15 March 2005 Use of Articles in the Pachyonychia Congenita Bibliography The articles in the PC Bibliography may be restricted by copyright laws. These have been made available to you by PC Project for the exclusive use in teaching, scholar- ship or research regarding Pachyonychia Congenita. To the best of our understanding, in supplying this material to you we have followed the guidelines of Sec 107 regarding fair use of copyright materials. That section reads as follows: Sec. 107. - Limitations on exclusive rights: Fair use Notwithstanding the provisions of sections 106 and 106A, the fair use of a copyrighted work, including such use by reproduction in copies or phonorecords or by any other means specified by that section, for purposes such as criticism, comment, news reporting, teaching (including multiple copies for classroom use), scholarship, or research, is not an infringement of copyright. In determining whether the use made of a work in any particular case is a fair use the factors to be considered shall include - (1) the purpose and character of the use, including whether such use is of a commercial nature or is for nonprofit educational purposes; (2) the nature of the copyrighted work; (3) the amount and substantiality of the portion used in relation to the copyrighted work as a whole; and (4) the effect of the use upon the potential market for or value of the copyrighted work. The fact that a work is unpublished shall not itself bar a finding of fair use if such finding is made upon consideration of all the above factors. We hope that making available the relevant information on Pachyonychia Congenita will be a means of furthering research to find effective therapies and a cure for PC. 2386 East Heritage Way, Suite B, Salt Lake City, Utah 84109 USA Phone +1-877-628-7300 • Email—[email protected] www.pachyonychia.org ORIGINAL ARTICLE Mice Expressing a Mutant Krt75 (K6hf ) Allele Develop Hair and Nail Defects Resembling Pachyonychia Congenita Jiang Chen1, Karin Jaeger2,3, Zhining Den4, Peter J. Koch1,4,5, John P. Sundberg2 and Dennis R. Roop1,4,5 KRT75 (formerly known as K6hf) is one of the isoforms of the keratin 6 (KRT6) family located within the type II cytokeratin gene cluster on chromosome 12 of humans and chromosome 15 of mice. KRT75 is expressed in the companion layer and upper germinative matrix region of the hair follicle, the medulla of the hair shaft, and in epithelia of the nail bed. Dominant mutations in members of the KRT6 family, such as in KRT6A and KRT6B cause pachyonychia congenita (PC) -1 and -2, respectively. To determine the function of KRT75 in skin appendages, we introduced a dominant mutation into a highly conserved residue in the helix initiation peptide of Krt75. Mice expressing this mutant form of Krt75 developed hair and nail defects resembling PC. This mouse model provides in vivo evidence for the critical roles played by Krt75 in maintaining hair shaft and nail integrity. Furthermore, the phenotypes observed in our mutant Krt75 mice suggest that KRT75 may be a candidate gene for screening PC patients who do not exhibit obvious mutations in KRT6A, KRT6B, KRT16, or KRT17, especially those with extensive hair involvement. Journal of Investigative Dermatology (2008) 128, 270–279; doi:10.1038/sj.jid.5701038; published online 13 September 2007 INTRODUCTION the skin, hair follicles, and nails. However, each member of The keratin 6 (KRT6) cluster consists of several genes that the KRT6 gene family shows a cell- and tissue-type-specific encode intermediate filament (IF) proteins belonging to the expression pattern. KRT6A and KRT6B are constitutively type II keratin family. In humans, functional KRT6 genes expressed in the outer root sheath of anagen-stage hair include KRT6A, KRT6B, KRT6C (formerly known as KRT6E/ follicles, epithelia of the nail bed, and stratified epithelia H), KRT75 (formerly known as K6hf) and KRT71-KRT74 lining the oral cavity and the esophagus (Moll et al., 1982; (formerly known as K6irs1-K6irs4), whereas in the mouse Ouhayoun et al., 1985; Stark et al., 1987; O’Guin et al., Krt6a, Krt6b, and Krt71-Krt75 make up this family of 1990; Langbein and Schweizer, 2005). KRT75 is expressed genes (These designations are used according to the in the companion layer, upper germinative matrix region of new nomenclature for mammalian keratins (Schweizer the hair follicle, and medulla of the hair shaft (Winter et al., et al., 2006).). These genes share striking sequence simi- 1998; Wojcik et al., 2001; Wang et al., 2003). In addition, larities and are widely expressed in epithelial tissues, especially the mouse keratin 75 protein (K75) is also synthesized in the nail bed epithelia of mice (Wojcik et al., 2001). 