“The Cellular Context of Rabies Virus Replication – Cell Culture Adaptation, Intra-Neuronal Virus Transport and Development of Host Gene Targeting Vectors”

I n a u g u r a l d i s s e r t a t i o n

zur

Erlangung des akademischen Grades eines

Doktors der Naturwissenschaften (Dr. rer. nat.)

der

Mathematisch-Naturwissenschaftlichen Fakultät

der

Ernst-Moritz-Arndt-Universität Greifswald

vorgelegt von

Sabine Nemitz

geboren am 14.02.1989

in Rathenow

Greifswald, den 20.07.2018 1

Dekan: Prof. Dr. Werner Weitschies

1. Gutachter : PD Dr. Stefan Finke

2. Gutachter: Prof. Dr. Karl-Klaus Conzelmann

Tag der Promotion: 05.12.2018

I. Table of Content

I. Table of Content 4 II. List of Abbreviations 7 III. Publications 10 1. SUMMARY 11 2. INTRODUCTION 15 2.1. Classification 16 2.2. Transmission 18 2.3. RABV virion structure and genome organization 19 2.4. RABV proteins 21 2.5. Life cycle 26 2.6. Neuronal transport of RABV particles 28 2.7. Fixed and non-fixed RABV 30 2.8. RABV as vector and research tool 31 2.8.1. Gene regulation via post-transcriptional silencing: RNAi 32 2.8.2. Cytoplasmically replicating RNA viruses as vectors for shRNA synthesis 34 3. AIMS OF THE STUDY 35 4. MATERIAL 36 4.1. Technical equipment 36 4.2. Chemicals 36 4.3. Antibiotics 36 4.4. Standard buffers 37 4.5. Marker 38 4.6. Kits 38 4.7. Cell lines 38 4.8. Cell culture media 39 4.9. Bacteria 41 4.10. Viruses 41 4.11. Plasmids 42 4.12. Enzymes 44 4.13. Oligonucleotides 45 4.14. Serologic reagents 48 4.14.1. Primary antibodies 49 4.14.2. Secondary antibodies 49 4.14.3. Fluorescent dyes 49 4.15. Software 50 4.16. Sequencing technologies 50 5. METHODS 51 5.1. Eukaryotic cell culture 51 5.1.1. Cell cultivation 51 5.1.2. Transfection of mammalian cell lines 52 5.1.3. Complementation assay 52 5.2. Preparation of primary neuronal cells 53 5.2.1. Preparation and cultivation of hippocampal neurons from neonatal rats 53

5.2.2. Preparation and cultivation of dorsal root ganglions from embryonic rats 53 5.3. Working with nucleic acids 54 5.3.1. Nuclease treatment 54 5.3.2. RNA extraction with Trifast (Trizol) / Chloroform 55 5.3.3. Isolation of viral RNA for Deep sequence analysis 56 5.3.4. Determining RNA and DNA concentration 56 5.3.5. Reverse Transcription (RT)-PCR 57 5.3.6. Polymerase chain reaction (PCR) 57 5.3.7. Polymerase chain reaction for comparison of mRNA level 58 5.3.8. Restriction enzyme digestion 59 5.3.9. Ligation 60 5.3.10. Transformation of chemically competent bacteria 60 5.3.11. Preparation of plasmid DNA 60 5.3.12. Preparative and analytic agarose gel electrophoresis 61 5.3.13. Site-directed mutagenesis of full-length RABV c-DNA containing plasmids 61 5.3.14. Routine DNA sequencing (Sanger sequencing) 62 5.4. Working with proteins 63 5.4.1. Preparation of protein samples with protein lysis mix 63 5.4.2. Discontinuous sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) 64 5.4.3. Semi-dry western blot 64 5.4.4. Indirect immunofluorescence 65 5.5. Working with viruses 66 5.5.1. Production of RABV virus stocks 66 5.5.2. Rescue of recombinant RABV (CaPO4 Method) 66 5.5.3. Virus titration by end-point-dilution 67 5.5.4. Replication kinetics 68 5.6. Cloning strategies 68 5.6.1. Truncation of full-length cDNA plasmids encoding shRNA against cellular targets 68 5.6.2. Cloning of G protein sequences from recombinant dog rabies virus (rRABV Dog) 69 5.6.3. Generation of recombinant RABV expressing ecto-domains of other Lyssavirus strains 70 5.7. Electron Microscopy 70 6. RESULTS 71 6.1. Axonal transport of RABV in dorsal root ganglions 71 6.1.1. Effect of various Lyssavirus G-sequences on the accumulation of RABV N particles in DRG axons 71 6.1.2. Accumulation of N and G in rRABV DogA and rRABV Fox infected DRG neurons 73 6.2. Molecular basis of RABV cell culture adaptation 77 6.2.1. Virus passages on different cell lines 77 6.2.2. Deep sequence analysis of cell culture passaged rRABV Dog and rRABV Fox 81 6.2.3. Release of new virus particles is impaired in non-fixed rRABV Dog 87 6.2.4. Cell line specific intracellular G accumulation and increased surface expression after virus passages. 90 6.3. RABV vectors for cytoplasmic shRNA expression 98 6.3.1. Generation of RABV expressing miR-shRNAs 98 6.3.2. Growth kinetics of rRABV expressing miR-shRNA 100 6.3.3. Downregulation of DYNLL1 in RABV-infected NA 42/13 cells 101 6.3.4. Infection of primary rat hippocampus neurons 107

7. DISCUSSION 110 7.1. Axonal transport of RABV 110 7.1.1. Accumulation of RABV N particles in DRG axons 111 7.1.2. Anterograde transport of non-fixed N and G virus particles in DRG axons 111 7.2. Cell culture passages of rRABV Dog and rRABV Fox lead to specific mutations in G and P 112 7.2.1. Increased virus titer after cell culture passage 113 7.2.2. Identification of adaptive mutations in the G protein 114 7.2.3. Accumulation of mutations in the P protein 116 7.2.4. Mutations in non-coding gene borders 117 7.2.5. Accumulation of non-fixed rRABV Dog-B at Endoplasmic reticulum 118 7.2.6. Cell culture adaptation and virulence 120 7.3. Generation of RABV expressing shRNA against cellular targets 121 7.3.1. Downregulation of DYNLL1 mRNA and protein level by RABV expressing miR-shRNAs 123 8. REFERENCES 127 APPENDIX 141 Supplementary data 141 Eigenständigkeitserklärung 153 Posters and Presentations on Conferences 154 Acknowledgement 155

II. List of Abbreviations aa amino acid AAV Adeno-associated virus AGO Agonaute protein ANP32B Acidic (Leucine-Rich) Nuclear Phosphoprotein 32 ATV Alsever’s Trypsin-Versene BHK baby hamster kidney CCLV Collection of Cell Lines in Veterinary Medicine cf. compare, latin: confer CLSM confocal laserscanning microscopy CNS central nervous system CR coding region C-terminus carboxy-terminus CVS challenge virus standard ddH2O deminaralized, destilled water DEPC Diethylpyrocarbonate DGCR8 DiGeorge syndrome critical region DMEM Dulbecco’s Modified Eagle Medium DMSO Dimethylsulfoxid DNA deoxyribonucleic acid dNTPs deoxyribonucleosid triphosphate DogA Dog Azerbaijan dpi days post infection DRG dorsal root ganglia neuron DYNLL1 dynein light chain 1 E. coli Escherichia coli e.g. for example, latin: exempli gratia eIF3H cellular eukaryotic translation initiation factor 3 subunit H ER endoplasmatic reticulum et al. and others; latin: et alii EXP5 Exportin 5 FCS fetal calf serum ffu focus forming units G glycoprotein G418 Geneticin Genta Gentamycin GFP green fluorescent protein HBSS Hanks balanced salt solution HEKT human embryonic kidney cells HRP horse raddish peroxidase i.e. that is; latin: id est ICTV imternational commitee for the taxonomy of viruses

IFN Interferon IgG immunoglobulin G iIF indirect immunofluorescence IRF interferon regulatory factor L large protein LB lysogeny broth LBV Lagos bat lyssavirus M matrixprotein MDCK Madin Darby canine kidney MEM Minimal Essential Medium miR micro RNA miR-shRNA micro RNA-adapted shRNA MNA murine neuroblastoma cells MOI multiplicity of infection MOKV Mokola bat lyssavirus mRNA messenger RNA N nucleoprotein NA 42/13 murine neuroblastoma cells NCBI National Center for Biotechnology Information NCR non- coding region NCS new born calf serum Nf-kappa-B Nuclear Factor Kappa B Subunit 1 nt nucleotide N-terminus amino-terminus o/n over night ORF open reading frame P passage P phosphoprotein p75NTR low affintiy nerve growth factor receptor PAGE polyacrylamid gelelectrophoresis PBS phosphate buffered saline PCR polymerase chain reaction PDZ structural domain in signal proteins PEI Polyethylenimine Pen/Strep Penicelline and Streptomycine PEP postexposure prophylaxis PFA paraform aldehyde pH potentia hydrogenii poly I:C polyinosinic:polycytidylic acid pre-miRNA precursor miRNA pri-miRNA primary miRNA q-PCR quantitative PCR RABV Rabies lyssavirus

RelAp43 NF-κB protein close to RelA/p65 RISC RNA-induced silencing complex RNA ribonucleic acid RNAi RNA interference RNP ribonucleoprotein RPMI medium for mammalian cell culture rRABV recombinant Rabies lyssavirus RT-PCR reverse transcription PCR SAD Street Alabama Dufferin SDS sodium dodecyl sulfate shRNA short hairpin RNA SINV Sindbis virus siRNA small interfering RNA interferon-induced signal transducer and activator of STAT transcription TCID50 50% tissue culture infective dose TEMED tetramethylethylendiamine TET tetracyclin inducible TIS transcription initiation signal TTS transcription termination signal VSV Indiana vesiculovirus WB western blot WHO world health organization WT wildtype α anti

III. Publications In Preparation:

Rabies Virus Vectors for Specific Host Cell shRNA Knock-down in infected cells Nemitz S, Nolden T, Finke S

Cell culture adaptation of recombinant Rabies virus field viruses from fox and dog Nemitz S, Nolden T, Christen M, Finke S

Published:

Oral vaccination of wildlife against rabies: Differences among host species in vaccine uptake efficiency. Vos A, Freuling CM, Hundt B, Kaiser C, Nemitz S, Neubert A, Nolden T, Teifke JP, Te Kamp V, Ulrich R, Finke S, Müller T. Vaccine. 2017 Jul 13;35(32):3938-3944. doi: 10.1016/j.vaccine.2017.06.022. Epub 2017 Jun 19.

Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof. Nolden T, Pfaff F, Nemitz S, Freuling CM, Höper D, Müller T, Finke S. Sci Rep. 2016 Apr 5;6:23887. doi: 10.1038/srep23887.

A Dynein Light Chain 1 Binding Motif in Rabies Virus Polymerase L Protein Plays a Role in Microtubule Reorganization and Viral Primary Transcription. Bauer A, Nolden T, Nemitz S, Perlson E, Finke S. J Virol. 2015 Sep; 89(18):9591-600. doi: 10.1128/JVI.01298-15. Epub 2015 Jul

Summary

1. Summary

Rabies virus (RABV) is an ancient, highly neurotropic rhabdovirus that causes lethal encephalitis. Most RABV pathogenesis determinants have been identified with laboratory- adapted or attenuated RABVs, but details of natural RABV pathogenesis and attenuation mechanisms are still poorly understood. To provide a deeper insight in the cellular mechanism of pathogenies of field RABV, this work was performed to assess virus strain specific differences in intra-neuronal virus transport, to identify cell culture adaptive mutations in recombinant field viruses and to explore shRNA-expressing RABVs as research tools for targeted host manipulation in infected cells. Comparison of chimeric RABVs with glycoprotein (G) ecto-domains of different lyssaviruses, together with field RABVs from dog and fox in dorsal root ganglion (DRG) neurons revealed no detectable differences in the axonal accumulation of the viruses. This indicates that previously described G-dependent transport of newly formed RABV in axons can occur both in laboratory-adapted and field RABV. Moreover, partial overlap of nucleoprotein (N) and G protein particles in field virus infected DRG axons supported the hypothesis of the “separate model” for anterograde RABV transport. Serial passages of recombinant dog and fox field clones in different cell lines led to the identification of general (D266N) and cell line specific (K444N) adaptive mutations in the G ecto-domain of both viruses. In BHK cells, synergistic effects of D226N, K444N and A417T on field dog virus G protein surface localization led to the loss of endoplasmic reticulum (ER) retention of G and increased virus titers in the supernatant, indicating that limited virus release by ER retention is a major bottleneck in cell culture adaptation. In addition, selection of mutations within the C-terminus of the RABV phosphoprotein (P) (R293H and R293C in fox and dog viruses, respectively) led to the hypothesis of altered binding affinities to nucleoprotein and RNP complexes. Identification of the above mentioned amino acid substitutions together with alterations in a suboptimal transcription stop signal in the P/M gene border indicated that adaptation to cell culture replication occurs on both levels, RNA transcription/replication and virus release. To evaluate the possibility of an expression of a functional microRNA-adapted short-hairpin RNAs (miR-shRNA) expressing RABV, recombinant RABVs encoding miR-shRNAs against

Summary cellular Dynein Light Chain 1 (DYNLL1) and Acidic Nuclear Phosphoprotein 32 family member B (ANP32B) were generated. In spite of cytoplasmic transcription of the respective mRNAs, downregulation of DYNLL1 and ANP32B mRNA and respective protein levels in infected cells revealed correct processing to functional shRNAs. Specific downregulation of the cellular genes at 2, 3 and 4 days post infection further demonstrated feasibility of the approach in standard cell lines. However, it remained open whether miR-shRNA expressing RABV can be used to study neuro-infection in vivo. Since first attempts in primary rat neuron cultures failed, it has to be clarified in further experiments whether this strategy can be used in mature, non-dividing neurons or whether breakdown of the nucleus in the course of cell division is a requirement for the processing of cytoplasmically expressed miR-RNA by nuclear RNases. By providing novel insights in axonal RABV transport and cell culture adaptive mutations this work extends the current understanding of RABV pathogenesis in natural and non-natural cell environments. Moreover, it provides a basis for further pathogenicity studies in which the impact of cell culture adaptation through increased virus release on RABV virulence can be investigated. With successful expression of functional miR-shRNAs from RABV vectors, this work also provides a tool for RABV gene targeting in infected cell lines and thus may contribute to the further investigation of RABV-host-cell-interactions.

Summary

Zusammenfassung

Das Tollwutvirus (RABV) ist ein lange bekanntes, neurotropes Rhabdovirurs, welches tödliche Enzephalitiden auslöst. Obwohl RABV-Pathogenitätsdeterminaten bereits in Experimenten mit laboradaptierten Viren oder attenuierten RABV identifiziert wurden, sind Einzelheiten der natürlichen Pathogenese und Mechanismen der Virusattenuierung kaum verstanden. Um ein besseres Verständnis der zellulären Pathomechanismen von RABV Feldviren zu erlangen, wurde in dieser Arbeit untersucht, inwieweit es Virusstamm- spezifische Unterschiede im intra-neuronalen Transport gibt. Außerdem wurden Zellkultur- adaptive Mutationen identifiziert und es wurde untersucht inwieweit es möglich ist, shRNA- exprimierende RABV als Werkzeug für eine gezielte Wirtszellmanipulation nach Infektion zu nutzen. In Vergleichsstudien mit Feldviren von Fuchs und Hund sowie RABV-Chimären, welche im Glycoprotein (G) die Ektodomänen-Sequenzen von unterschiedlichen Lyssaviren enthielten, konnten keine wesentlichen Unterschiede in der Lokalisation der Viruspartikel in den Axonen dorsaler Spinalwurzelganglien (DRG) festgestellt werden. Somit kann davon ausgegangen werden, dass ein G-abhängiger Transport in DRG-Neuronen Virusstamm-unabhängig erfolgt. Zudem konnte gezeigt werden, dass RABV Nukleoprotein (N) und G Partikel von Feldviren in Axonen von DRG-Neuronen nur teilweise überlagern, was für das „separate transport model“ des anterograden Transports spricht. Sequentielle Passagierung rekombinanter Feldviren von Hund und Fuchs führten zu adaptiven Mutationen im Virusgenom, wodurch allgemeine (D266N) und zelltypspezifische Mutationen (K444N) in den Ektodomänen beider Viren identifiziert werden konnten. Speziell in BHK Zellen konnte für die Mutationen D266N, K444N und A417T im G Protein des Hundevirus ein synergetischer Effekt zur Verbesserung der Oberflächenlokalisation beobachtet werden. Zudem konnte in höheren Passagen weniger G Protein im Endoplasmatischen Retikulum (ER) detektiert sowie höhere Titer erzielt werden. Basierend darauf kann die eingeschränkte Freisetzung von Viruspartikeln auf Grund der Retention im ER als Engpass in der Zellkulturreplikation angesehen werden. Zusätzliche Mutationen im C-Terminus des RABV Phosphoproteins (P) (R293H und R293C jeweils im Fuchs und Hundeisolat) könnten zu angepassten Bindungsaffinitäten von P zum RNP Komplex und somit zu einer angepassten Replikation führen. Die Identifizierung und Charakterisierung der Mutationen, zusammen mit

Summary den Anpassungen im Transkriptionsstoppsignal der P/M Gengrenze zeigen, dass eine zellkulturbedingte Anpassung sowohl auf Transkriptions-/ Replikationsebene als auch auf der Ebene der Virusfreisetzung stattfindet. Weiterhin wurde untersuchen, ob eine Expression von mikroRNA-adaptierter short-hairpin RNA (miR-shRNA) durch RABV möglich ist. Dazu wurden rekombinante RABV, welche miRNA-shRNAs gegen die zellulären Gene Dynein Light Chain 1 (DYNLL1) und Acidic Nuclear Phosphoprotein 32 family member B (ANP32B) exprimieren, generiert. Trotz der zytoplasmatischen Transkription der beschriebenen mRNAs zeigte die Herunterregulation von DYNLL1 und ANP32B mRNAs und der dazugehörigen Proteinlevel, dass die exprimierten miR-shRNAs korrekt zu funktionellen shRNAs prozessiert wurden. Durch die gezielte Herunterregulierung von DYNLL1 und ANP32B an Tag zwei, drei und vier nach Infektion konnte zudem bestätigt werden, dass eine Analyse von Virus-Wirt-Interaktionen in Standardzelllinien möglich ist. Es bleibt aber ungeklärt, ob die untersuchte Strategie auch in differenzierten, nicht teilungsfähigen Neuronen angewendet werden kann, da in ersten Experimenten mit Neuronenkulturen von Ratten keine Regulierung der Zielgene durch miR- shRNA exprimierende RABV gezeigt werden konnte. Die zugrundeliegenden Daten zum axonalen RABV Transport sowie zu zellkulturbedingten Adaptionen können dazu beitragen, die Pathogenese von RABV in vivo und in vitro Systemen besser zu verstehen. Auf Basis der vorgestellten Daten können in zukünftigen Pathogenitätsstudien der Einfluss zellkulturbedingter Mutationen auf die Virulenz von RABV untersucht werden. Des Weiteren ist es durch die erfolgreiche Expression von funktionellen miR-shRNAs durch RABV Vektoren möglich über gezielte Genregulation in infizierten Zelllinien Virus-Wirtszell-Interaktionen näher zu untersuchen.

Introduction

2. Introduction

As one of the 17 neglected tropical diseases announced by the world health organization, Rabies lyssavirus (RABV) is responsible for more than 55,000 deaths yearly worldwide, especially in south- and southeast Asia, Africa, South America and Eastern Europe (Knobel et al., 2005). RABV is the causative agent of rabies disease and is able to cause fatal encephalomyelitis in most mammals, including humans. Typically, dogs infected with the virus are recognized by their aggressive behavior and foaming at the mouth because of the paralysis of throat and jaw muscles. Dogs are responsible for approximately 95% of human rabies cases. After the onset of symptoms, it is almost invariably fatal. To date, there are only a few persons, who survived the RABV infection without severe neurological damages (Fooks et al., 2017; Willoughby et al., 2005). However, RABV infection is preventable, since vaccines for pre-treatment and post-exposure prophylaxis (PEP), for the treatment immediately after contact with rabid animals, are available. RABV is still endemic in many countries. As a result of extensive vaccination from 1983 – 2006, where compulsory vaccination for dogs was introduced and baits for red foxes were distributed, Germany was declared free of terrestrial rabies in 2006 (Muller et al., 2012). Although terrestrial rabies is eradicated in Germany, increased cases of bat-related rabies were reported in local bat species, which can result in a threat as humans are susceptible for bat related rabies (Fooks et al., 2003; Hanna et al., 2000; Paweska et al., 2006). RABV can use different Carnivora and bat species as reservoir hosts. Spillover to non- reservoir hosts can cause rabies disease also in other mammals, including humans. In early phases of infection, symptoms like slight inflammation at the site of inoculation can occur and later result in fever, pain or paraesthesia. At later stages, after infection of the central nervous system and massive virus replication, encephalitis with inflammation of the brain and spinal cord is developed (World Health Organization, 2013). Two forms of rabies disease progression are described. Furious rabies accounts for 70 – 80% of cases in Carnivora and includes aggressive behavior, hydrophobia and sometimes aerophobia. Numb or paralytic rabies is characterized by progressive paralysis of the muscles until coma and accounts for 20 – 30% of cases (Okolo, 1986). Usually, the incubation period lasts 4 to 8 weeks, but may vary from a few days to more than a year (Smith et al., 1991). Amongst others, duration of the

Introduction incubation period depends on the site of inoculation and viral load at initial contact (Warrell, 1976). In 1885, Louis Pasteur vaccinated a young boy bitten by a rabid dog. The vaccine virus was isolated from the spinal cord from an infected rabbit, which has been subjected to multiple passages in vivo. This was the first successful PEP of an RABV infected person. Recent PEP in humans includes the combined administration of one dose RABV immunoglobulin and five doses of immunization with an inactivated RABV vaccine at different time points after proven or suspected contact to a rabid animal (Manning et al., 2008). Once symptoms have developed, a successful PEP application is highly unlikely (Jackson et al., 2003; Willoughby, 2009). While humans and domestic animals are actively immunized with an inactivated vaccine, live attenuated or recombinant vector vaccines are used for oral vaccination of wildlife animals (Rupprecht et al., 2004).

2.1. Classification

The Mononegavirales order comprises all non-segmented negative-sense RNA viruses (NNSV). Accordingly, it includes a diverse group of viruses infecting animals and plants. Nevertheless, basic characteristics like genome organization and particle structure of the enveloped viruses are conserved. Beside additional gene products in some virus families, all members of the Mononegavirales order encode for a minimal set of five virus proteins in a strictly conserved gene order. All have short complementary 3´- and 5´-ends and control transcription by internal start and stop signals. Members of the Mononegavirales order are currently divided in eight families (Borna-, Filo-, Mymona-, Nyami-, Paramyxo-, Pnemo-, Rhabdo- and Sunviridae). Within the Rhabdoviridae family, two virus genera are of major importance for livestock and humans: Vesiculoviruses and Lyssaviruses. The respective type species Indiana vesiculovirus (VSV) and RABV share many similarities. Within the Rhabdoviridae family, the genus Lyssavirus covers classical RABV and RABV related Lyssaviruses (see table 1). The 16 Lyssavirus species are assigned to phylogroups by means of sequence similarities (phylogeny), immunologic features (cross-neutralisation) and pathogenicity in mice (Badrane et al., 2001; Kuzmin et al., 2005). There is significant

Introduction serological neutralization within phylogroups, but only limited neutralization across phylogroup borders.

