDougal group section h aeo supersection of base the uescinDecaloba— Supersection apigfrtepeetsuyi es nuht reveal to enough dense is study present the for Sampling ihncaeS h LadB re upr aa clade basal a support trees BI and ML the S, clade Within Decaloba Bryonioides c.15seis.Tepyoeei nlsspre- analysis phylogenetic The species). 115 (ca. .tenella P. .lta .filipes, P. lutea, P. .cuneata P. Xerogona. Decaloba + caeW.Tesalro h w lds S, clades, two the of smaller The W). (clade .pavonis, P. Decaloba Xerogona .misera P. spr fsection of part as nsvrlrset:pat r annuals, are plants respects: several in ssrnl upre smonophyletic as supported strongly is asfoatenella, Passiflora Decaloba, Decaloba. il.cmlxsi oobaand Colombia in complexes Willd. hra eea pce radiations species several Whereas Bryonioides .p ihteinformal the with p. p. h ags ld Fg Clades 3 (Fig. clade largest The ut ope nohrprsof parts other in complex Kunth caeS n h eane of remainder the and S) (clade and asfoagracilis Passiflora and bilobata supersection oae l i rs)formally press) (in al. et Boza .tenella P. Xerogona .pavonis P. aedsiciehooked distinctive have Xerogona asfoatenella Passiflora Decaloba nana pce,is species, annual an ru Kli 1938), (Killip group Xerogona r neovdat unresolved are 1 pce)and species) (15 htscinis section That . ssse othe to sister as Decaloba C r parte pro DC. .gracilis P. swl sup- well is .alnifolia P. caeT) (clade sinter- is sexflora (clade P. is rmteohr nhvn ueosrw fcrnlfila- coronal floral oily of large, rows and divergent bracts. variegation, numerous quite leaf having conspicuous is no species in ments, This others W clade consensus. the of strict from base the MP at the unresolved is in but analyses, BI and ML nld bec fla aigto.Wti the Within variegation. leaf of absence informal include the of comprised lineage sexflora supported weakly a p.), p. h eto section of rest the os.e il srsle ssse othe to sister as resolved is for Mill. Mexico. ex diversity species and Houst. of America several Central center is The lineage in obs.). this pers. series this MacDougal, in known single (J. is group pollination a bee and Wasp to 2003). (MacDougal reduced corona maturity, at and leaves variegated strongly petals, reduced The informal highly species). the 13 in distin- (ca. recognized X also Clade are species and characteristics. trees includes morphological MP several and by BI, ML, guishable the in resolve appear to they necessary be also species. may these among data relationships sequence responsible, partially ML, more be (i.e. may but sampling approach taxon the Sparse analytical MP). of of BI, are modifications regardless lineage this resolved or within poorly color, relationships flower most However, bracts, corona. large features by as marked America, such South in pollination present are bat complexes and times, in four evolving least in at 1982). evolving hummingbird and with (Gilbert pollination variable, ocellate, mimics quite egg are often syndromes butterfly Pollination the as are between appear nectaries species pattern some These V-shaped a veins. in America. lami- primary abaxial arranged South of lowland presence nectaries the and nar by Andes characterized is the lineage in This but species diverse Caribbean, the high most and is Mexico, exhibits as America, supersection Central the clade in in species richness This total 130 circumscribed. the of currently S) (excluding clade 94 in p. ca. substan- p. a comprising represent radiation, to species appears tial clade This monophyletic. as in sampled is subgenus species latter the simi- with when analyses. species future leaves, Caribbean a lobed MacDougal, larly M. J. & hypothe- Feuillet is It leaves. that compound sized nearly to lobed Republic Dominican deeply the with and Rico includes Puerto inflorescences. from species clade unbranched known s and pre- this the bracts topologies Interestingly, from floral three distinguished small all having is in and supported sented, Caribbean strongly the is V, Clade group, cernuous. strongly of more tips are trait shoot this as cernuous; U, all clade at for if synapomorphy barely a are be clade may this in to tips Similar bracts. shoot large and branching inflorescence the order within higher of presence include synapomorphies in noted been has costaricensis has pollination pollination Hummingbird section wasp rugulose. in twice are evolved seeds the on w ucae r otyo oewti ld because W clade within note of worthy are subclades Two from sampled taxa of remainder the includes W Clade itrto Sister asfoalancearia Passiflora and Decaloba .berteroana P. .tenella P. bilobata J aDua,pr.obs.). pers. MacDougal, (J. .penduliflora P. Xerogona nti nlss n ssrnl supported strongly is and analysis, this in rus hrdcaatrsisfrcaeU clade for characteristics Shared groups. + apetala Xerogona ilb lsl eae to related closely be will .lutea P. Xerogona at sas eovdwti this within resolved also is Mast. u ontdhseadteridges the and dehisce not do but etr xD.Svrlspecies Several DC. ex Bertero Xerogona ru sdsiciei having in distinctive is group scaeU(section U clade is n lsl eae species related closely and Mcogl18b,and 1989b), (MacDougal .berteroana, P. (including .capsularis P. apetala exflora asfoabicornis Passiflora sexflora apetala ru nthe in group .tenella P. ru by group .insueta P. Xerogona, poorly a Decaloba Decaloba bilobata and group, group )+ P. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 03 RSIKE L:PSILR UGNSDCLB 707 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK 2013] .Aohrvral hrce per ob h plication, the clade be throughout to present appears is character but variable V), Another and W. U (clades groups eperne ftopohlsi section in prophylls two plesiomorphic of reappearances the the in one a as subgenus to within two and as lineages some from in genus one varies to the condition, number across character the a documentation is whole, better prophylls or requires scales that bud vegetative of number in zero plesiomorphic to the reduced relatives, pedi- with further per are none, bracts Bracts from small to cel. two ranging being three Passifloraceae genus, for and the condition small across to variable large highly are bracts sections aooi eeseaie.Freape ihrorder higher subgenus in example, species subgenus all across For almost scattered is at examined. branching present characters levels from taxonomic and to transitions in ple characters morphological marked in well revealed lability has and investigation new This both lineages. established genus for the synapomorphies across identifying transformation toward character examina- of permits patterns of here tion presented analysis phylogenetic The group. pollina- this bat in to achieved bird readily or sug- are bird tion to clade, bee hummingbird-pollinated from switches a that gesting within nested also is section this in test sampling to Greater needed placement. is and investigation fruit further and morphology; vegetative, seed floral, in markedly differs but clade, caeR,adrdcdo atal otaani section in again lost partially or reduced Xerogona and R), (clade in lost n then is 2), (Fig. hsgopicuigteeegneo a-olnto in bat-pollination of in emergence documented the associated clearly penduliflora P. including traits been group in has this Lability biology pollination bee-pollination. suggesting with to 1994), MacDougal reversal 1979; Pijl a Der in fragrance, Van pollination sweet and insect (Faegri a with and associated filaments often features coronal yellow flowers cup-shaped thick diurnal, with weak. shallow, is white, hummingbird placement has species this exclusively This for an support of though clade, middle pollinated the at evolved embedded have is may ancestor. clade bee-pollinated a this from in syndromes the pollination sup- to bird weakly is sister obs.), as pers. ported MacDougal, (J. species American of placement the of testing pce ncaeYhv civdtesm hp through analysis, tube. shape current floral same or the hypanthium, the In the achieved of narrowing have and Y elongation clade other while in filaments, coronal species the of fusion via flower shaped tulae for known example, P. well For is syndromes. hummingbird group pollination with associated The morphology adults. floral This leaves and specialized on 2003). juveniles variegation from of both (Kay absence in Caribbean ranks relatives by the distinguished their various all is lineage of and at consists species 1938), past red-flowered (Killip the section to in genus recognized formally aiiyo opooia hrce Transformations— Character Morphological of Lability enossottpoinainfrtapasi ld F clade in appears first orientation tip shoot Cernuous ld ,ifral nw sthe as known informally Y, Clade ru caeJ,rgie nsupersection in regained J), (clade group 6 = Disemma, r. and Urb., asfoatenella, Passiflora caeT n h informal the and T) (clade Tetrapathea, Ky20) ntepeetanalysis, present the In 2001). (Kay n ld ,adsupersection and M, clade ru fsubgenus of group 6 = .orbiculata P. .obovata P. murucuja n nsubgenus in and .helleri, P. .bicornis P. n section and asfoatalamancensis Passiflora a.hv vle tube- a evolved have Cav. ru,sgetn htthe that suggesting group, pr fcaeI n nthe in and I) clade of (part e-olntdCentral bee-pollinated a and asfoamurucuja Passiflora Passiflora, murucuja sexflora Xerogona. Decaloba .lancearia P. asfoalutea Passiflora Decaloba, Decaloba. Decaloba Decaloba. .penduliflora P. and ihmulti- with ilpermit will ru and group hl the While Astrophea, Passiflora ihrare with Passiflora Decaloba . bilobata super- Floral Killip and L., , sfxdi dl evso eea neae pce in species unrelated several of leaves adult in supersections fixed the in is lost and W) (clade supersection in lineages unrelated hsaayi rvdsafrtse oadeaiigthe examining toward species). step most first for a lacking 2004; provides are MacDougal analysis observations and This field (Ulmer that syndrome note each asso- bats, characters with floral of hummingbirds, suites ciated specific include with wasps, and Pollinators bees, herbivores. that ecologi- and numerous associations the by cal influenced been has undoubtedly and rsn nms pce fsupersection of species most in present ld,subgenus clade, deidamioides. opooia aiiyin lability morphological the overall; across known condition operculum poorly genusisneeded. the is independently of character times examination operculum This careful three that genus. least appears the at it across appeared Thus, opercu- has folded. the not plication along are striations but vertical lum, marked have E) (clade eti sect. in sent beti supersection in absent ereo odn fteoeclmin operculum the of folding of subgenus degree addition, In sections plication. subgenus any and clade display (Holm-Nielsen Sister operculum 1986). plicate Jørgensen to plicate slightly a subgenus access However, pollinator the Tryphostemmatoides nectary. regulate at to the limen androgynophore to the the with of interacts base which operculum, plicate subgenus in species all Nearly Decaloba operculum. the of folding, or etre n umria aia etre r present are nectaries petiolar of laminar supersections pair submarginal in single A and supersection nectaries. nectaries petiolar while no have nectaries, sub- species scattered laminar and Hahniopathanthus pairs abaxial multiple in marginal nectaries petiolar has subgenus in Passiflora are species Subgenus that Some sepals. nectaries midvein. laminar the Passiflora abaxial along and restricted nectaries subgenus petiolar while nectaries, laminar ginal Passiflora Bryonioides ini ueiepattsusfrtapasi subgenus in in absent appears is first and G) tissues (clade plant variega- leaf juvenile Decaloba example, For in characters. tion notable of losses and petiole. the on nectaries lami- no abaxial supersection and ocellate nectaries the of nar arrangement of V-shaped unique remainder a the has while entirely, supersection nectaries within S) (clade clade Auriculata supersection of h aito bevdi h hrcesotie above outlined characters the in observed variation The xrfoa etre r n ftebs xmlsof examples best the of one are nectaries Extrafloral Subgenus bilobata Polyanthea caeF n speeti supersections in present is and F) (clade r hrceie ytepeec fastrongly a of presence the by characterized are ihrsett etre.Supersection nectaries. to respect with and aencaiso h tpls rcs and/or bracts, stipules, the on nectaries have ennsof remnants + CaeQ.Lsl,the Lastly, Q). (Clade .obovata P. Decaloba rus(ld ) oto eandi multiple in regained or lost U), (clade groups Xerogona gi,n lcto sosre ntesister the in observed is plication no Again, Disemma Hahniopathanthus Deidamioides Disemma Passiflora. a agnllmnrncaisadseveral and nectaries laminar marginal has Disemma Decaloba and hasalsobeendocumentedashaving ln rvdsmn xmlso gains of examples many provides alone pr fcaeI), clade of (part Passiflora caeT.I sasn nthe in absent is It T). (clade and Bryonioides Deidamioides caeK,adcaeM(supersection M clade and K), (clade Multiflora murucuja caeM), (clade Decaloba. a aeptoa n/rmar- and/or petiolar have may pce nsubgenus in Species Passiflora. stems ies ieg in lineage diverse most the is pr fcaeI.Variegation I). clade of (part a ihbt pollinators both with has .lutea P. .lt) aigto sthen is Variegation lat.). s. caeQ,adaanpre- again and Q), (clade ru caeY.Tetrait The Y). (clade group Decaloba Decaloba caeB ipa some display B) (clade .multiflora P. Subgenera Cieca Deidamioides Tetrapathea .cirrhiflora P. Astrophea / Xerogona Cieca section ak extrafloral lacks caeO,and O), (clade Deidamioides Pterosperma Pterosperma Tetrapathea caeO), (clade Astrophea, n parts and osnot does a both has / Decaloba section sexflora sexflora and P. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 708 h eu n nyoc nsubgenus in across once species less only eight is and pollination in genus Bat documented lineages. the been 20 has least but at common, in in evolved species fra- 2001). has 125 Olesen floral ca. hummingbird-pollination and genus, no Lindberg the 1990; to Across Bawa little 1982; and (Snow grance nectaries with floral flowers tube-shaped large, well-developed colored, across display brightly diurnal, characters species solitary, Hummingbird-pollinated these genus. between the transitions evolutionary 07.Wiebace nlrsecsaerltvl infre- relatively al. are et inflorescences in Garcia brightly quent branched 1994; have dish- While often (MacDougal and 2007). flowers, filaments scent, coronal bat-pollinated floral strong colored or the a emit be hummingbird shaped, com- to to smaller typically appear are pared flowers pollination These 2001). al. wasp et Varassin in and syndromes pollination Bee common most 2012). al. et ln-nmlitrcin htinvolve that interactions plant-animal for as well mor- as increasing diversity. thus phological presence, appearance, and their location as such for traits selection increased this drives turn, tri- In fitness hooked fitness. plant as increase such likely chomes, defenses mechanical and bodyguards coupl butterflies, host-plant gravid of of by Reduction use death. trichomes in resulting hooked larvae, butterfly sturdy the adenopoda that showed subgenus (1971) anti-herbivory in Another 2001). observed Bryonioides, Leal is and to Wirth defense shown 2001; been al. Hossaert-McKey have 2001; et Feener which Second, and (Apple plants, herbivory 1981). wasps, the reduce predatory Gilbert to ants, parasitoids and as and such (Williams ‘bodyguards’ laying plant attract from EFNs females the gravid on deter to eggs shown been have and Decaloba and Passiflora. petioles, leaf, sepals, and of of surfaces stipules, external (EFNs) bracts, floral on nectaries occur EFNs extrafloral and between relationship butterflies complex (1982) Gilbert the and and documented (1981) animals. Gilbert and and specialists Williams plants the example, between For of other coevolution some of many provided examples best have and interactions These wasps, generalists. parasitic tles, ingLepidoptera(e.g.tribesHeliconiini,Josiini),ants,bee- wit relationships ecological constraints relationships as change. function these evolutionary may further as on they specialized, conversely, more in traits; become interactions reproductive Pollinator on 2004). MacDougal Passiflora and events super- mass-flowering (Ulmer with (e.g. associated be wasp-pollinated may or inflorescences bee often section are related in and inflorescences groups, unbranched in flowers to compared ilb mesl aubei nesadn h resignif- true the understanding in valuable immensely be will in associated interest of interactions characters studies plant-animal with Additional specific genus. document the that across morpholog- observed the diversity underlie that ical agents selective the into insight h xmlshr ihih ml ubro h many the of number small a highlight here examples The in species pollination, Beyond Disemma ,oelt aia necta laminar ocellate ), Passiflora, a rv lrldvriiaintruhpressures through diversification floral drive may ucueteitgmn feryinstar early of integument the puncture is,i oeseis(..caeWo subgenus of W clade (e.g. species some in First, hr lnshv okdtihms Gilbert hooked-trichomes. have plants where rsik20) nsm pce,branched species, some In 2006). Krosnick ; hs lwr r yial mle nsize in smaller typically are flowers these hmanytypesofinsectsinclud- Passiflora ev w motn