Phylogenetic Evidence for an Animal Pathogen Origin of Ergot and The

Home , Clavicipitaceae, Cofana, Hypocrella

Molecular Ecology (2007) 16, 1701–1711 doi: 10.1111/j.1365-294X.2007.03225.x

BPlackwell Puhblishing Ltdylogenetic evidence for an animal pathogen origin of ergot and the grass endophytes

J. W. SPATAFORA,* G.-H. SUNG,* J.-M. SUNG,† N. L. HYWEL-JONES‡ and J. F. WHITE, JR§ *Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR 97331, USA, †Department of Applied Biology, Kangwon National University, Chuncheon 200-701, Korea, ‡Mycology Laboratory, National Center for Genetic Engineering and Biotechnology, Science Park, Pathum Thani 12120, Thailand, §Department of Plant Biology and Pathology, Rutgers University, New Brunswick, NJ 08901, USA

Abstract Grass-associated fungi (grass symbionts) in the family Clavicipitaceae (Ascomycota, Hypo- creales) are species whose host range is restricted to the plant family Poaceae and rarely Cyperaceae. The best-characterized species include Claviceps purpurea (ergot of rye) and Neotyphodium coenophialum (endophyte of tall fescue). They have been the focus of con- siderable research due to their importance in agricultural and grassland ecosystems and the diversity of their bioactive secondary metabolites. Here we show through multigene phylogenetic analyses and ancestral character state reconstruction that the grass symbionts in Clavicipitaceae are a derived group that originated from an animal pathogen through a dynamic process of interkingdom host jumping. The closest relatives of the grass symbionts include the genera Hypocrella, a pathogen of scale insects and white flies, and Metarhizium, a generalist arthropod pathogen. These data do not support the monophyly of Clavicipitaceae, but place it as part of a larger clade that includes Hypocreaceae, a family that contains mainly parasites of other fungi. A minimum of 5–8 independent and unidi- rectional interkingdom host jumps has occurred among clavicipitaceous fungi, including 3–5 to fungi, 1–2 to animals, and 1 to plants. These findings provide a new evolutionary context for studying the biology of the grass symbionts, their role in plant ecology, and the evolution of host affiliation in fungal symbioses. Keywords: Clavicipitaceae, evolution, fungi, grass symbionts, host affiliation, interkingdom host- jumping, symbioses Received 30 July 2006; revision received 9 October 2006; accepted 6 November 2006

hypothesized that psychoactive side effects from ingesting Introduction ergot alkaloids were connected with early biblical events, Grass-associated fungi (grass symbionts) of the family played an important ceremonial role in ancient Greece, Clavicipitaceae have had a significant impact on human and were partially responsible for the 16th and 17th civilization for thousands of years (White et al. 2003). The century witch trials in both Europe and colonial America best-documented case is that of Claviceps purpurea (ergot), (Matossian 1989; Hudler 1998; White et al. 2003). It was not the causal agent of ergotism, which is expressed in the until the mid-1700s, however, that Cl. purpurea was identi- form of numerous human maladies including gangrene, fied as the cause of ergotism (Tissot 1765). The biological convulsions and seizures, hallucinations and hysteria, and activity of Cl. purpurea and related fungi has been used susceptibility to other diseases (Matossian 1989; Hudler in numerous cultures and traditional and modern medi- 1998). The physiological and psychoactive effects of cine to facilitate childbirth and abortions (Riddle 1997), Cl. purpurea are due to its ability to produce potent to treat migraines (Landy 2004), and in recreational drug biologically active alkaloids that have detrimental effects use, that is, LSD25 (Hofmann 1980). on the central nervous system (Tudzynski et al. 2001). It is More recently, mycologists, plant ecologists, and plant pathologists have documented the prevalence and importance Correspondence: Joseph W. Spatafora, Fax: 1-541-737-3573; of fungal endophytes of plants, especially those of grasses E-mail: [email protected] (Schardl 1996; Saikkonen et al. 1998; Clay & Schardl 2002;

1702 J. W. S PAT AFO RA E T A L.

Fig. 1 Exemplar species of Clavicipitaceae. (a) Cordyceps militaris on lepidopteran pupa. (b) Cordyceps ophioglossoides on Elaphomyces sp. (truffle, Ascomycota). (c) Metarhizium on Graptopsaltria nigrofuscata (cicada, Hemiptera). (d) Hypocrella on scale insects (Hemiptera). (e) Claviceps purpurea on Spartina alterniflora (Poaceae). (f) hyphae of Neotyphodium lolii growing endophytically in Lolium perenne (Poaceae).

Schardl et al. 2004). The primary fungi that comprise In addition to the grass symbionts, Clavicipitaceae the grass endophytes are Clavicipitaceae species of comprises a diverse assemblage of fungi characterized by the sexually reproductive genus Epichloë and its asexual symbioses and associations with other eukaryotes, includ- counterpart Neotyphodium. These organisms grow as true ing pathogens of animals and parasites of other fungi endophytes and typically colonize the aerial portion of the (Kobayasi 1941, 1982; Mains 1957, 1958, 1959; Fig. 1). Sig- plant. Epichloë species produce sexually reproductive stro- nificantly, most Clavicipitaceae species are pathogens of mata that physically encase the florets, preventing seed arthropods and are classified in the sexual genera Cordyceps, development, a syndrome known as choke (White et al. Hypocrella, and Torrubiella (Kobayasi 1941, 1982; Mains 1991). Neotyphodium species produce no reproductive 1957, 1958, 1959). As a group, these fungi attack hosts from structures on the plant, but grow as a filamentous stage at least 10 orders of Arthropoda, although any one fungus throughout the plant and are vertically transmitted with species has a narrow host range of a single species or the host’s seeds. The interaction of Epichloë species with the closely related species and attacks a particular stage of the host plant is generally considered antagonistic, while arthropod life cycle. Fungal parasites in Clavicipitaceae Neotyphodium species are usually considered mutualistic. comprise a group of approximately 20 species of Cordyceps, Infected host plants benefit from increased drought which exhibit host specificity to the truffle genus Elapho- tolerance, enhanced growth and competitive ability, and myces (Ascomycota) (Mains 1957). Additional pathogens decreased herbivory (Clay 1988, 1990; Clay & Schardl and parasites of the animal and fungal kingdoms include 2002). Much of the beneficial effect of the interaction is numerous asexual genera that attack microinvertebrates attributed to the secondary metabolites produced by the (Gams & Zare 2003) and other fungi, including rust fungi fungus, although the mode of action is only known in the and the commercially cultivated button mushroom (Gams case of herbivory; many of the metabolites have antagonistic & van Zaayen 1982). Like the grass symbionts, animal effects on insects and significantly deter insect feeding pathogens and fungal parasites in Clavicipitaceae produce (Clay 1988; Bush et al. 1997; Siegel & Bush 1997; Wilkinson a myriad of secondary metabolites (Isaka et al. 2003) with et al. 2000; Clay & Schardl 2002; Tanaka et al. 2005). several extracts, purified compounds, and species used in