Table 1: Taxonomy for the Lyssavirus genus. Currently the Lyssavirus genus comprises 16 species. The different species can be divided in 3 phylogroups (Fooks et al., 2017), which do not cross-react serologically. + Information about recently described Taiwan bat lyssavirus is not scientifically published yet. #There is a discussion about the third phylogroup, as cross-neutralization is not always comparable and because of the distinct phylogeny of Ikoma Lyssavirus (Marston et al., 2012) and Ileida lyssavirus (Banyard et al., 2018). genus phylogroup species reservoir host Carnivora/ Rabies lyssavirus (RABV) Chiroptera Aravan lyssavirus (ARAV) Chiroptera Australian bat lyssavirus (ABLV) Chiroptera Bokeloh bat lyssavirus (BBLV) Chiroptera I European bat lyssavirus 1 (EBLV-1) Chiroptera

European bat lyssavirus 2 (EBLV-2) Chiroptera Ganorrova lyssavirus (GBLV) Chiroptera Duvenhage lyssavirus (DUVV) Chiroptera Irkut lyssavirus (IRKV) Chiroptera Khujand lyssavirus (KHUV) Chiroptera Lyssavirus Lagos bat lyssavirus (LBLV) Chiroptera II Mokola lyssavirus (MOKV) ? Shimoni bat lyssavirus (SHIBV) Chiroptera West Caucasian bat lyssavirus Chiroptera (WCBV) III Ikoma lyssavirus (IKOV)# Chiroptera Ileida lyssavirus (ILLEBV)# Chiroptera Taiwan bat lyssavirus+(ProMED-mail, ? Chiroptera 2016)

Introduction

Susceptible hosts for classical RABV include terrestrial wildlife and bats as well as domestic animals and humans. While RABV is found all over the world (except Australia, Antarctica and some islands), bat-associated lyssaviruses are restricted to certain geographical areas. Bat- lyssaviruses from the Eurasian continent include Aravan lyssavirus (ARAV) (Kuzmin et al., 1992), Bokeloh bat lyssavirus (BBLV) (Freuling et al., 2011), European bat lyssavirus (EBLV) type I and II, Irkut lyssavirus (IRKV) (Botvinkin et al., 2003), Khujand lyssavirus (KHUV) (Kuzmin et al., 2003) and Rabies lyssavirus (RABV). West Caucasian bat lyssavirus (WCBV) (Botvinkin et al., 2003), Gannoruva bat lyssavirus (GBLV) (Gunawardena et al., 2016) and Ikoma lyssavirus (IKOV) (Marston et al., 2012) were isolated from Asian bats. The novel Lleida bat lyssavirus (LLEBV) from Spain was first described in 2012 and is classified to pylogroup III (Arechiga Ceballos et al., 2013; Banyard et al., 2018; Marston et al., 2017), together with WCBV and IKOV. Australian bat lyssavirus (ABLV) is the only Lyssavirus from the Australian continent known so far (Fraser et al., 1996). African lyssaviruses include the Lagos bat lyssavirus, first isolated from Nigerian fruit bats (Boulger and Porterfield, 1958), Mokola lyssavirus (MOKV) isolated from African shrew (Shope et al., 1970), Shimoni bat lyssavirus (SHIBV) isolated from a Commerson's leaf-nosed bat (Hipposideros commersoni) (Kuzmin et al., 2010) and fruit bat (Eidolon helvum) associated Duvenhage lyssavirus (DUVV) (Meredith et al., 1971). Whereas in endemic regions cross species transmissions (CST) of classical RABV from wildlife to domestic animals occur frequently, CST of bat variants to terrestrial animals are rare and only reported for a few species including skunks (Leslie et al., 2006), red foxes (Daoust et al., 1996), cats (Dacheux et al., 2009), sheeps (Tjornehoj et al., 2006) and stone martens (summarized in (Gibbons, 2002)). Sustained spill-over or host-shifts occasionally occur (Hughes et al., 2005). In most other cases CST from bats to other animals, e.g. livestock and cats, are considered as dead end host transmissions (reviewed in (Burnett, 1989)).

2.2. Transmission

All mammals are considered susceptible to lyssavirus infections. However, only certain Carnivora (including dog, fox, raccoondog, raccoon, skunk, mongoose, jackal and arctic fox)

Introduction and Chiroptera are known reservoir species, which are important for maintenance and transmission of RABV. Both, within a host population and in CST, the virus is transmitted by bite of a rabid animal or transdermal contact with contagious material, e.g. saliva or central nervous system (CNS) tissue (Brito et al., 2011; Manning et al., 2008; Warrell and Warrell, 2004). The natural infection route of RABV starts in peripheral neurons, where virus was introduced and enters motor neurons at the neuro muscular junctions via binding to respective receptors (Ugolini, 2011). It was observed that infection of muscle tissue at the site of inoculation plays an important role in the infection of peripheral nerves (Charlton et al., 1997; Park et al., 2006). However, others demonstrated that RABV directly infects peripheral nerves without the necessity of primary infection and replication in the muscle (Coulon et al., 1989; Shankar et al., 1991). An infection via aerosol is possible under artificial laboratory conditions, e.g. when highly concentrated virus is handled. However, aerosol transmission in caves with large bat populations, including airborne spillovers to humans, has been reported in some publications (Winkler et al., 1972; Winkler et al., 1973), but have never been well documented (reviewed in (Gibbons, 2002)). Human-to-human transmission does not occur under natural conditions, but was described for cornea transplantations from infected to healthy patients (Srinivasan et al., 2005).

2.3. RABV virion structure and genome organization

The typical shape of a Rhabdovirus (lat. rhabdos = rod) is following the helical basic structure, with one flattened and one rounded end. It is 100 – 300 nm long and 75 nm in diameter (Matsumoto, 1962; Tordo et al., 1988). The RABV genome encodes for five proteins designated as nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA-dependent RNA polymerase or large protein (L) (Flamand and Delagneau, 1978). Inside the virus particle the single-stranded, non-segmented, negative-sense RNA is protected within the ribonucleoprotein complex (RNP) (reviewed in (Schnell et al., 2010)). The RNP is the smallest infectious unit of the virus and it directly serves as template for primary transcription after release into the cytoplasm and is sufficient for the synthesis of viral

Introduction proteins. It combines the N protein and the viral RNA together with the polymerase complex composed of the L protein and the P protein as co-factor (Koser et al., 2004). The RNP is condensed by the M protein and surrounded by the host cell membrane-derived envelope, which contains the trimeric G protein arranged (figure 1, A). The respective genes are arranged in a conserved order (3´- N-P-M-G-L -5´) (figure 1, B). The 5´- and 3´- ends of the mono-cistronic mRNAs are flanked by transcription initiation signals (TIS) (consensus sequence: 3’-UUGURRNGA-5’) and transcription termination polyadenylation signals (TTS) (consensus sequence: 3’-WCUUUUUUUG-5’), which are separated by intergenic regions (IGR) of variable length (figure 1, B). The termini of the negative sense genome RNA are characterized by a leader RNA coding region (leader) and a non-coding trailer region (figure 1, B). The first and last 11 nucleotides of the virus genome are inversely complementary to each other (Tordo et al., 1988) and conserved among all Lyssaviruses. Whereas the 3’ -leader acts as a genome promoter, which allows initiation of mRNA transcription and replicative synthesis of positive strand anti-genome RNA, the trailer sequence in the positive sense anti-genome contains the anti-genome promotor for replicative synthesis of the negative sense RNA genome (Finke and Conzelmann, 1997).

Figure 1: Schematic presentation of RABV particle and genome. (A) The viral negative-sense RNA and the nucleoprotein form the helical nucleocapsid. Phosphoprotein and large protein are associated with the

Introduction nucleocapsid forming the ribonulceoprotein (RNP). The matrix protein condenses the RNP assuring the helical structure and the glycoprotein is arranged in trimers, which are anchored in the host cell-derived envelope and point to the outside. (B) The 11.9 kb large non-segmented RABV genome of negative-sense encodes five viral proteins, which are divided by intergenic regions of variable length. The open reading frames are additionally flanked by transcription initiation signals (TIS) and transcription termination signals (TTS). Leader and trailer sequences terminate the RABV genome.

2.4. RABV proteins

N protein (nucleoprotein) The 57 kDa N protein is the most conserved lyssavirus protein. It is essential for replication of the virus as it co-replicatively encapsidates de novo-synthesized viral genomic RNA in an RNP (Patton et al., 1984). Only the RNP serves as template for theviral RNP-dependent RNA polymerase. During replication soluble N (N0) protein is captured by the P protein in N-P complexes, comprising one N and two P molecules (Mavrakis et al., 2003), preventing newly synthesized N from self-assembly (Masters and Banerjee, 1988). Two binding sites for N0 in the P protein are described, both essential for efficient replication (Chenik et al., 1994). Furthermore, N phosphorylation plays a key role in RABV transcription and replication. It has been suggested that phosphorylation of N induces a switch from transcription to replication mode (Wu et al., 2002). The necessity of N phosphorylation was discussed earlier, as absence of phosphorylation at amino acid position 389 (serine) led to a 10,000-fold reduced replication (Dietzschold et al., 1987; Wu et al., 2002; Yang et al., 1999). Interestingly, the N protein is also involved in immune invasion, evading the RIG-I mediated antiviral response (Masatani et al., 2011; Masatani et al., 2010). In vivo studies in mice showed that in virulent RABV amino acids at positions 273 and 394 are responsible for increased pathogenicity and efficient virus spread to the CNS (Masatani et al., 2013).

P protein (phosphoprotein) The 38 kDa P protein forms homo-oligomers and exists, in addition to full-length P protein, in four truncated forms (Chenik et al., 1995; Gerard et al., 2007). The P protein consists of two functional domains. One for the binding of N protein together with the viral RNA (N-virus

Introduction

RNA complexes) at the C-terminus, and one central oligomerization domain. Additionally, two binding sites for N0 and L protein are present at the N-terminal end (figure. 2). Besides its N-binding chaperone function (summarized in (Mavrakis et al., 2006)), P is a non-catalytic co-factor for the L Protein and is required for positioning of the polymerase on its template (Mellon and Emerson, 1978). Moreover, P interacts with cellular factors including Dynein Light Chain 1 (DYNLL1) (Jacob et al., 2000; Raux et al., 2000) and Interferon Regulatory Factor 3 (IRF3). It acts as a direct interferon (IFN) antagonist by prohibiting phosphorylation of IRF 3 and 7 and thus interferes with type I IFN gene transcription induction. Additionally, P can interfere with IFN signalling by preventing nuclear accumulation of IFN-induced signal transducer and activator of transcription 1 (STAT1) (Brzozka et al., 2006; Vidy et al., 2005; Wiltzer et al., 2014). Therefore, RABV P can be considered the most important factor interfering with the cellular immune response. The IFN antagonistic functions of P are important for in vivo replication and pathogenesis, as stable replication of RABV in muscle cells depends on the ability to suppress the expression of IFN-β and IFN-stimulated genes (Yamaoka et al., 2013).

Figure 2: Predicted structure of the phosphoprotein with respective binding domains [adapted from

(Mavrakis et al., 2004)]. The P protein has 2 domains and 2 binding sites for soluble N (N0) and the polymerase (L) (black dotted circle). Grey dotted lines indicate interaction domains of P with cellular factors. Numbers indicate amino acid residues.

M protein (matrixprotein) With exception of the truncated P gene products, the 25 kDa matrixprotein (M) is the smallest of the RABV proteins. Its main function is to condense the RNP by binding to it and initiating the budding of the typical bullet-shaped virus particles (Mebatsion et al., 1999). Although M alone is able to support virus budding, glycoprotein (G) increases the efficacy (Mebatsion et

Introduction al., 1996a), indicating that both envelope proteins cooperate in the process of membrane envelopment and virion release. Regulatory function on RNA synthesis of M was observed by keeping the balance between transcription and replication. In-trans complementation of M- deleted RABV and simple amino acid substitutions led to the loss of regulatory function and thus to a high transcription phenotype (Finke and Conzelmann, 2003; Finke et al., 2003). Moreover, M affects translation through interaction with cellular eukaryotic translation initiation factor 3 subunit H (eIF3H) and thus interferes with cellular translation machinery (Komarova et al., 2007). Via binding to RelAp43, the M protein is able to interfere with the activation of the innate immune response (Luco et al., 2012). This interaction suppresses the antiviral state by inhibiting NF-κ B signalling and reduces IFN-β transcription in virulent field RABV (Ben Khalifa et al., 2016; Luco et al., 2012). A pro-apoptotic function of M was confirmed by Zan et al., showing that RABV CVS M comprises a mitochondrial-targeting sequence. Also in other strains, mitochondria targeting and apoptosis induction via the mitochondrial pathway seem to be conserved (Zan et al., 2016).

G protein (glycoprotein) The 65 kDa G protein is a type I transmembrane protein presented as a homo-trimer on the surface of infected cells and on RABV virions. The so called “spikes” are essential for the attachment to cellular receptors and membrane fusion during receptor mediated endocytosis (Gaudin et al., 1992; Whitt et al., 1991). Only the nascent form of the G protein carries a N- terminal signal peptide, which is cleaved off after synthesis in the Endoplasmic Reticulum (Gaudin et al., 1999; Sissoeff et al., 2005). The mature G protein is composed of a cytoplasmic domain, which is important for the interaction with M, a transmembrane domain, anchoring G in the envelope and the extending ecto-domain (figure 3). The G protein plays an important role in immunity and pathogenicity and is the major target antigen for neutralizing antibodies (Cox et al., 1977; Wunner et al., 1988). The antigenic sites (I – IV) are located in the ecto-domain of G, of which sites II and III are the major antigenic sites, but also other epitopes are described (Benmansour et al., 1991; Dietzschold et al., 1990; Lafay et al., 1996; Lafon et al., 1983; Prehaud et al., 1988; Seif et al., 1985). Moreover, G is the primary target for cellular immune responses (Celis et al., 1988; Macfarlan et al., 1986). It is worth noticing that G proteins of attenuated RABVs as well as overexpression of G are inducers of apoptosis (Faber et al., 2002; Prehaud et al., 2003). Via variable binding

Introduction efficiencies to the PDZ domain of cellular targets, G is able to either induce apoptosis (mainly attenuated strains) or influence survival of infected neurons (virulent strains) (summarized in (Caillet-Saguy et al., 2015)). This demonstrates the subversive, neuro-invasive role of the cytoplasmic domain of wild type G, promoting survival of infected neurons (Prehaud et al., 2010). G is the only glycosylated RABV protein. Glycosylation and formation of the trimeric structure takes place in the Endoplasmic Reticulum and Golgi apparatus (Gaudin et al., 1992). There are differences in the glycosylation status of G in different RABV strains. Up to 5 sequons can be glycosylated and there is evidence that especially laboratory adapted strains have more potential glycosylation sites than field strains (Anilionis et al., 1981; Shakin- Eshleman et al., 1992; Yamada et al., 2013; Yamada et al., 2012). Usually non-fixed RABV have at least two N-glycosylation sites, namely at amino acid positions 56 and 336 (Yamada et al., 2014; Yamada et al., 2013; Yamada et al., 2012). The N-glycosylation sites at the asparagine positions 336 and 266 increase virus propagation in cell culture and play an important role for transport processes inside the cell (Hamamoto et al., 2015; Shakin- Eshleman et al., 1992; Yamada et al., 2014). All Lyssaviruses have a pseudogene region (Ψ) of variable length (app. 450 nucleotides) between G and L protein coding sequences. It does not code for a 6th gene, since it is not translated, but is transcribed together with G (Tordo et al., 1986b). The pseudogene region is neither essential for replication nor is there evidence that it is involved in pathogenicity of RABV. However, it is described as a region for insertion of additional genes (e.g. green fluorescent protein) (Ceccaldi et al., 1998; Mebatsion et al., 1996b; Schnell et al., 1994). In this study also G protein deleted RABV was used. These particles are capable of one cycle of replication in their host cell, as they do not express G. Therefore, they produce virus particles, which are not able to spread and infect other cells (Etessami et al., 2000; Mebatsion et al., 1996a). They can also be used to track monosynaptic spread of RABV in neurons (Wickersham et al., 2007a).

Introduction

Figure 3: Predicted structure of the glycoprotein [adapted from(Evans et al., 2012)]. The G protein consists of three functional domains and an additional signal peptide at the NH2-end. There is a flexible hinge region in the ecto-domain with variable length. Dashed lines indicate antigenic sites (I, II, III and IV). Numbers indicate amino acid residues counted from NH2-end.

L protein (large protein, RNA-dependent RNA polymerase) The L protein (244 kDa) is the catalytic component of the viral RNA-polymerase and responsible for initiation, elongation and posttranscriptional modifications like methylation, 5’ -capping and polyadenylation. Due to its similarities to VSV, these functions have been assigned to L (Perlman and Huang, 1973). Moreover six conserved regions (CR I – VI) are found in the L sequence and mapped to respective activity (summarized in (Rahmeh et al., 2010)). Most important are CR III, which is essential for RdRP activity and polyadenylation (Sleat and Banerjee, 1993), CR V, which is responsible for capping activities (RNA:GDP polyribonucleotidyltransferase) by transferring the 5′- monophosphate RNA onto a GDP acceptor through a covalent L-pRNA intermediate (Li et al., 2008) and CR VI with an methyltransferase activity (Rahmeh et al., 2009). The P protein ensures stability as co-factor of L as shown for VSV (Canter and Perrault, 1996). Besides the P protein, also RABV L interacts with cellular DYNLL1 (Bauer et al., 2015). Recent studies also show that L is implicated in pathogenicity and immune evasion of RABV (Tian et al., 2015).

Introduction

2.5. Life cycle

The virus is introduced via bites or scratches in the periphery of the host, predominantly in muscle tissue. RABV can bind to a variety of receptors present on the surface of muscle and neuronal cells. These include the nicotinic acetylcholine receptor (nAChR) (Lentz et al., 1982), the neuronal cell adhesion molecule (NCAM) (Thoulouze et al., 1998) and the low affinity nerve growth factor receptor (p75NTR) (Gluska et al., 2014; Langevin et al., 2002; Tuffereau et al., 1998b). There is evidence that low level of replication in muscle tissue contributes to an efficient infection of peripheral nerves and subsequent better infection of the CNS (Charlton and Casey, 1981; Murphy and Bauer, 1974; Park et al., 2006; Yamaoka et al., 2013). This is the case for highly virulent RABV strains and it was reported that the P protein plays a major role in this process by interfering with the IFN signalling (Yamaoka et al., 2013). However, the G protein plays a major role and is essential for virus internalization (Gaudin et al., 1992). The virus enters the host cell via clathrin-dependent, receptor-mediated endocytosis (figure 4, ) and is actin and dynamin 2 dependent (Piccinotti et al., 2013). By binding to the respective receptor at the cell surface, the membrane proteins cluster into clathrin-coated pits (Superti et al., 1984). The virus particles are taken up and transported using early endosomes through the endosomal pathway. It could be shown in previous studies that RABV co-localizes with RAB5a, a marker for early endosomes (St Pierre et al., 2011). Early endosomes have a characteristic mild acidic pH (5.5 – 6.3), which is maintained by membrane-associated ATPases pumping protons from cytosol into the lumen. A conformational change in the G protein induces the fusion of the viral and endosomal membrane, which is strongly pH dependent and can only occur at an optimum of 5.8 – 6.0 (Gaudin et al., 1993). This so called acid-activated penetration is completed by the formation of a lipid pore in a hemi-fusion diaphragm (Gaudin, 2000). Afterwards, the viral RNP is released into the cytoplasm (uncoating) (figure 4, ), where primary transcription and replication of the viral genome take place. Primary transcription of the viral genes is mediated by the L-P polymerase complex and starts at the 3´ -end of the viral genome (leader sequence or genome promotor), where the negative stranded RNP serves as template and results in production of the 46 bp long positive strand uncapped leader RNA. The RNA polymerase then starts with mRNA synthesis of 5´ -capped and polyadenylated mRNAs (reviewed in (Banerjee, 1987)). Polyadenylation by the viral polymerase occurs via polymerase slippage at

Introduction uracil rich sequons. After each gene border, the polymerase stops and reinitiates for 5´ - capping and transcription of the next gene. Due to the massive production of viral proteins, predominantly N, P and L, the formation of Negri bodies is induced, which are inclusion bodies where synthesis of viral proteins takes place (Lahaye et al., 2009). Since transcription initiation can only occur at the 3´- end of the genome and not internally, a transcription gradient towards the template 5´- end is established (figure 4, ) (Iverson and Rose, 1981). The transcription gradient is further determined by the length of the non- transcribed intergenic regions (IGR) (depicted in figure 1, B), where, with increasing IGR length, there is less downstream re-initiation (Finke et al., 2000; Tordo et al., 1986a; Tordo et al., 1986b). Replication is initiated at the genome promoter at the 3´- end of the negative sense RNP and thus results in the production of full length anti-genome RNPs. The 3’-terminal anti-genome promotor of the positive sense anti-genome acts subsequently as template for the synthesis of genomic negative-sense RNPs. N is critical to virus replication, encapsidating the leader mRNA as well as the full-length anti-genome (Yang et al., 1998; Yang et al., 1999). Transcription from newly synthesized genomes is referred to as secondary transcription. There is evidence that the conversation of negative to positive-strand RNA occurs due to a switch of the polymerase from transcriptive to replicative mode. Here, the M protein plays a major role in stimulating the replication, while reducing the transcription (Finke and Conzelmann, 2003; Finke et al., 2003). The G protein has three potential N-glycosylation sites in its extracellular domain (Anilionis et al., 1981). Glycosylation of the G protein, which takes place in ER and Golgi apparatus, is essential for its expression and function, since non-glycosylated G is not expressed on the surface of the cell (Burger et al., 1991; Gaudin et al., 1992; Shakin-Eshleman et al., 1992) (figure 4, ). Simultaneously, virus particle assembly occurs: the RNP is covered and condensed by the M protein (Mebatsion et al., 1999) and recruited to the host cell plasma membrane, where G is incorporated (figure 4, ). Budding is initialized by the M protein (Mebatsion et al., 1996a) and leads to the release of complete viral particles.

Introduction

Figure 4: Schematic representation of RABV Life cycle. (1) Attachment and endocytosis: RABV enters host cells via receptor-mediated endocytosis induced by the glycoprotein. (2) Transport in acidic vesicles and pH dependent release into the cytoplasm. (3) RNA-synthesis and translation of viral proteins. (4) Processing of the glycoprotein in ER and Golgi apparatus. (5) Virus assembly at the host cell membrane and virus budding.

2.6. Neuronal transport of RABV particles

RABV is able to infect any cell type in vitro, not only neuronal cells. However, infection of neuronal cells and trans-synaptic spread of the virus in vivo are essential for the virus to reach the CNS. After entering the nervous system, virus transport occurs inside of endosomal

Introduction vesicles along microtubules (Gluska et al., 2014; Klingen et al., 2008; Piccinotti and Whelan, 2016; Tsiang et al., 1989). Within axons, the polarized microtubules are orientated with the (+)-ends towards the cell periphery and with the (-)-ends towards the cell soma. Dynein motor complexes are responsible for retrograde transport towards the (+)-ends, whereas kinesin motor complexes facilitate anterograde transport of cargos in (-)-end direction (reviewed in (Kapitein and Hoogenraad, 2011)). For a long time, RABV axonal transport has been considered to occur exclusively in the retrograde direction and, therefore, the virus has been used as marker for mono-directional tracing of neuronal connections within the CNS (reviewed in (Ugolini, 2010; Ugolini, 2011)). However, release of viral particles after anterograde transport was described already in late 80´s (Astic et al., 1993; Coulon et al., 1989; Tsiang et al., 1989). More recently, anterograde axonal transport of RABV virus in vivo was described in peripheral sensory neurons (Zampieri et al., 2014). Glycoprotein dependent anterograde axonal transport of newly synthesized RABV particles in DRG neurons was identified by live virus imaging and it was hypothesized that exclusiveness of retrograde axonal transport may depend on the type of infected neurons (Bauer et al., 2014b). Moreover, it was hypothesized that either complete, enveloped virus particles within exocytotic vesicles (figure 5, A) or cytoplasmic RNPs attached to G-containing transport vesicles (figure 5, B) enter the anterograde axonal transport pathway. It has been estimated that RABV migrates within axons at a rate of 3 mm/h (Tsiang, 1979). More recently, live imaging of RABV particles in rat DRG neurons revealed transport velocities of 1.5 µm/second in the retrograde and 3.4 µm/second in the anterograde direction. The anterograde transport was discussed to represent fast, kinesin dependent virus transport (Bauer et al., 2014a).Via microtubule-dependent axonal transport, the virus reaches higher order neurons and subsequently the CNS. RABV accumulates in the midbrain and spread from the CNS to peripheral organs. After reaching the salivary glands it can be transmitted to new hosts via bites (Charlton and Casey, 1981).

Introduction

Figure 5: Proposed models of anterograde axonal RABV transport. (A) Either complete, enveloped virus particles are transported within exocytotic vesicles or (B) co-transport of cytoplasmic RNPs and G-containing transport vesicles may occur. Whereas the former mode may allow release of complete virus particles at pre- synaptic membranes, the co-transport model would allow local concentration of both, viral G protein and RNPs at distal sites of virus assembly. After fusion of the transport vesicle with pre-synaptic membranes, RNPs are positioned directly beneath the G-enriched pre-synaptic membrane and virus particles may be assembled by a subsequent budding event Adapted from (Bauer et al., 2014b).