oe in roles important two serve dwt h eeiso plant of benefits the with ed ismmcbtefyeggs butterfly mimic ries Passiflora Decaloba r oeynee,and needed, sorely are Passiflora. Passiflora Decaloba aediverse have supersection hyoffer They (Jørgensen Ky2001; (Kay Heliconius Heliconius Passiflora P. . ieaino h pcfceouinr atr htmay that reconstruc- factors phylogenetic in evolutionary used tion. locus specific each influencing the be of of sideration evolution the in occurred subgenus that changes genome-level subgenus of nus lineages basal the on needed Decaloba is work more clcaatr eg supersections morpholog- and of (e.g. suites by characters identified ical readily in be can events that diversification clades Subgenus OW. multiple and NW with the both complex, clades these quite of history is biogeographical the that seem would and numbers The chromosome genus. on the research across additional highlighted elaborate for also display has need plants study the present where The one W). (clade larger nectaries a and l S), completely (clade lineage smaller lineages: a monophyletic two elucidated have data well-unde Molecular least and largest subgenus within ships rate such the into but events. these investigation adaptation, of timing further and and require speciation will rapid hypotheses of examples supersection supersection (e.g. Disemma synapomorphies morphological clear no Tetrapathea in lineage oyliiainadhbiiaineet nsm clades. some in events Subgenus hybridization and polyploidization teghnn upr o h akoeo relationships of backbone the for Notably, addressed. support be to strengthening need that new challenges new many many subgenus as provided of has evolution the study into insights This evolu- polyploidy. number and copy tion, gene heteroplasmy, of cases suspected gsi subgenus in ages etpae nsubgenus in Tetrapathea placed best sebaeta nldsa es n pce ( species one least at includes that subgenusassemblage that clear posi- is phylogenetic it the genera, subgenus examining of of result tion a named formally As be sections. to need as supersections, that clades as species, additional recognized several 230 be and can least that at subgenus lineages of major that consists eight and clear monophyletic now cloning. is defined is molecular require it that and/or those First, evolution, char- as morphological chromosome well to as acters, regard revision, with of investigation need additional identification in the in clades resulting of subgenus, The this into of supersections. insights evolution new the provided the has analysis among molecular combined relationships (2003), examine MacDougal and and Feuillet of classification infrageneric ie fti nlsswr oeuiaetepsto fsub- of position the elucidate to were genus analysis this of tives phyloge- as well as ecological context. an netic in characters these of icance hssuyhsas mhszdtene o aeu con- careful for need the emphasized also has study This hssuyhspoie h fir the provided has study This e nesadn fSbeu Decaloba— Subgenus of Understanding New A Tetrapathea .obovata P. Cieca Passiflora Decaloba eg supersections (e.g. .Hwvr aywl-upre ldshave clades well-supported many However, ). Decaloba. Decaloba n ld [supersection P clade and ssse osubgenus to sister is ssse osubgenus to sister is Passiflora Decaloba .Adtoa hoooecut o subge- for counts chromosome Additional ). a ope eei itr u npr to part in due history genetic complex a has r lonee nodrt hdlgto the on light shed to order in needed also are eaiet h eto h eu,ts the test genus, the of rest the to relative Decaloba Decaloba a t w ut fcalne including challenges of suite own its has ) hs r ieyt einteresting be to likely are These ]). htcnan Wtx.Subgenus taxa. OW contains that n Decaloba =6groupiswellestablished,but aeaN itiuin hs it Thus, distribution. NW a have eaiet h te orsub- four other the to relative sodcaei h subgenus. the in clade rstood Decaloba. trsem,Hahniopathanthus, Pterosperma, Deidamioides cigetalrlnectaries extrafloral acking Decaloba, Decaloba supersection Decaloba, tisgt norelation- into insights st trsem,Bryonioides, Pterosperma, Decaloba h Wsubgenus OW The Decaloba, ossso several of consists e h aa line- basal the yet Bryonioides sapolyphyletic a is h nyother only the Decaloba, scurrently as u reveals but .obovata P. h objec- The with the ) Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. urcaMcen un gynMn,Cro atnz Idalmi Ana Martinez, Lezcano, Carlos Jorge Manh, Hiep, Nguyen Tien Cuong Martı Nguyen Andrew MacVean, Ferrero, Galdames, Michael Lucrecia Deng, Banka, Carmen Yunfei Roy Das, P. Ford, Aranda, A. Correa, Jorge for Mireya Clase, individuals Angel, Rube following Miguel valuable Boza, the for Tatiana fieldwork: thank reviewer We with anonymous Faculty manuscript. assistance one a the like and by would on Feuillet We and comments University. Christian Provost), Arkansas thank Southern the at of to of at SEK Dean KPU to Office the to Grant Sciences, of to grants Research Office Social by 0717084 Grant, JMM), and Development DEB to Sciences (Faculty LAM; 0716940 College DEB and State PMJ; SEK Keene to National to 0717115 the DEB 0717151 a by KPU; (DEB by awarded Foundation supported Grant was Science Systematics University, research Revisionary This State University). collaborative Harris-Stowe Missouri Arkansas Garden, College, Southern Botanic State and Ana Keene Santa Garden, (Rancho Botanical group working tematics nihsta eutfo the from result that insights eesn Yocupı Petersen, Mele 03 RSIKE L:PSILR UGNSDCLB 709 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK lineage. biogeography charismatic of this and studies in transformation detailed more character pat- for allow morphological evolutionary and clarify supersection processes, group, and the in terns of relationships revisions taxonomic of resolution Decaloba greater ing acrossthesubgenuswarrantsfocusedeffort,asdoesachiev-2013] lae,I n .F edl 03 iooa T eune n plant and sequences ITS Ribosomal 2003. Wendel. F. J. and I. Alvarez, specimens. Cynthia herbarium sample cura- to the Rohmann, permission for to US grateful and Shirley are L, we MO, at Finally, Reynard, Mills, tors Struemph. Gloria Suzanne Frank Malast, and Mary Strickland, Kupski, Puthanpurayil, Lori Jones, Jolsna Graves, Christina Tiffanie Burgund Cogburn, specimen Hirth, Adams, Sara Suzanne Boza, Daniel in Tatiana georeferencing: Bedalli, scan- Helena assisted and literature Bassuner, databasing, loans, Garden library herbarium managing ning, Botanical measuring, and Missouri following databasing The Tyack. from Nicholas and individuals Amber Shakya Sandra Peters, Subir Jared Moss, Siddall, Ocampo, Nicolle Kate Gilberto Poirier, Neal, McLean, Jake Anna Narula, Nitish Tess Massed, Namoff, Scott Clarke, Martinez, Mashayekhi, Cristina Cornelia Ly, Saeideh Thuy Jolles, King, Samson Diana Chafin, Kempton, Isa, Elizabeth Keil, Siti Tyler Carrie Georgian, Elizabeth Canady, Dockter, Katherine Candice Deresienski, Bissonnette, in Kristin assistance Brooks, Bergeron, for Lisa Erika at Bettina sequencing: students Henk DNA Garden following with and Botanical the Weigend, laboratory the Francisco thank Torsten Max San We the Arboretum. Vanderplank, Tripp, Strybing and Yockteng, Sula Erin Roxana Vanderplank, Posla, Wouters, Tomlinson, Mario John Peters, Phillip Ulmer, Elizabeth Skimina, Ochoa, Jorge Tim Piet Morse, Hearn, Molinari, Miguel Clinton Leonard, David Joan Moerman, Kuethe, Gengler, Yero Goldman, Kingma, Karla Klaas Herna Douglas Keeney, Alexandra Feuillet, Gilbert, Hansen, Christian Lawrence Katie Boender, Gibson, Dianxiang Ronald Arthur material: Wen, plant Abbott, Jun shared graciously Wang, Richard have individuals Hong following Takeuchi, The Zhang. Wayne Steinman, Victor aly .D,T .Cr,S .Hri,adC .Hge.20.Char- 2003. Hughes. E. C. and Harris, A. S. Carr, G. T. D., C. Bailey, pl,J .adD .Fee.20.Atvstto fetalrlnectaries extrafloral of visitation Ant 2001. Feener. H. D. and L. J. Apple, akr .K n .M uzn.20.Teuiiyo h incongruence the of utility The 2002. Lutzoni. M. F. and K. F. Barker, aa .S 90 ln-olntritrcin ntoia rainforests. XCV. tropical reports number in Chromosome 1987. interactions P. Berry, Plant-pollinator 1990. S. K. Bawa, oa .E,P .Jresn n .M aDua.21.Ataxonomic A 2014. MacDougal. M. J. and Jørgensen, M. P. E., T. Boza, Acknowledgments. ´ hlgntcinference. phylogenetic ceiaino nisemnDAplmrhs,prlg,and paralogy, polymorphism, nrDNA pseudogenes. angiosperm of acterization atrsi auttv n-ln mutualisms. ant-plant facultative in patterns of 434. 