E V OL U TI ONAR Y OR IGI N OF GR ASS-A SSOCI AT E D F UNGI 1703 traditional (Zhu et al. 1998) and modern (Dunn et al. 2001) related families in Hypocreales. Emphasis was placed on medicine, research (Naula et al. 2003), and in agriculture as broad representation of host affiliation and morphological biological control agents (Shah & Pell 2003). and taxonomic diversity. Two species, Glomerella cingulata Clavicipitaceae is in the order Hypocreales (Ascomycota) and Verticillium dahliae, from the closely related order and its broad host range and diverse ecology is unique for the Phyllachorales were included as outgroup taxa. Information order. Other major families and ecologies of Hypocreales on source of fungal isolates is provided in Table 1. include Hypocreaceae, with most species being parasites of fungi, and Nectriaceae and Bionectriaceae, which com- Molecular techniques prise numerous plant pathogens and saprobes of woody and herbaceous plants (Rossman et al. 1999). As such, the Six loci including those that encode for the nuclear small evolutionary history of Hypocreales and Clavicipitaceae is (SSU rRNA) and large (LSU rRNA) ribosomal RNAs, characterized by interkingdom host jumping, with the best β-tubulin (β-tub), translation elongation factor 1-α (tef1) studied example being among closely related species of the largest (rpb1) and second largest (rpb2) subunits of RNA Cordyceps that attack cicadas nymphs and Elaphomyces, polymerase II genes were sampled. DNA was isolated and which share a common subterranean habitat (Nikoh & rRNA loci were amplified, sequenced and aligned as pre- Fukatsu 2000). To better understand the evolutionary rela- viously described (Sung et al. 2001). Protein-coding genes tionships among the animal, fungal, and plant-associated were amplified and sequenced with primers listed in Table 2. fungi in Clavicipitaceae and to provide a phylogenetic Sequencing was performed with BigDye version 3 (Applied foundation for future studies, we conducted a multigene Biosystems Inc.) and run on either an ABI 3100 or ABI 3700 phylogenetic study of the family. Using this phylogeny, we automated sequencer in the Central Services Laboratory at then performed a maximum-likelihood character-state Oregon State University. GenBank Accession nos for all data reconstruction analysis to test the evolutionary origins of are listed in Table 1. Protein-coding genes were initially the grass symbionts and to develop more robust hypothe- converted to predicted amino acid sequences, aligned using ses for the evolution of interkingdom host jumping. clustal w (Thompson et al. 1999) and then converted back to primary nucleotide sequences. Ambiguous regions in alignment were excluded from phylogenetic analyses. Materials and methods

Materials Phylogenetic analyses A total of 69 fungal isolates were sampled, including To test for incongruence among the six individual data 54 isolates of Clavicipitaceae and 13 isolates from closely sets, we compared 70% bootstrap trees from weighted

Table 1 List of taxa used in this study, the voucher information, the host affiliation, and the GenBank Accession nos

GenBank Accession no.

Taxon Voucher no.* Host/substrate SSU rRNA LSU rRNA tef1 rpb1 rpb2 β-tub

Aschersonia badia BCC 8105 scale insect DQ522537 DQ518752 DQ522317 DQ522363 DQ522411 DQ522472 Aschersonia placenta BCC 7957 scale insect DQ522538 DQ518753 DQ522318 DQ522364 DQ522412 DQ522473 Balansia henningsiana GAM 16112 Panicum sp. AY545723 AY545727 AY489610 AY489643 DQ522413 DQ522474 Balansia pilulaeformis AEG 94–2 Poaceae AF543764 AF543788 DQ522319 DQ522365 DQ522414 DQ522475 Bionectria ochroleuca CBS 114056 on bark AY489684 AY489716 AY489611 — DQ522415 DQ522476 Claviceps fusiformis ATCC 26019 Poaceae DQ522539 U17402 DQ522320 DQ522366 — DQ522477 Claviceps paspali ATCC 13892 Poaceae U32401 U47826 DQ522321 DQ522367 DQ522416 DQ522478 Claviceps purpurea GAM 12885 Dactylis glomerata AF543765 AF543789 AF543778 AY489648 DQ522417 DQ522479 Cordyceps agriota ARSEF 5692 Coleoptera DQ522543 DQ518754 DQ522326 DQ522371 DQ522423 DQ522485 Cordyceps aphodii ARSEF 5498 Aphodius hewitti DQ522540 DQ518755 DQ522322 DQ522368 DQ522418 DQ522480 Cordyceps brunneapunctata OSC 128576 Coleoptera DQ522541 DQ518756 DQ522323 — DQ522419 DQ522481 Cordyceps capitata OSC 71233 Elaphomyces sp. DQ522542 AY489721 DQ522324 DQ522369 DQ522420 DQ522482 Cordyceps cardinalis OSC 93609 Lepidoptera AY489689 AY184962 AY489615 AY489649 DQ522421 DQ522483 Cordyceps cf. acicularis OSC 128580 Coleoptera AY184973 DQ518757 DQ522325 DQ522370 DQ522422 DQ522484 Cordyceps chlamydosporia CBS 101244 Mollusca DQ522544 DQ518758 DQ522327 DQ522372 DQ522424 DQ522486 Cordyceps fracta OSC 110990 Elaphomyces sp. DQ522545 DQ518759 DQ522328 DQ522373 DQ522425 DQ522487 Cordyceps gunnii OSC 76404 Lepidoptera larva AF339572 AF339522 AY489616 AY489650 DQ522426 DQ522488 Cordyceps heteropoda OSC 106404 cicada AY489690 AY489722 AY489617 AY489651 — — Cordyceps irangiensis OSC 128577 ant DQ522546 DQ518760 DQ522329 DQ522374 DQ522427 DQ522489

1704 J . W. S P A TA FOR A E T A L.

Table 1 Continued.

GenBank Accession no.