2.7. Fixed and non-fixed RABV

After isolation of field RABV, the viruses are often amplified in cell culture or in animals. Serial cell culture or animal passaging usually result in increased virus production and a stable time courses of disease in infected animals. Those viruses are designated as “fixed” (Lepine, 1938). Simultaneously, multiple cell culture passages can also lead to virus attenuation, since the virus needs to adapt to different conditions (bottlenecks), which in turn leads to selective pressure on the virus itself. Adaptation to non-natural growth conditions may occur at the expense of virulence. The adaptation to non-natural conditions is a prerequisite for the establishment of fixed viruses, but they might not reflect all features of pathogenic field RABV. As fixed viruses are considered to differ from field viruses, the use of fixed viruses for infection experiments may lead to misleading data regarding pathogenicity. Several examples of field virus attenuation by multiple passages in animals and cell cultures exist. The first

Introduction attempt for the development of an RABV vaccine by Louis Pasteur was in late 18th century. He established the first fixed RABV through sequential passaging of field isolates in rabbits via intra-cranial inoculation. The passaged field isolates lost their ability for propagation along neurons after peripheral inoculation (Lepine, 1938). Another example for an attenuated RABV is the RC-HL strain derived from the Nishigahara strain after 330 passages in chicken embryos and cell cultures (Takayama-Ito et al., 2004). The Street Alabama Dufferin (SAD) strain, used as vaccine strain for oral immunization of foxes to eradicate rabies in Europe (Steck et al., 1982), was serially passaged on BHK cells to get an attenuated RABV strain (summarized in (Vos et al., 1999)).

2.8. RABV as vector and research tool

As an RNA virus with a relatively simple genome organization, genetic modification of RABV by reverse genetics technology is possible. The rescue of a recombinant RABV (rRABV) from a full length cDNA plasmid in 1994 provided the possibility to generate a large variety of rRABV (Schnell et al., 1994). Since then, RABVs have been used as vectors to introduce foreign genes e.g. for the expression of envelope proteins from other viruses or even bacterial antigens in order to develop a vector vaccine platform (Blaney et al., 2011; Schnell et al., 2000; Smith et al., 2006). Additionally, increase of the immunogenicity by expression of immunogenic epitopes, cytokines, chemokines or hematopoietic factors is possible (Faber et al., 2005; Koser et al., 2004; Zhao et al., 2010). Because of the trans- synaptical spread of RABVs, they have also been used as neuronal tracers. Whereas non- recombinant RABVs allow tracing of multiple neuronal junctions (Ugolini, 2011), reporter expressing G gene RABV can be used for monosynaptic neuron tracing (Wickersham et al., 2007a; Wickersham et al., 2007b). Moreover, reporter gene expressing RABVs have been developed to investigate the biology of RABV, e.g. by the introduction of fluorescent proteins to label virus RNPs (Finke et al., 2004) or the viral envelope (Klingen et al., 2008). Fluorescence labelled particles have also been used to study intra-neuronal particle transport, receptor binding and co-internalization (Klingen et al., 2008, Bauer et al., 2014, Gluska et al., 2014). Host miRNAs from the closely related VSV were successfully expressed (Langlois et al., 2012). However, in contrast to heterologous anti-genes and other proteins, host cell gene regulatory RNAs have not yet been expressed from RABV vectors.

Introduction

2.8.1. Gene regulation via post-transcriptional silencing: RNAi

RNA interference (RNAi) is one option to regulate post-trancriptional gene expression in mammalian cells. There are different possibilities to induce RNAi in host cells: eihter by naturally expressed micro (mi)RNAs, by vectors encoding both, natural miRNAs or synthetical short-hairpin (sh)RNAs, or via exogenously provided double-stranded small- interfering (si)RNAs. Both, miRNAs and shRNA, form hairpin structures, which include a stem with invers-complementary basepairing sites and a loop structure. miRNAs are naturally expressed in a wide range of organisms, including mammals, and regulate gene expression on a post-transcriptional level (summarized in (Bartel and Chen, 2004)). RNAi can also be induced in cells by direct transfection of synthetic, double-stranded siRNAs or by intracellular synthesis through RNA transcription from transfected plasmids or other vectors like lentiviruses. The mechanism of miRNA and shRNA, or the equivalent miR-shRNA processing, is summarized and compared in figure 6. miRNAs are initially transcribed as long RNA-Pol II and III pri-miRNA transcripts (Cullen, 2004; Lee et al., 2002), which are subsequently processed by nuclear RNAse III complex Drosha/DGCR8, leading to pre-miRNA with an 2 nts long 3’-overhang. The pre-miRNA is exported to the cytoplasm by nuclear export factor Exportin-5 (Cullen, 2004). Further cytoplasmic pre-miRNA processing by the endoribonuclease Dicer results in the removal of the hairpin-loop and the formation of a short double strand siRNA with a second 2-nt long 3’-overhang (Lee et al., 2003; Zeng et al., 2005). This siRNA structure can be used for gene silencing or regulation through RNA induced silencing complex (RISC) (summarized in (Cullen, 2005)), which includes guiding of the RISC to specific mRNAs by the ~23 nt long siRNA. Components of the RISC disassemble the siRNA in guide strand (antisense) and passenger strand. The guide strand is incorporated by Argonaut 2 (AGO 2), further loaded to the RISC for mRNA targeting (Cullen, 2005) and serves there as a template for the target mRNA, which is either degraded or used to repress translation (summarized in (Bartel, 2004; Bartel, 2009)). The shRNA used in this study had an additional microRNA (miR)-site, which allowed processing of shRNA. In such systems, the shRNA sequence is flanked by miRNA-sequences

Introduction

(miR-shRNA) that allow Drosha cleavage and thus formation of a shRNA, which is similar to a pre-miRNA.This special shRNA is dubbed microRNA-adpated shRNA (miR-shRNA). Because nuclear pri-miRNA processing by Drosha results in the formation of an shRNA-like RNA, the same mechanism can be used to generate artificial shRNAs from RNA polymerase II transcripts (Gou et al., 2007; Hinton et al., 2008). Both cleavage products from pri-miRNAs and miR-shRNAs are transported to the cytoplasm and are further processed by Dicer.

Figure 6: Pri-miRNA and miR-shRNA processing. Simplified scheme of pri-miRNA and miR-shRNA processing. Transcription of naturally occurring miRNAs in eukaryotic cells starts in the nucleus with transcription of miRNA templates by RNA-polymerase II or III (POL II/III), resulting in primary micro-RNA (pri-miRNA). RNase-III Drosha and DGCR8 (DiGeorge syndrome critical region) cleave off cap and poly-A tail, leaving the precursor micro-RNA (pre-miRNA), which is actively transported to the cytoplasm by Exportin 5 (EXP5). In the cytoplasm RNase-III Dicer processes the hairpin structure, leaving an siRNA duplex with overlapping 3´ -ends. The siRNA separates into guide and passenger strands, where the guide strand is bound by Argonaut-2 (AGO) and loaded to the RNA induced silencing complex (RISC). Depending on the base pairing of guide siRNA strand and target sequence, RISC can induce mRNA cleavage or translation inhibition. Artificial shRNAs can be transcribed from introduced vectors as miR-shRNAs. These artificial miR-shRNAs contain Drosha cleavage sites for processing to shRNA molecules.

Introduction

2.8.2. Cytoplasmically replicating RNA viruses as vectors for shRNA synthesis

Although shRNAs have been expressed by a number of virus vectors, the expression of shRNA by negative strand RNA viruses, such as RABV, has been considered impossible for a long time. Since RABV replicates in the cytoplasm, 5’-capped and polyadenylated shRNA transcripts will be released in the cytoplasm and cannot be processed by nuclear RNase III Drosha into functional siRNA. However, functional miRNAs have been synthesized from cytoplasmic replicating RNA viruses such as Sindbis virus (SINV), Tickborne encephalitis virus (TBEV) or VSV (Langlois et al., 2012; Rouha et al., 2010; Shapiro, 2013). After SINV virus infection, Drosha was re-distributed, from nucleus to cytoplasm, independent of virus derived miRNA expression (Shapiro, 2013). This indicates that SINV virus induces Drosha translocation in a rather unspecific manner, maybe in the course of host cell inhibition and virus dependent cell death induction. Similarly, inhibition of nuclear protein import by VSV (Her et al., 1997; Petersen et al., 2000) could lead to cytoplasmic accumulation of newly synthesized Drosha nuclease and the processing of VSV expressed miRNAs as observed after expression of miRNA-124 from VSV vectors (Langlois et al., 2012). By comparison, RABV is less cytopathic and it is still unclear whether similar approaches are feasible using an RABV vector. However, the expression of functional shRNAs by RABV vectors would allow for the investigation of the host cell response to RABV infection.

Aims of the study

3. Aims of the study

Although it is well known that cell culture or animal model adaptation leads to fixed or even highly attenuated RABV, the involved mechanisms in virus adaptation are largely unknown. Moreover it is unknown, whether this adaptation directly correlates with alterations in virulence. In many cases the passage history of those laboratory-adapted strains is not well documented. Therefore, direct comparison with original virus isolates do not allow correlation of individual mutations with phenotypic changes. With the availability of recently developed reverse genetics systems for field RABV isolates (Nolden et al., 2016), this work was focused on the use of these genetically characterized virus clones to identify cell culture adaptive mutations. Serial virus passages on different cell lines and subsequent genetic analysis by deep sequencing and phenotypic characterization of virus mutants were intended to identify mutations that increase RABV replication and to investigate major bottlenecks of field RABV replication in cell culture systems. Since RABV is a highly neurotropic virus and anterograde intra-neuronal G dependent virus spread may contribute to RABV infection in vivo, it was also investigated whether lyssaviruses differ in their ability to enter axons in an anterograde direction after replication. Chimeric viruses with G protein ecto-domains of various bat and RABV lyssaviruses were used to assess whether the ecto-domains influence axonal transport in a virus specific manner. Additional field virus clones were used to assess whether anterograde particle transport in axons also occurs after neuronal infection with field RABVs. In a third part, the feasibility of shRNA-expressing RABV as suitable research tools for targeted host manipulation in virus-infected cells was explored. Since RABV is a non- cytopathic, cytoplasmatic replicating virus, the question was whether RABV expressed miR- shRNAs indeed can be processed to functional siRNAs. The possibility of functional shRNA expression from RABV vectors would be a convenient approach to study host cell factors in RABV infections, even in complex in vitro and in vivo infection models.

Material

4. Material 4.1. Technical equipment

The use of technical equipment, brands and adjustments, are indicated in the methods section for the respective methods (paragraph 5).

4.2. Chemicals

If not indicated differently, chemicals were purchased from Carl Roth (e.g. NaCl), Thermo Scientific (e.g. DNA-ladder (4.5)), Gibco (e.g. medium for neuronal cell culture (4.8)) or Qiagen (e.g. DNA extraction kits (4.6)).

4.3. Antibiotics

If not supplied as liquid, antibiotics were dissolved in Milli-Q-H2O to prepare a stock solution and further diluted in respective the medium to a final concentration as shown in table 2.

Table 2: Dilution of antibiotics used in cell and bacterial culture.

antibiotic final concentration Ampicillin 100 µg/mL Penicillin/ Streptomycin 10 mL/L Geneticin (G418) 200 µg/mL Hygromycin B 60 µg/mL

Material

4.4. Standard buffers

If not indicated differently, the following standard buffers were used. All other buffers are described together with respective methods. If not indicated differently, stock solutions were prepared in ultrapure milli-Q-H2O.

PBS: 140 mM NaCl; 2.7 mM KCl; 10 mM Na2HPO4 × 2H2O; 1.8 mM

KH2PO4; pH = 7.4; H20 PBS-T: 1 × PBS; 0.05% (v/v) Tween-20 PFA (3%): 1 × PBS; 3% (w/v) paraformaldehyde

LB-Medium (1 L): 5 g yeast extract; 10 g casein; 5 g NaCl; 0.25 g MgSO4; ad

1000 ml H2O LB-agar: LB-medium; 1 % bacterial grade agar lysis buffer

(nuclease treatment): 10mM NaCl; 10 mM Tris (pH = 7.5); 1.5 mM MgCl2; 1% (v/v) Triton-X-100 reaction buffer

(nuclease treatment): 10 mM Tris (pH = 7.5); 1 mM CaCl2 Flexi I: 100 mM Tris-HCl (pH = 7.5); 10 mM EDTA (pH = 8.0); 100 μg/ml RNase A Flexi II: 200 mM NaOH; 1% (w/v) SDS

Flexi III: 3M NaAcetat (pH = 5.75)

TAE-buffer (50×): 2 M Tris; 500 mM Na2EDTA (pH = 8); 1 M acidic acid; H2O loading dye (10×): 0.25% (w/v) bromide phenyl blue; 0.25% (w/v) Xylenzanol;

30% (w/v) glycerin; H2O agarose gel (0.7 – 1.5%): 0.7 – 1.5% (w/v) agarose; 0.001% (v/v) ethidium bromide

(10 mg/ml in ddH2O) in 1 × TAE buffer protein-lysis-mix: 62.5 mM Tris-HCl (pH = 6.8); 8% (w/v) SDS; 40% (v/v) glycerine; 6M urea; 0.01 % (w/v) bromide phenyl blue; 0.01% (w/v) phenol red; 5% (v/v) β-mercaptoethanol

Material resolving gel 15 %: 15% (w/v) acrylamide/bis-acrylamide; 1.5 M tris-HCl (pH = 8.8); 1% (w/v) SDS; 1% (w/v) ammoniumperoxysulfate; 0.04% (v/v) TEMED stacking gel: 5% (w/v) acrylamide/bis-acrylamide; 1 M tris-HCl (pH = 6.8); 1% (w/v) SDS; 1% (w/v) ammoniumperoxysulfate; 0.04% (v/v) TEMED SDS-PAGE buffer: 25mM Tris; 200mM glycine; 0.05% (w/v) SDS transfer buffer : 25mM Tris; 150 mM glycine; 10% (v/v) methanol; adjust to pH = 8.3 wash buffer: 1×PBS; 0.05% (v/v) Tween

4.5. Marker

Prestained PageRuler Protein Ladder (Fermentas) and Quick-Load 1 kb DNA Ladder (New England Biolabs) were used for assessment of protein weight and nucleic acid sizes, respectively, in western blot analysis and gel electrophoresis (5.4.2 and 5.3.12).

4.6. Kits

Commercially available kits were acquired from Thermo Scientific (BigDye Terminator v1.1 Cycle Seq. Kit, Super Signal West Femto Chemiluminescent Kit), Qiagen (QIAfilter Midi/Maxi Kit, RNeasy Kit, QIAquick Nucleotide Removal Kit, Mammalian Transfection Kit (Agilent), QIAquick Gel Extraction Kit), and Bio-Rad (Clarity™ Western ECL Substrate Kit).

4.7. Cell lines

All used cell lines were supplied from the Collection of Cell Lines in Veterinary Medicine (CCLV) of the Friedrich-Loeffler-Institute (Isle of Riems).

Material

HEK293T: Human embryonic kidney cell line stably expressing the large T-antigen of Simian Virus 40 (Dubridge et al., 1987).

BHK (clone BSR T7/5): Sub-clone derived from BHK-21 clone BSR-CL13 (CCLV-RIE 582) originating from gold hamster (Mesocricetus auratus). The cells stably express T7 RNA polymerase from T7 bacteriophage and are resistant to Geneticin (Buchholz et al., 1999).

NA 42/13: Murine neuroblastoma cell line (Mus musculus).

NIH 3T3: Murine embryonic fibroblast cell line (Mus musculus) (Todaro and Green, 1963).

MDCK – II: Canine kidney epithelial cell line (Canis lupus). Subclone derived from the heterogeneous parental cell line – MDCK, (Madin and Darby, 1958).

MgON (MG136): Sub-clone derived from BHK-21 clone BSR-CL13 originating from gold hamster (CCLV-RIE 582) (Mesocricetus auratus). This cell line constitutively expresses a reverse-TET repressor (selection via Geneticin (4.3)) and expresses matrix and glycoprotein of RABV SAD B19 controlled by a TET-promoter (selection via hygromycin B (4.3)) (Finke et al., 2003). MgON cells were used for the production of G-deleted RABV stocks (5.5.1).

4.8. Cell culture media

Cell culture medium and trypsin (designated as ATV, Alsever’s Trypsin-Versene) for standard cell-lines were supplied by the Collection of Cell Lines in Veterinary Medicine (CCLV) of the Friedrich-Loeffler-Institute (Isle of Riems). Medium for the preparation and cultivation of primary cells was purchased from Thermo Scientific.

Material

Table 3: Composition of cell culture reagents. MEM: Minimal Essential Medium; DMEM: Dulbecco’s Modified Eagle Medium; RMPI: cell culture medium (developed at the Roswell Park Memorial Institute), FCS: fetal calf serum; NCS: newborn calf serum name base medium serum supplements antibiotics

ATV 145 mM NaCl, 5 mM KCl, 6 mM

dextrose, 7 mM NaHCO3, 21 mM trypsin 1:250, 0.7 mM EDTA,

H2O; pH = 7.2 ATV-D 290 mM NaCl, 10 mM KCl, 12 mM dextrose, 14 mM NaHCO3, 42 mM trypsin 1: 500, 1.4 mM

EDTA, H2O; pH = 7.2

Zb 5 MEM Hanks, MEM Earle 10% FCS non-essential amino acids, 1% pen/strep

NaHCO3, natriumpyruvate

Zb 5 N MEM Hanks 10% NCS non-essential amino acids, 1% pen/strep

NaHCO3, natriumpyruvate

Zb 9 d DMEM Earle 1 g/L glucose

Zb 23 aN DMEM Glasgow 10% NCS 2 mL/L essential aa, yeast extract 1% pen/strep

RPMI 1640 20% FCS glutamax 1% pen/strep

Neuro-B Neurobasal 2% B27, 1% glutamax (200 mM), 1% pen/strep 25 ng/mL NGF

Neuro-A Neurobasal - A 1% B27, 1% Glutamax (200 mM) 1% pen/strep

0.2% gentamycin

HBSS Hanks balanced salt solution

F-12 Ham's F-12 nutrient mixture

Material

4.9. Bacteria

Escherichia coli (E. coli) XL1 blue: Commercially available E. coli strain (Stratagene). Genotype: recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F´ proAB lacIqZ∆M15 Tn10 (Tetr)].

4.10. Viruses

Recombinant rabies lyssaviruses (rRABV) were generated via a reverse genetic approach from full-length cDNA (cf.table 5). rRABV SAD corresponds to the recombinant virus of the vaccine strain SAD L16 (Schnell et al., 1994). All rRABVs were provided by PD Dr. Stefan Finke (FLI, Isle of Riems) or generated in the context of this study and listed in table 4.

Table 4: Viruses used in this study. If not indicated differently, all viruses were provided by PD Dr. Stefan Finke (FLI, Isle of Riems). * Viruses rescued during the course of this study.

Virus Remark rRABV-DogA 14 recombinant RABV originating from Dog Azerbaijan (Nolden et al., 2016) rRABV Dog B-(1 – 10)* recombinant RABV originating from DogA 14, passaged 5 times on NA and 1 to 10 times (1 – 10) on BHK

rRABV Dog M-(1 – 10)* recombinant RABV originating from DogA 14, passaged 5 times on NA and 1 to 10 times (1 – 10) on MDCK

rRABV Dog N-(1 – 10)* recombinant RABV originating from DogA 14, passaged 5 to 15 (1 – 10) times on NA

rRABV-Fox 9 recombinant RABV originating from Fox (Nolden et al., 2016)

rRABV Fox B-(1 – 10)* recombinant RABV originating from Fox 9, passaged 5 times on NA and 1 to 10 times (1 – 10) on BHK

rRABV Fox M-(1 – 10)* recombinant RABV originating from Fox 9, passaged 5 times on NA and 1 to 10 time(s) on MDCK

rRABV Fox N-(1 – 10)* recombinant RABV originating from Fox 9, passaged 5 times on NA

rRABV SAD L16 ΔG GFP recombinant G protein deficient RABV, expressing GFP reporter

rRABV SAD L16 recombinant RABV derived from the vaccine virus (SAD B19) derived full length cDNA clone pSAD L16 (Conzelmann et al., 1990b)

Material

Virus Remark rRABV SAD L16 GFP recombinant RABV expressing green fluorescent protein

rRABV SAD L16 shANP* recombinant RABV expressing shRNA against (human) ANP32B

rRABV SAD L16 shANP GFP recombinant RABV expressing shRNA against (human) ANP32B and green fluorescent protein

rRABV SAD L16 shDYNLL* recombinant RABV expressing shRNA against (murine) DYNLL1

rRABV SAD L16 shDYNLL GFP recombinant RABV expressing shRNA against (murine) DYNLL1 and green fluorescent protein

rRABV SAD GFP L16-ecto* recombinant RABV expressing the G ecto- and TM-domain of RABV L16 and green fluorescent protein

rRABV SAD GFP CVS-ecto* recombinant RABV expressing the G ecto- and TM-domain of RABV CVS and green fluorescent protein

rRABV SAD GFP DUVV-ecto recombinant RABV expressing the G ecto- and TM-domain of DUVV and green fluorescent protein

rRABV SAD GFP EBLV-ecto* recombinant RABV expressing the G ecto- and TM-domain of EBLV-I and green fluorescent protein

rRABV SAD GFP Vampbat-ecto* recombinant RABV expressing the G ecto- and TM-domain of RABV Vampbat and green fluorescent protein

4.11. Plasmids

Sequences coding for different viral and cellular proteins or full-length virus cDNA sequences were cloned into following vectors: pCAGGS: eukaryotic expression vector with chicken-β-actin promotor and hCMV immediate early enhancer sequence. Resistance: Ampicillin (Niwa et al., 1991). pHaHdmin: pHaHdmin minimal vector for cloning of full length RABV cDNA sequences by linear-to-linear homologous recombination (Nolden et al., 2016). The plasmid consists of CMV and T7 promotor, a synthetic RABV specific ribozyme and RABV minigenome cDNA sequences

Material

followed a Hepatitis δ ribozyme (Hd) and a T7 termination/polyadenylation site. Resistance: Ampicillin. pCMV-SADL16: full-length RABV cDNA vector with nucleotide sequence of recombinant Street Alabama Dufferin (SAD) B19. The plasmid consists of CMV and T7 promotors and T7 termination. Resistance: ampicillin (Finke et al., 2010).

Table 5: Additional plasmids (with laboratory number). *plasmids generated in the course of this study name reference pCAGGS (Niwa et al., 1991) pCAGGS-N K13 (Finke et al., 2010) pCAGGS-L K2 (Finke et al., 2010) pCAGGS-P K14 (Finke et al., 2010) pCMVL16StrepGFPHis K1 unpublished pCMV SAD L16 EKTO CVSG K1 (Genz et al., 2012) pCMV SAD L16 EKTO EBLV-1G K1 (Genz et al., 2012) pCAGGS DogAs. G K1 unpublished pCAGGS DogAs. G K2 unpublished pCMV SAD DUV-G ecto K49 unpublished pCMV SAD VampBat-G ecto K3 unpublished V3LHS 353558 (shANP) purchased from Dharmacon pCMV SAD strep GFP His ANP sh RNA K6 unpublished V2LMM_37425 (shDYNLL) purchased from Dharmacon pSADGFP sh DLC1-844 K15 unpublished pCMV SAD strepGFPhis DUV G ecto K1* unpublihed pCMV SAD strepGFPhis EBLV1 G ecto K1* unpublished pCMV SAD strepGFPhis CVS G ecto K1* unpublished pCMV SAD strepGFPhis L16 G K1* unpublished pCMV SAD strepGFPhis VampBat G ecto K3* unpublished pCMV SAD DLC shRNA 844 K2* unpublished pCMV SAD ANP shRNA 767 K1* unpublished pCMVHaHd DogA K14 (Nolden et al., 2016) pCMVHaHd Fuchs West K9 (Nolden et al., 2016) pCAGGS DogA G K14 (10.Passage BHK) K3* unpublished pCAGGS DogA G K14 (10.Passage BHK) K5* unpublished pCAGGS DogA G K14 (10.Passage BHK) K7* unpublished pCAGGS DogA G K14 (10.Passage BHK) K10* unpublished pCAGGS DogA G K14 (10.Passage BHK) K11* unpublished pCAGGS DogA G444 K2* unpublished

Material name reference pCAGGS DogA G444 K5* unpublished pCAGGS DogA G266 K10* unpublished pCAGGS DogA G266 K6* unpublished pCAGGS Dog A G 266/444 K8* unpublished pCAGGS Dog A G 266/444 K13* unpublished pCAGGS DogA G 266/419 K5* unpublished pCAGGS DogA G 266/419 K7* unpublished pCAGGS DogA G 266/419/444 K1* unpublished pCAGGS DogA G 266/419/444 K8* unpublished pCAGGS DogA G 419 K1* unpublished pCAGGS DogA G 419 K6* unpublished pCAGGS DogA G 419/444 K3* unpublished pCAGGS DogA G 419/444 K9* unpublished

4.12. Enzymes

All type II restriction endonucleases and corresponding reaction buffers were purchased from New England Biolabs and Thermo Scientific. Restriction enzymes used in this study are summarized in the following table:

Table 6: Used restriction enzymes. restriction enzyme recognition site 5´∙∙∙∙G^AATTC∙∙∙∙3´ EcoRI 3´∙∙∙∙CTTAA^G∙∙∙∙3´ 5´∙∙∙∙GC^GGCCGC∙∙∙∙3´ NotI 3´∙∙∙∙CGCCGG^CG∙∙∙∙3´ 5´∙∙∙∙T^CCGGA ∙∙∙∙3´ Bsp13I 3´∙∙∙∙AGGCC^T∙∙∙∙3´ 5´∙∙∙∙G^GATCC∙∙∙∙3´ BamHI 3´∙∙∙∙CCTAG^G∙∙∙∙3´ 5´∙∙∙∙RG^GWCCY∙∙∙∙3´ PpuMI 3´∙∙∙∙YCCWG^GR∙∙∙∙3´ 5´∙∙∙∙C^TCGAG∙∙∙∙3´ XhoI 3´∙∙∙∙GAGCT^C∙∙∙∙3´ 5´∙∙∙∙G^CTAGC∙∙∙∙3´ NheI 3´∙∙∙∙CGATC^G∙∙∙∙3´

Material

Additional enzymes were obtained from Thermo Scientific (Platinum™ Pfx DNA Polymerase, RevertAid™ Premium Reverse Transcriptase, T4 DNA Ligase), New England Biolabs (Phusion ® Hot Start Flex DNA Polymerase), Promega (GoTaq® G2 Flexi DNA Polymerase), DNase I (Thermo Fisher Scientific) and micrococcal nuclease (New England Biolabs)

4.13. Oligonucleotides

Oligonucleotides for PCR amplification and Sanger sequencing (4.16) were purchased from

Eurofins Genomics. Oligo (dT)12-18 primer were purchased from Thermo Scientific.