417– eghdfeec test. difference length nulRve fEooyadSystematics and Ecology of Review Annual eiinof revision ´ dz nesLindstro Anders ndez, e . Marı R., nez Passiflora uhipoeet ilpoieasldbssfor basis solid a provide will improvements Such . ´ zaRamı tzia h fet fncayatiue n n eairon behavior ant and attributes nectary of effects the : Passiflora ´ rsiaMartı Cristina a ´ oeua hlgntc n Evolution and Phylogenetics Molecular Martı n ´ h okpeetdhr rvdstefirst the provides here presented work The e-mzu,Jc eaao ya Rodrı Eyvar Regalado, Jack rez-Amezcua, ¨ section ´ ytmtcBiology Systematic ieaueCited Literature ,PdoPro iulA Miguel Pardo, Pedro m, e aio eud hmoea Teodoro Chimbolema, Segundo Camilo, nez Passiflora oeua hlgntc n Evolution and Phylogenetics Molecular ´ ´ dz ye rie laKy George Kay, Elma Irvine, Myles ndez, e,RbnMartı Ruben nez, Xerogona subgenus Rf)Kli (Passifloraceae) Killip (Raf.) 1 399–422. 21: 1 625–637. 51: Decaloba Oecologia ´ Taxon e,Nyl Martı Nayely nez, ´ glPe ngel 9 435–455. 29: eiinr sys- revisionary 6 493. 36: 2:49 416. 409– 127: ´ e,Jennifer rez, ´ guez, ´ nez 29: eWle .J .O 92 h nieosOdWorld Old indigenous The 1972. O. J. J. W. Wilde, De cyto- and Karyology 2001. Guerra. M. and Cervi, C. A. F., N. Melo, de ars .S,M Ka M. S., J. Farris, agi .adL a e il 1979. Pijl. Der Van L. and K. Faegri, soa,L .A 99 e ugnsadfv e pce of species new five and subgenus new A 1989. A. K. L. Escobar, oivu,P 91 itrcleooyi eiga-tesuhln bridge land south the - Beringia in ecology Historical 1981. P. Colinvaux, and Swensen, M. S. Wurdack, J. K. Lledo, D. M. Zmarzty, S. W., M. Chase, classifica- Higher-level 2000. Savolainen. V. and Fay, F. M. W., M. Chase, mhilr .adJ .Dye 99 hools-xrse glutamine Chloroplast-expressed 1999. Doyle. J. J. and E. Emshwiller, M. Duran, C. Cooper, A. Cheung, M. Buxton, S. Ashton, B. A., Drummond, Chloroplast-expressed 2003. Harbison. C. and Doyle, L. J. J., J. Doyle, 1987. Doyle. L. J. and J. Noise 2000. J. Quicke. Doyle, J. L. D. and Orme, L. D. C. Belshaw, R. (Passifloraceae) K., Passifloreae Dolphin, tribe of genera The 1974. O. J. J. W. Wilde, De Paropsieae, tribe the of position systematic The 1971. O. J. J. W. Wilde, De V. J. Campbell, M. L. Seberg, J. O. Petersen, M. G. Stevenson, and W. D. Jaramillo, I., J. A. Davis, C. Wurdack, J. K. Webb, O. C. C., of C. Phylogeny 2001. Davis, Donoghue. J. M. and Anderson, R. W. C., C. Davis, eilt .adJ .Mcogl 03 20] e nrgnrcclassi- infrageneric new A [2004]. 2003. MacDougal. of M. J. classification and C. Infrageneric Feuillet, 1999. MacDougal. M. J. and C. Feuillet, nrs,P .adA grhi.19.Gneimdvriyadsystem- and diversity Gynoecium 1997. Igersheim. A. and K. P. Endress, nrs,P .1994. K. P. Endress, eCnol,A .12.Passifloraceae. 1822. P. A. Candolle, de Soltis, E. D. Reveal, L. J. Fay, F. M. Chase, W. M. Bremer, K. B., Bremer, aooyo h genus the of taxonomy and jackknife calculating values. for bootstrap methods of comparison a and variation, e ok egmnPress. Pergamon York: New Garden America. South from (Passifloraceae) 93–168. os tS.Pu Island. Paul St. at coast molecular plastid a Flacourtiaceae: on in Bulletin it based put analysis doubt, in phylogenetic When 2002. Fay. F. M. DNA of perspective the from insights data. new sequence angiosperms: the in tion yteae(cg) oeta tlt o hlgntcsuiswith studies phylogenetic from for example utility an potential (ncpgs): synthetase Auckland: 5.4. v. Geneious S. 2011. Ltd. Stones-Havas, Wilson. Biomatters S. A. Moir, and R. Thierer, Markowitz, T. S. Sturrock, Kearse, M. Heled, J. Field, polyploidy. ancient and 567–577. 28: duplication, gene eny, in synthetase glutamine tissue. leaf fresh of 11–15. 19: quantities small for length incongruence the of test. results difference interpreting incongruence: and morphology. flower to reference special with 327–356. 21: Passifloraceae. genus the particular in Evolution and A 2004. from Gandolfo. inferred M. as and monocots, the Vergara-Silva, P. of M. F. phylogeny Michelangeli, Specht, A. D. F. C. Hardy, R. Simmons, C. Goldman, H. D. Freudenstein, a forests. rain supports tropical Malpighiales modern Naturalist of of origin radiation mid-Cretaceous Explosive 2005. Donoghue. sequences. tide chloroplast from evidence Malpighiaceae: ac fincongruence. of cance iainof fication Missouri. Louis, St. Passiflora tc fteLaurales. the of atics Press. University Cambridge Cambridge: Evolution Gene de Naturelle d’Histoire n ru lsiiainfrteodr n aiiso flowering of families G. and R. orders Moore, the phylog- angiosperm III. J. for APG the Y. plants: classification M. Q. of J. update group Anderberg, Wurdack, An K. 2009. A. eny Tank, Zmarzty. C. A. D. S. Sytsma, and Stevens, J. Xiang, K. F. Rudall, J. P. P. Olmstead, Soltis, S. P. Garden analysis. component principal using 6 877–885. 76: i press). (in 7 141–181. 57: 2 310–319. 12: .(asfoaee,XIItrainlBtnclCongress, Botanical International XVI (Passifloraceae), L. 6:E36–E65. 165: Passiflora ¨ 2:69–84. 226: llersjo Blumea oeua hlgntc n Evolution and Phylogenetics Molecular Taxon mrcnJunlo Botany of Journal American oaia ora fteLnenSociety Linnean the of Journal Botanical iest n vltoaybooyo rpclflowers tropical of biology evolutionary and Diversity ytmtcBotany Systematic ¨ Oxalis .G lg,adC ut 94 etn signifi- Testing 1994. Bult. C. and Kluge, G. A. , .(Passifloraceae). L. 9 685–704. 49: 4 99–104. 14: Passiflora oaia ora fteLnenSociety Linnean the of Journal Botanical Cladistics utrayResearch Quaternary Ancistrothyrsus, Glycine ` (Oxalidaceae). ve :435. 1: ai N slto procedure isolation DNA rapid A .(Passifloraceae). L. 0 315–319. 10: n eae euioa:phylog- Leguminosae: related and h rnilso olnto ecology pollination of principles The Me 9 467–510. 29: ´ orsd aSocie la de moires naso h isuiBotanical Missouri the of Annals naso h isuiBotanical Missouri the of Annals Passiflora n e otegnr of genera the to key a and oeua hlgntc and Phylogenetics Molecular rbcL 8 1830–1846. 88: 6 18–36. 16: ndhF rbcL htceia Bulletin Phytochemical Blumea N sequences. DNA 3 34–38. 13: and and Passifloras ytmtcBotany Systematic ln Systematics Plant 7 401–406. 17: ´ 2 37–50. 22: 6:105–121. 161: te trnL ´ atpA ePyiu et Physique de - F American sequence Passiflora . nucleo- Blumea 125: Kew . . Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. rgr .J .1982. D. H.-J. Gregor, 1972. S. Miocene P. Green, The II. paleobotany. neotropical in Studies 1976. 2000. A. MacDougal. Graham, vine. M. a J. and and butterfly E. a L. of Gilbert, coevolution The 1982. E. L. Gilbert, 1 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC has coevolution: Butterfly-plant 1971. E. L. history Gilbert, biogeographical the of Gene Reconstruction Arbor: 2002. Ann K. 3.1.1. Gengler-Nowak, v. Sequencher, 2000. Corporation. Codes Gene data among of Corroboration 1999. Ultrastructure Baker. H. 2007. R. Hoc. and O’Grady, S. P. J., P. Gatesy, and Galati, G. B. A., T. M. Garcia, in 270–281 Pp. Passifloraceae. 2007. MacDougal. M. J. and C. Feuillet, 710 øgne,P . .Mchl,adJ .Mcogl 2012. MacDougal. M. J. and Muchhala, N. M., P. Jørgensen, 2004. Weigend. inference M. and Bayesian M. MrBayes: P. 2001. Jørgensen, Ronquist. F. and Delabie, P. C. J. H. Huelsenbeck, J. Pascal, L. Labeyrie, E. Orivel, J. M., Hossaert-McKey, from wood Dated 1981. Matthews. V. J. and Smith, A. P. M., D. Hopkins, i,K .adR .Jne.1995. Jansen. K. R. and J. K. Kim, Passifloraceae. of species American The 1938. P. E. Killip, a,E 01 bevtoso h olnto of 2003. pollination E. Kay, the on Observations 2001. E. Kay, ookv,N,J .Shedr .Qad,A obr,G ik,adT. and Zizka, G. Worberg, A. Quandt, D. Schneider, V. J. N., Korotkova, hypothe- phylogenetic a and evidence for concern A 1989. G. A. Kluge, asn .K,L .Glet .B ipo,S .Dwi,A .Cri and Cervi, C. A. Downie, R. S. Simpson, B. B. Gilbert, E. L. K., A. Hansen, Pater- 2007. Jansen. K. R. and Gilbert, E. L. Escobar, K. L. K., A. Hansen, chromosome 2004. a K. A. to Hansen, Contributions 1959. Beuzenberg. J. E. and B. J. Hair, er,D .2006. J. D. Hearn, omNesn .B n .M øgne.1986. Jørgensen. M. P. and B. L. phylo- Holm-Nielsen, versus Congruence 2004. Sytsma. J. K. and Hall, C. J. L., A. Hipp, 539–558. Mexico. Garden Veracruz, of communities Mexico. southeast from Passifloraceae of species American butterflies? Heliconiine with race 585–586. selectional the won fMalesherbiaceae. of Corporation. Codes taxa. rela- artiodactyl phylogenetic level for higher among support tionships hidden analysis: simultaneous in of sets flowers scentless and scented (Passifloraceae). of corona the plants vascular of Springer. genera Berlin: and families The (Passifloraceae). unipetala Bolivia. and Peru from Passifloraceae trees. phylogenetic three of of ants with associations Differential plants. nectary-bearing extrafloral 2001. co-occurring Dejean. A. Beringia. and in refugia forest for implications Research - Quaternary Yukon the and Alaska fSine USA family. Sciences of sunflower the in clades History Natural of Museum Field University. Louis Saint Missouri: Pseudomurucuja Murucuia, htsrtgahe Pala Phytostratigraphie, Biotropica farclirn ld ihsqecso the of sequences Evolution and with Systematics analysis clade Plant Malpighiales: recalcitrant order a eudicot the of of Phylogeny 2009. Borsch. Zoology among relationships of sis .K asn 06 hlgntcrltosisadchromosome and relationships Phylogenetic 2006. in evolution number Jansen. K. R. Botany of Journal genome American chloroplast the of inheritance in biparental and maternal, nal, Texas. of University The Texas: Austin, Dissertation. Science families. Miscellaneous of 2. Journal flora. Zealand New the of atlas matoides test. difference length Biology incongruence Systematic the revisiting accuracy: genetic diversification. form 805–821. growth and phylogeny Passiflora 3 787–842. 