Taxon Voucher no.* Host/substrate SSU rRNA LSU rRNA tef1 rpb1 rpb2 β-tub

Cordyceps japonica OSC 110991 Elaphomyces sp. DQ522547 DQ518761 DQ522330 DQ522375 DQ522428 DQ522490 Cordyceps melolonthae OSC 110993 Scarabaeidae larva DQ522548 DQ518762 DQ522331 DQ522376 — DQ522491 Cordyceps militaris OSC 93623 Lepidoptera AY184977 AY184966 DQ522332 DQ522377 AY545732 DQ522492 Cordyceps nutans OSC 110994 stink bug DQ522549 DQ518763 DQ522333 DQ522378 — DQ522493 Cordyceps ophioglossoides OSC 106405 Elaphomyces sp. AY489691 AY489723 AY489618 AY489652 DQ522429 DQ522494 Cordyceps ravenelii OSC 110995 Phyllophaga sp. DQ522550 DQ518764 DQ522334 DQ522379 DQ522430 DQ522495 Cordyceps scarabaeicola ARSEF 5689 Scarabaeidae pupa AF339574 AF339524 DQ522335 DQ522380 DQ522431 DQ522496 Cordyceps sphecocephala OSC 110998 wasp DQ522551 DQ518765 DQ522336 DQ522381 DQ522432 — Cordyceps stylophora OSC 111000 Elateridae grub DQ522552 DQ518766 DQ522337 DQ522382 DQ522433 DQ522497 Cordyceps taii ARSEF 5714 Lepidoptera AF543763 AF543787 AF543775 DQ522383 DQ522434 DQ522498 Cordyceps tuberculata OSC 111002 Lepidoptera DQ522553 DQ518767 DQ522338 DQ522384 DQ522435 DQ522499 Cordyceps unilateralis OSC 128574 ant DQ522554 DQ518768 DQ522339 DQ522385 DQ522436 — Cordyceps variabilis ARSEF 5365 Diptera larva DQ522555 DQ518769 DQ522340 DQ522386 DQ522437 DQ522500 Cosmospora coccinea CBS 114050 Inonotus nodulosus AY489702 AY489734 AY489629 AY489667 DQ522438 DQ522501 Engyodontium aranearum CBS 309.85 spider AF339576 AF339526 DQ522341 DQ522387 DQ522439 DQ522502 Epichloë typhina ATCC 56429 Festuca rubra U32405 U17396 AF543777 AY489653 DQ522440 DQ522503 Glomerella cingulata CBS 114054 Fragaria sp. AF543762 AF543786 AF543773 AY489659 DQ522441 DQ522504 Haptocillium balanoides CBS 250.82 Nematoda AF339588 AF339539 DQ522342 DQ522388 DQ522442 DQ522505 Haptocillium sinense CBS 567.95 Nematoda AF339594 AF339545 DQ522343 DQ522389 DQ522443 DQ522506 Hydropisphaera erubescens ATCC 36093 Cordyline banksii AY545722 AY545726 DQ522344 DQ522390 AY545731 DQ522535 Hydropisphaera peziza CBS 102038 on bark AY489698 AY489730 AY489625 AY489661 DQ522444 DQ522507 Hymenostilbe aurantiaca OSC 128578 ant DQ522556 DQ518770 DQ522345 DQ522391 DQ522445 DQ522508 Hyphomyces polyporinus ATCC 76479 Trametes versicolor AF543771 AF543793 AF543784 AY489663 — — Hypocrea lutea ATCC 208838 on conifer wood AF543768 AF543791 AF543781 AY489662 DQ522446 DQ522509 Hypocrella schizostachyi BCC 14123 scale insect DQ522557 DQ518771 DQ522346 DQ522392 DQ522447 DQ522510 Hypocrella sp. GJS 89–104 scale insect U32409 U47832 DQ522347 DQ522393 DQ522448 DQ522511 Isaria farinosa OSC 111005 Lepidoptera pupa DQ522558 DQ518772 DQ522348 DQ522394 — DQ522512 Isaria tenuipes OSC 111007 Lepidoptera pupa DQ522559 DQ518773 DQ522349 DQ522395 DQ522449 DQ522513 Lecanicillium antillanum CBS 350.85 agaric AF339585 AF339536 DQ522350 DQ522396 DQ522450 DQ522514 Mariannaea pruinosa ARSEF 5413 Iragoides fasciata AY184979 AY184968 DQ522351 DQ522397 DQ522451 DQ522515 Metarhizium album ARSEF 2082 Cofana spectra DQ522560 DQ518775 DQ522352 DQ522398 DQ522452 DQ522516 Metarhizium anisopliae ARSEF 3145 Oryctes rhinoceros AF339579 AF339530 AF543774 DQ522399 DQ522453 DQ522536 Metarhizium flavoviride ARSEF 2037 Nilaparvata lugens AF339580 AF339531 DQ522353 DQ522400 DQ522454 DQ522517 Myriogenospora atramentosa AEG 96–32 Andropogon virginicus AY489701 AY489733 AY489628 AY489665 DQ522455 DQ522518 Nectria cinnabarina CBS 114055 Betula sp. U32412 U00748 AF543785 AY489666 DQ522456 DQ522519 Ophionectria trichospora CBS 109876 on liana AF543766 AF543790 AF543779 AY489669 DQ522457 DQ522520 Pochonia gonioides CBS 891.72 Nematoda AF339599 AF339550 DQ522354 DQ522401 DQ522458 DQ522521 Pseudonectria rousseliana CBS 114049 Buxus sempervirens AF543767 U17416 AF543780 AY489670 DQ522459 DQ522522 Rotiferophthora angustispora CBS 101437 Rotifera AF339584 AF339535 AF543776 DQ522402 DQ522460 DQ522523 Roumeguieriella rufula CBS 346.85 Globodera rostochiensis DQ522561 DQ518776 DQ522355 DQ522403 DQ522461 DQ522524 Simplicillium lamellicola CBS 116.25 Agaricus bisporus AF339601 AF339552 DQ522356 DQ522404 DQ522462 DQ522525 Simplicillium lanosoniveum CBS 101267 Hemileia vastatrix AF339603 AF339554 DQ522357 DQ522405 DQ522463 DQ522526 Simplicillium lanosoniveum CBS 704.86 Hemileia vastatrix AF339602 AF339553 DQ522358 DQ522406 DQ522464 DQ522527 Sphaerostilbella berkeleyana CBS 102308 on polypore AF543770 U00756 AF543783 AY489671 DQ522465 DQ522528 Torrubiella confragosa CBS 101247 Coccus viridis AF339604 AF339555 DQ522359 DQ522407 DQ522466 DQ522529 Torrubiella ratticaudata ARSEF 1915 Euophrys sp. DQ522562 DQ518777 DQ522360 DQ522408 DQ522467 DQ522530 Verticillium dahliae ATCC 16535 Crataegus crus-galli AY489705 AY489737 AY489632 AY489673 DQ522468 DQ522531 Verticillium epiphytum CBS 384.81 Hemileia vastatrix AF339596 AF339547 DQ522361 DQ522409 DQ522469 DQ522532 Verticillium incurvum CBS 460.88 Ganoderma lipsiense AF339600 AF339551 DQ522362 DQ522410 DQ522470 DQ522533 Viridispora diparietispora CBS 102797 Crataegus crus-galli AY489703 AY489735 AY489630 AY489668 DQ522471 DQ522534

*AEG, A. E. Glenn personal collection; ARSEF, USDA-ARS Collection of Entomopathogenic Fungal cultures, Ithaca, NY, USA; ATCC, American Type Culture Collections, Manassas, VA, USA; BCC, BIOTEC Culture Collection, Pathum Thani, Thailand; CBS, Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands; GAM, Julian H. Miller Mycological Herbarium Athens, GA, USA, GJS, G. J. Samuels personal collection; OSC, Oregon State University Herbarium, Corvallis, OR, USA.