Table 7: List of oligonucleotides. Recognition sites for restriction endonucleases are underlined. name sequence (5’  3’)

Lstart revSeq GAGATTGTAGTCAGAGTTCC

L16 pseudogene seq forw TTGGGCACAGACAAAGGTC

L16G425b forw TGACTACCGCTGGCTTCG

DogA_PM_seq TTTAGCTCATGACGGATCC dogA_MG border_seq GAAGAGGACAAAGACTCC dogAseq1 GGGGCGGTCTCGAATATC dogAseq2 ATGGAACTGACAAGGGAC dogAseq3 TTGGATGCTATATGGGTC dogAseq4 TCTTGAGATGGCTGAAGA dogAseq5 CGCTCACCAGATTGCGGA dogAseq6 CCCAAATGGTTACTCGTT dogAseq7 ACCTTTACATTTTGAGCC dogAseq8 CCTTCACTCGAGGGTCTTC dogAseq9 GAATGAGATCATTCCCTC dogAseq10 CCTGAAGATCACCTTCCC dogAseq11 CCCCACTGTTCCTAACAT dogAseq12 CGGGAAGGACTTGGTCAA dogAseq13 AAAGTGATAGATAAGTCC

Material name sequence (5’  3’) dogAseq14 CTTGCCACTTTTTGACGC dogAseq15 TCAATATACCGAGCCATC dogAseq16 AGACCTTGGAGAGAGAAC dogAseq17 CTGCACTTGTGGAGCAAC dogAseq18 GCAACAGGTGTGTAAGGC dogAseq19 CGATCTTGTGTTATCTCC dogAseq20 AGCCCATCCTAGATGATC dogAseq21 ATCTCCGATTCTCCAAAC dogAseq22 CTAGCTTCGCAAGACTTC

Pseudo_Mid_fw TGTTTGAATGAGGCTTCAGT

Pseudo_Mid_rev TAGGTCAGAAGGCGGCTTTAA rDogK14 K444N Bsp13I TGTTGAGGTTCACCTTCCGGATGTGCACAATCAGGTCTCAG SM fw rDogK14 444 SM rev AGGTGAACCTCAACAAAATCCTCAG rDogA K14 A419T BamHI CTGATGCACCCCCTGACGGATCCGTCCACAGTT SM fw rDogA K14 419 SM rev CAGGGGGTGCATCAGGGGAATAACT

G1_A_IX44_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATTGGTGGAAA GTGCTCAGGAA

G1_A_IX44_rev CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATCCAACTGAT CAGGAGGGCA

G1_A_IX45_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATTGGTGGAAA GTGCTCAGGAA

G1_A_IX45_rev CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATCCAACTGAT CAGGAGGGCA

G1_A_trP1_fw CCTCTCTATGGGCAGTCGGTGATTGGTGGAAAGTGCTCAGGAA

G1_A_trP1_rev CCTCTCTATGGGCAGTCGGTGATCCAACTGATCAGGAGGGCA

G2_A_IX44_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATCCCTCCTCC AGCAACATATG

G2_A_IX44_rev CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATACCAGCCTT CACAGTCTAGT

G2_A_IX45_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATCCCTCCTCC AGCAACATATG

G2_A_IX45_rev CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATACCAGCCTT

Material name sequence (5’  3’) CACAGTCTAGT

G2_A_trP1_fw CCTCTCTATGGGCAGTCGGTGATCCCTCCTCCAGCAACATATG

G2_A_trP1_rev CCTCTCTATGGGCAGTCGGTGATACCAGCCTTCACAGTCTAGT

N_A_IX44_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATGAAGAATGT TCGAGCCAGGG

N_A_IX44_rev CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATAGTCCTCAT CGTCAGAGTTGA

N_A_IX45_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATGAAGAATGT TCGAGCCAGGG

N_A_IX45_rev CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATAGTCCTCAT CGTCAGAGTTGA

N_A_trP1_fw CCTCTCTATGGGCAGTCGGTGATGAAGAATGTTCGAGCCAGGG

N_A_trP1_rev CCTCTCTATGGGCAGTCGGTGATAGTCCTCATCGTCAGAGTTGA

Illumina_PM_P5_fw CTTTCCCTACACGACGCTCTTCCGATCTGGCCAATTCCAAGAAATTCCA

Illumina_PM_P7_fw GGAGTTCAGACGTGTGCTCTTCCGATCGGAAGCCACAGGTCATCGT

GIPZ IRES fw TATCTACTCGAGCTAGCGGCCGCATATGTTATTTTCCACCATATTGC

GIPZ Puro rv CGATAGAGATCTTCAGGCACCGGGCTTGCGGGTC

DYNLL1 mouse fw ATGTGCGACCGGAAGGCGGTGAT

DYNLL1 mouse rev TTAACCAGATTTGAACAGAAG

Delta GFP NotI rev ATCTGAGCGGCCGCTTGTAGGGCTAGCCAGATCC

GAPDH fw h/m GGAGCCAAAAGGGTCATCATCTC

GAPDH rev h/m GACCTTGCCCACAGCCTTGGC

ANP32B mur/hum fw CACCTGGAGCTGAGGAACCGGAC

ANP32B mur/hum rev GTCAGGTGCTTCCTGGTCCTCTCG

DYNLL 1 human fw ATGTGCGACCGAAAGGCCGTGAT

G1_A_IX44_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATTGGTGGAAA GTGCTCAGGAA

G1_A_IX44_rv CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATCCAACTGAT CAGGAGGGCA

G1_A_IX45_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATTGGTGGAAA GTGCTCAGGAA

G1_A_IX45_rv CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATCCAACTGAT CAGGAGGGCA

Material name sequence (5’  3’) G1_trP1_fw CCTCTCTATGGGCAGTCGGTGATTGGTGGAAAGTGCTCAGGAA

G1_trP1_rv CCTCTCTATGGGCAGTCGGTGATCCAACTGATCAGGAGGGCA

G2_A_IX44_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATCCCTCCTCC AGCAACATATG

G2_A_IX44_rv CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATACCAGCCTT CACAGTCTAGT

G2_A_IX45_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATCCCTCCTCC AGCAACATATG

G2_A_IX45_rv CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATACCAGCCTT CACAGTCTAGT

G2_trP1_fw CCTCTCTATGGGCAGTCGGTGATCCCTCCTCCAGCAACATATG

G2_trP1_rv CCTCTCTATGGGCAGTCGGTGATACCAGCCTTCACAGTCTAGT

N_A_IX44_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATGAAGAATGT TCGAGCCAGGG

N_A_IX44_rv CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGATAGTCCTCAT CGTCAGAGTTGA

N_A_IX45_fw CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATGAAGAATGT TCGAGCCAGGG

N_A_IX45_rv CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGATAGTCCTCAT CGTCAGAGTTGA

N_trP1_fw CCTCTCTATGGGCAGTCGGTGATGAAGAATGTTCGAGCCAGGG

N_trP1_rv CCTCTCTATGGGCAGTCGGTGATAGTCCTCATCGTCAGAGTTGA

Illumina_PM_P5_fw CTTTCCCTACACGACGCTCTTCCGATCTGGCCAATTCCAAGAAATTCCA

Illumina_PM_P7_rv GGAGTTCAGACGTGTGCTCTTCCGATCGGAAGCCACAGGTCATCGT

4.14. Serologic reagents

All antibodies and fluorescent markers used for western blot analysis (5.4.3) and indirect immunofluorescence (5.4.4) were diluted in PBS. WB = western blot, iIF = indirect immunofluorescence.

Material

4.14.1. Primary antibodies

Table 8: Primary antibodies used for indirect immunofluorescence (iIF) and western blot analysis (WB). host species and antibody dilution iIF dilution WB purchased from (reference) origin

α-N 161-5 rabbit, polyclonal 1:3,000 1:100,000 (Orbanz and Finke, 2010) α-G E559 mouse, monoclonal 1:20 - (Muller et al., 2009) α-Calnexin rabbit, polyclonal 1:500 - Thermo Scientific α-ANP32B rabbit, polyclonal - 1:2,500 Proteintech α-DYNLL1 [EP1660Y] rabbit, monoclonal 1:250 1:5,000 Abcam α-β-Tubulin (H 235) rabbit, polyclonal - 1:1,000 Santa Cruz Biotechnologies α-DYNLL 1/2 rabbit, polyclonal - 1:1,000 Santa Cruz Biotechnologies

4.14.2. Secondary antibodies

Table 9: Secondary antibodies used for indirect immunofluorescence (iIF) and western blot analysis (WB). host species antibody and origin dilution iIF dilution WB purchased from

IgG α-Cy5 rabbit 1:1,000 - Dianova IgG α -POD rabbit - 1:50,000 Dianova α-mouse IgG Alexa Fluor 488 donkey 1:1,000 - Thermo Scientific α-rabbit IgG Alexa Fluor 568 goat 1:1,000 - Thermo Scientific

4.14.3. Fluorescent dyes

Hoechst 33342: bis-benzimid H 33342 trihydrochlorid trihydrat (Thermo Fisher Scientific), stock solution in H2O: 10 mg/mL; working dilution for iIF: 1:20,000 in PBS

Material

4.15. Software

Geneious Version 9, http://www.geneious.com Image J Version 1.51, http://imagej.nih.gov/ij/ Leica LAS AF Version 2.7.2 Quantity One 1-D Version 4.6 Endnote Version X7.1 (Build 7705) Prism Version 7 Corel Draw Version 2017 Microsoft Office Excel, Word (Version 2016)

4.16. Sequencing technologies

Different sequencing technologies were used, including Sanger, IonTorrent PMG (Life Technologies) and MiSeq (Illumina).

Sanger: Sanger sequencing was performed for all routine DNA sequencing applications. The DNA fragments are analyzed using the chain termination method (see 5.3.14).

NGS can be used to identify and quantify rare transcripts without prior knowledge of a particular gene. Whole genomes can be sequenced and compared to allow large scale comparative studies (summarized in (Metzker, 2010)). All NGS work for this study was performed by the NGS Laboratory of the Friedrich-Loeffler-Institute (FLI, Institute of Diagnostic Virology, Isle of Riems).

IonTorrent: A semi-conductor chip on a solid membrane is used to detect the release of protons (H+) during sequencing, measuring the change in voltage and assigning it to the respective nucleotides. Here, this technology was used to sequence complete RABV genomes

Methods

MiSeq: The principle of this technology is sequencing by synthesis. Each fragmented DNA is isothermally amplified in a solid membrane (flow cell) with fluorescently-labeled nucleotides being added to the growing chain. This NGS method supports sequencing of templates from both ends (i.e. paired-end sequencing) and was therefore used to sequence the non-coding regions of RABV, which contain homo-polymeric sequences.

5. Methods 5.1. Eukaryotic cell culture 5.1.1. Cell cultivation

Cell cultures were kept in the respective medium (table 3) and passaged every 3 – 4 days. For passaging, medium was removed and cells were washed once with trypsin solution (cf. table 3, paragraph 4.8). Subsequently, cells were detached with either trypsin (ATV) or double- concentrated trypsin (ATV-D), depending on cell line (ref table 10). To inactivate the trypsin reaction and to dilute the cells, the respective serum containing culture medium was added.

The cells were cultivated at 37 °C and 5% CO2 in a humidified atmosphere in T25 or T75 flasks in a volumes of 7 mL or 15 mL, respectively.

Table 10: Culture medium required for each cell line (for composition see table 3, paragraph 4.8). cell line medium dilution remarks

BHK Zb 23 aN 1:7 addition of G418 (diluted: 200 µg/mL) ervery second passage (BSR T7/5) HEK293T Zb 5 1:3 MDCK-II Zb 5 1:7 detachment with ATV-D MgON Zb 23 1:4 addition of G418 (diluted: 200 µg/mL, Thermo Scientific) and Hygromycin B (diluted: 60 µg/mL) every second passage NA 42/13 Zb 5 1:5 NIH 3T3 Zb 5 N 1:7

Methods

5.1.2. Transfection of mammalian cell lines

For transfection of eukaryotic cell lines polyethylenimin (PEI) was used. PEI is an organic, highly branched polymer with high cationic charge-density-potential. Because of to its positive charge it forms complexes with negatively charged DNA, which are absorbed via endocytosis (Boussif et al., 1995). Cells were seeded to 6-well plates and cultivated to 80% confluence. Prior to transfection, cell culture medium was replaced by serum free medium (ZB 9d, paragraph 4.8) and cells were incubated for 1 h. For the DNA-PEI transfection mix, 6 µg DNA and 9 µg PEI transfection reagent (1 µg/µl in H2O, Sigma Aldrich) were separately added to 400 µL serum free medium (ZB 9d). After 5 min incubation at RT, both solutions were combined and incubated at RT for 20 min. A total of 800 µL transfection mix was added dropwise to the cells, which were incubated at 37 °C and 5% CO2. After 3 hrs, transfection medium was replaced with the respective cell culture medium (table 10). For transfection in T25 flasks, the required amount of reagents was scaled proportionally to the culture surface.

5.1.3. Complementation assay

In order to investigate the ability of different RABV proteins to support virus release, G- deleted RABV was complemented in-trans with plasmid derived G variants. 1×106 BHK (clone BSR T7/5) cells were infected with rRABV SAD L16 ΔG-GFP at an MOI (multiplicity of infection) of 2. Infected cells were detached, dissolved in ZB 23aN, transferred to a 6-well plate and grown to 80% confluence. One day post infection, cells were transfected with 6 µg RABV G-encoding plasmids (5.1.2). Two days post transfection cell culture supernatant was collected and cell debris was removed by centrifugation at 1,500×g for 5 min. Supernatant was transferred to a fresh tube and the virus titer was determined by end point dilution (5.5.3).

Methods

5.2. Preparation of primary neuronal cells 5.2.1. Preparation and cultivation of hippocampal neurons from neonatal rats

One-day-old Sprague Dawley rats were decapitated and the brain was extracted. Cerebellum and hypothalamus were removed and the hemispheres were separated. The midbrain of each hemisphere was removed, hippocampi were separated from surrounding tissue, mechanically crushed and transferred to a 15 mL tube containing 10 mL ice-cold HBSS (cf. table 3, paragraph 4.8). Hippocampal neurons were pelleted at 200 × g for 2 min and supernatant was discarded. To dissolve tissue, 700 µL of 0.25% Trypsin/EDTA (Gibco) and 300 µL DNaseI (200 U/ml; AppliChem) were added and incubated at 37 °C for 30 min. Trypsin reaction was blocked by addition of serum containing medium (cf. table 3, paragraph 4.8) and cells were pelleted at 500 × g for 5 min. Supernatant was discarded, cells were resuspended in 1 mL of Neuro-A medium, pooled and dissociated using a rounded glass Pasteur pipette. For seeding, 12-well cell culture dishes were pre-coated with poly-D-lysine for at least 30 min (0.1 mg/mL, Sigma Aldrich, diluted in H2Odd), washed three times with H2Odd and air dried. Cells were cultivated at 37 °C, 5% CO2 in a humidified atmosphere. Half of the culture medium was changed every second day.

5.2.2. Preparation and cultivation of dorsal root ganglions from embryonic rats

Dorsal root ganglions (DRG) were extracted from embryonic Sprague Dawley rats (embryonic day 16; E16). The uteri of pregnant rats were separated, embryos were extracted and transferred to HBSS medium. The embryos were decapited and the body was fixed on ventral side. The spinal cord was exposed by removing skin and surrounding tissues. DRGs were extracted, collected in ice-cold HBSS (cf. table 3, paragraph 4.8) and seeded to respective pre-coated culture plates (table 11). To establish a compartmentalized chambers system (Bauer et al., 2014b), the channels of ibidi µ-Slides VI were filled with approximately 30 µL agarose (0.5% (w/v) in Neuro-B medium) after coating but prior to seeding. After agarose polymerization, both chambers were filled with 70 µL Neuro-B medium, and 2 – 3 DRGs were transferred to one of the two chambers.

Methods

DRGs were treated with 10 µM arabinofuranosyl cytidine (AraC) (Sigma-Aldrich) one day after seeding. Cells were cultivated at 37 °C, 5% CO2 in a humidified atmosphere. Culture medium was exchanged every three days.

Table 11: Preparation of culture dishes for seeding DRGs. culture dish coating remarks

12-well plates 0.1% (w/v) poly-L-lysine (1:100 Incubation o/n at RT; washed diluted in H2O, Sigma Aldrich) and twice with Milli-Q-H2O prior natural mouse laminin (10 µg/mL; to seeding Thermo Scientific) ibidi µ-dishes 0.1% (w/v) poly-L-lysine (1:100 Incubation o/n at RT; washed diluted in H2O, Sigma Aldrich) and twice with Milli-Q-H2O prior natural mouse laminin (10 µg/mL; to seeding Thermo Scientific) ibidi µ-Slides VI poly-DL-ornithine (500 µg/ml; Thermo Poly-DL-ornithine Scientific), natural mouse laminin (10 incubation for one day, µg/ml; Thermo Scientific) washed with Milli-Q-H2O and dried; incubation with laminin o/n, then washed twice with Milli-Q-H2O and dried; fill channels with 0.5% agarose containing neuro-A- medium prior to seeding

5.3. Working with nucleic acids 5.3.1. Nuclease treatment

Micrococcal nuclease is able to degrade free mRNA, while viral RNA, which is encapsidated by RABV N, is protected. Using this strategy, RABV-derived RNA can be harvested and separated from host cell RNA. Cells were seeded to 12-well pates, infected with RABV at an MOI of 0.01 and incubated for 3 days. Cells were washed, detached using ATV and transferred to a 15 mL tube (total volume of 2 mL). 5 mL Zb 5 (table 5) were added to stop trypsin reaction and cells were

Methods pelleted by centrifugtion at 1,500 × g for 5 min. The pellet was lysed in 100 µL lysis buffer (4.4) and 20 µg micrococcal nuclease (New England Biolabs) in reaction buffer (4.4) was added. After incubation at 30° C for 30 min, viral RNA was isolated (5.3.2) and remaining genomic DNA was removed by DNase I treatment (5.3.2).

5.3.2. RNA extraction with Trifast (Trizol) / Chloroform

To isolate viral and cellular RNA from adherent cells in 12-well plates, medium was removed and 500 µL PeqGOLD TriFast™ reagent (Peqlab) were added to each cavity. Cell lysates were transferred to microcentrifuge tubes and incubated for 5 min at RT. Alternatively, samples were stored at -80 °C. 200 µL chloroform were added to Trizol samples, which were shaken vigorously for 15 sec and incubated for 10 min at RT before centrifugation at 12,000 × g and 4 °C for 5 min. Subsequently, the aqueous phase was transferred to a new reactiontube. 0.5 µL glycogen was added to each sample and mixed with 250 µL isopropanol. RNA was precipitated by centrifugation at 12,000×g and 4 °C for 10 min. Supernatant was discarded and the RNA pellet was washed with 750 µL 75 % EtOH in DEPC-H2O. After centrifugation at 12,000×g and 4 °C for 10 min, the RNA pellet wasa again washed with 750 µL 75 % EtOH in DEPC-H2O. Finally, the RNA was pelleted, the supernatant was removed and the pellet was air-dried before being dissolved in 30 µL DEPC-H2O. Purified RNA was stored at - 20 °C. In order to minimize contamination of RNA samples with genomic DNA, the samples were treated with DNase I (Thermo Scientific). For this purpose, 5 µg RNA were digested according to following scheme: component amount

RNA (5 µg) X µL 10× DNase I buffer 5 µL DNase I 5 µL

H2O up to 50 µL

The reaction mix was incubated at 37 °C for 30 min. After addition of 5 µL 50 mM EDTA, DNase I was inactivated at 65 °C for 10 min.

Methods

5.3.3. Isolation of viral RNA for Deep sequence analysis

Single nucleotide polymorphisms (SNPs) were analyzed with NGS, which allowed high- throughput sequencing of whole lyssavirus genomes within a few days. To identify SNPs in the genome, BHK (clone BSR T7/5), NA 42/13 and MDCK-II cells (1×107 in a T25 flask) were infected with RABV from passage experiments (cf. paragraph

6.2.1). Cells were incubated at 37° C and 5% CO2 in a humidified atmosphere for 3 days. For isolation of viral RNA, cell culture supernatant was diluted 1:4 in PeqGOLD TriFast™ reagent (Peqlab) and RNA was extracted using the RNeasy Kit (Qiagen) according to manufacturer’s protocol (4.6). RNA extraction, quantification, pooling and further preparation of viral RNA was performed by the NGS Laboratory (FLI, Institute of Diagnostic Virology, Isle of Riems). SNP analysis was performed with IonTorrent PMG (Life Technologies) (4.16). Analysis of modifications in non-coding regions was performed with MiSeq (Illumina) (4.16).

5.3.4. Determining RNA and DNA concentration

To assess yield and purity of nucleic acids, absorbance (optical density) was measured using a nanophotometer (IMPLEN). Due to differences of aromatic rings in purine- and pyrimidine bases, RNA and DNA have different absorptions coefficients. To evaluate the purity of the nucleic acid, the quotient of A260/A280 is calculated. To assess protein contamination, pure

DNA or RNA should have an A260/A280 ratio between 1.7 and 2.0. The following equation was used to calculate RNA or DNA concentrations:

C = A260×f×ε×d C concentration

A260 absorbance at λ =260 nm f dilution factor ε absorbance coefficient of pure dsDNA (50 µg/mL) or ssRNA (40 µg/mL) ×cm d layer thickness of cuvette in cm

Methods

5.3.5. Reverse Transcription (RT)-PCR

Reverse Transcriptases are RNA-dependent DNA-polymerases used to synthesize complementary DNA (cDNA) from RNA templates. A standard pre-RT-reaction mix consisted of the following: component amount

RNA (400 – 750 ng) X µL RNasin 0.5 µL dNTPs (25 mM) 0.5 µL

oligo dt (18) 2 µL

H2O up to 15 µL

The Pre-RT mix was incubated at 65 °C for 10 min and then at 45 °C for 10 min. The mix was chilled at 4 °C and completed with RevertAid premium polymerase (100 U) and 4 µl RT- reaction buffer (Thermo Scientific). Following incubation at 50 °C for 30 min, the reaction was terminated by heating the samples to 85 °C. cDNA was stored at 4 °C.

5.3.6. Polymerase chain reaction (PCR)

In order to amplify DNA templates either Platinum Pfx DNA Polymerase (Thermo Scientific) or Phusion Hot Start Flex DNA Polymerase (New England Biolabs) were employed The standard pipetting schemes for both DNA polymerases and respective PCR programs are listed below. Depending on the template, DMSO or MgSO4 were added and annealing/reaction temperatures as well as cycle durations were adjusted.