63: lrleouinr clg of ecology evolutionary Floral 8 7–25. 38: e a-olntdseisof species bat-pollinated new a , n t allies. its and 4:110–121. 247: 3 709–713. 33: Psilrca) mlctosfrpyoeei studies. phylogenetic for implications (Passifloraceae): Passiflora ytmtcsuisi asfoaL (Passifloraceae) L. Passiflora in studies Systematic Adenia 2 10379–10383. 92: i Jungtertia Die Novon Flora :148–156. 2: 3 81–89. 53: 5 217–249. 15: oaia Review Botanical Passiflora ¨ Bioinformatics 0:302–315. 202: Phytologia nAsrlsaadtePacific. the and Australasia in oo 2 174–179. 22: Psilrca)adisaatv radiation: adaptive its and (Passifloraceae) ¨ ooi,Pala kologie, 4 42–46. 94: and ¨ Epicrates e lrnSu Floren ren ndhF . 8:201–228. 282: seha h .Dsetto.S.Louis, St. Dissertation. D. Ph. Astephia. ytmtcBotany Systematic 9 613. 19: 0 119–124. 60: rceig fteNtoa Academy National the of Proceedings euneeouinadtemajor the and evolution sequence Passiflora ¨ 7 754–755. 17: naso h isuiBotanical Missouri the of Annals oklimatologie 8 171–188. 68: asfoainca, Passiflora Bia,Serpentes). (Boidae, Novon asfoamicrostipula Passiflora ¨ Passiflora ddeutschlands: Pala o.9 d .Kubitzki. K. ed. 9, vol. 4 79–83. 14: Psilrca) subgenera (Passifloraceae): Cladistics Ecoscience asfoapenduliflora Passiflora petD ytmtcBotany Systematic asfoatryphostem- Passiflora Lundellia asfoaadenopoda Passiflora 1 138–150. 31: ttgr:I Enke. I. Stuttgart: . supersect. Passiflora e pce of species new a ru Iintron. II group e Bulletin Kew oaia Series Botanical 5 271–313. 15: e Zealand New Science :325–335. 8: ¨ okarpologie, :1–5. 3: Systematic Passiflora Scientific Tacsonia ,anew h D. Ph. . species 172: 26: 31: . . io,K .adJ .Cretr 96 nsmlaeu analysis. simultaneous On 1996. by Carpenter. Published M. J. Ithaca: and 1.00.08. C. K. v. rapid Nixon, (BETA) for Winclada method 2002. new C. a K. ratchet, Nixon, parsimony The 1999. C. K. Nixon, Souza-Chies, I. T. Bonatto, L. S. Cervi, C. A. M. Lorenz, P. F. A. C., Bonatto, V. Muschner, L. S. Vecchia, M. Lorenz-Lemke, P. A. C., V. Muschner, CIPRES the Creating 2010. Schwartz. T. and Pfeiffer, W. A., M. Miller, cen,M .17.WsErp once ietyt ot America North to directly connected Europe Was 1972. C. M. McKenna, atr,M .17.Cnrbtost h aua itr fthe of history Passifloraceae. 1872. natural T. the M. to Masters, Contributions 1871. T. M. Masters, a,D .16.DeFoeznndrFoewcsluddie und Florenwechsel der Florenzonen Die 1967. H. D. Mai, aDua,J .2003. M. J. MacDougal, 1995. M. J. MacDougal, aDua,J .adA Herna A. and M. of J. section MacDougal, new A 2003. Hansen. K. A. and M. J. MacDougal, in 27–31 Pp. Systematics. 2004. Feuillet. C. and M. J. MacDougal, aDua,J .19.Rvso of Revision 1994. M. J. MacDougal, aDua,J .1983. M. J. speciali- MacDougal, extreme of fragility The 2001. Olesen. M. J. and tropical B. of A. Lindberg, relationships and Origins 1993. Luckow. M. and M. Lavin, aDua,J .1989b. M. J. MacDougal, 1989a. M. J. MacDougal, revi- Taxonomic 2009. Freudenstein. V. J. and Ford, J. A. E., S. Krosnick, ae,G,P .Zmeln .J .Fgne,T ans .M Salzano, M. F. Magnus, T. Fagundes, R. J. N. Zamberlan, M. P. G., Mader, rsik .E n .V ruesen 05 oohl n floral and Monophyly 2005. Freudenstein. V. J. and E. S. Krosnick, 2006. E. S. Krosnick, rsik .E,E .Hri,adJ .Fednti.20.Pten of Patterns 2006. Freudenstein. V. J. and Harris, M. E. E., S. Krosnick, tics author. the analysis. parsimony phylogenetic molecular 1229–1238. first 90: A 2003. of Freitas. B. analysis L. and Salzano, M. F. inheritance organellar Differential 2006. Freitas. in B. L. and Salzano, Workshop November. 14 Environments Louisiana: Computing Orleans, in New Gateway 8 (GCE), 1– the Pp. trees. of phylogenetic large Proceedings of inference for Gateway Science ro otemdl Eocene? middle the to prior –128. t.106 9–645. 593– Passifloraceae. Institutes Republik. Demokratischen u Vorstellungen eeisadMlclrBiology Molecular and Genetics 1–146. Pseudodysosmia e species. new subgenus Inc. Press, Timber world the of passionflowers 454–458. 13: Novon Rica. Costa from passionflower subgenus mimic in series and species Novon new a (Passifloraceae), Passiflora era Passiflora .L oat,adL .Fets 00 h s n iiso T aain data ITS of in limits and variation use intraspecific The of 2010. analysis Freitas. the B. L. and Bonatto, L. S. oaia Garden Botanical ensifera zation: Botany of hypothesis. Journal Boreotropics the of context the in America North Xerogona group trichome hooked University. the Duke Durham: MacDougal, Dissertation. J. emend. Killip (Harms) of sion oaia Garden Botanical Decaloba hrce oooyo l World Old supersection of homology character University. State Ohio The of Ohio: Columbus, species World Old supersection the in evolution nmlu lrldvlpeti h Asian the in development Decaloba: floral anomalous Passiflora’s Hollrungia 2 221–241. 12: :48–51. 5: . Passiflora asfoamixta Passiflora ora fToia Ecology Tropical of Journal 0 55–81. 10: . supersection . subgenero , Psilrca)fo Mesoamerica. from (Passifloraceae) Psilrca)fo Mesoamerica. from (Passifloraceae) ytmtcBotany Systematic Decaloba Disemma Passiflora Novon Disemma Psilrca)subgenera. (Passifloraceae) and ¨ hlgntcrltosisadpten fmorphological of patterns and relationships Phylogenetic (Passifloraceae). 0 1–14. 80: rnatoso h ina oit fLondon of Society Linnean the of Transactions e e lmalu mJungteria im Klimaablauf den ber 6 354–356. 76: 6 1172–1174. 76: subgenus Tetrapathea Psilrca) rmCnrlAeia ihtwo with America, Central from (Passifloraceae), 3 459–466. 13: asfoaboenderi Passiflora eiinof Revision Decaloba Cladistics Disemma ). n subgenus and asfoamalletii Passiflora (Passifloraceae). asfoacitrina Passiflora ytmtcBotany Systematic asfoasanctae-mariae Passiflora n t olntn hummingbird pollinating its and .UmradJ .Mcogl Portland: MacDougal. M. J. and Ulmer T. . Tetrapathea 4 375–385. 34: badugndsZnrlnGeologischen Zentralen des Abhandlungen vltoayBiology Evolutionary 3 99–108. 33: ´ ). aaColombia. para Psilrca) n e pce of species new a and (Passifloraceae), dz 04 n uv sei de especie nueva Una 2014. ndez. 5 0–414. 407– 15: mrcnJunlo Botany of Journal American Passiflora Passiflora 7 323–329. 17: lr Brasiliensis Flora ytmtcBtn Monographs Botany Systematic erpte) h .Dissertation. D. Ph. Tetrapathea). asfoa( Passiflora Passiflora nldn h ooyi gen- monotypic the including Psilrca) e egg- new a (Passifloraceae), e pce nsection in species new a , e pce nsection in species new a , Passiflora mrcnJunlo Botany of Journal American Genetica 0 139–152. 30: subgenus .sect. L. Novon naso h Missouri the of Annals naso h Missouri the of Annals (subgenus Passiflora :179–189. 6: subgenus .(Passifloraceae). L. 2:49 453. 449– 128: ¨ nseries in Pseudodysosmia e Deutschen der r 31) 529–628, 13(1F): Decaloba i press). (in 3 620–636. 93: (subgenus Decaloba Passiflora Passiflora American Decaloba Decaloba h D. Ph. . Ensifera section Cladis- Luteae 27: 41: . : : , : Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. le,T n .M aDua.2004. MacDougal. M. J. and T. Ulmer, udc,K .adC .Dvs 09 apgilspyoeeis gaining phylogenetics: Malpighiales 2009. Davis. C. C. and J. K. Wurdack, hemi- northern the of geography plant of of aspects Some variability 1975. temporal A. affect J. rainfall Wolfe, Does 2001. Leal. R. I. and R. Wirth, plant on agents selective as Insects 1981. Gilbert. E. L. and S. K. Williams, direct and Amplification 1990. Taylor. J. and Lee, S. Bruns, T. ho: J., Eastward T. 2007. White, Cook. A. J. and Lessa, P. E. Hoberg, P. E. E., pro- Waltari, nectar of role The 2001. Sazima. M. and Trigo, R. J. G., I. Varassin, sensu Passifloraceae of analysis phylogenetic Molecular impor- 2012. T. its Tokuoka, Bridge: Land Atlantic North Eocene - The W 1985. H. Clustal B. 1994. Tiffney, Gibson. J. T. and Higgins, G. D. D., J. Thompson, 711 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK the of polyphyly the for Evidence 1995. Reeves. A. P. and G. R. Olmstead, 2013] otrUly .E eiinof Revision E. K. Porter-Utley, 2007. E. K. Porter-Utley, 2003. E. K. Porter-Utley, abu,A 00 EA,amna euneaineteio.Oxford: editor. Ra alignment sequence manual a SE-AL, 2000. A. averaging. Rambaut, model phylogenetic JModelTest: 2008. D. Posada, nw .A 92 olnto nest n oeta edstin set seed potential and intensity Pollination 1982. A. A. Snow, the of revision A 2001. Weigend. M. and crossroads. Tillich, Beringian H. J., the Skrabal, at lights 1995. Traffic Olmstead. 