Table 2 Primers used in this study

Gene Primer 5′-sequence-3′ Source

SSU rRNA NS1* GTAGTCATATGCTTGTCTC White et al. (1990) SSU rRNA SR7†‡ CTTCCGTCAATTCCTTTAAG White et al. (1990) SSU rRNA NS3*‡ GTTCAACTACGAGCTTTTTAA White et al. (1990) SSU rRNA NS4† GCAAGTCTGGTGCCAGCAGCC White et al. (1990) LSU rRNA LR0R* GTACCCGCTGAACTTAAGC Vilgalys & Sun (1994) LSU rRNA LR5† ATCCTGAGGGAAACTTC Vilgalys & Sun (1994) tef1 983F* GCYCCYGGHCAYCGTGAYTTYAT From Stephen A. Rehner tef1 2218R† ATGACACCRACRGCRACRGTYTG From Stephen A. Rehner rpb1 CRPB1* CCWGGYTTYATCAAGAARGT Castlebury et al. (2004) rpb1 CRPB1A* CAYCCWGGYTTYATCAAGAA Castlebury et al. (2004) rpb1 RPB1Cr† CCNGCDATNTCRTTRTCCATRTA Castlebury et al. (2004) rpb2 fRPB2–5F* GAYGAYMGWGATCAYTTYGG Liu et al. (1999) rpb2 fRPB2–7cR† CCCATRGCTTGTYYRCCCAT Liu et al. (1999) β-tub T12* TAACAACTGCTGGGCCAAGGGTCAC O’Donnell & Gigelnik (1997) β-tub T22† TCTGGATGTTGTTGGGAATCC O’Donnell & Gigelnik (1997)

*Forward primers, †reverse primers, ‡primers only used for sequencing.

parsimony analyses of individual genes for well-supported Individual nodes were considered well supported by the conflicting topological resolutions (Lutzoni et al. 2004). A data and analyses when supported by both WP bootstrap total of 14 data partitions, including one for both of the values (WP-BS) greater than or equal to 70% and B- rRNA loci and one for each codon position for each of the MCMCMC posterior probabilities (B-PP) greater than or four protein-coding loci, were delimited for weighted equal to 0.95 (Lutzoni et al. 2004). parsimony and Bayesian analyses. Weighted parsimony (WP) analyses were conducted using paup* 4.0 (Swofford Ancestral character state reconstruction 2004) on parsimony informative characters only with the following settings: 100 replicates of random sequence To reconstruct the ancestral character states of host addition, tree-bisection–reconnection (TBR) branch swap- affiliation and estimate the number of interkingdom host ping, and multrees in effect. Step matrixes based on the – jumps, we coded each taxon based on host kingdom to ln of the pairwise base comparisons were used to weight include animal, fungi and plant. Data available on host the six possible nucleotide transformations for each data identity for each isolate are provided in Table 1. We partition (Lutzoni et al. 2004). Bayesian Metropolis coupled used a continuous-time Markov model of trait evolution, Markov chain Monte Carlo (B-MCMCMC) analyses in a maximum-likelihood framework, implemented in were conducted using mrbayes 3.0 (Huelsenbeck et al. multistate (Pagel 1999). The topology and average branch 2002). All searches were conducted using four chains lengths in the consensus tree from Bayesian analyses were for a total of 10 000 000 generations with phylogenetic used in the estimation of instantaneous rates of transitions trees sampled every 100 generations. A total of three inde- and likelihoods among host character states. pendent 10 000 000 generation analyses were conducted to verify likelihood convergence and burn-in parameter. Results In estimating the likelihood of each tree, we used the general time-reversible model with invariant sites and Sequence data and alignments gamma distribution (GTR + I + Γ) and employed this model separately for each of the 14 data partitions. All protein-coding genes amplified as single-copy genes Nodal support in WP analyses was determined by non- except for β-tub. Paralogues β-tub1 and β-tub2 (Landvik et al. parametric bootstrapping (Felsenstein 1985). One hundred 2001) co-amplified in the four species of the Hypocreaceae bootstrap replications with the same search options as and the three species of Simplicillium of Clavicipitaceae clade described previously were performed with five heuristic C. Both paralogues were cloned using a TOPO TA cloning replicates per bootstrap replicate. Nodal support in B- kit (Invitrogen) and β-tub2 was identified based on sequence MCMCMC analyses was estimated as posterior probabili- comparison and included in subsequent analyses. The six- ties calculated from the posterior distribution of trees gene region alignment comprised 5543 bp of sequence data excluding burn-in trees (Huelsenbeck & Rannala 2004). with the amount of data included per locus as follows:

1102 bp SSU rRNA, 954 bp LSU rRNA, 616 bp β-tub, 1020 bp Ancestral character-state reconstruction tef1, 803 bp rpb1, and 1048 bp rpb2. The final alignment after exclusion of ambiguously aligned regions consisted As part of the multistate ancestral character-state of 5213 bp with contributions from the six loci as follows: reconstruction analyses, a likelihood-ratio test was used to 1088 bp SSU rRNA, 767 bp LSU rRNA, 616 bp β-tub, compare a six-parameter model, which allowed unique 1048 bp tef1, 674 bp rpb1, and 1048 bp rpb2. From the final rates of transitions among the three host character states, to alignment, 1835 bp were parsimony informative with a one-parameter model, which enforced an equal rate of distributions among the six loci as follows: 157 bp SSU transitions among host states (Pagel 1999). No significant rRNA, 163 bp LSU rRNA, 232 bp β-tub, 383 bp tef1, 347 bp difference was found between the six- and one-parameter rpb1, and 553 bp rpb2. The alignment used in this study is models and thus the one-parameter model was selected deposited in treebase with the study number SN2792. to characterize the evolution of host affiliation. Log- likelihoods for each possible character-state reconstruction per critical node are provided in Table 3. Support for one Phylogenetic analyses state over another at a particular node was considered Results from the comparisons of 70% bootstrap trees from significant when the difference between their log- the individual gene analyses did not reveal any major likelihoods was greater than two (Pagel 1999). conflicts among the data sets. The sole conflict was re- Animal pathogens and fungal parasites were found in stricted to a terminal clade of the tree and involved the all three clades of Clavicipitaceae, while the grass sym- resolution of three closely related species of the Hypocrella bionts were restricted to a single clade, Clavicipitaceae clade clade. SSU rRNA, rpb1, and rpb2 resolved Aschersonia A. In addition to the grass symbionts, Clavicipitaceae clade placenta and Hypocrella sp. as monophyletic, while tef1 A also included two major subclades of animal pathogens, resolved Aschersonia badia and Hypocrella sp. as mono- Hypocrella (Hywel-Jones & Evans 1993) (a pathogen of scale phyletic. Exclusion of any or all of these three species did insects and white flies), Metarhizium (Driver et al. 2000) (an not alter the topology of the phylogeny in simultaneous asexual genus that is a generalist pathogen of arthropods), analyses of all six genes (data not shown). These results and their allies. Ancestral host reconstruction significantly were interpreted as indicating that no significant incon- supported an animal pathogen ancestor of Clavicipitaceae gruence existed among the six data sets and thus all data clade A (node 6) with a subsequent interkingdom host were combined in the final phylogenetic analyses. jump onto plants (node 12). Ancestral host associations of Weighted parsimony analyses resulted in one tree of the two remaining Clavicipitaceae clades, B (node 7) and C 27316.94 steps. These analyses inferred Clavicipitaceae to (node 5), were resolved as animal and equivalent animal or be paraphyletic, consisting of three monophyletic clades fungal, respectively. In all cases, an ancestral host associa- designated A, B, and C (Fig. 2). The paraphyly of Clavi- tion with plants was rejected as a likely ancestral host cipitaceae was defined by the monophyly of Clavicipitaceae reconstruction of the major deep nodes (nodes 3, 4, 5) of clade C with the Hypocreaceae. All three 10 000 000 genera- Clavicipitaceae with the most likely ancestral host recon- tion B-MCMCMC analyses converged on the same set of struction being that of animals (Fig. 2, Table 3). It was likelihood and burn-in parameters. Of 100 000 resulting estimated that 5–8 interkingdom host jumps have occurred trees, the initial 300 trees (30 000 generations) were identi- within Clavicipitaceae, including 3–5 onto fungi, 1–2 onto fied as the burn-in prior to the convergence of likelihoods animals, and 1 onto plants (Fig. 2, Table 3). and were excluded from postrun analyses. Comparison of the three majority-rule consensus trees generated from the Discussion three postrun analyses revealed identical topologies. As in the WP analyses, Clavicipitaceae comprised three clades Evolution of Clavicipitaceae with the family being paraphyletic based on the monophyly of the Hypocreaceae-Clavicipitaceae clade C. Each Previous phylogenetic studies have convincingly demon- of the three clades of Clavicipitaceae were supported by strated that Clavicipitaceae is a member of Hypocreales both WP-BS (≥ 70%) and B-PP (≥ 95%), as was the mono- (Spatafora & Blackwell 1993; Rehner & Samuels 1995; phyly of the Hypocreaceae-Clavicipitaceae clade C. Exam- Glenn et al. 1996; Sung et al. 2001; Castlebury et al. 2004), ination of bootstrap frequency tables in paup* showed that a large order of filamentous fungi. The monophyly of all other topological resolutions of Clavicipitaceae, includ- Clavicipitaceae, however, has received conflicting support ing both paraphyletic and monophyletic, received less in molecular phylogenetics with studies based on differ- than 15% bootstrap support (data not shown), and were ent sampling strategies resulting in both monophyletic rejected as plausible alternative hypotheses. Figure 2 is and paraphyletic resolutions of the family (Spatafora & a majority-rule consensus tree generated from one of the Blackwell 1993; Rehner & Samuels 1995; Glenn et al. 1996; B-MCMCMC analyses with average branch lengths. Sung et al. 2001; Castlebury et al. 2004). Our analyses, based