Methods

Platinum Pfx DNA polymerase: component amount DNA-template 100 ng PCR program (Pfx-polymerase): 10 pmol/μL forward primer 2.5 μl 10 pmol/μL reverse primer 2.5 μl 94 °C, 2 min denaturation 10× Pfx-buffer 5 μl 94 °C, 30 sec DMSO 5 μl annealing 43 °C, 30 sec 30× 50 mM MgSO4 1 μl 68 °C, 1 min/kb 25 mM dNTPs 0.6 μl elongation 68 °C, 10 min 1.25 U Pfx-polymerase 0.5 μl store 4 °C H2O up to 50 μl

Phusion Hot Start Flex DNA polymerase: component amount

DNA-template 100 ng PCR program (Phusion- 10 pmol/μL forward primer 2.5 μl polymerase): 10 pmol/μL reverse primer 2.5 μl denaturation 98 °C, 10 sec 5× HF buffer 10 μl 98 °C, 30 sec DMSO 1.5 μl annealing 55 °C, 30 sec 25× 10 mM dNTPs 1 μl elongation 72 °C, 50 sec/kb Phusion polymerase 0.5 μl 72 °C, 10 min

H2O up to 50 μl store 12 °C

DNA fragments were verified by agarose gel electrophoresis (5.3.12), using 5 µl of PCR product. If the expected fragment was detected, the remaining sample was separated by agarose gel electrophoresis and the desired DNA band was purified using QIAquick Gel Extraction Kit (Qiagen) according to manufacturer’s instructions.

5.3.7. Polymerase chain reaction for comparison of mRNA level

Reverse transcription PCR (RT-PCR) was performed to assess expression level of cellular mRNAs during RABV infection. To this end, virus RNA was extracted from infected cell cultures with PeqGOLD TriFast™ reagent (Peqlab) (5.3.2) and 500 ng of RNA were used for reverse transcription (5.3.5). Specific oligonucleotides (listed in 4.13) against cellular targets were used in a standard amplification PCR using Tag polymerase (Promega).

Methods

PCR-Taq polymerase: component amount

cDNA 50 ng PCR-programm (Taq-polymerase): 10 pmol/μL forward Primer 1 µL 95 °C, 10 sec denaturation 10 pmol/μL reverse Primer 1 µL 95 °C, 30 sec dNTP´s (25 mM) 0.5 µL annealing 55 °C, 1 min Taq green buffer 5 µL 72 °C, 50 sec elongation MgCl2 2.5µL 72 °C, 10 min Taq polymerase 0.5µL store 12 °C H2O up to 25 µL

To be able to determine differences in the qualitative expression levels of cellular mRNA, the number of cycles was adjusted to 23forDYNLL1, 30 for ANP32B and 21 for GAPDH mRNA.

5.3.8. Restriction enzyme digestion

Standard restriction endonuclease reactions differed for plasmid preparations and preparative digestion for molecular cloning. For the verification of plasmid preparations, 1 µg plasmid DNA was used, whereas for preparative digests (e.g. for subsequent ligations) 5 µg DNA was used. A standard restriction endonuclease reaction contained: component amount DNA x µg restriction endonuclease 1 µL ( = 10 U) buffer 1 µL

H2O up to20 µL

After an incubation of 1 – 2 hrs at 37 °C, the restriction endonuclease was heat-inactivated, depending on the enzyme either at 65 °C or at 80 °C for 5 min. Correct restriction was verified by agarose gel electrophoresis (5.3.12).

Methods

5.3.9. Ligation

T4 DNA ligase catalyzes the formation of a phosphodiester bond between the 5´- phosphate and the 3´- hydroxyl ends of DNA fragments. The standard ligation reaction contained th following: component amount vector x µg insert mixed with vector at molar ratio 1:1 ligase buffer 3 µL T4 DNA ligase 1 µL

H2O up to 30 µL

The ligation mixture was incubated at RT for 1 h and was kept o/n at 16 °C. To stop the ligation reaction, the T4 DNA ligase (Thermo Scientific) was heat-inactivated at 65 °C for 10 min. Subsequently, ligation mixture was used for transformation into chemically-competent E. coli (5.3.10).

5.3.10. Transformation of chemically competent bacteria

For amplification of plasmid DNA, 50 µL chemically competent E. coli XL1-Blue (4.9) were incubated on ice with 5 µL ligate or 1 µL purified plasmid DNA for 20 min, followed by an incubation at 42 °C for 2 min. Cells were chilled on ice for 5 min, 200 µL LB++ was added and the sample was incubated at 37 °C for 1 h on an orbital shaker at 750 rpm. For molecular cloning, the sample was plated on ampicillin-containing agar plates and incubated o/n at 37 °C. For plasmid preparations, the cells were added to 50 – 100 mL LB medium containing the respective selective antibiotic and incubated o/n at 37 °C on an orbital at 200 rpm.

5.3.11. Preparation of plasmid DNA

DNA mini preparation from E. coli was performed by alkaline lysis (Birnboim and Doly, 1979). Bacterial colonies on agar plates were transferred to 1.5 mL LB liquid cultures (4.4) and incubated o/n rotating (750 rpm) at 37° C. Bacteria were pelleted by centrifugation at 4,500×g for 2 min. Supernatant was discarded and cells were re-suspended in 200 µL Flexi I

Methods buffer (4.4). 200 µL of Flexi II (4.4) and Flexi III (4.4) buffer were added successively for alkaline lysis and cells were incubated on ice for 60 min. After centrifugation at 14,000×g for 10 min, supernatant was transferred to a new tube, 400 µL isopropanol were added and the sample was incubated for 10 min at RT. The plasmid DNA was sedimented by centrifugation at 14,000×g for 10 min. Supernatant was discarded and the DNA precipitate was washed twice with 70% EtOH. Plasmid DNA was dried at 56 °C for 5 min, dissolved in 50 µL H2O .DNA concentrations were determined by spectrophotometric analysis (5.3.4). To isolate large amounts of plasmid DNA, plasmid-transformed E. coli were grown in 50 or 100 mL LB liquid cultures (4.4). Plasmid DNA preparation was performed with QIAFilter Plasmid-Midi/Maxi-Kits (Qiagen) according to the manufacturer’s instructions

5.3.12. Preparative and analytic agarose gel electrophoresis

Depending on the molecular weight of the DNA molecules different agarose concentrations were used (4.4). For small DNA fragments below 600 bp, 1.5 % agarose was used, whereas for bigger fragments (above 600 bp) 0.7% agarose was used. The respective amount of agarose was dissolved in TAE-buffer (4.4) and ethidium bromide to a final concentration of 0.001% (v/v) was added. Samples were treated with loading dye (4.4) before being loaded onto the agarose gel. To separate the DNA fragments within an electric field, a constant voltage of 120 V was applied for 30 min, while the agarose gel was kept in TAE-buffer (4.4). DNA was detected under UV light (302 nm) because of the intercalating ethidium bromide. For visualization of analytic agarose gels the Molecular Imager® Gel Doc™ XR+ (Bio-Rad) was used, while bands from preparative gels were extracted and purified using the QIAquick Gel Extraktion Kit (QIAGEN) according to manufacturer’s instructions.

5.3.13. Site-directed mutagenesis of full-length RABV c-DNA containing plasmids

By site-directed mutagenesis, mutations were introduced in DNA sequences of genes via a PCR-based approach (adapted from (Braman et al., 1996)). Plasmid DNA was amplified with the Phusion Hot Start Flex DNA Polymerase (New England Biolabs) (5.3.6) and respective overlapping primers, of which one carries the 61

Methods mutation to be introduced (table 12). The methylated template DNA was selectively digested for 2 hrs by adding 2 µl (40 U) of the restriction endonuclease DpnI (4.12). The PCR-product was then transformed in E. coli (5.3.10), plated on LB-agar plates and incubated o/n at 37 °C. Overnight colonies were selected for mini-preparation of plasmid DNA (5.3.11), successful mutagenesis was assessed by restriction endonuclease digestion (5.3.8) and sequence analysis (ref).

Table 12: Primer combinations for longrange mutagenesis of pHaHd Dog A. Respective primer sequences can be found in table 7, paragraph 4.13. product template forward primer reverse primer pHaHd DogA K444N pCMVHaHd DogA K14 rDogK14 K444N Bsp13I rDogK14 444 SM rev SM2 fw pHaHd Dog A pCMVHaHd Dog A G D rDogK14 K444N Bsp13I rDogK14 444 SM rev N266/ N444 266 N K20 SM2 fw pHaHd Dog A pHaHd Dog A N444 K1 rDogA K14 A419T rDogA K14 419 SM rev A419T/ N444 BamHI SM fw pHaHd DogA A419T pCMVHaHd DogA K14 rDogA K14 A419T rDogA K14 419 SM rev BamHI SM fw pHaHd Dog A pCMVHaHd Dog A G D rDogA K14 A419T rDogA K14 419 SM rev N266/ A419 266 N K20 BamHI SM fw pHaHd Dog A N266/ pHaHd Dog A N266 rDogA K14 A419T rDogA K14 419 SM rev A419/ N444 N444 K1 BamHI SM fw

5.3.14. Routine DNA sequencing (Sanger sequencing)

The Sanger sequencing or chain-termination method (4.16) (Sanger et al., 1977) was used in a fluoresence-based cycle sequencing reaction with BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Scientific). Samples were prepared according the following scheme. PCR-reaction mix with Big Dye:

component amount PCR-program (Big Dye):

cDNA (100 ng) X µL denaturation 98°C 10 sec primer (5 pmol) 1 µL annealing 50°C 5 sec 24× DMSO (5%) 0.625 µL elongation 60°C 4 min Big Dye 1.25 µL store 4°C seq buffer 2.5 µL

H2O up to 12.5 µL

The samples were purified using NucleoSEQ® columns (Macherey-Nagel) according to manufacturer’s instructions, 10 µL formamid were added and the sample was analyzed using the Applied Biosystems AB3132 Genetic analyzer. Sequencing results were analyzed using Geneious (4.15). In case of sequences with strong secondary structures (e.g. hair pin structures in shRNA encoding sequences (cf. 6.3)), the protocol was optimized. After successful PCR amplification using the Phusion DNA polymerase (5.3.6) with the respective primer pair for shRNA amplification (“L16 pseudogene seq forw” and “Lstart revSeq“ (cf. table 7, paragraph 4.13), 1.7 kb bands were isolated from agarose gel using QIAquick Gel Extraction Kit (Qiagen) according to manufacturer’s instructions. For sequencing, 30 ng of template and primer pair “Pseudo_Mid_fw” or “Pseudo_Mid_rev” were used.

PCR-reaction with Big Dye, optimized for shRNA sequencing:

initial denaturation 95°C 3 min denaturation 98°C 40 sec

annealing 50°C 5 sec elongation 60°C 4 min denaturation 98°C 10 sec annealing 50°C 5 sec 24× elongation 60°C 4 min store 4°C

5.4. Working with proteins 5.4.1. Preparation of protein samples with protein lysis mix

In order to prepare samples for SDS-PAGE (5.4.2) and subsequent western blot analysis (5.4.3), cell cultures were harvested using protein lysis buffer (4.4). The buffer contained β- mercaptoethanol to disrupt disulfide bridges in proteins and to denature proteins. After cell culture medium was removed, cells were covered with protein lysis mix (4.4) and the sample was transferred to a fresh tube. The samples were heated at 95 °C for 10 min and sonicated with the Branson Sonifier 450 for 20 sec.

Methods

5.4.2. Discontinuous sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS- PAGE)

To separate proteins of different molecular weights in an electric field, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used. The negatively charged SDS disrupts secondary, tertiary and quaternary structure of proteins and masks intrinsic the charge of proteins proportional to their mass. If an electric field is applied, negatively charged poly- peptide chains are separated due to their weight within the gel environment. The resolving gel (4.4) was handcast using casting stands (Bio-Rad) and overlaid with distilled water. The polymerized resolving gel was overlaid with a stacking gel (4.4) of lower acrylamide concentration and a comb was inserted to prepare sample slots. Due to different properties of resolving and stacking gel, proteins concentrate into a narrow band before entering the resolving gel. The fully polymerized gel was transferred to an electrophoresis chamber (Bio-Rad), which was filled with 1×SDS running buffer (4.4). A voltage of 150 V was applied for 1 h. Polyacrylamide gels were subsequently used for western blott analysis (5.4.3).

5.4.3. Semi-dry western blot

In semi-dry western blot, proteins are transferred from an SDS-PAGE gel to a transfer membrane (e.g. nitrocellulose) using an electrical field. To this end, three layers of Whatman paper soaked in transfer buffer (4.4) were stacked on top of the cathode, followed by a nitrocellulose membrane equilibrated in transfer buffer (4.4), the acrylamide gel and three additional layers of Whatman paper. The anode was placed on top of the stack and a voltage of 24 V was applied for 2 hrs. The transferred proteins were detected immunologically. To achieve this, the membrane was blocked in 3% non-fat milk (in PBS) for 30 min. The membrane was incubated with the primary antibody (4.14.1) o/n at RT on a rocking shaker. After incubation, the membrane was washed three times with PBS-Tween (4.4) for 5 min each. A peroxidase-labeled secondary antibody (4.14.2) was added and the blot was incubated for 1 h at RT on a rocking shaker. The membrane was washed three times for 5 min each and chemiluminescence was detected using Lumiol reagents A and B (Clarity™ Western ECL

Methods

Substrate Kit (Bio-Rad)) (4.6) according to manufacturer’s instructions and the Versa Doc™ Imaging System (Bio-Rad).

5.4.4. Indirect immunofluorescence

Antigens can be detected by fluorescence-conjugated antibodies. For indirect immunofluorescence, two antibodies are necessary: the unconjugated primary antibody and a fluorophore-conjugated secondary antibody, which is directed against the primary antibody. For immunofluorescence analysis, cells were cultivated on coverslips or in culture dishes, which are suitable for confocal microscopy (ibidi µ dish), until confluence was reached. The cells were washed once with PBS, fixed with 3% PFA for 30 min and permeabilized with

Triton-X 100 for 20 min. To reduce auto-fluorescence, cells were treated with 50 mM NH4Cl for 10 min. Unspecific binding sites were blocked by treating the cells with 1% non-fat milk (diluted in PBS) for 30 min. Primary antibody was added in respective dilution (cf. 4.14.1) and incubated at RT for at least 2 hrs. After three washing step in PBS, each for 5 min, fluorophore-labeled secondary antibody (4.14.2) was added and incubated for 1 h. Secondary antibody was removed , nuclei were counterstained with Hoechst 33342 (4.14.3) for 15 min and cells were washed twice with PBS. Finally, the samples were mounted on microscopic slides using Kaiser´s glycerin gelatine. High resolution fluorescence images were acquired using the confocal laser-scanning microscope Leica DMI 6000 TCS SP5 with a 63-fold oil immersion objective (numerical aperture: 1.4). The specimen was excited with the respective adsorption wavelength for the fluorophore and detected within the spectrum depicted in table 13. The pinhole diameter was kept constant at 1.0 airy. The optical thickness of slices was 0.772 µm. Z-Stacks were performed in 0.34 µm steps. Maximum z-projections were generated with Image J software (4.15).

Table 13: Absorption and emission spectra of fluorophores used in this study. fluorophore absorption emission maximum detection range Hoechst 33342 405 nm 455 nm 415 - 485 nm Alexa 488 488 nm 520 nm 505 - 555 nm GFP 488 nm 509 nm 505 – 530 nm Alexa 568 561 nm 603 nm 580 - 640 nm

Methods

5.5. Working with viruses 5.5.1. Production of RABV virus stocks

To produce virus stocks, 1×107 BHK cells were seeded to a T75 flask and infected with the respective virus at an MOI of 0.01. Cells were incubated at 37 °C, 5% CO2 for 3 days, when supernatant was harvested and clarified by centrifugation at 1,500×g for 5 min. Aliquots were stored at -80 °C. For the production of G-deleted RABV (rRABV ΔG) virus stocks, 1×107 MgON cells were seeded to a T75 Flask. Doxycycline (5 µg/mL, Sigma Aldrich) was added to induce the production of glycoprotein by the MgON cells. After 72 hrs the supernatant containing G- deficient RABV was harvested and stored at -80°C.

5.5.2. Rescue of recombinant RABV (CaPO4 Method)

Expression plasmids for RABV N, RABV P, RABV L and the full-length RABV cDNA were transfected in BHK (clone BSR T7/5) cells. In combination with the helper plasmids, full- length RABV genome can be both transcribed and replicated, resulting in the release of infectious virions. BHK cells were seeded to 6-well plates and cultivated o/n at 37 °C. The next day cells were washed with serum-free medium (Zb 9d) and incubated in Zb 9d at 37 °C for 1 h. Calcium chloride solution (#1) and phosphate containing solution (#2) from the Agilent transfection kit were thawed on ice. An NPL plasmid mix, containing the three helper plasmids coding for RABV N, P and L, was generated by combining 5 µg, 2.5 µg and 2.5 µg of the plasmids in

50 µl Milli-Q-H2O respectively. 10 µg full-length RABV cDNA were diluted in a total of 40 µL water and combined with the NPL plasmid mix on ice 10 µL of solution #1 was added, mixed and incubated for 5 min, then 100 µL of solution #2 was added, mixed and incubated for 20 sec. After the cells have been incubated for 1 hr, the transfection mix was added and the cells were incubated for another 3.5 hrs after in which the medium was changed to Zb 23aN. After 72 hrs, fresh BHK cells were seeded and infected with supernatant from the transfected cells (1st virus passage). Fresh medium was added to the transfected cells, which were incubated for another 48 hrs.

Methods

Supernatants from transfected cells and the 1st virus passage were harvested and stored at - 80 °C. The cells were fixed with 3% PFA for 25 min, permeabilized with 0.5% Triton-X-100 for 20 min and viral N and G protein were detected via indirect immunofluorescence (5.4.4). When positive immunofluorescence was detected, a T25 flask with cells was infected with the supernatant in order to produce virus stocks (5.5.1).

5.5.3. Virus titration by end-point-dilution

RABV titers were determined by endpoint dilution. To this end, 1×104 cells per well in a total volume of 100 µL of the respective cell culture medium were seeded to a 96-well cell culture plate and infected with serial dilutions (10-1 – 10-7) of virus-containing cell culture supernatant. Dilutions were performed with serum free medium. Cells were incubated at

37 °C and 5% CO2 for 48 hrs. When possible, presence of virus was assessed by detecting fluorescent reporter genes. Else, the supernatant was discarded and cells were fixed and indirect immunofluorescence against RABV N was performed (5.4.4).

Virus titers were calculated in two different ways, either as ffu/mL or as TCID50/mL. The determination of focus forming units per milliliter (ffu/mL) was done in duplicates and the determination in 50% tissue culture infective dose per milliliter (TCID50/mL) was done in quadruplicates. For the calculation of the viral titer in ffu/mL, the number of G or N positive foci was counted to determine virus titers. A focus is defined as at least three cells in close distance, but not more than 50 foci in total should be counted. If possible, the average of at least two wells (duplicates) should be used for the calculation.

To calculate the TCID50, the number and ratio of RABV N-positive wells was plugged into the Spearman-Kärber equation (Hierholzer, 1996):

log10 50% end point dilution = - (x0 - df/2 + df ∑ ri/ni) x0 log10 of the reciprocal of the highest dilution (lowest concentration) at which all wells are positive; df log10 of the dilution factor; ni number of wells used in each individual dilution ri number of positive wells

Methods

5.5.4. Replication kinetics

In order to assess and compare the replication kinetics of different viruses, replication kinetics were generated. To this end, 1×106 cells in a total volume of 8.5 mL were infected with an MOI of 0.01 and incubated at RT on a roller mixer for 2 hrs. Cells were pelleted at 1,500 × g for 5 min and supernatant was discarded. To remove input virus, cells were washed three times with 8 mL cell culture medium. Cells were resuspended in a total volume of 8 mL cell culture medium, seeded to T25 flasks and cultivated at 37 °C and 5% CO2. 500 µL of virus- containing supernatant were harvested 0, 16, 24, 72 and 96 hrs post-infection and stored at - 80 °C to assess virus titers (5.5.3). After each sampling, the total volume was filled back up to 8 ml with fresh cell culture medium.

5.6. Cloning strategies 5.6.1. Truncation of full-length cDNA plasmids encoding shRNA against cellular targets

Recombinant rabies lyssaviruses (rRABV) expressing shRNAs against cellular target sequences were previously generated and provided by the laboratory of PD Dr. Stefan Finke. The shRNA sequences are commercially available shRNA-encoding pGIPZ vectors (V3LHS 353558 and V2LMM_37425 for shANP and DYNLL, respectively; Dharmacon) and were introduced into full-length RABV plasmids (pCMV-SAD L16) (cf. table 5, paragraph 4.11) and designated as pSAD strep GFP His ANP shRNA K6 and pSAD GFP shDLC1-844 K15. Respective viruses were rescued from cDNA plasmids (5.5.2). To truncate the shRNA-encoding cistron by removing the GFP-encoding cistron, a 1.7 kb DNA-fragment was amplified by PCR with forward primer “L16G425b fw” and reverse primer “Delta GFP NotI rev” (cf. table 7, paragraph 4.13) from pSAD strep GFP His ANP shRNA K6 and and pSAD GFP shDLC1-844 K15, respectively. The amplified PCR product was digested (5.3.8) with restriction nucleases PpuMI and NotI and the resulting 981 bp fragment was used to replace the 1.7 kb GFP-encoding PpuMI/NotI-excisable fragment in the respective cDNA clones. The obtained full length cDNA clones were dubbed pSAD ANP shRNA 767 K1 and pSAD DLC shRNA 844 K2. Sequence-positive clones (5.3.14) were used for virus rescue (5.5.2).

Methods

5.6.2. Cloning of G protein sequences from recombinant dog rabies virus (rRABV Dog)

For transfection experiments and the in-trans complementation assay, the RABV G protein- encoding sequence of a recombinant dog rabies virus (rRABV Dog) was cloned from cDNA into pCAGGS (figure 7). Site-directed mutagenesis (5.3.13) was used to introduce amino acid exchanges within the RABV G sequences (cf. supplementary table 5). To achieve this, RNA of rRABV Dog-B-10 was isolated (5.3.2) and transcribed to cDNA by RT-PCR (5.3.5). The cDNA was amplified by PCR (5.3.6) using the primer pair “DogA_5989_EcoRI_fw” and “DogA_G_NheI_rv” to introduce recognition sites for EcoRI and NheI. After agarose gel electrophoresis PCR fragments were purified from the agarose gel (5.3.12), digested with EcoRI and NheI (5.3.8) and ligated (5.3.9) into EcoRI/NheI- digested pCAGGS. Following transformation, clones were selected and used for plasmid amplification (5.3.11). Sequence integrity was verified by Sanger sequencing (GATC Biotech).

Figure 7: Schematic overview of the cloning strategy for rRABV Dog G protein. Small striped vertical lines indicate recognition sites for restriction enzymes EcoRI or NheI.

Methods

5.6.3. Generation of recombinant RABV expressing ecto-domains of other Lyssavirus strains

For the infection of DRG neurons, rRABV chimera were generated which express the ecto- domains of other lyssaviruses. For this purpose, the ecto-domain sequences were PCR- amplified from the full-length lyssavirus cDNA plasmids (cf. table 5) using the respective forward (“DUV_EcoRI_fw”, “Vampbat_G_EcoRI_fw”, “CVS_G_EcoRI_fw” and “EBL_atg_EcoRI_fw”) and reverse primer (“Lstart_rev_seq”) (see table 7). The PCR product with an additional EcoRI recognition site were gel-purified (5.3.12) and digested with EcoRI and ClaI (5.3.8) to generate the 3.7 kb insert. The full-length RABV cDNA plasmid “pCMV L16 StrepGFPHis K1” was amplified using the primer pair “L16G425b forw” and “Lstart_rev_seq” to generate a 12.4 kb vector. The PCR product was gel-purified (5.3.12) and digested with EcoRI and ClaI (5.3.8). Both, insert and vector were ligated (5.3.9) and transformed into E. coli . Positive clones were selected via restriction endonuclease digestion (5.3.8) and used for plasmid amplification. Sequence positivity was assessed by Sanger Sequencing (5.3.14). rRABVs expressing the respective ecto-domains of L16 Rabies lyssavirus, Duvenhage lyssavirus, Vampbat rabies lyssavirus, CVS rabies lyssavirus and European bat lyssavirus I, were rescued (5.5.2).

5.7. Electron Microscopy

In order to prepare samples for electron microscopy, 3×106 NA 42/13 or BHK (clone BSR T7/5) cells were seeded to a T75 flask and infected with rRABV Dog from the 4th NA passage with an MOI of 0.01 and 0.1, respectively, and incubated for three days at 37 °C and 5% CO2. Supernatant was discarded, cells were washed once with 0.1 M sodium cacodylate (pH = 7.2, 300 mOsmol) and fixed for 30 min with 2.5% glutaraldehyde in 0.1 M sodium cacodylate (pH = 7.2). Additionally, an infection control was seeded on coverslips in 6-well plates and harvested after 3 days for indirect immunoflorescence analysis (5.4.4). The fixed cells were sent in for preparation of ultra-thin sections. Transmission electron microscopy analysis (Philips Tecnai 12, Philips) was performed by the Laboratory for Electron Microscopy. (FLI, Institute of Infectiology, Isle of Riems).