1Department of Molecular and Cellular Biology, Baylor College of Medicine, In addition to constitutive expression, several KRT6 Houston, Texas, USA; 2The Jackson Laboratory, Bar Harbor, Maine, USA; isoforms are specifically induced in response to hyperproli- 3Department of Dermatology, Medical University of Vienna, Vienna, Austria ferative stimuli, such as wounding. For example, KRT6A is 4 and Department of Dermatology, Baylor College of Medicine, Houston, induced in all layers of the epidermis under hyperprolifera- Texas, USA tive conditions, whereas the induction of KRT6B is restricted 5Current address: Department of Dermatology and Regenerative Medicine and Stem Cell Biology Program, University of Colorado at Denver and Health to the more differentiated layers of the epidermis (Wojcik Sciences Center, Aurora, Coloardo 80045, USA et al., 2000). The in vivo functions of Krt6 genes have been Correspondence: Dr Dennis R. Roop, Department of Dermatology and evaluated in genetically engineered mouse models for Krt6a Regenerative Medicine and Stem Cell Biology Program, University of (Krt6atm1Der) and Krt6a/Krt6b (Krt6a/Krt6btm1Cou, Krt6a/ Colorado at Denver Health Sciences Center, PO Box 6511, Mail Stop 8320, Krt6btm1Der) (Wojcik et al., 2000, 2001; Wong et al., 2000). Aurora, Colorado 80045, USA. E-mail: [email protected] Interestingly, the absence of Krt6a or Krt6a/K6b did not Abbreviations: BAC, bacterial artificial chromosome; ES, embryonic stem IF, intermediate filament; K75, human and mouse keratin 75 (formerly known prevent normal development and function of epithelial as K6hf) protein; KRT6, keratin 6; KRT75, human keratin 75 (formerly known tissues and ectodermal appendages. However, loss of these as human K6hf) gene; Krt75, mouse keratin 75 (formerly known as mouse tm1Der proteins altered the response of these tissues to injury and K6hf) gene; Krt75 , mouse keratin 75-targeted mutation; PC, mechanical stress. For instance, delayed re-epithelialization pachyonychia congenita; PC-1, Type I PC; SEM, scanning electron tm1Der microscopy; SM-CSM, selection counter selection marker of the skin was observed in Krt6a mice following Received 7 May 2007; accepted 24 June 2007; published online wounding (Wojcik et al., 2000), and hyperplastic changes 13 September 2007 secondary to mechanical stress associated with food intake 270 Journal of Investigative Dermatology (2008), Volume 128 & 2007 The Society for Investigative Dermatology J Chen et al. Mouse Model for a Dominant Krt75 Mutation were reported in the oral cavities of Krt6a/Krt6btm1Cou and To explore the role of mouse Krt75 in hair and nail Krt6a/Krt6btm1Der mice (Wong et al., 2000; Wojcik et al., formation and generate a mouse model that more closely 2001). In contrast to Krt6a and Krt6b, Krt75 expression is not mimicked human PC, we genetically engineered a dominant induced in the epidermis in response to mechanical stress or mutation into the mouse Krt75 locus. We present, the first wounding (Wojcik et al., 2001). reported ‘‘knock-in’’ model for a dominant type II keratin Mutations in KRT6A and KRT6B result in pachyonychia mutation. We report that deletion of the highly conserved congenita (PC) (OMIM #167200 and #167210). PC is a rare, asparagine residue (N159) in the initiation motif of the helical autosomal dominant form of ectodermal dysplasia, charac- rod domain of Krt75 caused collapse of the keratin IFs terized by distally progressive hypertrophic onychodystrophy in vitro, and produced hair and nail abnormalities in vivo. and focal hyperkeratosis of palms and soles (Leachman et al., 2005). Germline mutations in KRT6A and KRT16 are RESULTS associated with Type I PC (PC-1), whereas mutations in Generation of a Krt75 dominant mutation that interferes with KRT6B and KRT17 are associated with Type II PC (PC-2) normal IF assembly in cultured cells (Smith et al., 2005). KRT16 and KRT17 encode type I keratins Dominant-negative mutations have been identified in the (K16 and K17) that form keratin IF together with K6A and KRT6A gene of PC-1 patients. The most frequent mutation is a K6B, respectively. Codon 171 (AAC) and 172 (AAC) of deletion of codon 172, encoding asparagine (N). It is thought KRT6A both encode asparagines (N). Previous reports that this mutation leads to the synthesis of a defective K6a referred to deletion of one of these codons as either protein that interferes with the assembly of a functional N171del or N172del. The Human Genome Variation Society keratin IF cytoskeleton. A comparison of the NH2-terminal (www.hgvs.org) has recently recommended that when a rod domains of human K6A and mouse K75 reveals a high codon is deleted from a series of identical codons, the degree of amino-acid sequence homology (Figure 1a). N172 deletion should be designated as the last codon in the series. of human K6A corresponds to N159 of mouse K75. There- Therefore, in accordance with this recommendation, we have fore, we hypothesized that a deletion of N159 (N159del) now designated N171del as N172del. We previously suggested that N172del was a mutational ‘‘hotspot’’ KRT6A GAGCGTGAACAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTCATC (Lin et al., 1999) and a recent review as confirmed that K6A -E--R--E--Q--I--K--T--L--N--N--K--F--A--S--F--I-- N172del is the most common mutation in PC-1 (Lane and (172) McLean, 2004).