Fig. 2 Phylogenetic tree of Hypocreales and Clavicipitaceae. Phylogenetic tree is a consensus of 97 700 trees from Bayesian analyses with averaged branch lengths. Numbers above nodes are parsimony bootstrap values and numbers below the nodes are posterior probabilities. Parsimony analyses resulted in three trees of 16 920 steps. No nodes supported by parsimony (≥ 70%) or posterior probabilities (≥ 95%) differed between parsimony and Bayesian analyses. The two-letter code after the species name corresponds to more definitive host identification as follows: Ar, Arachnida; Co, Coleoptera; El-A, Elaphomyces-Ascomycota; He, Hemiptera; Hy, Hymenoptera; Hy- B, Hymenomycetes-Basidiomycota; La, Laxmanniaceae; Le, Lepidoptera; Mo, Mollusca; Ne, Nematoda; Po, Poaceae; Ro-A, Rotifera- Animal; Ro, Rosaceae; Ur-B, Uredinales-Basidiomycota. Color of branches corresponds to the ancestral character state reconstruction in multistate as follows: black, ambiguous; blue, fungal; green, plant; red, animal. Species without two-letter host designation represent isolates for which no additional host information was available.

Table 3 Log-likelihood values for ancestral character-state recon- traced back to a plant-associated common ancestor (node struction. Node numbers correspond to nodes in Fig. 2 12), these analyses significantly supported an ancestral host affiliation with animals for the common ancestor of Ancestral state clade A (node 6). Therefore, the common ancestor of the grass symbionts likely originated via an interkingdom host Node Animal Fungi Plant jump from animals to plants. Although these findings 1 −45.49 −46.89 −42.44 were consistent with a single origin of the grass symbionts, 2 −42.83 −44.20 −44.01 they did not form a monophyletic group. Verticillium 3 −42.46 −45.78 −45.52 epiphytum, a parasite of Hemileia vastatrix (the fungus that 4 −43.04 −43.31 −44.81 causes coffee rust), is placed among the grass symbionts, 5 −42.40 −46.70 −49.06 suggesting that other ecologies and host associations, 6 −42.40 −49.02 −46.44 especially those of asexual species, may be phylo- 7 −42.98 −43.27 −45.72 8 −46.81 −48.50 −42.40 genetically interspersed among the grass symbionts. 9 −49.08 −42.39 −52.60 Clavicipitaceae clade B is characterized by an ancestral 10 −42.41 −46.20 −49.32 animal pathogen ecology, with the dominant theme being 11 −42.44 −48.70 −45.38 pathogens of subterranean and wood-inhabiting hosts. 12 −45.57 −46.88 −42.44 The majority of the taxa sampled in clade B attack larval 13 −42.51 −44.58 −48.67 and pupal stages of arthropods buried in soil or imbedded 14 −45.80 −42.49 −45.00 in decaying wood. Exceptions to this trend do exist with 15 −48.68 −46.16 −42.41 some taxa (e.g. C. sphecocephela, C. unilateralis, etc.) attacking adult stages of arthropods that are typically found in relatively exposed habitats such as leaf litter and under- on 54 clavicipitaceous taxa and over 5000 bp of nucleotide sides of leaves. In addition to arthropod pathogens, other sequence data from six nuclear-encoded genes, do not hosts represented in clade B include nematodes parasitized support the monophyly of Clavicipitaceae. The species by asexual forms closely related to Cordyceps (e.g. Hapto- currently classified in Clavicipitaceae formed three distinct cillium) and fungi of the genus Elaphomyces parasitized clades (labelled A, B and C) with the paraphyly of the by Cordyceps species. As such, clade B includes one of the family defined by the monophyly of Clavicipitaceae clade other major interkingdom host jumps, from animals to C and Hypocreaceae (Fig. 2). Common to all three clades fungi (Nikoh & Fukatsu 2000), and intrakingdom host of Clavicipitaceae are species of the genus Cordyceps jumps among major phyla of the Animal kingdom (Fig. 2). (Fig. 2). As with Clavicipitaceae, these data reject the Clavicipitaceae clade C includes pathogens of arthro- monophyly of Cordyceps with the phylogenetic diversity pods, parasites of epigeous macrofungi, and parasites of of the genus paralleling that of the entire family. In plant pathogenic rust fungi (Fig. 2). Reconstruction of the rejecting the monophyly of Cordyceps, these data also do not ancestral ecology of the common ancestor to clade C is support the use of ecology of host affiliation, that is, complicated by both the nature of the infraclade phylo- pathogen of arthropods, as a phylogenetic character dia- genetic relationships of arthropod pathogens and fungal gnostic of a monophyletic taxon in the Hypocreales. parasites and the sister group relationship of Clavicipitaceae clade C and Hypocreaceae. Within Clavicipitaceae clade C multiple interkingdom host jumps have occurred between Evolution of host affiliation animals and fungi, but the polarity of these events remains Maximum-likelihood ancestral character-state recon- ambiguous. Thus while a plant associated ancestral ecology struction of Hypocreales rejected a plant host association can be rejected as a less likely character-state reconstruc- as the ancestral ecology of the three major clades tion for the common ancestor of Clavicipitaceae clade C of Clavicipitaceae (Fig. 2, Table 3). The grass symbionts (Fig. 2, Table 3), these data cannot statistically distinguish are resolved as a paraphyletic group within Clavicipita- between an animal and fungal host affiliation. ceae clade A (Fig. 2). The two additional subclades of Clavicipitaceae clade A include two major groups of Evolution of nutritional modes arthropod pathogens, Hypocrella and Metarhizium. Clavi- cipitaceae clades B and C also possess numerous taxa that These results reveal that the evolution of Hypocreales is are pathogens of animals including pathogens of arthro- characterized by a shift in nutritional mode from plant- pods and nematodes. The parasites of fungi are distri- based (Bionectriaceae & Nectriaceae) to animal and fungal- buted in a manner similar to the animal pathogens with based nutrition (Hypocreaceae & Clavicipitaceae clades A, members found in all three Clavicipitaceae clades plus B, & C) (node 2 in Fig. 2). Prior to the common ancestor Hypocreaceae. Although the grass symbionts can be of Hypocreaceae/Clavicipitaceae, the dominant ecologies