Results

6. Results 6.1. Axonal transport of RABV in dorsal root ganglions

In previous studies anterograde co-transport of RABV G and P protein in DRG neurons has been demonstrated. Accordingly, a model of intra-neuronal, G-dependent RABV transport has been proposed in which newly formed virus is anterogradely transported in axons either as complete enveloped virus particles inside transport vesicles or as incomplete particles with RNPs sticking to the cytoplasmic side of G-containing transport vesicles (cf. figure 5, paragraph 2.6). Here it was investigated whether expression of different lyssavirus G protein ecto-domain sequences affects the accumulation of RABV in DRG axons and whether non-fixed and highly virulent field isolates from dog and fox hosts also accumulate in the axons of infected DRG neurons.

6.1.1. Effect of various Lyssavirus G-sequences on the accumulation of RABV N particles in DRG axons

In order to assess whether the ecto-domain sequences of different Lyssaviruses vary in their ability to direct RABV in DRG axons, chimeric viruses were constructed in which the respective sequence of the attenuated laboratory strain SAD L16 was replaced by ecto- and transmembrane domain (TM) sequences of the RABV strain CVS-11 (challenge virus standard-11), a Vampire bat derived RABV (Vampbat) and two non-RABV bat lyssaviruses, EBLV-1 and DUVV (figure 8, A). For the identification of infected neurons the GFP reporter sequence was inserted in an additional transcription unit between the virus genes G and L. The recombinant viruses were rescued from cDNAs (5.5.2) and virus stocks were produced on NA 42/13 cells. For infection experiments, primary DRG neurons were seeded into compartmentalized cultivation chambers (5.2.2) as described previously (Bauer et al., 2014b). The neurons were cultivated for 7 days and then infected with 1×105 infectious units per well. After day 3 post-infection (3 dpi), the cells were fixed and immunostained (5.4.4) with RABV N specific serum. RABV N particles in distal axons were detected by confocal laser scanning microscopy (figure 8, C). Successful infection of the neurons was confirmed by positive GFP

Results fluorescence. With all tested viruses, RABV N positive particle structures (figure 8, B) could be detected. The detection of N particles in the axons confirmed the previously observed anterograde transport of RABV in axons of DRG neurons. However, no differences in axonal N accumulation between the tested chimeric viruses were observed.

Figure 8: RABV N positive particles in axons of DRG neurons after infection with chimeric RABVs. (A) Schematic organization of recombinant chimeric RABVs. In rRABV-GFP the ecto-domain and TM sequences of G were replaced by the respective sequences of the CVS-11 strain, a vampire bat derived RABV (Vampbat), bat derived Duvenhage lyssavirus (DUVV) and European bat lyssavirus 1 (EBLV-1). TM = transmembrane domain; Cyt = cytoplasma domain. (B) Schematic representation of compartmented system (IBIDI µ-slide). In order to generate a diffusion barrier, channels were filled with agarose prior to seeding of neurons. Infections were performed at the cell bodies. (C) DRG neurons were infected with 1×105 infectious units per well. GFP (green) and RABV N specific (red) immunofluorescence detection in axons at 3 dpi was done by confocal laser scanning microscopy. Maximum z-projection of images (z-step size = 0.34 µm) were acquired in the channel region. Scale bars: 10 µm.

Results

6.1.2. Accumulation of N and G in rRABV DogA and rRABV Fox infected DRG neurons

The detection of RABV N particles in the axons of infected DRG neurons at the expression of various ecto-domain sequences was comparable, what could mean that all lyssavirus G proteins direct RNPs in DRG axons or that the cytoplasmic domain of G is involved in transport specificity. Moreover, it could not be excluded that the chimeric character of the expressed glycoprotein had an effect of the specificity of the intra-neuronal transport. With availability of a genetically and pathogenically defined field virus clones like rRABV DogA and rRABV Fox (Nolden et al., 2016), it became possible to test anterograde transport with unmodified clones of RABV field isolates. To see whether N and G particles of rRABV DogA and rRABV Fox are anterogradely transported in DRG axons, neurons in 3.5 cm cell culture dishes were infected with 1×103 infectious units of the respective viruses. At 1 dpi, cells were fixed and RABV N and G proteins were detected by indirect immunofluorescence. N and G were detectable in the cell soma and both, proximal and distal axonal regions of rRABV DogA and Fox infected neurons (figure 9 and 10). The imaging analysis shows that N and G proteins of non-fixed RABV are transported in the axons of infected DRG neurons.

Results

Figure 9: Distribution of rRABV DogA G and N protein in DRG neurons. DRG neurons were infected with rRABV DogA (1×103 infectious units/well). Indirect immunofluorescence of RABV N (red) and RABV G (green) protein was monitored 1 dpi. Images of cell soma are maximum z-projections (step size = 0.34 µm). Scale bars: 10 µm.

Results

Figure 10: Distribution of rRABV Fox G and N protein in DRG neurons. DRG neurons were infected with rRABV Fox (1×103 infectious units/well). Indirect immunofluorescence of RABV N (red) and RABV G (green) protein was monitored 1 dpi. Images of cell soma are maximum z-projections (step size = 0.34 µm). Scale bars: 10 µm.

More detailed analysis of rRABV DogA at distal axonal sites revealed co-localization of N and G signals in particle structures at both 1 and 2 dpi (figure 11). Whereas most N signals (red) were associated with a corresponding G signal, most of the G signals were not connected to N, indicating that accumulation of N in distal axonal regions depended on G and not vice versa. Similar to the previous report about G-dependent RABV transport (Bauer et al., 2014b), co-localization of N and G in small particles was not complete (see details in figure 11), indicating particle transport according to the separate model of axonal RABV transport.

Results

Figure 11: Co-localization of RABV DogA G and N at distal sites of axons. DRG neurons were infected with rRABV Dog A (1×103 infectious units/well). Indirect immunofluorescence of RABV N (red) and RABV G (green) was monitored 1 and 2 dpi. Scale bar: 10 µm, Scale bar (detail): 1 µm.

Results

6.2. Molecular basis of RABV cell culture adaptation

A typical difference of fixed RABV and non-fixed field isolates is improved virus propagation in cell culture and a stable time courses of disease in animal models. Adaptation to non-natural growth conditions is often accompanying with reduction of virulence. This can lead to the requirement of higher virus doses for disease induction and the ability to infect through peripheral, intramuscular routes may get lost. However, neither detailed mechanisms of RABV cell culture adaptation are understood, nor it is known whether such adaptive mutations directly correlate with virus attenuation. In order to identify the genetic basis of cell culture adaptation, recombinant clones of highly virulent dog and fox field RABVs (rRABV DogA, rRABV Fox) (Nolden et al., 2016) were used as a genetically defined starting-point for sequential virus passages on different cell lines and subsequent genetic and phenotypic characterization.

6.2.1. Virus passages on different cell lines

Recombinant rRABV Dog and rRABV Fox were passaged 10 times on murine neuroblastoma (NA 42/13), hamster kidney (BHK clone BSR T7/5) or canine epithelial (MDCK-II) cells, respectively (figure 12). Prior to those passages, the recombinant viruses have been rescued by transfecting BHK cells with full length cDNA clones (Nolden et al., 2016) and subsequent preparation of virus stocks by passaging five times on NA 42/13 cells.

Results

Figure 12: Schematic presentation of cell passaging of rRABV Dog and rRABV Fox. Recombinant rRABVs were rescued by transfecting BHK (BSR T7/5) cells with full length cDNA clones and subsequently amplified in NA 42/13 cells (Nolden et al., 2016). After five passages on NA 42/13 cells, the resultant virus stocks were used for infection and sequential virus passages on BHK, NA 42/13 and MDCK-II cells, respectively. Resultant viruses were designated rRABV Dog/Fox - B, N and M, respectively.

After initial infection of the different cell lines (P 1) at an MOI of 0.01 (titer determined on NA 42/13 cells), further virus passages were performed every third day by transferring 200 to 500 µl cell culture supernatant to fresh cell cultures. Infection of the cells was monitored by indirect immunofluorescence of RABV N and RABV G in parallel-infected dishes (not shown). The cell culture supernatant of every passage (P 1 to 10) was collected and infectious virus titers were compared by endpoint-dilution on NA 42/13 cells (5.5.3) to assess improved virus production as a measure for cell culture adaptation (figure 13). Overall, the infectious titers of both, rRABV Dog and rRABV Fox, were highly variable, ranging from 5×102 to 3×107 ffu/mL. Notably, titer of the recombinant, BHK-cell passaged dog isolate (rRABV Dog-B) increased from 2×104 ffu/mL at P 1 to 1×107 ffu/mL at P 10 (figure 13 A, black bars). With 2×107 ffu/mL rRABV Fox-B also exhibited the highest titers after 10 passages (figure 13 A, grey bars), although the titer increase was less pronounced than observed for rRABV Dog-B. The observed trend towards higher titers suggested that 78

Results adaptation to BHK cell culture conditions occurred. In contrast to BHK passaged viruses, the titers of NA 42/13 cell passaged rRABV Dog-N and rRABV Fox-N did not exhibit an obvious increase as titers were already high at the first passages and fluctuated between 1×105 to 1×107 ffu/mL (figure 13 B). While the MDCK-II cell passaged rRABV Dog-M gradually increased the viral titer by 1.5-log fold (figure 13 C, black bars), titer of the rRABV Fox-M collapsed in the 2nd passage. After that, a positive trend towards higher titers in later passages was observed (figure 13 C, grey bars).

Figure 13: Virus production in the course of 10 virus passages on different cell lines. Infectious virus titers of rRABV Dog and rRABV Fox in cell culture supernatants from passages on (A) BHK, (B) NA 42/13 or (C) MDCK-II cells. Note: Titers were determined to assess whether sequential cell culture passages may correlate with alterations in the efficiency of virus production. Although some data sets indicated increased virus release, the titer courses for the individual cell passage experiments did not provide evidence for cell culture adaptation, because passage infections were performed blind, at unknown MOIs.

To measure suspected differences in virus propagation, replication kinetics (5.5.4) for recombinant dog and fox viruses from early (P 1) and late passages (P 10) were directly compared (figure 14).

Results

Compared to rRABV Dog - B - 1, rRABV Dog - B - 10 titers were approximately 100-fold higher at 16, 24, 48, 72 and 96 hours post infection (hpi) (figure 14, A) when passaged on BHK cells, indicating a selection of cell culture adapted virus with improved virus production. By contrast, rRABV Fox - B - 1 and - B - 10 exhibited comparable growth kinetics on BHK cells (figure 14, B). Compared to BHK passaged virus (figure 14, A), comparable replication kinetics for rRABV Dog - N - 1 and rRABV Dog - N - 10 (figure 14, C) as well as for rRABV Fox - N - 1 and rRABV Fox - N - 10 (figure 14 D) showed that NA 42/13 cell passages did not further increase virus production. Notably, passages on MDCK-II cells led to increased titers for rRABV Dog - M - 10 (figure 14, E) and rRABV Fox - M - 10 (figure 14, F) compared to the respective P 1 passages, indicating an adaptation to MDCK-II cells. These data showed that cell passages of both non-fixed RABV, rRABV Dog and rRABV Fox, can result in adaptation of the respective virus to a more efficient virus production. Moreover, the results for rRABV Dog indicated that selection pressure on these viruses may differ in a cell type dependent manner.

Results

Figure 14: Replication kinetics for rRABV Dog and rRABV Fox from 1st and 10th passage on different cell lines. Virus replication was monitored over time by infectious virus titers in cell culture supernatants. (A) Comparison of replication of rRABV Dog after 1st and 10th passage on BHK cells. (B) Comparison of replication of rRABV Fox after 1st and 10th passage on BHK cells. (C) Comparison of replication of rRABV Dog after 1st and 10th passage on NA 41/13 cells. (D) Comparison of replication of rRABV Fox after 1st and 10th passage on NA 42/13 cells. (E) Comparison of replication of rRABV Dog after 1st and 10th passage on MDCK-II cells. (F) Comparison of replication of rRABV Fox after 1st and 10th passage on MDCK-II cells.

6.2.2. Deep sequence analysis of cell culture passaged rRABV Dog and rRABV Fox 6.2.2.1. Mutations in coding and non-coding regions except transcription signals

To identify adaptive mutations in the genomes of the passaged viruses, deep seqeuence analysis was performed. Therefore BHK, NA 42/13 and MDCK-II cells were infected with the respective P 10 viruses at an MOI of 0.1. Cell culture supernatants were harvested at 2 dpi for RNA extraction (5.3.3) and subsequent IonTorrent sequencing (4.16) of the complete

Results genome was performed. The resultant consensus sequences were compared with the cDNA plasmid clones used for the rescue of rRABV Dog and rRABV Fox. For rRABV Dog, 4, 3 and 5 amino acid substitutions were identified in BHK, NA 42/13 and MDCK-II cells, respectively (table 14). In rRABV Dog - B, high frequencies of 96.4%, 99.8%, 94.1% and 99.5% for substitutions R293C (P protein) and D266N, A419T and K444N (G protein) were observed. In contrast and with the exception of a G to A nucleotide transition at genome position 4728 (frequency 99.5%), synonymous mutations and SNPs in non-coding mRNA regions maintained at much lower frequencies (e.g. 18.7% and 9.7% for A to G transition at position 2440 and T to C transition at position 11175, respectively; see appendix supplementary table 2). Note that alterations in non-coding, homo-polymeric transcription stop signals are described separately below. In rRABV Dog - N amino acid substitutions M83R (P protein), T206M and D266M (G protein) were observed at frequencies of 97.5%, 97.9% and 100%. rRABV Dog - M substitutions L277V (P protein), D266N, R283L, R365S (G protein) and A1535A (L protein) were detected at frequencies of 68%, 100%, 92.5%, 70.5% and 74.7%, respectively. In summary, all passaged rRABV Dog comprised the D266N substitution, one amino acid substitution in P and one to two additional substitutions in G. rRABV Dog - M showed also an additional mutation at amino acid position 1535 in L. Interestingly, all rRABV Fox passages viruses exhibited the D266N substitution in G at a frequency of almost 100%, showing that this mutation was independently selected in rRABV Dog and rRABV Fox viruses, either in the course of virus rescue and amplification or in the course of subsequent serial passages described here (table 14). Like rRABV Dog - B, rRABV Fox - B also comprised the K444N substitution at a frequency of 76.7%, indicating independent selection of a BHK cell specific mutation. Whereas D266N was the only amino acid exchange in rRABV Fox - N beyond 50% frequency (for less abundant substitutions see cf. appendix, supplementary table 2), rRABV Fox - M comprised one amino acid substitution in P (R293H), one in M (D38Y) and two in G (R369G and S398A) at frequencies of 92.4%, 81.6%, 88.1% and 95.5%. Notably, the independent replacement of an arginine at an identical position in the C-terminus of the P protein (R293H in rRABV Fox - M and R293C in rRABV Dog - B) strongly suggested an adaptive character of that mutation. Moreover, arginine substitutions (R369G in rRABV Fox - M and R365S rRABV Dog - M) were identified at closely spaced positions in

Results the G protein. Selection of similar mutations in two independent RABVs in an MDCK-II cellular environment indicates MDCK-II cell specific adaptations.

Table 14: Amino acid exchanges in consensus sequence after 10 passages of rRABV Dog and rRABV Fox on BHK, NA 42/13 and MDCK-II cells. Indicated are the number of silent mutations in the whole genome and amino acid exchanges in the virus proteins N, P, M, G and L with frequencies of over 50%. NCR = non-coding region (without transcription signals), CR = coding region. i = mutation in all sequenced viruses; ii = BSR cell specific mutation in both viruses (rRABV Dog - B and rRABV Fox - B); iii = mutation in rRABV Dog - M and rRABV Fox - M virus that may represent MDCK-II cell specific adaptations. iv = mutation in rRABV Dog - B and rRABV Fox - M virus at identical position in C-terminus of P. Percentages indicate the frequency of the mutations in deep sequence analysis. Complete overview of all synonymous and non-synonymous mutations (including frequencies, coverage and nt replacements) are provided in supplementary table 2 (appendix).

rRABV Dog synonymous non-synonymous mutations in CR mutations in mutations in NCR N P M G L CR D266Ni (99.8%) R293Civ A419T BHK cells 0 1 - - - (96.4%) (94.4%) K444Nii (99.5%) T206M M83R (97.9%) NA cells 2 1 - - - (97.5%) D266Ni (100%) D266Ni (100%) MDCK L277V R283L A1535S 0 3 - - cells (68%) (92.5%) (74.7%) R365Siii (70.5%) rRABV Fox D266Ni (99.5%) - BHK cells 0 1 - - - K444Nii (76.7%) D266Ni NA cells 0 1 - - - - (99.5%) D266Ni (100%) MDCK R293Hiv D38Y iii 1 3 - R369G - cells (92.4%) (81.6%) (88.1%) S398A (95.5%) 83

Results

6.2.2.2. Mutations in P and G prevailed during passage on BHK cell line (amplicon sequencing)

After the passage of rRABV Dog on different cell lines, specific mutations were identified in the P and the G protein. To investigate in which passage the mutations occurred the first time and after how many passages mutations prevailed, amplicon sequencing was performed by the NGS Laboratory (FLI, Institute for Virus Diagnostic, Isle of Riems). For this, 1×106 BHK cells were infected with rRABV Dog after each second passage at

MOI = 0.01 and incubated for 3 days at 37 °C, 5% CO2. Virus was harvested from cells (5.3.1 and 5.3.2) and regions around amino acid residue 293 in P, and 266, 419 and 444 in G were amplified by RT-PCR with primer combinations provided in the appendix (supplementary table 3). The resulting cDNA fragments were analyzed by IonTorrent sequencing (4.16). In the P protein of rRABV Dog - B, the amino acid exchange R293C was identified the first time in the 5th passage at 16% frequency, which then increased to 99% in the 10th passage, suggesting a strong positive selection pressure on the R293C mutation. Two additional mutations in P were detected at stable but low frequencies, one with an amino acid exchange (L276M) and one silent at nt position 2338. In contrast, an amino acid exchange in P at position 184 (S184P) appeared at low frequencies of 1 – 2% till the 7th passage and then disappeared (table 15). Another mutation at amino acid position 206 (T206M) was detected in the first passage at 8.5%, in the 3rd and 5th passage at 17% and 18%, respectively, then decreased to 1% in the 7th passage until it was not detectable anymore in the 10th passage (table 15). In G, the amino acid exchange at position 266 (D266N) was already present since the first passage on BHK cells at a frequency of 99.8%, whereas the replacements A419T and K444N prevailed later. Although K444N was not detectable in passage 3, the mutation was abundant in the 5th passage with 76% and further increased to 100% in the 10th passage. A419T was first detected in passage 7 at a frequency of 59% and further increased to 97% in P 10 (table 15). Additionally, an amino acid exchange at position 447 (S447L) was transiently observed with 8% and 1% frequency in the 3rd and 7th passage, respectively, but was lost in the 10th passage. A silent mutation at nt position 4726 was present at a frequency of 100% in all passages. The results confirmed the mutations in the P and G open reading frame (ORF) of rRABV Dog - B and provided insights in the time course of their appearance.

Results

Table 15: Sequence variations detected by sequencing of RABV Dog-B amplicons after 1, 3, 5, 7 and 10 passages on BHK cells. The percentages of the identified mutations are indicated for every passage number. n.s. = not sequenced (error in sequencing results).

nt. 2338 2339 2390 3866 3933 4112 4571 4648 4656 4728 Position (A>G) (T>A) (C>T) (T>C) (C>T) (G>A) (G>A) (G>T) (C>T) (G>A) aa no L276M R293C S184P T206M D266N A419T K444N S447L no exchange Passage

no. 1 10% 2% 0% 2% 8.5% 99.8% 0% 0% 0% 99% 3 10% 2% 0% 1% 17% 100% 0% 0% 8% 99% 5 11% 2% 16% 1% 18% 99% 0% 76% n.s. 100% 7 12% 2% 76% 0% 1% 99% 59% 96% 1% 100% 10 11% 2% 99% 0% 0% 99% 97% 100% 0% 100%

6.2.2.3. Sequence variations in transcription signals

In rhabdoviruses, polymerase stop and polyadenylation of nascent mRNAs is regulated by homo-polymeric sequences in the virus genome, mostly consisting of 7 uridine (U) residues (Barr et al., 1997). In the deep sequence analysis differences in the homo-oligomeric U stretches between original and passaged viruses were found. Compared to the cDNA clone prRABV Dog K14, in all passaged RABV Dog viruses the P gene stop signal was elongated from 6 to 8 uridines whereas the 8 uridine long M gene stop signal was truncated by the deletion of one nt (table 16). In contrast to the Dog viruses, gene border sequences in the passaged Fox viruses were stable. With the exception of a single nucleotide deletion in the G mRNA stop signal in rRABV Fox-B, no further alterations were observed in the consensus sequences. Notably, even a 5 U long P gene stop signal was not modified in the course of the passage experiment (table 17). Table 16: Length of thymidine or uridine stretches in the transcription stop / polyadenylation signals of the full length cDNA clone pRABV Dog K14 and the resultant recombinant virus after 10 passage on BHK, NA 42/13 and MDCK-II cell line. *Sequence of plasmid cDNA of prRABV Dog K14 was verified by Sanger sequencing.

Gene border prRABV Dog K14* rRABV Dog - B rRABV Dog - N rRABV Dog - M N/P 7 T 7 U 7 U 7 U P/M 6 T 8 U 8 U 8 U M/G 8 T 7 U 7 U 7 U G/L 7 T 7U 6 U 6 U

Results

Table 17: Comparison of polyadenylation signals length for original rRABV Fox K9 and rRABV Fox after passaging on BHK, NA 42/13 and MDCK-II cell line.

Gene border prRABV Fox K9 rRABV Fox - B rRABV Fox - N rRABV Fox - M N/P 7 T 7 U 7 U 7 U P/M 5 T 5 U 5 U 5 U M/G 7 T 7 U 7 U 7 U G/L 7 T 6 U 7 U 7 U

The data indicated that in addition to mutations in the protein coding regions, alterations in the transcription stop signals of rRABV Dog led to a more efficient virus replication in cell culture. However, since homo-polymeric sequences may lead to the insertion of multiple nucleotides during Ion Torrent sequencing (Quail et al., 2012), confirmation of the stop signal variations was required. Therefore the sequences of the P/M, M/G and GL gene borders in prRABV Dog K14 and rRABV Dog B – 10 (figure 15, A) were determined by Sanger sequencing of RT-PCR products using following primer combinations (cf. table 7): “dogAseq5” and “dogA_4989_rv” for P/M, “dogAseq6 and dogA F318S rv” for M/G, and “dogAseq9” and “DogA EcoRI rev” for G/L gene border. Although the presence of 8 U and 6 U stretches in the P/M and M/G gene borders were confirmed, the chromatograms also indicated sequence variability at the end or downstream of the stop signals. For a more detailed characterization of the P/M gene border sequence variability, amplicon sequencing using MiSeq technology (4.16) was performed for rRABV Dog - B passage numbers 1, 3, 5, 7 and 10. Either one, two or three insertions were detected in the P stop signal sequence of rRABV Dog -B-10 (figure 15, B), whereas the proportion of the 2 U insertion increased from 90 % (rRABV Dog-B-1) to 95 % (rRABV Dog - B - 10). The poly-A signal with 6 U was nearly vanished compared to the original sequence of pRABV Dog K14. This suggests that the stop signal insertions were also present at the beginning of the virus passages. Clear selection of a 2 nt insertion further indicates that this alteration supports efficient virus growth in cell culture.

Results

Figure 15: Additional adenines in transcription termination signal in P-M gene border in BHK passaged virus. (A) Gene borders sequences of P/M, M/G and G/L by Sanger sequencing of plasmid prRABV Dog K14 and virus rRABV Dog B - 10 (passaged on BHK cell line). (B) Deep sequencing analysis of P/M gene border amplicons. Shown are 1, 2 and 3 A insertions compared to poly-(A) sequence of rRABV DogA K14 containing 6 A. m: adenine or cytosine; r: adenine or guanine.

6.2.3. Release of new virus particles is impaired in non-fixed rRABV Dog

In order to test, whether the identified mutations in the G gene of rRABV Dog - B - 10 were sufficient to support increased virus release from BHK cells, expression plasmids encoding cloned G-gene sequences of rRABV Dog - B - 10 were used for the complementation of G- gene deleted SAD ΔG GFP virus, comprising the amino acid substitutions D266N, A419T and K444N (supplementary table 4). With the amino acid substitution V483F and G175V further replacements were identified in individual clones.