1999. G. A. R. and Sher, Reeves, A. P. Sweere, A. J. W., R. Scotland, in 132 Pp. Passifloraceae. 1828. L. Reichenbach, nw .adJ .Mcogl 93 e hoooerprsin reports chromosome New 1993. MacDougal. M. J. and N. Snow, oa . .W hs,adC acns 2003. Barcenas. C. and Chase, W. M. V., Sosa, aelt . .Gel,G atu n .Bue.19.Uieslprimers Universal 1991. Bouvet. J. and parsimony Pautou, using G. Gielly, analysis G. P., Phylogenetic Taberlet, PAUP* 2002. L. D. Swofford, Phylogenetic 1994. Hulbert. H. S. and Liang, H. G. Skinner, Z. D. Y., Sun, ´ k,K 90 faznet u e Obereoza dem aus Pflanzenreste 1960. K. sky, rudo n ftems eactatcae nteagopr tree angiosperm the in clades recalcitrant life. most of the of one on ground teritary. Garden and Botanical cretaceous late the during sphere in protection ant butter- by egg-laying reduces flies. mimicry egg morphology: vegetative Press. Academic Diego: San White. J. T. and Sninsky, J. Gelfand, D. in 322 315– Pp. phylogenetics. for genes RNA ribosomal fungal of sequencing para- and nexus. Beringian hosts the of across sites colonization on perspectives phylogeographical spe- Society Linnean four the of of pollination Journal the in of odour cies and pigments flower duction, Inc. Press, Timber Portland: sequences. DNA nuclear and Research Plant plastid of on Journal based (Malpighiales) lato hemi- northern the of phytogeography sphere. modern and tertiary in tance penalties gap align- choice. position-specific matrix sequence weight weighting, and multiple sequence progressive through of ment sensitivity the improving chloroplast on based Scrophulariaceae 25–28. subgenus Florida. of University Florida: supersection Garden Botanical Missouri the of Annals nvriyo xod eateto Zoology. of Department Oxford, of University Evolution and Biology vitifolia species. lobii 103–104. chloroplast by determined DNA-sequences. Acanthaceae of systematics Higher-level Cnobloch. Carl Leipzig: Lethaea Cieca Passiflora Ahraee:A xml fteLuainfoao rpclforests tropical of flora America. Laurasian Central the of of example An (Achariaceae): o mlfcto ftrenncdn ein fclrpatDNA. chloroplast of regions Biology non-coding Molecular Plant three of amplification for Associates. Sinauer Sunderland: 10. beta 4.0 v. methods). other and (* DNA. 26–32. 89: ribosomal nuclear of spacers of analysis ru Psilrca)icuigsm e pce n sub- and species new some including (Passifloraceae) group Science (Passifloraceae). C rtcl:agiet ehd n applications and methods to guide a protocols: PCR mrcnJunlo Botany of Journal American . 1 423–449. 41: ora fteAnl Arboretum Arnold the of Journal Passiflora Oecologia avr aesi Botany in Papers Harvard (Passifloraceae). Decaloba ic ( Cieca 1:467–469. 212: Sorghum 2 264–279. 62: asfoaccie?Ecoscience coccinea? Passiflora mrcnJunlo Botany of Journal American 5 231–237. 55: Psilrca)i ot-atr Brazil. south-eastern in (Passifloraceae) Passifloraceae Taxon supersection asfoatacanensis Passiflora 5 1253–1256. 25: ytmtcBtn Monographs Botany Systematic n eae aauigitra transcribed internal using taxa related and 7 1105–1109. 17: 2:489–497. 125: eiinof Revision ytmtcBotany Systematic uli cd Research Acids Nucleic 2 519–524. 52: Passiflora 3:139–152. 136: .P.D israin Gainesville, Dissertation. D. Ph. ). ora fBiogeography of Journal :309–338. 6: asfoa asofoeso h world the of passionflowers Passiflora: 6 1551–1570. 96: Cieca subgenus hoeia n ple Genetics Applied and Theoretical Passiflora 2 176–193. 82: 6 73–94. 66: e pce of species new a , rmMexico. from ¨ rbcL nUngrans. osetsrgivegetabilis regni Conspectus 2 266–275. 82: 8 261–273. 18: :450–453. 8: and Decaloba naso h Missouri the of Annals 2 4673–4680. 22: subgenus ndhF i press). (in Chiangiodendron Senckenbergiana d.M Innis, M. eds. 4 561–574. 34: supersection Brittonia Nature sequences. Molecular Decaloba Passiflora Passiflora Passiflora Botanical 397: 59: . . rsik610 Krosnick ooo . .Drea,P on,T osc,F azn,S oat,and Bonatto, S. Salzano, F. Fonseca, T. Togni, P. Dornelas, M. K., Yotoko, among relationships Phylogenetic 2004b. Nadot. S. and R. Yockteng, comparison a phylogenies: Infrageneric 2004a. Nadot. S. and R. Yockteng, wcl .J 2006. J. D. Zwickl, Q516 X771 DQ284534. JX679741, DQ458126, .Gnlr54 Gengler K. JX470860. JX679725, JX847204, JX470766, (OS), ¥”Lc o eune o atclrtxnaeidctda “-.” as indicated are ncpGS, taxon nrITS, order: particular following trnL-F. a the and in ndhF for listed sequenced numbers with Sequence accession not indicated GenBank “§.” is Loci a GenBank in “¥.” with unvouchered a indicated as listed are Ossowski and from used Colombia, following in Herna listed by fieldwork A. by vouchers during collected verified specimens nrITS, voucher independently Four for asterisk. were the specimens identifications vouchered species sequencing “*”); number, cases, a name, with these (indicated collector unvouchered in were with taxa listed Four location. is voucher and specimen Each analyses. genetic JX470917; -. -, -, DQ521377, 949 Zyhra asfoaauriculata Passiflora capsularis asfoaboenderi Passiflora Q223 X425 X776 JX470937. JX679726, JX847205, DQ521293, xShn)W .d Wilde. de J. W. Schinz) ex X778 AY632722. JX679728, weberbaueri asfoaaltebilobata Passiflora alnifolia AY632727. 25 Krosnick JX679729, DQ458122, X772 DQ458105. JX679732, (* Krosnick. .Martı N. X422 X773 JX470872. JX679793, JX847222, Schwerdtfeger. 93100 n. s. Lorenz-Lemke tor. 2266 JX470868. JX679746, JX847259, -; -. JX679744, anadenia Q515 X779 AY632729. JX679739, DQ458125, JX470865. arborea rsik259 Krosnick JX470873. DQ458101. JX679755, DQ458130, citrina Passiflora AY632731.Juss. JX679753, DQ458129, AY632706, (CBG), .Herna A. JX470866. Miller. ex Houston JX470863. X775 JX470918. JX679735, X779 X420 X776 JX470864. JX679736, JX847210, JX470779, .M øgne 61434 Jørgensen M. P. .Pre-te .Mondragon-Chaparro D. 327 Porter-Utley & K. ugopGenera Outgroup Appendix Ingroup .E a 131 Kay E. E. B) X776 X427 X789 JX470869. JX679829, JX470796, JX847217, (BH), .Fets 01 osvraini eoeszsrfetaatv or adaptive reflect sizes from genome clues in New processes? variation neutral Does 2011. Freitas. L. 379–396. 31: (ncpgs). chloroplast in expressed Passiflora Evolution and in Phylogenetics K cytosol-expressed maturase cpDNA synthetase, and synthetase glutamine glutamine chloroplast-expressed of flrebooia eunedtst ne h aiu ieiodcrite- Likelihood Maximum the under datasets rion sequence biological large of .Wuess n. s. Wouters H. M) ,J872,J695,JX470871. JX679751, JX847221, -, (MO), ´ ´ e .&M .Pe A. M. & M. nez h .Dsetto.Asi,Txs h nvriyo Texas. of University The Texas: Austin, Dissertation. D. Ph. . dz175 ndez Spreng. Kunth. .Ga 2035IV Gray B. asfoabicrura Passiflora asfoaapetala Passiflora .HanMad009 Hearn D. asfoaaurantia Passiflora — Urb. L. WS,- ,A776,AY636105; AY757164, -, -, (WIS), asfoacochinchinensis Passiflora asfoabifloraPassiflora O) Q509 Q513 X770 DQ458114. JX679730, DQ458123, DQ458069, (OS), asfoaadenopoda Passiflora O) Y373 Q676 X777 AY632728. JX679737, DQ463766, AY632703, (OS), M) X770 X422 X772 -. JX679742, JX847212, JX470780, (MO), var. O) X775 X426 X777 JX470861. JX679727, JX847206, JX470765, (OS), .Herna A. .VuhrifrainfrDAsucsue nphylo- in used sources DNA for information Voucher 1. pce ae nteguaiesnhts ula gene nuclear synthetase glutamine the on based species .M øgne .Ciblm 2479 Chimbolema S. & Jørgensen M. P. .Konc 621 Krosnick S. .A cae1339 McDade A. L. M) X783 X428 X778 JX470944. JX679748, JX847218, JX470813, (MO), .Herna A. unr ulmifolia Turnera M) X788 X420 X770 JX470870; JX679750, JX847220, JX470838, (MO), weberbaueri .Porter-Utley 418 K. IN,- ,- DQ123029. -, -, -, (ICN), eei loih prahsfrtepyoeei analysis phylogenetic the for approaches algorithm Genetic .M MacDougal. M. J. .M MacDougal. M. J. — asfoaampullacea Passiflora asfoaapoda Passiflora ´ Kunth. aosamadagascariensis Paropsia dz262 ndez M) Q503 Q672 X774 DQ458093. JX679754, DQ463762, DQ458063, (MO), dnaheterophylla Adenia ,A622,- X773 AY632745. JX679733, -, AY632720, ), Hemsl. O) Q507 Q677 X770 DQ458085. JX679740, DQ463767, DQ458057, (OS), ´ ´ dz234 ndez e .461 F. rez AI) Q224 ,- -. -, -, DQ521284, (ARIZ), Urb. Killip. Lam. .A cae&K akil1254 Balkwill K. & McDade A. L. asfoabryonioides Passiflora asfoacinnabarinaPassiflora .Konc 350 Krosnick S. .Forst. G. asfoacobanensis Passiflora §,J400,J871,J694,-; JX679749, JX847219, JX470806, (§), 1 397–402. 