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd E VO L UT IONAR Y OR I GI N OF GR A SS-A SSOC I AT E D F UNGI 1709 include pathogens of plants and decomposers of plant invade plant cells, to illicit host-defence responses typical debris. Both lifestyles are reliant on plants or plant material of plant pathogenic fungi (Tudzynski & Tenberge 2003), as an immediate food source. The common ancestor of and to produce phytotoxic secondary metabolites (Clay & Hypocreaceae and Clavicipitaceae corresponds to a depar- Schardl 2002; Schardl et al. 2004), are all consistent with an ture from plant-based nutrition to one that specializes animal pathogen ancestry. on animals and fungi. Most known Clavicipitaceae species are animal pathogens with the diversity of animal hosts Conclusions including Nematoda, Rotifera, Mollusca and 10 orders of Arthropoda, especially insects (Kobayasi 1941, 1982; Mains Phylogenetic investigations of fungal–arthropod associations 1958, 1959; Gams & Zare 2003). The known distribution have documented numerous and diverse evolutionary of fungal hosts is also phylogenetically diverse and in- patterns of symbioses including symbiont replacement cludes Urediniomycetes, Hymenomycetes (mushrooms and (Suh et al. 2001), complex patterns of host tracking (Mueller other fleshy fungi), and Elaphomyces, but significantly et al. 1998; Currie et al. 2003), host jumping between fewer species of Clavicipitaceae are known as parasites of distantly related hosts occupying a common habitat other fungi as compared to pathogens of animals (Mains (Nikoh & Fukatsu 2000), and convergent evolution acting 1957; Gams & van Zaayen 1982). on multiple parts of the fungal life cycle (Spatafora & As a derived ecology of Clavicipitaceae, the grass sym- Blackwell 1994; Cassar & Blackwell 1996). Our study bionts represent a reversal from animal-based to plant- illuminates a biological system that is characterized by a based nutrition, relying on the host plant for the majority dynamic process of three-kingdom host jumping with little of their carbon needs. Most clavicipitaceous grass sym- evidence of host tracking at higher taxonomic levels. bionts are known from cool season C3 grasses (Diehl 1950; Animal pathogens of Lepidoptera, Coleoptera, Hemiptera Bischoff & White 2003), but the tissue and amount of the and Nematoda and parasites of fungi are interspersed in host plant colonized by the fungi vary according to species several parts of the tree (Fig. 2). Although more detailed forming the symbiosis. Some are restricted to developing studies of the grass endophyte genus Epichloë have ovaries (e.g. Claviceps spp.; Shaw & Mantle 1980; Tudzynski revealed some host tracking or cospeciation, this obser- & Tenberge 2003) while others colonize virtually all aerial vation was restricted to closely related species complexes portions of the plant (e.g. Epichloë spp.; Clay & Schardl (Clay & Schardl 2002). While such patterns of host tracking 2002; Schardl et al. 2004). In addition, the grass symbionts may exist at lower taxonomic levels in other taxa of Clavi- are known producers of biologically active secondary cipitaceae, the evolutionary history of the family as a metabolites with some of the best characterized being whole is characterized by a propensity for host jumping, ergot alkaloids (Panccione 1996; Tudzynski et al. 2001) and often between distantly related organisms. lolines (Blankenship et al. 2001; Spiering et al. 2005). While These results provide a new phylogenetic paradigm for these metabolites appear to have no deleterious effect on studying the grass symbionts of Clavicipitaceae and their the host plant, ergot alkaloids have been implicated in roles in plant ecology. As an order, the evolution of Hypo- diseases of animals (e.g. staggers of livestock, ergotism creales is characterized by a shift in nutritional mode of humans) that feed on infected plants by acting on the from plant-based nutrition (Bionectriaceae & Nectriaceae) central nervous and vascular systems (Petroski et al. 1992; to animal and fungal-based nutrition (Hypocreaceae & Miles et al. 1998; Tudzynski et al. 2001). Similarly, lolines Clavicipitaceae s.l.) (Fig. 2). This shift in nutritional mode and peramines produced by species of Epichloë and related correlates with short internal nodes that are supported fungi function in the symbiosis between grass hosts and by the data and that are consistent with relatively rapid their symbionts by reducing insect herbivory of the host cladogenic events (Fishbine et al. 2001). The evolution of plant (Wilkinson et al. 2000; Tanaka et al. 2005). clavicipitaceous fungi is further characterized by diversifi- In the context of the phylogeny presented in Fig. 2, the cation leading to the three main groups of Clavicipitaceae common ancestor of the grass symbionts was derived from where pathogenicity of animals is a major theme. Numer- a pathogen of arthropods with the most closely related ous interkingdom host jumps have occurred and based on taxa, Hypocrella and Metarhizium, producing biologically these results, we propose that the common ancestor of the active secondary metabolites that function in insect patho- grass symbionts of Clavicipitaceae originated through a genicity (e.g. destruxins; Kershaw et al. 1999; Pedras et al. series of interkingdom host jumps from an ancestor that 2002; Watts et al. 2003). Therefore, we propose that the bio- was a pathogen of animals, likely arthropods. chemical potential to produce compounds that are biologically active against animals, especially insects, predates the origin of the grass symbionts, and was likely inherited Acknowledgements from an ancestor that was a pathogen of animals. Further- We thank Drs Richard Humber (ARSEF), Anthony Glenn (USDA), more, the inability of most species of grass symbionts to and Walter Gams (CBS) for providing specimens and cultures for