Results

6.2.3.1. Hundred-fold increase of RABV release from BHK cells by mutations D266N, A419T and K444N.

After infection of BHK cells with rRABV SAD G-GFP at an MOI of 2 and virus replication for 2 days, complementation was performed by additional transfection of expression plasmids for G proteins of wt RABV DogA or rRABV Dog - B - 10. Of the latter, 5 different clones were used, comprising the amino acid substitutions D266N, A419T and K444N. In comparison to wt RABV DogA G, all five clones of rRABV Dog - B - 10 G led to a 100-fold increase in the obtained virus titers (figure 16).

Figure 16: Adaptation to BHK cells is attributed to G protein and correlates with improved virus release. In-trans complementation of SAD ΔG-GFP by expression plasmids encoding wild type Dog G protein and five G-clones from rRABV Dog - B - 10 (K1 – K5) in BHK cells (clone BSR T7/5). Two independent expression plasmids for wildtype G (Dog WT K1 + K2) were used. Mock transfection with a plasmid without target sequence (pCAGGS). Mock infection was performed without subsequent transfection. Error bars indicate standard deviations (SD) from three individual experiments.

A sequence blast for the respective G protein from rRABV Dog was performed and compared to the known G sequence from rRABV Dog - B - 10. In 1000 sequences from NCBI approximately 4% carried a mutation at position 444 and approximately 8% at position 266. All mutations originated from RABV isolates with a passage history on cell culture, e.g. NA, chicken embryo fibroblast or BHK cells (supplementary table 5). A closer look on RABV 88

Results strains with respective mutation at position K444N shows that most of them have been passaged on BHK cells (supplementary table 5, strains marked with *). An amino acid exchange in G at position 419 was only found once in 1000 compared sequences (results not shown).

6.2.3.2. The combination of D266N, A419T and K444N in G is required for increased RABV release

In order to test whether the combination of all three amino acid replacements (D266N, A419T and K444N) was required for increased virus release from BHK cells, G-deficient RABV was complemented with plasmid expressing G with respective mutations in different combinations (figure 17). After insertion of the three amino acid replacements of wt G virus, virus release was increased by 100-fold and comparable to the adapted G proteins from the 10th passage (compare G 266/419/444, P10 and WT). D266N and K444N alone resulted in 10-fold virus titer increase, whereas A419T alone was comparable to WT G (figure 17). The combination of D266N and A419T or D266N and K444N resulted in a 15-fold titer increase whereas the double mutant with amino acid replacements A419T and K444N remained at the 10-fold increased titer level as observed for the K444N single mutant (figure 17). Overall, these data showed that the combination of those three amino acid replacements is required as well as sufficient for efficient virus release from infected BHK cells.

Results

Figure 17: Single amino acid replacements in G already lead to improved virus release. In-trans complementation of SAD ΔG-GFP by expression plasmids encoding wildtype (WT) Dog G protein and G- clones from rRABV Dog-B-10 (D266N/A419T/K444N), three single mutations either at position D266N, A419T or K444N, three double mutations at position D266N/K444N, A419T/K444N and D266N/A419T, and a triple mutant combining all the mutations (D266N/A419T/K444N) in BHK (clone BSR T7/5) cells. Mock transfection with plasmid without the target sequence (pCAGGS). Mock infection with rRABV SAD GFP without subsequent transfection. Error bars indicate standard deviations of at least two independent experiments with two grouped clones. The significance was calculated in a multiple comparison test (Dunnett test) with mean values of both clones using WT Dog G as reference, all other clones were directly compared to the WT Dog G reference. *p< 0.05; ***p < 0.001

6.2.4. Cell line specific intracellular G accumulation and increased surface expression after virus passages.

As increased virus release from BHK cells depended on the modifications in G. Reasons for that could be a more efficient transport to the budding sites at the plasma membrane. Therefore, at 24 hpi with rRABV of Dog and Fox from the 1st or 10th passage, cellular localization of G was monitored by indirect immunofluorescence (figure 18, 19 and 20).

Results

Notably, in rRABV Dog - B - 1 infected BHK cells G protein (green) accumulated predominantly in perinuclear regions close to cytoplasmic inclusion bodies, which were visualized by N-specific serum (red) and only few G-specific signals were detected at the cell periphery. In contrast, G protein in RABV Dog - B - 10 infected BHK cells was mostly plasma membrane associated and intracellular accumulation was lost (figure 18, BHK cells 2nd column). These data indicated that in contrast to the passaged virus, G protein of early passage virus accumulates at intracellular sites. By contrast, in NA 42/13 cells G protein was clearly located at the cell periphery after infection with both, rRABV Dog - N - 1 and rRABV Dog - N - 10 (figure 18, NA cells), indicating that the intracellular accumulation of Dog -  - 1 G protein was cell specific. In MDCK-II cells G protein of rRABV Dog - M - 1 accumulated intracellular and close to the cytoplasmic inclusion bodies (figure 18, MDCK cells, 1st column). In rRABV Dog - M - 10 infections these accumulations were not detectable and only a faint rim staining at the cell periphery indicated a surface accumulation of G protein at the plasma membrane (figure 18, MDCK cells 2nd column).

Results

rRABV Dog not infected 1st passage 10th passage

BHK RB- -RABV-G -RABV-N+ α α

RABV-N RABV-G RABV-N RABV-G

NA 42/13 RB- -RABV-G -RABV-N + α α

RABV-NRABV-G RABV-N RABV-G

MDCK-II RB- -RABV-G -RABV-N + α α

RABV-NRABV-G RABV-N RABV-G

Figure 18: Accumulation of the G protein in rRABV Dog infected host cells. BHK, NA 42/13 and MDCK-II cells were infected with rRABV Dog-P1 and -P10 at an MOI of 0.01. At 1 dpi the cells were fixed and co- stained against RABV N (red) and G (green) protein. Nuclei were stained with Hoechst 333124 (blue). Scale bar: 5 µm. 92

Results

In contrast to rRABV Dog, in rRABV Fox infected BHK cells an accumulation of G at the plasma membrane was observed in both, P 1 and P 10 virus (figure 19, BHK cells) indicating that G protein surface transport of rRABV Fox - B was not further increased by passaging on BHK cells. Similarly, P 1 and P 10 rRABV Fox - N led to plasma membrane accumulation of G (figure 19, NA cells). In contrast to BHK and NA 42/13, infection of MDCK cells with rRABV Fox - M - 1 led to an accumulation of G at cytoplasmic inclusion bodies (figure 19, MDCK cells, 1st column), while in rRABV Fox - M - 10 infected MDCK cells G protein accumulations at inclusion bodies were less pronounced and granule like structures were distributed all over the cytoplasm (figure 19, MDCK cells, 2nd column). However, distinct plasma membrane localization was observed neither for rRABV Fox - M - 1 nor for rRABV Fox - M - 10. Although increased plasma membrane localization of G was not observed, loss of inclusion body accumulation indicated re-localization of MDCK-II passaged virus.

Results

rRABV Fox 1st passage 10th passage

BHK RB- -RABV-G -RABV-N+ α α

RABV-NRABV-G RABV-N RABV-G

NA 42/13 RB- -RABV-G -RABV-N + α α

RABV-NRABV-G RABV-N RABV-G

MDCK-II RB- -RABV-G -RABV-N + α α

RABV-N RABV-G RABV-N RABV-G Figure 19: Accumulation of G protein in rRABV Fox infected host cells. BHK, NA 42/13 and MDCK-II cells were infected with rRABV Fox-P1 and -P10 at an MOI of 0.01. 1 dpi the cells were fixed and co-stained against RABV N (red) and G (green) protein. Nuclei were stained with Hoechst 333124 (blue). Scale bar: 5 µm. 94

Results

6.2.4.1. ER-localisation of rRABV Dog - B in early passage on BHK cells

In order to identify the cellular compartment of G protein accumulation in BHK cells, rRABV Dog - B - 1 and rRABV Dog - B - 10 infected BHK cells were immunostained against G (green) and the endoplasmic reticulum (ER) marker calnexin (red). As observed before (cf. figure 18), P 1 virus accumulated in the cytoplasm, whereas plasma membrane localization was increased for P 10 virus (figure 20). Co-localization of cytoplasmic localized G with calnexin in rRABV Dog - B - 1 infected BHK cells showed that P1 G protein accumulated in the ER (figure 20, 1st column), whereas after 10 passages more G was located at the plasma membrane (figure 20, 2nd column). Compared to not infected cells, G protein of both passages, P 1 and P 10, induced a redistribution of calnexin, indicating a general redistribution of the ER in the course of RABV infection (figure 15, 3rd column). These data showed that the non-adapted G protein from rRABV Dog was tethered in the ER of BHK and probably also of MDCK cells. Efficient surface transport in rRABV Dog - B - 10 infected cells further indicated that BHK cell adaption relied on improved surface transport.

Figure 20: Distribution of G protein and calnexin in BHK cells infected with rRABV Dog. BHK cells were infected with rRABV Dog-P1 and -P10 at an MOI = 0.01. 1 dpi cells were fixed and co-stained against RABV G protein (green) and ER-marker calnexin (red). Nuclei were stained with Hoechst 333124 (blue). Scale bar: 5 µm.

Results

6.2.4.2. Ultrastructure of rRABV Dog particles: formation of intra- and extracellular virus particles.

Intracellular virus particle formation is a common feature of RABV (Finke et al., 2010) and the here detected ER accumulation of G in BHK cells could lead to increased level of virus assembly at the ER membrane. In order to assess, whether virus assembly at ER and plasma membrane was affected in BHK and NA 42/13 cells, assembly of non-passaged rRABV Dog virus was analyzed in these cells by transmission electron microscopy at 3 dpi. In parallel, virus infections and intracellular G accumulation were examined by indirect immunofluorescence of N and G. In both, NA 42/13 and BHK cells, intracellular virus particles were detected in the ER (figure 21 A + B, black arrowheads). Also extracellular virus particles (figure 21 C + D, black arrowheads) were detected in both cell lines demonstrating that assembly of both virus structure types occurred. However, only few extracellular virus particles were detected at BHK cells (figure 21, D) whereas multiple extracellular particles were detected in the NA 42/13 cell culture (figure 21, B).

Results

Figure 21: Ultrastructure of rRABV Dog infected NA 42/13 and BHK cells. NA 42/13 and BHK (clone BSR T7/5) cells were infected with rRABV Dog at an MOI = 0.01 (A + B + E) and 0.1 (C + D + F), respectively. After three days cells were fixed and analyzed by transmission electron microscopy (A – D) and indirect immunofluorescence (F + E). Infected cells were co-stained against RABV G protein (green) and RABV N protein (red). Nuclei were stained with Hoechst 333124 (blue). Black arrowheads: assembled RABV particles. IB = inclusion bodies; N = nucleus.

Results

6.3. RABV vectors for cytoplasmic shRNA expression

In order to investigate the contribution of host cell factors in virus pathogenesis, selective targeting of si- or shRNA to infected cells in complex in vivo cell systems may be a helpful tool. In case of upregulated genes in infected cells, expression of counteracting, inhibitory RNAs from the pathogen itself may represent one strategy to selectively block cellular responses and to directly analyse the role of upregulated factors on virus replication without causing broad effects on not infected cells and tissues. To clarify the feasibility of such a strategy for cytoplasmic replicating RNA viruses like RABV, rRABV transcribing miR- shRNAs from an extra-cistron were generated. Cellular DYNLL1, known to be upregulated in RABV infected cells on a transcriptional level (Bauer et al., 2014, Tan et al., 2007) and Acidic Nuclear Phosphoprotein 32 family member B (ANP32B) as an cellular control gene, not known to be involved in RABV replication, were used as targets for RABV expressed and inhibitory RNAs.

6.3.1. Generation of RABV expressing miR-shRNAs

To assess whether cytoplasmic transcribed RABV mRNAs can be converted to functional siRNAs, rRABV expressing miR-shRNA against DYNLL and ANP32B from an extra transcriptional unit were generated by the introduction of commercially available miR-shRNA coding cDNAs in an extra transcription unit between the RABV genes G and L. In these constructs, the shRNA sequences were flanked by miR30-cleavage sites to allow efficient processing of the transcripts by ribonuclease Drosha (Hinton et al., 2008). Prior to insertion into the virus genome, functional miR-shRNA sequences against human ANP32B were selected from commercially available Pol II promoter controlled shRNA plasmids by the successful downregulation in transfected HEK293T cells (Bauer et al., 2014a). To identify potential miR-shRNA candidates against murine DYNLL1, a screening with recombinant rRABVs was performed, expressing different miR-shRNA sequences. The most promising sequence with lowest DYNLL1 western blot signals in virus infected cells (not shown) was selected for further characterization. A first set of viruses comprised a GFP ORF upstream of the miR-shRNA encoding sequence (figure 22, A) to monitor the extra gene expression by GFP auto-fluorescence. In a second set 98

Results of viruses, the GFP-coding ORF was removed in order to truncate the transcribed mRNA from 1.2 kb in the GFP-expressing to 0.5 kb in the non-GFP expressing viruses (figure 22, B). Even though it was not clear at all whether the mRNAs can enter the nucleus by diffusion, it was speculated that truncation of the transcript size may facilitate nuclear import for subsequent cleavage by Drosha and a more efficient production of inhibitory RNAs. Successful generation of the miR-shRNA encoding viruses from the constructed cDNAs (cf. table 5, paragraph 4.10) with confirmation of the inserted sequence in stock viruses by RT- PCR sequencing (5.6.1) revealed that the inserted ribonuclease cleavage sites as well as the shRNA stem-loop sequence did not prevent replication of the recombinant RNA viruses. Most importantly, the shRNA sequences were maintained for stock production after virus amplification.

Figure 22: Organization of miR-shRNA expressing rRABV. The recombinant viruses transcribe miR- shRNAs from an extra transcription unit between the RABV G and L genes. The 5’ -capped (5’ -cap) and polyadenylated ([A]n) mRNAs comprise a microRNA derived (miR-30) Drosha nuclease cleavage site and a stem-loop structure. Scissors indicate the predicted cleavage sites. (A) Organization of non-modified virus

Results rRABV L16, GFP-expressing rRABV L16 GFP and shRNA expressing rRABV L16 GFP-shRNA. The latter contained miR-shRNA in the non-coding region downstream of the GFP ORF. (B) In rRABV L16 shRNA viruses, the GFP ORF was deleted in order to truncate the mRNA sizes from 1.2 kb to 0.5 kb (calculated without consideration of the poly-A tail).

6.3.2. Growth kinetics of rRABV expressing miR-shRNA

To investigate whether the introduction of an additional transcription unit with encoded miR- shRNA sequences affected the replication of the rRABVs, replication kinetics on murine NA 42/13 cells were compared by virus replication kinetics. Therefore, cells were infected at an MOI of 0.01 with the different rRABVs and the infectious virus titers in the cell culture supernatants were determined at 16, 24, 48, 72 and 96 hpi (5.5.3). Two control viruses, which do not express miR-shRNAs, were included for comparison. These were rRABV L16, not comprising an additional transcription unit, and rRABV L16 GFP, encoding an additional transcription unit with a GFP ORF but not coupled to the downstream miR-shRNA sequence. The replication kinetics of GFP encoding viruses, rRABV GFP-shDYNLL and rRABV GFP- shANP32B, as well as the non-GFP encoding viruses, rRABV shDYNLL and rRABV shANP were comparable to those of the control viruses rRABV L16 GFP and rRABV L16, respectively (figure 23). These data showed that neither the additional transcription unit (figure 23, B) nor the introduction of miR-shRNA sequences (figure 23, A + B) negatively affected virus replication in NA 42/13 cells. GFP auto-fluorescence in rRABV GFP-shRNA infected NA 42/13 cells (figure 23, C) indicated transcription of the additional transcription unit and thus synthesis of the downstream-located miR-shRNA sequence.

100

Results

Figure 23: Replication kinetics of miR-shRNA expressing recombinant viruses and GFP expression in infected cells. Virus titers from cell culture supernatant after infection of NA 42/13 cells (MOI = 0.01) with (A) rRABV L16 GFP, rRABV GFP-shDYNLL and rRABV GFP-shANP or (B) rRABV L16, rRABV shDYNLL and rRABV shANP. ffu: focus forming units. Error bars: min-max values from two independent experiments. (C) GFP auto-fluorescence (green) and RABV N protein expression (red) by indirect immunofluorescence in infected NA 42/13 (MOI = 2) at 2 dpi. Scale bars: 10 µm.

6.3.3. Downregulation of DYNLL1 in RABV-infected NA 42/13 cells

In order to assess whether the RABV expressed sequences were indeed processed to functional siRNAs, murine NA 42/13 cells were infected at an MOI of 2 with rRABV GFP- shDYNLL and control viruses rRABV GFP and RABV GFP-shANP. DYNLL1 mRNA levels were monitored by RT-PCR at 2, 3 and 4 dpi (figure 24, A). Similar to the previously shown upregulation of DYNLL1 mRNA level in RABV infected cells (Bauer et al., 2015), increased intensities of RT-PCR signals for DYNLL1 mRNA were observed for the control viruses rRABV L16 GFP and rRABV GFP-shANP at days 2, 3 and 4 post infection (figure 24, A). Accordingly, DYNLL1 protein level increased in rRABV L16 GFP and rRABV GFP- shANP32B infected cells compared to not infected and rRABV GFP-shDYNLL infected cells (figure 24, B). In rRABV GFP-shDYNLL infected cells, mRNA-level remained below those

101

Results in not infected cells at all time points (figure 24, A). The upregulation of DYNLL protein level was not detectable (figure 24, B). Murine ANP32B mRNA was not affected by rRABV GFP-shANP, whose sequence was directed against human ANP32B. GAPDH mRNA level were comparable in all analyzed samples. The data showed that cytoplasmic shDYNLL1 transcription from a RABV vector indeed leads to the generation of functional siRNAs that specifically downregulate murine DYNLL1 in NA 42/13 cells. In spite of increased DYNLL1 mRNA level in rRABV GFP-shANP infected cells at all three time points (figure 24, A), the upregulated DYNLL1 protein level remained below those observed in rRABV L16 GFP infected cells. This correlated with less abundant signals for RABV N protein (figure 24, B). Similar downregulation of DYNLL1 mRNA level was detectable for the truncated mRNA expressing rRABV shDYNLL (figure 24, C), but less pronounced than to rRABV GFP- shDYNLL. In contrast to the GFP-expressing virus, signals for DYNLL1 mRNAs did not decrease below those in not infected cells (comparing figure 24, A + C), indicating that downregulation of DYNLL1 was less efficient in rRABV shDYNLL than in rRABV GFP- shDYNLL infected cells. Whereas rRABV L16 and rRABV shANP upregulated DYNLL1 protein level at all time points, the DYNLL1 protein level remained at the level of not infected cells (figure 24, D). The data indicated that compared to rRABV GFP-shDYNLL the truncation to 0.5 kb had no positive influence on the efficiency of siRNA generation from the transcribed mRNAs.

102

Results

Figure 24: Downregulation of DYNLL1 mRNA and protein level by rRABV GFP-shDYNLL and rRABV shDYNLL in a murine neuroblastoma cell line. Murine neuroblastoma (NA 42/13) cells were infected at an MOI of 2. After 2, 3 and 4 ddpi, cells were lysed and prepared for RT-PCR and western blot analysis. (A) Infections with rRABV GFP-shRNA. Detection of DYNLL1, ANP32B and GAPDH (housekeeping) mRNA. (B) Western blot analysis with antisera against RABV N, DYNLL1 and β-tubulin. (C) Infections with rRABV shRNA. Detection of DYNLL1, ANP32B and GAPDH (housekeeping) mRNA. (D) Western blot analysis with antisera against RABV N, DYNLL1 and β-tubulin. n.i. = not infected.

To confirm virus mediated downregulation of DYNLL1 mRNA in a distinct cell line, murine NIH 3T3 cells were infected with the different viruses and DYNLL1 expression was monitored on mRNA and protein level. As observed above for NA 42/13 cells, infection of NIH 3T3 cells with rRABV GFP-shDYNLL led to downregulation of DYNLL1 mRNA and protein level below those observed in not infected cells at all three time points, whereas

103

Results upregulation of DYNLL1 mRNA and protein level was observed for rRABV GFP and rRABV GFP-shANP (figure 25, A + B). An effect on ANP32B mRNA level due to miR- shRNA expression was not visible (figure 24, A + C), again indicating the specificity of the miR-shRNA for murine targets. In the NIH 3T3 cells, also for the truncated mRNA of rRABV shDYNLL downregulation of DYNLL1 mRNA level was detectable (figure 25, C). However, similar to the NA 42/13 cells the DYNLL1 level did not decrease below the level of not infected cells (figure 25, D). As DYNLL1 level were downregulated in NIH 3T3 cells by both miR-shRNA expressing viruses, rRABV GFP-shDYNLL and rRABV shDYNLL, also the truncation did not seems to have a positive effect on the efficiency of DYNLL1 regulation.

104

Results

Figure 25: Downregulation of DYNLL1 mRNA and protein level by rRABV GFP-shDYNLL and rRABV shDYNLL in a murine fibroblast cell line. Murine fibroblast (NIH 3T3) cells were infected at an MOI of 2. After 2, 3 and 4 dpi, cells were lysed and prepared for RT-PCR and western blot analysis. (A) Detection of DYNLL1, ANP32B and GAPDH (housekeeping) mRNA (B) Western blot analysis with antisera against RABV N, DYNLL1 and β-tubulin. (C) Detection of DYNLL1, ANP32B and GAPDH (housekeeping) mRNA. (D) Western blot analysis with antisera against RABV N, DYNLL1 and β-tubulin. n.i. = not infected.

In order to verify whether RABV expressed miR-shRNA against human ANP32B was also functional in mRNA downregulation, human embryonic kidney cells were infected with the same set of viruses described above and mRNA and protein level were compared. Whereas not infected cells or rRABV L16 GFP and rRABV GFP-shDYNLL infected cells exhibited comparable ANP23B mRNA and protein levels, rRABV GFP-shANP32B led to a strong downregulation of ANP32B mRNA level at 2, 3 and 4 dpi (figure 27, A). By contrast, at 2 dpi the ANP32B protein level in rRABV GFP-shANP32B infected cells were comparable to rRABV L16 GFP and rRABV GFP-shDYNLL infection (figure 27, B). However, decreasing western blot signal intensities for ANP32B at 3 and 4 dpi showed that downregulated mRNA level indeed correlated with downregulation of ANP32B protein level. DYNLL1 mRNA level were only slightly affected in rRABV GFP-shDYNLL infected HEK293T cells (figure 27, A) and siRNA activity of the murine DYNLL1 directed miR- shRNA expression in the human cell line remained speculative. In HEK293T cells infected with the truncated rRABV shANP the ANP32B, mRNA and protein levels were decreased at 3 and 4 dpi (figure 27, C + D). Notably, for rRABV shDYNLL1 downregulation of DYNLL1 mRNAs was observed at 2, 3 and 4 dpi (figure 27, C) indicating that the inserted miR-shRNA is able to target both, murine and human DYNLL1. Sequence alignment (cf. figure 28, A) showed a two nt difference in the middle of the murine specific miR-shRNA against DYNLL1, suggesting that this still allows recognition of the human DYNLL1 target mRNA. Comparison of human and mouse ANP32B sequences revealed that 3 nt mismatches may affect efficient recognition and/or downregulation of murine ANP32B by the specific human ANP32B siRNA (figure 26).

105

Results

Figure 26: Differences in nucleotide sequence of ANP32B mRNA between human, mouse and miR-shRNA against ANP32B. Accession number for human ANP32B mRNA (# NM_006401) and murine ANP32B mRNA (# NM_130889). Sequences were aligned in Geneious.

Overall, these data showed that RABV expressed miR-shRNA indeed are inhibitory to specific target sequences in the infected cell line. In contrast to the DYNLL1 shRNA sequence, shown to be active in murine and human cell lines, the ANP32B targeting sequence was only active in human cells.

106

Results

Figure 27: Downregulation of ANP32B mRNA and protein levels by rRABV GFPshANP and rRABV shANP. Human embryonic kidney (HEK 293T) cells were infected at an MOI of 2. After 2, 3 and 4 dpi, cells were lysed and prepared for RT-PCR and western blot analysis. (A) Detection of DYNLL1, ANP32B and GAPDH (housekeeping) mRNA. (B) Western blot analysis with antisera against RABV N, ANP32B and β- tubulin. (C) Detection of DYNLL1, ANP32B and GAPDH (housekeeping) mRNA (D) Western blot analysis with antisera against RABV N, ANP32B and β-tubulin. n.i. = not infected.