31: Gilg. .Konc 3 Krosnick S. .Konc 581 Krosnick S. asfoaberteroana Passiflora .E a 197 Kay E. E. M) X783 X428 JX679734, JX847208, JX470833, (MO), .E a 194 Kay E. E. asfoaaurantioides Passiflora M) ,J870,J693,JX470862. JX679731, JX847207, -, (MO), DC. M) X777 X421 JX679738, JX847211, JX470767, (MO), L. asfoaallantophylla Passiflora KS) X786 X423 JX679743, JX847213, JX470836, (KESC), KS,HM,J400,- JX679756, -, JX470807, HEM), (KESC, .Pre-te 416 Porter-Utley K. oeua hlgntc n Evolution and Phylogenetics Molecular .Gnlr288 Gengler K. .Konc 296 Krosnick S. Harms. .Konc 23 Krosnick S. Passiflora Spreng. asfoaarbelaezii Passiflora .Konc 258 Krosnick S. aehri lanceolata Malesherbia .Konc 24 Krosnick S. CC) X787 ,- JX470867. -, JX470837, -, (CICY), Ms. Harms. (Mast.) Bue Koord. (Blume) asfoachelidonea Passiflora O,RAPM,DQ284532, RSA-POM), (OS, O) Q508 DQ458124, DQ458078, (OS), M) ,J871,JX679745, JX847215, -, (MO), .HanMad037 Hearn D. aaatetriloba Basananthe M) X782 JX847209, JX470822, (MO), M) X784 JX847214, JX470834, (MO), .Herna A. Passiflora calcicola asfoachrysosepala Passiflora . .Konc 326 Krosnick S. LSONE PLoS Ms. .Perrier. H. (Mast.) Kunth. asfoacirrhiflora Passiflora Lindl. Killip. Passiflora O) ,- JX679858, -, -, (OS), O) Y367 -, AY632697, (OS), asfoabicornis Passiflora KS) JX470823, (KESC), O) DQ458083, (OS), ´ O) AY632702, (OS), M) JX470839, (MO), O) AY632704, (OS), ab xDC. ex Balb. dz235 ndez ´ dzwr lost were ndez .Bte 66949 Butler G. .Porter-Utley, K. .Konc 262 Krosnick S. .H Goldman H. D. .Konc 4 Krosnick S. Malesherbia K Schum.) (K. :1–8. 6: .Uribe. L. . Passiflora Passiflora Passiflora Passiflora Molecular Mast. J MO), (J, Ricardi. .Croat T. (ARIZ), (Bolus (MO), Mast. Proc- .P. A. (OS), M. S. S. S. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. X777 AY632737. JX679787, jugorum Passiflora Schwerdtfeger. 631 X798 “ JX470938. 70 Yockteng X420 X780 -. JX679800, JX847250, micropetala 1774 AY632726. JX679798, DQ458146, aDua 6203MacDougal Martı ilamo 36203 Nee H. M. 719 Krosnick M) X772 Q671 X775 DQ458092. JX679765, Killip. DQ463761, JX470772, (MO), DQ445920. gracillima 1519GR87 MacDougal JX470881.JX679771, JX470877.JX679767, eberhardtii Passiflora JX470891. maestrensis holosericea 2051 gilbertiana AY632734. 351 JX679853, Krosnick DQ458134, AY632709, (BH), JX470880. -, JX847233, JX470799, JX847232,-,JX470879.escobariana -; JX470876. JX679764, Harms. JX847228, JX470815, (MO), AY632733. JX679763, DQ458132, JX470920. 233 cuneata Kay E. E. .Konc 353 Krosnick S. 4417 Wells X779 JX470861. JX679779, hirtiflora 255 Krosnick AY632735. JX679777, DQ458128, AY632710, DQ458106. JX679776, DQ458138, JX470884. JX470882. .M aDua 3012 MacDougal M. J. 38 [Volume gracillima BOTANY SYSTEMATIC complanata Passiflora Rose. DQ087430. JX679757, DQ458150, DQ087421, 712 FA) X770 X425 X770 JX470919. JX679760, JX847225, JX470790, (FLAS), JX470874. JX679759, JX847224, asfoalutea Passiflora Weigend. Mast. 261 Krosnick S. P-4 Mondragon-Chaparro 359 Mondragon-Chaparro 357 Mondragon-Chaparro D. Martı hahnii 6297 MacDougal asfoalancifolia Passiflora JX470925; JX679791, -, -, lancearia 334 Krosnick S. JX470887. JX679788, JX847243, X425 X772 JX470926. JX679792, JX847245, lancetillensis Passiflora uc.e .M MacDougal. JX470927. M. JX679794, J. ex Hutch. 1368 .Konc 365 Krosnick S. ´ M) JX470846, JX847246, JX679793, JX470889.(MO), M) X784 X429 X775 -. JX679785, JX847239, JX470844, (MO), ´ e .&R Martı R. & M. nez e .&M .Pe A. M. & M. nez .M aDua aVa p o.ined. nov. sp. MacVean & MacDougal M. J. ” .Pre-te 490 Porter-Utley K. LE,D488,D484,J693,DQ458110. JX679731, DQ458140, DQ458081, (LAE), .Pre-te .Ferna C. & Porter-Utley K. B) Y373 Q517 X780 AY632738. JX679840, DQ458147, AY632713, (BH), .E relv 58312 Breedlove E. D. E or. Mast. Fourn.) (E. .Mdrs n. s. Mader G. Willd. øgne Holm-Nielsen. & Jørgensen asfoahelleri Passiflora asfoamembranacea Passiflora Mast. .Wied2000 Weigend M. asfoacupiformis Passiflora asfoaguatemalensis Passiflora Killip. Killip. U) Q002 ,- -. -, -, DQ006022, (US), asfoaintricata Passiflora .M MacDougal. M. J. P,- Y656 ,-; -, AY261596, -, (P), asfoadiscophora Passiflora L. (* Duharte. Mast. .M MacDougal. M. J. O) Y371 Q519 X778 AY632736. JX679778, DQ458139, AY632711, (OS), RAPM,D485,D436,- DQ458094. -, DQ463760, DQ458053, (RSA-POM), otrUly487 Porter-Utley M) Q502 Q676 X776 DQ458097. JX679796, DQ463776, DQ458062, (MO), M) X778 X422 ,JX470943. -, JX847242, JX470768, (MO), O) Q500 Q673 X779 DQ458090. JX679789, DQ463773, DQ458060, (OS), .Konc 328 Krosnick S. M) X784 X426 X771 JX470875. JX679761, JX847226, JX470814, (MO), .M aDua 4983 MacDougal M. J. .M aDua 431 MacDougal M. J. M) ,J873,J698,-. JX679783, JX847238, -, (MO), L. ,D071,D483,J697,JX470883. JX679774, DQ458137, DQ087419, ), M) X782 X427 X772 X786 “ JX470886. JX679782, JX847237, JX470842, (MO), .E a 222 Kay E. E. .Konc 357 Krosnick S. .M øgne .Ciblm 2466 Chimbolema S. & Jørgensen M. P. RAPM,J407,- X779 JX470878. JX679769, -, JX470774, (RSA-POM), .M aDua n auode 4982 Lalumondier and MacDougal M. J. .M aDua 224 MacDougal M. J. .W Smith. W. W. asfoaedulisPassiflora asfoalobbii Passiflora asfoagracilisPassiflora asfoahollrungii Passiflora Ham. asfoajuliana Passiflora asfoaexsudansPassiflora asfoamicrostipula Passiflora ,J400,J873,J697,-; JX679772, JX847235, JX470800, ), IN,E975,- ,-; -, -, EU907257, (ICN), M) Q506 Q679 X781 -. JX679801, DQ463769, DQ458066, (MO), .E a 231 Kay E. E. .M MacDougal. M. J. .Yctn 65 Yockteng R. .Konc 564 Krosnick S. Gagn. ´ (FLAS),-,-,-,JX470924. .M aDua Meerman. & MacDougal M. J. CC,FA) ,J874,- -; -, JX847241, -, FLAS), (CICY, e .436 C. nez ´ e .434 F. rez KS,HM,J409,J872,J695,-. JX679758, JX847223, JX470797, HEM), (KESC, .Pre-te .Pu P-51 Paul A. & Porter-Utley K. M) X778 X429 X776 JX470921. JX679766, JX847229, JX470798, (MO), / CC) X771 ,- -; -, -, JX470791, (CICY), Peyr. .E aml20544 Hammel E. B. 385 ),JX470781,-,-,-. .M aDua p o.ined. nov. sp. MacDougal M. J. ” asfoacoriacea Passiflora asfoaleptoclada Passiflora .Konc 486 Krosnick S. O) Q847 ,J698,DQ087426; JX679781, -, DQ087417, (OS), .Konc 292 Krosnick S. asfoakuranda Passiflora asfoafilipes Passiflora .Konc 508 Krosnick S. asfoahenryiPassiflora M) ,D437,J697,-. JX679773, DQ463778, -, (MO), ´ asfoamexicana Passiflora .M aDua 3823 MacDougal M. J. .Konc 15 Krosnick S. M) X785 ,J699,JX470888. JX679790, -, JX470845, (MO), dzRı ndez Mast. M) X772 X428 ,JX470928. -, JX847248, JX470782, (MO), asfoamacrophyllaPassiflora .Konc 356 Krosnick S. øgne Lawesson. & Jørgensen asfoacupraea Passiflora Benth. KS,HM,J407,- JX679775, -, JX470777, HEM), (KESC, KS,HM,J402,- ,-; -, -, JX470825, HEM), (KESC, M) ,J874,J698,JX470923. JX679786, JX847240, -, (MO), Sims. .Yctn 67 Yockteng R. M) X786 X429 JX679797, JX847249, JX470816, (MO), P,- Y651 ,-; -, AY261591, -, (P), Mast. M) X780 X427 JX679762, JX847227, JX470840, (MO), .Watson. S. RAPM,J407,J874,- -. -, JX847244, JX470775, (RSA-POM), aq xLink. ex Jacq. M) ,- X775 JX470890 JX679795, -, -, (MO), .M MacDougal. M. J. aDua 555GRMacDougal ´ .Konc 253 Krosnick S. s425 os .Schum. K. Zucc. .Yctn 46 Yockteng R. .Konc 19 Krosnick S. asfoaherbertianaPassiflora subsp asfoacolimensis Passiflora .Glet&J .MacDougal. M. J. & Gilbert L. asfoaindecora Passiflora .Mrut 3080 Marquete R. M) X783 ,JX679784, -, JX470843, (MO), O) Y372 DQ458143, AY632712, (OS), M) X782 JX847247, JX470802, (MO), .M aDua 3015 MacDougal M. J. asfoajussieui Passiflora asfoaichthyuraPassiflora asfoacubensis Passiflora O) X778 JX847230, JX470778, (OS), asfoajatunsachensis Passiflora . M) X784 JX847234, JX470824, (MO), Benth. KS,HM,JX470801, HEM), (KESC, Hemsl. ayacuchoensis asfoadeidamioides Passiflora Juss. asfoalobata Passiflora .Konc 347 Krosnick S. RAPM,DQ458082, (RSA-POM), asfoadolichocarpa Passiflora asfoafoetida Passiflora P,J404,JX847236, JX470841, (P), rsik&A .Ford. J. A. & Krosnick .Bna&S Krosnick S. & Banka R. asfoakarwinskii Passiflora Harms. .Konc 413 Krosnick S. .Pre-te D. & Porter-Utley K. .Konc 447 Krosnick S. Juss. M) X773 ,-, -, JX470773, (MO), .Pre-te D. & Porter-Utley K. .Pre-te P-68 Porter-Utley K. .Pre-te,N. Porter-Utley, K. .H oda 2153 Goldman H. D. L. P,- Y655 -, AY261575, -, (P), FA) JX470792, (FLAS), .Konc 8 Krosnick S. .Pre-te,N. Porter-Utley, K. O) AY632708, (OS), M) JX470808, (MO), .Pre-te & Porter-Utley K. O) AY632701, (OS), M) JX470847, (MO), puee Mast. ex Spruce M) JX470827,(MO), .E a 227 Kay E. E. .Konc 352 Krosnick S. Passiflora .H Goldman H. D. .A McDade A. L. (RB),-,-,-, .Krosnick S. Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora kaa & Skrabal Kunth. Lindl. at & Mast. Feuillet. (Killip) (* Urban. (* (MO), (MO), Mast. .M. J. .W. B. .M. J. (OS), .M. J. L. aff. R. S. S. S. rovirosae JX470901. 1 JX679826, Krosnick -, JX470771, enn 3 Henning JX470932. JX470903; JX679832, JX679831, JX847271, Martı N. Utley, MacDougal. JX470902. JX679830, M. JX847270, J. & Feuillet 1358 JX470931. McDade A. JX679828, JX847268, JX470810, FLAS), JX470900. -. JX679824, MacDougal. JX847267, JX470851, (RSA-POM), JX470939. JX679726, JX847266, porphyretica s.n. 528GR asfoapilosa Passiflora 341 Mondragon-Chaparro subsp. D. DC. ex Pav. & Ruiz aa1774 Lara 256 JX470892. misera 55 “ DQ284535. JX679804, L. DQ458155, DQ284535, (OS), X789 DQ087431. JX679819, .Mre199800014 Morse C. X786 -. JX679836, sexflora L. asfoaperakensis Passiflora sanguinolenta 6036 MacDougal sandrae Q843 Q512 X788 DQ087432. Cham. JX679838, & Schlecht. DQ458162, DQ087423, JX470906; X785 -. JX679845, AF454793. -, -, AF454809, talamancensis 435 JX470907. -, JX847277, JX470786, -. JX470933; JX679839, -, -, JX470805, FLAS), Sesse DQ458098. JX679809, DQ463779, DQ458064, JX470895. (MO), JX679808, JX847254, -. JX679807, JX470893. JX679806, 217 Kay JX847253, JX470784, (§), xDC. JX470929. ex JX679817, JX847262, JX470803, pendens Passiflora RAPM,J405,J878,J694,JX470941. JX679844, JX847280, telesiphe JX470853, (RSA-POM), tacanensis 418 JX470922. JX679768, aff. aDua 410 MacDougal 1031 Carretero E) X781 X420 X785 -. JX679815, MacDougal. JX847260, JX470831, HEM), X782 -. JX679812, orbiculata Passiflora ined. nov. “ JX470896. pavonis adrln s.n. Vanderplank 745 -; -, -, EU258359, -. (ICN), JX679813, JX847258, JX470826, asfoamunchiquensisPassiflora .H oda 2164 Goldman H. D. .Konc 264 Krosnick S. FA) X781 X424 X780 JX470899. JX679820, JX847264, JX470821, (FLAS), §,J408,J875,JX679803, JX847252, JX470783, (§), KS,HM,J409,J877,J694,JX470910. JX679842, JX847279, JX470794, HEM), (KESC, ´ HES,- ,- DQ123122. -, -, -, (HUEFS), eckmanii M) Q946 Q944 X782 DQ995475. JX679822, DQ995474, DQ995476, (MO), M) X779 X428 X781 JX470909. JX679841, JX847278, JX470769, (MO), &Mocin M) X784 ,- JX470930. -, -, JX470804, (MO), Kunth. .E a 230 Kay E. E. M) X787 ,- JX470894 -, -, JX470817, (MO), Mast. .M MacDougal. M. J. M) ,- ,DQ087427. -, -, -, (MO), Juss. asfoamonadelphaPassiflora np Mallet. & Knapp .Herna A. Killip .Pre-te .Pu P-48 Paul A. & Porter-Utley K. O) Y316 Q670 X787 AY636106. JX679827, DQ463780, AY636106, (OS), Port.-Utl. M) X775 X423 X783 JX470904. JX679833, JX847273, JX470785, (MO), asfoaoccidentalis Passiflora asfoapyrrhantha Passiflora asfoatenella Passiflora .M aDua 6215 MacDougal M. J. asfoaornithoura Passiflora asfoaoblongata Passiflora asfoasodiroi Passiflora ˜ at var. Mast. asfoasiamica Passiflora .Pre-te 420 Porter-Utley K. M) X777 ,J694,JX470908. JX679840, -, JX470787, (MO), o. .Konc 371 Krosnick S. Mast. ´ .Pre-te .Mrie .&M ee 467 Perez M. & M. Martinez N. & Porter-Utley K. .Konc 626 Krosnick S. e .&R Martı R. & M. nez Liogier. Killip. M) ,- X783 -; JX679843, -, -, (MO), M) X781 X429 X789 -. JX679829, JX847269, JX470811, (MO), .A cae1348 McDade A. L. .Pre-te .MnrgnCaar 309 Mondragon-Chaparro D. & Porter-Utley K. M) X780 X429 X784 -. JX679814, JX847259, JX470850, (MO), M) X782 ,J693,JX470940. JX679834, -, JX470852, (MO), ´ uz&Pv xD.subsp. DC. ex Pav. & Ruiz O) Y318 Y665 ,AY636109. -, AY261645, AY636108, (OS), dz257 ndez .Pre-te .MnrgnCaar 338 Mondragon-Chaparro D. & Porter-Utley K. CN) ,A214,- -. -, AY261643, -, (CONN), .Konc 28 Krosnick S. asfoasphaerocarpa Passiflora .M MacDougal. M. J. asfoaperfoliata Passiflora .Pre-te .Mrie .&R atnzC. Martinez R. & M. Martinez N. & Porter-Utley K. asfoasagasteguii Passiflora al f. Hall. Cav. .S ue,J .Jri,M .Mre .M Silva M. B. & Moraes V. M. Jardim, G. J. Nunes, S. T. M) X780 X423 X788 JX470898. JX679818, JX847263, JX470820, (MO), B) Y375 Q512 X780 AY632740. JX679810, DQ458152, AY632715, (BH), .Yctn 125 Yockteng R. angustata .Konc 595 Krosnick S. asfoatatei Passiflora ”A.Herna dimidiata .Yctn 112 Yockteng R. §,J404,J875,J691,JX470897. JX679811, JX847256, JX470849, (§), .Konc 601 Krosnick S. .Yctn 127 Yockteng R. .Konc 314 Krosnick S. CC,FA) ,J876,J692,-. JX679821, JX847265, -, FLAS), (CICY, RAPM,J404,J875,JX679802, JX847251, JX470848, (RSA-POM), asfoaobovata Passiflora Killip. .M aDua 6019 MacDougal M. J. asfoarugosissima Passiflora asfoapunctata Passiflora asfoamorifoliaPassiflora asfoasolomonii Passiflora øgne Holm-Nielsen. & Jørgensen M) X780 X425 JX679837, JX847275, JX470830, (MO), .R ats520 Santos R. R. Harms. 6414 Magana H. R. M) X776 X421 X786 -. JX679816, JX847261, JX470776, (MO), ´ asfoaovalis Passiflora .G Craib. G. W. O) X782 ,J693,JX470905; JX679835, -, JX470812, (OS), e .428 C. nez ”J.M.MacDougal&Herna Killip. asfoapardifolia Passiflora Sw. M) X773 X425 JX679810, JX847255, JX470793, (MO), ´ Mast. .Jresn .Ula .Nraz&M. & Narvaez E. Ulloa, C. Jørgensen, P. dzs.nv ined. nov. sp. ndez asfoapittieri Passiflora asfoaquadrangularis Passiflora Harms. .M MacDougal. M. J. KS) X789 ,JX679825, -, JX470809, (KESC), .B ltar,B eio .Lozano P. Merino, B. Klitgaard, B. B. .Konc 263 Krosnick S. .E a 177 Kay E. E. .Vnepak1243 Vanderplank J. P,- Y663 ,-; -, AY261653, -, (P), ilp&Rusby. & Killip .M aDua 1941 MacDougal M. J. .M aDua 571 MacDougal M. J. .M aDua 2027 MacDougal M. J. asfoapenduliflora Passiflora asfoapedicellaris Passiflora .M aDua 6205 MacDougal M. J. L. FA) X789 JX847274, JX470829, (FLAS), M) X785 JX847231, JX470835, (MO), asfoamurucuja Passiflora O) Q842 DQ458158, DQ087422, (OS), P,- Y661 ,-; -, AY261641, -, (P), M) X789 JX847257, JX470819, (MO), .Pre-te .Pu P- Paul A. & Porter-Utley K. asfoaserratodigitata Passiflora KS,HM,JX470828, HEM), (KESC, r Planch. & Tr. .Konc 391 Krosnick S. P,J405,JX847281, JX470854, (P), kaa Weigend. & Skrabal pilosa asfoapusilla Passiflora .Konc 346 Krosnick S. asfoarubra Passiflora asfoaobtusifolia Passiflora asfoasicyoides Passiflora Killip. asfoamultiflora Passiflora M) ,JX847272, -, (MO), Mast. Vell. M) ,JX847276, -, (MO), asfoas.nov. sp. Passiflora L. O) ,DQ458153, -, (OS), . .K Escobar. K. L. asfoapilosa Passiflora M) JX470789, (MO), .M MacDougal M. J. .Pre-te & Porter-Utley K. Killip. Mast. M) JX470818, (MO), .Herna A. .Konc 363 Krosnick S. asfoarufa Passiflora .Konc 355 Krosnick S. .Konc 387 Krosnick S. .Konc 311 Krosnick S. Vanderplank. .Mdrs.n. Mader G. / .Herna A. 07a .Krosnick S. Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora Passiflora .Boender R. ´ .Porter- K. ´ dzsp. ndez M) -, (MO), dz252 ndez L. (KESC, (NCP), (CICY, (CICY, (MO), (MO), (MO), (MO), L. .M. J. .M. J. (OS), .M. J. ´ .M. J. Bert. .E. E. L. ndez .L. J. T. S. L. Delivered by Publishing Technology to: Smithsonian Institution Libraries IP: 160.111.254.17 on: Tue, 24 Sep 2013 10:44:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 03 RSIKE L:PSILR UGNSDCLB 713 DECALOBA SUBGENUS PASSIFLORA AL.: ET KROSNICK tenuiloba 426 Delgado T. & 2013] AY632744. Urban. 1360 McDade A. JX470936. JX679850, JX847285, JX470788, (MO), JX470935. JX679849, JX847284, JX470911. AY632746.Ulmer. JX679847, DQ463764, AY632721, .Konc 345 Krosnick S. .Konc 569 Krosnick S. asfoatricuspis Passiflora Engelm. asfoatetrandra Passiflora M) X782 X422 X786 JX470934. JX679846, JX847282, JX470832, (MO), M) X786 X426 X781 -. JX679851, JX847286, JX470856, (MO), .H oda 1770 Goldman H. D. O) ,D486,J695,JX470912. JX679852, DQ458164, -, (OS), RAPM,J407,J878,JX679848, JX847283, JX470770, (RSA-POM), Mast. asfoatruncata Passiflora ak o.e DC. ex Sol. & Banks .Konc 385 Krosnick S. B) Y379 Q514 -, DQ458154, AY632719, (BH), asfoatina Passiflora asfoatuberosa Passiflora RAPM,JX470855, (RSA-POM), Regel. .Konc 266 Krosnick S. asfoatulae Passiflora .Konc 465 Krosnick S. one & Boender Passiflora Passiflora Jacq. (OS), L. .Mondragon-Chaparro 387 D. -; -, -, clGre BV 3320 JBAVH Garden ical X786 DQ087434.JX679856, Kunth urnifolia 2468 JX470942. JX679853, Passiflora -, AY261668, M) X789 X428 X781 JX470914. JX679851, JX847288, JX470859, (MO), asfoawilsonii Passiflora .Pre-te 98–1 Porter-Utley K. Rusby. cf. viridescens .M aDua 6022 MacDougal M. J. .A cae1344 McDade A. L. asfoaxiikzodz Passiflora asfoavespertilio Passiflora P,- Y660 ,-; -, AY261670, -, (P), .K Escobar. K. L. CC) X775 ,J695,JX470916. JX679857, -, JX470795, (CICY), Hemsl. FA) ,- X785 JX470915; JX679855, -, -, (FLAS), .Wn5973 Wen J. M) X788 ,- JX470913. -, -, JX470858, (MO), .M MacDougal. M. J. .M øgne .Chimbolema S. & Jørgensen M. P. .M sosis.n. Ossowski M. A. M) X787 JX847287, JX470857, (MO), L. F,D072,DQ458165, DQ087425, (F), .Yctn 137 Yockteng R. asfoavitifolia Passiflora .Pre-te & Porter-Utley K. ¥,AF454796, (¥), oiaBotan- Tolima P,-, (P),