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd 1710 J . W. S P A TAFOR A ET AL . this research project and Dr Mark Pagel for providing a copy of the Hudler GW (1998) Magical Mushrooms, Mischievous Molds. Prince- program multistate. This research was supported by grants from ton University Press, Princeton, New Jersey. the National Science Foundation (DEB-0129212 and DEB-0529752 to Huelsenbeck JP, Rannala B (2004) Frequentist properties of Bayesian J.W.S.), the Korea Science and Engineering Foundation (to J-M Sung), posterior probabilities of phylogenetic trees under simple and the Fogarty International Center (NIH) under U01 TW006674 for complex substitution models. Systematic Biology, 53, 904–913. International Cooperative Biodiversity Groups (to J.F.W.), and con- Huelsenbeck JP, Larget B, Miller RE, Ronquist F (2002) Potential tinuing support from Dr Morakot Tantichroen and BIOTEC (to N.H.J.). applications and pitfalls of Bayesian inference of phylogeny. Systematic Biology, 51, 673–688. References Hywel-Jones NL, Evans HC (1993) Taxonomy and ecology of Hypocrella discoidea and its anamorph, Ashersonia samoensis. Bischoff JF, White JF Jr (2003) The plant-infecting clavicipitaleans. Mycological Research, 97, 871–876. In: Clavicipitalean Fungi: Evolutionary Biology, Chemistry, Biocontrol, Isaka M, Kittakoop P, Thebtaranonth Y (2003) Secondary metabolites and Cultural Impacts (eds White JF Jr, Bacon CW, Hywel-Jones of clavicipitalean fungi. In: Clavicipitalean Fungi: Evolutionary NL, Spatafora JW), pp. 125–150. Marcel Decker, Inc., New York. Biology, Chemistry, Biocontrol, and Cultural Impacts (eds White JF Jr, Blankenship JD, Spiering MJ, Wilkinson HH, Fannin FF, Bush LP, Bacon CW, Hywel-Jones NL, Spatafora JW), pp. 355–397. Schardl CL (2001) Production of loline alkaloids by the grass Marcel Dekker, Inc., New York. endophyte, Neotyphodium uncinatum, in defined media. Phyto- Kershaw MJ, Moorhouse ER, Bateman R, Reynolds SE, Charnley chemistry, 58, 395–401. AK (1999) The role of destruxins in the pathogenicity of Bush LP, Wilkinson HH, Schardl CL (1997) Bioprotective alkaloids Metarhizium anisopliae for three species of insect. Journal of Inver- of grass-fungal endophyte symbioses. Plant Physiology, 114, 1–7. tebrate Pathology, 74, 213–223. Cassar SC, Blackwell M (1996) Non-monophyly of ambrosia fungi Kobayasi Y (1941) The genus Cordyceps and its allies. Science in Ambrosiella. Mycologia, 88, 596–601. Reports of the Tokyo Bunrika Daigaku, 84, 53–260. Castlebury LA, Rossman AY, Sung G-H, Hyten AS, Spatafora JW (2004) Kobayasi Y (1982) Keys to the taxa of the genera Cordyceps and Torru- Multigene phylogeny reveals new lineage for Stachybotrys char- biella. Transactions of the Mycological Society of Japan, 23, 329–364. tarum, the indoor air fungus. Mycological Research, 108, 864–872. Landvik S, Eriksson OE, Berbee ML (2001) Neolecta — a fungal Clay K (1988) Fungal endophytes of grasses: a defensive mutual- dinosaur? Evidence from beta-tubulin amino acid sequences. ism between plants and fungi. Ecology, 69, 10–16. Mycologia, 93, 1151–1163. Clay K (1990) Fungal endophytes of grasses. Annual Review of Eco- Landy S (2004) Migraine throughout the life cycle: treatment logy and Systematics, 21, 275–297. through the ages. Neurology, 62, S2–S8. Clay K, Schardl CL (2002) Evolutionary origins and ecological Liu Y, Whelen S, Hall B (1999) Phylogenetic relationships among consequences of endophyte symbiosis with grasses. The Ameri- ascomycetes: evidence from an RNA polymerse II subunit. can Naturalist, 160, S99–S127. Molecular Biology and Evolution, 16, 1799–1808. Currie CR, Wong B, Stuart AE, Schultz TR, Rehner SA, Mueller UG, Lutzoni F, Kauff F, Cox CJ et al. (2004) Assembling the fungal tree Sung G-H, Spatafora JW, Straus NA (2003) Ancient tripartite co- of life: progress, classification, and evolution of subcellular evolution in the attine ant-microbe symbiosis. Science, 299, 386–388. traits. American Journal of Botany, 91, 1446–1480. Diehl WW (1950) Balansia and the Balansiae in America. Agricultural Mains EB (1957) Species of Cordyceps parasitic on Elaphomyces. Monograph No. 4. U. S. D. A., Washington, DC. Bulletin of the Torrey Botanical Club, 84, 243–251. Driver F, Milner RJ, Trueman JWH (2000) A taxonomic revision of Mains EB (1958) North American entomogenous species of Metarhizium based on a phylogenetic analysis of rDNA Cordyceps. Mycologia, 50, 169–222. sequence data. Mycological Research, 104, 134–150. Mains EB (1959) Species of Hypocrella. Mycopathologia et Mycologia Dunn CJ, Wagstaff AJ, Perry CM, Plosker GL, Goa KL (2001) Applicata, 11, 311–326. Cyclosporin — an updated review of the pharmacokinetic proper- Matossian M (1989) Poisons of the Past. Yale University Press, New ties, clinical efficacy and tolerability of a microemulsion-based for- Haven, Connecticut. mulation (Neoral) in organ transplantation. Drugs, 61, 1957–2016. Miles CO, Di-Menna ME, Jacobs SWL et al. (1998) Endophytic Felsenstein J (1985) Confidence limits on phylogenies: an fungi in indigenous Australasian grasses associated with approach using the bootstrap. Evolution, 39, 783–791. toxicity to livestock. Applied and Environmental Microbiology, 64, Fishbine M, Hibsch-Jetter C, Soltis DE, Hufford L (2001) Phylo- 601–606. geny of Saxifragales (Angiosperms, Eudicots): analysis of a rapid, Mueller UG, Rehner SA, Schultz TR (1998) The evolution of agri- ancient radiation. Systematic Biology, 50, 817–847. culture in ants. Science, 281, 2034–2038. Gams W, van Zaayen A (1982) Contribution to the taxonomy and Naula N, Hilti N, Schweingruber AM, Schweingruber ME (2003) pathogenicity of fungicolous Verticillium species. I. Taxonomy. Cordycepin in Schizosaccharomyces pombe: effects on the wild Netherlands Journal of Plant Pathology, 88, 57–78. type and phenotypes of mutants resistant to the drug. Current Gams W, Zare R (2003) A taxonomic review of the clavicipitaceous Genetics, 43, 400–406. anamorphs parasitizing nematodes and other microinvertebrates. Nikoh N, Fukatsu T (2000) Interkingdom host jumping under- In: Clavicipitalean Fungi: Evolutionary Biology, Chemistry, Biocontrol, groud: phylogenetic analysis of entomopathogenic fungi of the and Cultural Impacts (eds White JF Jr, Bacon CW, Hywel-Jones genus Cordyceps. Molecular Biology and Evolution, 17, 629–638. NL, Spatafora JW), pp. 17–73. Marcel Dekker, Inc., New York. O’Donnell K, Gigelnik E (1997) Two divergent intragenomic Glenn AE, Bacon CW, Price R, Hanlin RT (1996) Molecular phylo- rDNA ITS2 types within a monophyletic lineage of the fungus geny of Acremonium and its taxonomic implications. Mycologia, Fusarium are nonorthologous. Molecular Phylogenetics and Evolu- 88, 369–383. tion, 7, 103–116. Hofmann A (1980) LSD: My Problem Child, J Ott Transl. McGraw- Pagel M (1999) Inferring the historical patterns of biological evo- Hill, New York. lution. Nature, 401, 877–884.

Panccione DG (1996) Multiple families of peptide synthetase Thompson J, Plewniak F, Poch O (1999) A comprehensive com- genes from ergopeptine-producing fungi. Mycological Research, parison of multiple sequence alignment programs. Nucleic Acids 100, 429–436. Research, 27, 2682–2690. Pedras MSC, Zaharia LI, Ward DE (2002) The destruxins: syn- Tissot SA (1765) An account of the disease called ergot, in French, thesis, biosynthesis, biotransformation, and biological activity. from its supposed cause, viz, vitiated rye. Philosophical Trans- Phytochemistry, 59, 579–596. actions, 1, 106–126. Petroski RJ, Powell RG, Clay K (1992) Alkaloids of Stipa robusta Tudzynski P, Tenberge KB (2003) Molecular aspects of host– (sleepygrass) infected with an Acremonium endophyte. Natural pathogen interactions and ergot alkaloid biosynthesis in Toxins, 1, 84–88. Claviceps. In: Clavicipitalean Fungi: Evolutionary Biology, Chemistry, Rehner SA, Samuels GJ (1995) Molecular systematics of the Hypo- Biocontrol, and Cultural Impacts (eds White JF Jr, Bacon CW, creales: a teleomorph gene phylogeny and the status of their Hywel-Jones NL, Spatafora JW), pp. 445–473. Marcel Dekker, anamorphs. Canadian Journal of Botany, 73, S816–S823. Inc., New York. Riddle JM (1997) Eve’s Herbs: a History of Contraception and Abortion Tudzynski P, Correia T, Keller U (2001) Biotechnology and in the West. Harvard University Press, Cambridge, Massachusetts. genetics of ergot alkaloids. Applied Microbiology and Biotechnology, Rossman AY, Samuels GJ, Rogers JS, Lowen R (1999) Genera 57, 593–605. of Bionectriaceae, Nectriaceae and Hypocreaceae (Hypocreales, Vilgalys R, Sun BL (1994) Ancient and recent patterns of geo- Ascomycetes). Studies in Mycology, 42, 1–238. graphic speciation in the oyster mushroom Pleurotus revealed Saikkonen K, Faeth SH, Helander M, Sullivan TJ (1998) Fungal by phylogenetic analysis of ribosomal DNA sequences. Proceed- endophytes: a continuum of interactions with host plants. ings of the National Academy of Sciences, USA, 91, 4599–4603. Annual Review of Ecology and Systematics, 29, 319–343. Watts P, Kittakoop P, Veeranondha S et al. (2003) Cytotoxicity Schardl CL (1996) Epichloë species: fungal symbionts of grasses. against insect cells of entomopathogenic fungi of the genera Annual Review of Phytopathology, 34, 109–130. Hypocrella (anamorph Aschersonia): possible agents for biolo- Schardl CL, Leuchtmann A, Spiering MJ (2004) Symbioses of gical control. Mycological Research, 107, 581–586. grasses with seedborne fungal endophytes. Annual Review of White JF Jr, Bacon CW, Hywel-Jones NL, Spatafora JW (2003) His- Plant Biology, 55, 315–340. torical perspectives: human interactions with Clavicipitalean Shah PA, Pell JK (2003) Entomopathogenic fungi as biological fungi. In: Clavicipitalean Fungi: Evolutionary Biology, Chemistry, control agents. Applied Microbiology and Biotechnology, 61, 413– Biocontrol, and Cultural Impacts (eds White JF Jr, Bacon CW, 423. Hywel-Jones NL, Spatafora JW), pp. 1–15. Marcel Decker, New Shaw BI, Mantle PG (1980) Host infection by Claviceps purpurea. York. Transactions of the British Mycological Society, 75, 77–90. White TJ, Bruns TD, Lee S, Taylor J (1990) Amplification and direct Siegel MR, Bush LP (1997) Toxin production in grass/endophyte sequencing of fungal ribosomal RNA genes for phylogenetics. associations. In: The Mycota V. Plant Relationships, Part B (eds Carroll In: PCR Protocols, a Guide to Methods and Applications (eds Innis GC, Tudzynski P), pp. 185–208. Springer-Verlag, Berlin, Germany. MA, Gelfand DH, Sninsky JJ, White TJ), pp. 315–322. Academic Spatafora JW, Blackwell M (1993) Molecular systematics of unitu- Press, San Diego. nicate perithecial ascomycetes: the Clavicipitales-Hypocreales White JF Jr, Morrow AC, Morgan-Jones G, Chambless DA (1991) connection. Mycologia, 85, 912–922. Endophyte–host associations in forage grasses. XIV. Primary Spatafora JW, Blackwell M (1994) The polyphyletic origins of stromata formation and seed transmission in Epichloë typhina. ophiostomatoid fungi. Mycological Research, 98, 1–9. Mycologia, 83, 72–81. Spiering MJ, Moon CD, Wilkinson HH, Schardl CL (2005) Gene Wilkinson HH, Siegel MR, Blankenship JD, Mallory AC, Bush LP, clusters for insecticidal loline alkaloids in the grass-endophytic Schardl CL (2000) Contribution of fungal loline alkaloids to pro- fungus Neotyphodium uncinatum. Genetics, 169, 1403–1414. tection from aphids in a grass-endophyte mutualism. Molecular Suh S-O, Noda H, Blackwell M (2001) Insect symbiosis: derivation Plant–Microbe Interactions, 13, 1027–1033. of yeast-like endosymbionts within an entomopathogenic Zhu JS, Halpen GM, Jones K (1998) The scientific rediscovery of filamentous lineage. Molecular Biology and Evolution, 18, 995– an ancient herbal medicine: Cordyceps sinensis: part I. Journal of 1000. Alternative and Complementary Medicine, 4, 289–303. Sung G-H, Spatafora JW, Zare R, Hodge KT, Gams W (2001) A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs Joseph Spatafora’s main research interests are in evolutionary and teleomorphs of the Clavicipitaceae. Nova Hedwigia, 72, 311– biology of fungi with emphases on molecular phylogenetics of 328. Fungi and fungal-insect associations. Gi-Ho Sung’s research Swofford DL (2004) PAUP*: Phylogenetic Analysis Using Parsimony interests are in molecular phylogenetics of Ascomycota and (*and Other Methods), Version 4.0b10. Sinauer Associates, evolution of fungal parasitism of arthropods. Nigel Hywel-Jones’ Sunderland, Massachusetts. research is focused on biodiversity of arthropod pathogenic fungi Tanaka A, Tapper BA, Popay A, Parker EJ, Scott B (2005) A in the Asian tropics. Jae-Mo Sung’s research interests include symbiosis expressed non-ribosomal peptide synthetase from biodiversity of arthropod pathogenic fungi in temperate Asia. a mutualistic fungal endophyte of perennial ryegrass confers James White, Jr.’s research focus is on evolution and ecology of protection to the symbiotum from insect herbivory. Molecular grass endophytes. Microbiology, 57, 1036–1050.