6.3.4. Infection of primary rat hippocampus neurons

Although specific downregulation of cellular genes by the rRABVs was achieved, it remained unclear, how cytoplasmic mRNAs were processed to functional siRNAs. One possibility was that mRNAs got accessible to nuclear Drosha after nuclear membrane breakdown in the

107

Results course of cell division. As RABV is a neurotropic virus, neurons were used for first follow up experiments to confirm regulator activity of the miR-shRNA. Since miR-shRNA expressing RABVs led to DYNLL1 downregulation in both human and murine cells and the respective rat sequence is less divergent to the expressed shRNA (figure 28, A), established rat primary hippocampus neuron cultures were chosen for the following experiments. Neurons were prepared from newborn rats and 4×105 cells per cavity of a 12-well plate were seeded. After 7 days of cultivation, neurons were infected with rRABV L16 GFP, rRABV GFP-shDYNLL and rRABV GFP-shANP at an MOI of 2. At 3 dpi the neurons were lysed for western blot and RT-PCR analysis. Neither DYNLL1 upregulation by rRABV L16 GFP and rRABV GFP-shANP nor downregulation by rRABV GFP-shDYNLL was detected in a reproducible manner (figure 28, B).

Figure 28: Efficiency of shRNA against DYNLL 1 in primary rat hippocampus neurons. (A) Sequence comparison of murine, rat and human mRNA to miR-shRNA against DYNLL1. Data for dynein light chain shRNA binding region was collected from NCBI for mouse (Accession no. #NM_019682), human (accession no. #NM_001037494) and rat (accession no. # NM_053319) and aligned in Geneious. Hippocampus neurons

108

Results infected with rRABV-shRNA and rRABV GFP - shRNA and respective controls were harvested at 3 dpi. (B) RT-PCR detection of DYNLL1 (M) (mouse specific primer), DYNLL1 (H) (human specific primer), ANP32B and GAPDH (housekeeping) mRNAs.

109

Discussion

7. Discussion 7.1. Axonal transport of RABV

The axonal transport and trans-synaptic spread of RABV represent important features of its neuro-invasiveness. An essential role in the axonal transport plays the G protein, as it directs incoming virions to long distance endosomal trafficking (Gluska et al., 2014; Klingen et al., 2008) and, after virus replication, newly formed virus to anterograde transport in axons of sensory DRG neurons (Bauer et al., 2014b). The latter finding was contradictory to the dogma of exclusive retrograde axonal RABV transport, but was yet supported by recent in vivo studies (Zampieri et al., 2014), older RABV transport studies in DRG neurons (Tsiang et al., 1989) and pathological consideration of natural and experimental RABV infections (reviewed in (Begeman et al., 2017)). The pseudo-unipolar DRG neurons enable transport events in both directions, using kinesin motors for anterograde and dynein/dynactin complexes for retrograde transport (summarized in (Ibanez, 2007). G-dependent, anterograde RABV transport in DRG neurons led to the suggestion of two alternate models, in which newly synthesized virus particles are transported either as complete virions inside transport vesicles (“married” transport model) or as incomplete particles with cytoplasmic RNPs bound to G-containing vesicles (“separate” transport model) (Bauer et al., 2014b). As separate co-transport of incomplete virus components has also been suggested for other neurotrophic viruses, e.g. herpesviruses (summarized in (Taylor and Enquist, 2015)), the latter model might also apply for RABV. Beside the exact mode of anterograde RABV transport, it is also not known whether the transport mode depends on virus G protein-specific features or on neuron type-specific differences in vesicle and virus sorting. Whereas the first could explain differences in intraaxonal transport between field virus isolates and laboratory-adapted fixed RABVs, the second may explain the contradictory concepts of anterograde transport in DRG or other sensory neurons (Bauer et al., 2014b; Tsiang et al., 1989; Zampieri et al., 2014) as well as the model of exclusive retrograde transport (Ugolini, 2011), which may be restricted to peripheral moto- and CNS neurons.

110

Discussion

7.1.1. Accumulation of RABV N particles in DRG axons

In order to assess whether specific differences in the ecto-domain of different chimeric Lyssavirus G proteins affect the transport of RABV in DRG axons, RABV chimeras with the attenuated virus backbone SAD L16 (Schnell et al., 1994) were generated. The chimeric viruses encoded ecto- and TM-domain sequences of fixed RABV CVS-11, a virulent RABV isolate from a vampire bat and of two bat lyssaviruses, EBLV-1 and DUVV (figure 8, A). Similar to previous work with ecto-domain RABV chimeras (Genz et al., 2012), replication in cell cultures and primary neurons confirmed viability of all recombinant viruses. Detection of N particles in axons after infection of DRG neurons in a compartmentalized culture system (figure 8, C) showed that N-particle transport in the DRG axons did occur for all tested chimeras. These data suggested that differences in the ecto- and TM-domains of the five tested Lyssavirus G proteins did not affect G-dependent anterograde transport in a detectable manner, although a G and N particle co-transport was not directly investigated. The data further indicated that the tested Lyssaviruses either do not differ in the anterograde transport, or that other G-domains or non-G sequences might play a role.

7.1.2. Anterograde transport of non-fixed N and G virus particles in DRG axons

Although chimeric viruses represent a useful tool to investigate gene specific functions on a constant genetic virus backbone, direct analysis of intra-neuronal spread of virulent field virus strains was considered more reasonable. The availability of field virus clones of dog and fox origin allowed investigation of intra-neuronal virus accumulation in a complete field virus context. Importantly, the genetic background as well as the highly virulent character of the parental viruses and their recombinant clones rRABV DogA and rRABV Fox have been well characterized (Nolden et al., 2016). rRABV DogA and rRABV Fox N and G protein detection in axons of infected DRG neurons indeed indicated that also the field virus clones were directed to the axons (cf. figure 9 and 10). Additionally, at one and two days post infection the detection of partially co-localizing N and G particles with diameters < 0.5 µm in the distal axonal regions strongly supported the anterograde transport of newly formed RABVs (cf. figure 11).

111

Discussion

This was similar to the anterograde transport previously observed for RABV with fixed virus G protein and consistent with the monitored partial overlap of P and G particles during anterograde axonal transport (Bauer et al., 2014b). The not fully overlapping N and G particles (see details in figure 11) detected in this study were more in favor of the “separate model” of intra-neuronal virus transport. However, because of the resolution limits of conventional laser scaning microscopy, evidence has to be provided by super-resolution microscopy. The fact that more G than N signals were accumulating in the distal parts of the axon (figure 11, green and red signals, respectively) was also consistent with previous observation of multiple G-containing transport vesicles, of which only some were connected to labeled RNPs (Bauer et al., 2014b). It is most likely that the N particles of rRABV DogA and rRABV Fox were also transported in a G-dependent manner within the DRG axons. With the full length clones for rRABV DogA and rRABV Fox it is now possible to modify these viruses genetically by G-gene deletions and fluorescence labeling to further investigate the axonal transport of the field viruses by site-directed mutagenesis or fluorescence-labeled RNPs. Overall, the lack of differences in intra-axonal accumulation of N particles of different chimeric RABVs and the analysis of two field virus clones, support a model of separate transport for cell culture adapted as well as for field virus strains. These findings are consistent with possible anterograde transport in natural infections, which may depend on the inoculation site and its innervation by sensory- and motor-neurons (reviewed in (Begeman et al., 2017)).

7.2. Cell culture passages of rRABV Dog and rRABV Fox lead to specific mutations in G and P

The glycoprotein has been shown to be a decisive factor in RABV pathogenicity, e.g. by insertion of “virulent G proteins” in attenuated vaccine viruses (Finke and Conzelmann, 2005; Morimoto et al., 2000). G proteins of non-fixed field isolates are considered highly virulent and not adapted to cell culture or non-natural animal models. Consecutive virus passages in laboratory animals or cell cultures therefore often result in virus attenuation (Lepine, 1938; Yamada et al., 2012). Direct comparison of known field viruses with adapted or attenuated lab strains only provides 112

Discussion limited information about adaptive mutations, since multiple passage histories led to the accumulation of multiple mutations of which only few may be connected to adaptation directly. In addition, sequence information about the original field virus isolates is poor in many cases. Here, the clonal character of the recombinant viruses rRABV DogA and rRABV Fox (Nolden et al., 2016) was used as a genetically defined starting point for cell culture passages on different cell lines (cf. figure 12). The limited number of virus passages indeed led to the identification of adaptive mutations that support virus replication and spread in different cell lines. Additionally, the in vitro characterization provides an important molecular basis for future pathogenesis studies, in order to clarify whether cell culture adaptive mutations directly affect the pathogenic potential or whether acquisition of further mutations are required for virus attenuation.

7.2.1. Increased virus titer after cell culture passage

Whereas titration of infectious virus titers in supernatants from the passage experiment did not allow clear conclusions (cf. figure 13), comparative replication kinetics with viruses from the 1st and 10th passage revealed improved virus growth for rRABV Dog-B (cf. figure 14, A), rRABV Dog-M (cf. figure 14, E) and rRABV Fox-M (cf. figure 14, F), whereas growth of rRABV Fox-B (cf. figure 14, B), rRABV Dog-N (cf. figure 14, C) and rRABV Fox-N (cf. figure 14, D) was not increased after the 10th passage. However, sequencing of rRABV Fox-B also revealed BHK cell culture specific adaptive mutations, similar to rRABV Dog-B (cf. table 15). This could be due to early adaptation events at the level of rRABV Fox rescue from cDNA in BHK cells (cf. figure 12), where adaptive mutations may have been selected in the first rounds of virus replication. Similarly, comparable growth of rRABV Dog-N and rRABV Fox-N (cf. figure 14, C and D, respectively) of the 1st and 10th passage was most likely due to the selection of NA 42/13 cell specific adaptation during stock preparation on the neuroblastoma cells (cf. figure 12). Already at P1 rRABV Dog exhibited the D266N amino acid replacement compared to the parental full length cDNA clone (cf. table 15).

113

Discussion

7.2.2. Identification of adaptive mutations in the G protein

Detection of the D266N and K444N amino acid replacements in BHK cell passaged rRABV Dog and rRABV Fox demonstrated independent selection of both mutations in two different virus isolates (cf. table 14). The change of aspartic acid (K) to asparagine (N) at position 266 was found in all other passaged viruses and thus might represent a more general cell culture adaptation marker. K444N only appeared after BHK cell passage and thus represents a BHK cell specific mutation. Notably, also after passages on MDCK-II cells, both, rRABV Dog and rRABV Fox, selected similar mutations leading to the amino acid replacements R365S and R369G, respectively. Although not further investigated, it is conceivable these mutations represent MDCK cell specific adaptations. Cell culture adaptation of fixed RABV is well known to require additional N-glycosylation sites and indeed the D266N replacement identified here resulted in an Asn-X-Thr sequon that has been previously described as an additional glycosylation site in the RABV G protein context (Yamada et al., 2014). Whereas non-fixed RABV often contain only two N- glycosylation sites at Asn56 and Asn338, fixed RABV tend to have additional (potential) N- glycosylation sites at position Asn177, Asn223 and/or Asn266 (Anilionis et al., 1981; Hamamoto et al., 2015; Shakin-Eshleman et al., 1992; Yamada et al., 2013; Yamada et al., 2012). N- glycosylation of Asn266 also affects the stability of G and sialyation of distant N-glycosylation sites (Wojczyk et al., 2005). Both, increased N-glycosylation status and higher levels of G in infected cells might contribute to an improved replication of fixed RABV in cell culture. The here described reproducible selection of D266N in two independent RABV isolates showed that there are limited possibilities of adaptation through enhanced N-glycosylation, most likely because of structural constraints in the RABV G. Considering the high overall similarity with 95.5% amino acid identity of the analyzed fox and dog viruses (cf. supplementary table 1), together with previously identified additional glycosylation sites at positions 177 and 223 in other RABV G proteins (Anilionis et al., 1981; Hamamoto et al., 2015; Shakin-Eshleman et al., 1992), those constraints may differ between more divergent RABVs leading to additional glycosylation sites at different positions. Most differences between the dog and fox viruses are actually located in the cytoplasmic domain of G (amino acid identity 94.9%), whereas the ecto-domain contains only 6 amino acid differences. This is in accordance with the high degree of conservation among RABVs of different host species origin (Khawplod et al., 2006). Because of the high degrees of

114

Discussion conservation, it is conceivable the cell culture adaptive mutations in the ecto-domains may affect virus fitness and pathogenesis in vivo. In agreement to the here presented data, the glycosylation status of transmembrane proteins is not only important for proper folding and assembly of trimeric structures, but plays also an important role in glycoprotein transport processes, cell surface expression and secretion (summarized in (Varki, 1993). However, as the additional glycosylation site at position 266 was not yet sufficient to support efficient surface transport in BHK cells in the rRABV Dog context, other cell type specific mutations may also contribute. In contrast to D266N, the K444N exchange after virus adaptation to BHK did not result in a typical N-glycosylation motif, indicating that efficient virus replication on BHK cells requires also other adaptations than increased glycosylation. The BHK cell specific adaption was further supported by sequence database searches that revealed the adaptive D266N and K444N mutations in most BHK cell passaged virus strains (cf. supplementary table 5, asterisk marked (*) strains), including the attenuated vaccine strain SAD B19 (Conzelmann et al., 1990). Considering the high reproducibility of the detected mutations, the combination of D266N and K444N may represent a general BHK cell adaption motif (cf. supplementary table 5). Whereas D266N and K444N were found in both, fox and dog derived viruses, A419T only appeared in rRABV Dog. As complementation experiments showed this mutation is required in the dog virus context to improve virus release (cf. figure 17) (see below for further discussion: in trans complementation), A419T may represent a virus strain specific adaptation that appeared after selection of K444N, as shown by amplicon sequencing at different passage numbers (cf. table 15). Structural alterations by the A419T mutation may be required in the rRABV Dog context to support adaptation by K444N, whereas adapted rRABV Fox still contained an alanine residue at positon 419. Notably, only a limited number of possibly adaptive mutations as well as a combination of specific mutations were required to allow more efficient virus production on the different cell lines. In addition to the number of detected mutations, also the time course of appearance was of interest. Since for D266N amplicon sequencing revealed a frequency of already 99.9% in rRABV Dog-B-1 (cf. table 15), it is most likely that this mutation accumulated during virus rescue or virus stock preparation on NA 42/13 cells. The consecutive appearance of the amino acid exchanges in the order D266N, K444N and A419T in G illustrated the importance of those mutations. Notably, an additional amino acid replacement at position 206 was only

115

Discussion transient and at low prevalence in the BHK passaged rRABV Dog, whereas it was prevailed in NA 42/13 cells (cf. table 15). This further supports the observation that specific cell culture conditions had a major impact on the selection of specific mutations. In trans complementation of the G-gene deleted RABV SAD L16 by cloned G genes from BHK cell passaged rRABV Dog with 2-log fold increased virus titers indeed confirmed the role of D266N, A419T and K444N for increased virus production (cf. figure 17). Together with mutational dissection of improved virus release these data provided evidence for a functional role of these mutations BHK cell adaptation. These data also strongly indicated that efficient virus release is a major bottleneck in cell culture adaptation, instead or in addition to previously discussed roles of receptor specificities and uptake kinetics (Dietzschold et al., 2008). For D266N, a strong attenuating effect can be excluded because of its presence in virulent fixed RABV (Yamada et al., 2014; Yamada et al., 2013) and re-isolation of D266N containing viruses from a raccoon, which has been experimentally infected with rRABV Fox (Nolden et al., 2016). The latter may have even improved in virulence, as the D266N mutants were selected from a challenge virus with only limited passages on NA 42/13 cells and the D266N mutation was only a minor single nucleotide polymorphism (Nolden et al., 2016). Whether introduction of K444N is accompanied with reduced virulence has to be tested in future animal experiments.

7.2.3. Accumulation of mutations in the P protein

In addition to the mutations in G, amino acid exchanges in the P protein at position R293C, M83R, L277V and R293H emerged in rRABV Dog-B-10, Dog-N-10, Dog-M-10 and Fox-M- 10, respectively (cf. table 14). Three of the P-mutations were located in the C-terminal region, of which two, R293C and R293H, were located at the same amino acid position, strongly indicating relevance for cell culture adaptation. Accordingly, a gradual increase in the prevalence of the R293H mutation in rRABV Dog-B during passage was monitored (cf. table 15). The structure of the C-terminus of P exhibits a positively charged path and a hydrophobic pocket with an exposed tryptophan side-chain at opposite surfaces of the molecule (Mavrakis et al., 2004). Further analyses revealed that those interfaces represent two functionally and

116

Discussion spatially independent regions with critical roles in genome replication and STAT- binding/antagonism, respectively (Wiltzer et al, 2014). Together with the amino acids K211, K214, K256, K260 and K282, R293 is part of the positively charged C-terminal part responsible for N-RNA binding (Mavrakis et al., 2004). Thus, the mutations R293H and R293C in rRABV Fox-M and rRABV Dog-B most likely affect N-RNA binding and virus genome replication. Apart from the improved cell surface transport of the glycoprotein, alterations on the replication level may lead to improved cell culture replication.

7.2.4. Mutations in non-coding gene borders

Similar to the P mutations, mutations in non-coding genome regions (NCR) could also contribute to altered virus replication. The NCRs include terminal promoters and internal cis- action transcription signals that are crucial for efficient virus gene expression and replication (cf. paragraph 2.3). For instance, the length of the intergenic region between RABV transcription stop and restart signals affects downstream transcript synthesis, gene expression and pathogenicity (Finke et al., 2000). Elongation of the P-gene TTS from 7 to 8 A is supposed to support more efficient virus spread (Virojanapirom et al., 2016). Compared to the original field isolate RABV Dog Azerbaijan, the cell culture passaged virus clone rRABV Dog-B acquired the insertion of two U nucleotides in the P/M-gene border, resulting in an elongated polyadenylation signal of the respective TTS from 6 to 8 U (cf. table 16). Presence of a suboptimal, 6 U polyadenylation signal in the P/M gene border of the authentic RABV Dog Azerbaijan isolate may decrease transcription termination efficiency and thus increases the level of bi-cistronic, P and M ORF comprising read-through transcripts. Although functional analyzes in a minigenome reporter assays or real time PCR transcript quantification have not been performed, it is conceivable that alterations in the polyadenylation signals affected virus gene expression. In addition to the above described limited G-dependent virus release, limited M translation because of increased read-through at the original 6 U P/M gene border may also contribute to inefficient virus release, since M has been shown to be the major factor in RABV particle budding (Mebatsion et al., 1996a). Sequencing of homo-polymers of more than four bases by semiconductor sequencing, like Ion Torrent and pyrosequencing techniques, can be problematic (Quail et al., 2012) and differentiation between 6, 7 and 8 U stop signals is difficult, but can be solved by more reads (Marston et al., 2013). For exact analysis of the alterations in the P/M gene border, amplicon

117

Discussion sequencing by Illumina MiSeq technology (Minoche et al., 2011) was used. This allowed verification and quantification of the P/M transcription stop signal alterations of rRABV Dog- B over time (cf. figure 15, B). With already 89.9% of the 8 U signal in rRABV Dog-B-1 the data showed that adaptation of this signal already occurred in the course of virus stock production on NA 42/13 cells. Notably, the fox virus clone also contained, with only 5 U (P/M gene border), a truncated TSS (cf. table 17), indicating a common feature of at least some field viruses. However, in contrast to RABV Dog, the 5 U signal was not elongated even after the 10th passage on the different cell lines, indicating that in the context of the fox virus transcription downregulation of M protein expression may not represent a strong bottleneck for cell culture replication. Reduced pathogenicity after serial passage of RABV in non-neuronal host cells has been described (Ito et al., 2001b; Morimoto et al., 1998; Vos et al., 1999). However, others also described increased virulence after field isolate passage on BHK cells (Virojanapirom et al., 2012). The latter described amino acid replacements in G after passage on BHK cells, which were not identical to the here detected mutations and a 7 U P stop signal that was truncated to 6 U. Whereas the truncated P stop signal is in favor of a theory in which limited M translation leads to higher virulence, it remains unclear whether it was selected during the BHK cell passage.

7.2.5. Accumulation of non-fixed rRABV Dog-B at Endoplasmic reticulum

The exact mechanism how the observed mutations allowed for better virus replication in cell culture remains unknown. However, cell culture passaging of rRABV Dog-B resulted in an altered distribution of the G protein in a cell line-specific manner. In non-adapted P1 rRABV Dog-B G accumulated predominantly at ER structures and not at the host cell membrane (cf. figure 20). Most likely, surface transport of G was inefficient because of insufficient N- glycosylation and the need of additional supportive mutations (as discussed above). Insufficient N-glycosylation of RABV G is known to affect cell culture replication. Glycosylation sites at positions 338 and 266 have already been shown to be important for correct folding of nascent G and transport processes inside the cell (Hamamoto et al., 2015; Shakin-Eshleman et al., 1992; Yamada et al., 2014). Deletion of all N-glycosylation sites even

118

Discussion completely blocks cell surface expression of the G protein (Burger et al., 1991; Shakin- Eshleman et al., 1992). The here identified adaptation at amino acid position 266 in both, rRABV-Fox and rRABV- Dog, was thus in fully agreement with the previously published data and recent findings for other RABV field isolates with poor detection of field virus G at the cell surface but strong surface localization for fixed RABV CVS strain (Hamamoto et al., 2015; Yamada et al., 2013; Yamada et al., 2012). Limited cell surface presentation of field RABV G together with efficient surface presentation after insertion of an extra N-glycosylation site at position 223 (Hamamoto et al., 2015) was also in agreement with the here described increased cell surface expression of rRABV Dog G protein as a consequence of cell culture adaptation. Initial accumulation in the ER and efficient surface expression after 10 passages on BHK cells (cf. figure 20 and 18, respectively), together with increased virus release in the in trans complementation assays (cf. figure 16 and 17) showed that increased surface expression indeed correlated with a more efficient virus release. However, additional modifications like the K444N mutation in BHK cells were required to increase the virus release (cf. figure 17), indicating that additional mutations, independent of the additional glycosylation site are required in a cell line dependent manner. In contrast to BHK cells, rRABV Dog was already located at the plasma membrane at early passages in NA 42/13 cells (cf. figure 18, 1st passage NA), indicating that in NA 42/13 cells the transport of G to the cell surface was not restricted. However, the adaptive mutation D266N must have been selected already in the course of virus stock production on NA 42/13, since it was already detected in rRABV Dog-B-1 (cf. table 15). Considering the important role of the additional glycosylation sites in RABV G surface transport (see discussion above), it is likely that also in NA 42/13 cells increased surface transport is a major factor in adaptation. Accordingly, G protein of non-fixed RABV (Kyto strain) was not plasma membrane associated on MNA (mouse neuroblastoma) cells (Hamamoto et al., 2015). It is therefore conceivable that limited surface expression of G is a more general phenotype of field RABVs, even in cells of neuronal origin. The perinuclear localization of the G protein in MDCK-II cells infected with rRABV Dog - M - 1 was similar to the G localization of rRABV Dog-B-1 in BHK cells (cf. figure 18, 1st passage MDCK). More peripheral G accumulation after serial passages on MDCK cells together with accumulation of amino acid substitutions at positions 365 and 369 in rRABV

119

Discussion

Dog-M-10 and rRABV Fox-M-10 suggested that also in MDCK-II cells the adaptive glycosylation site at 266 must be supported by additional, cell line specific mutations. By electron microscopy it was investigated whether the intracellular accumulation of rRABV DogA G protein affected infectious virus release at the cell surface as well as assembly of virus particles (cf. figure 21, A – D). Virus particle accumulation in a dilated ER, similar to infected NA 42/13 cells or previous work with attenuated RABV (Finke et al., 2010; Pollin et al., 2013), showed that the process of virus assembly at membranes was not affected per se. Instead, detection of a few RABV particles at the cell surface of infected BHK cells and multiple particles at the surface of NA 42/13 cells supported the hypothesis that cell type specific differences are involved in the release of rRABV Dog at the cytoplasmic membrane. Because intracellularly assembled virus particles are not considered to contribute to extracellular virus particles (Finke et al., 2010; Pollin et al., 2013) and thus only plasma membrane assembled virions are relevant of infectious virus production in cell culture, these data matched to the observe ER retention of the non-adapted G protein (cf. figure 21, E + F). Although M has been shown to be the major factor in virus budding at the ER (Finke et al., 2010) as well as plasma membranes (Mebatsion et al., 1996a) and G-less and non-infectious virus particles could be released even at G protein retention in the ER, G contributes to the efficiency of the particle release at the plasma membrane (Mebatsion et al., 1996a). The limited detection of budding or extracellular virus particles by electron microscopy observed here is therefore in agreement with the loss of budding efficacy in the absence of G protein observed previously

7.2.6. Cell culture adaptation and virulence

The here provided data suggest, that faster replication and improved virus release represent a major difference of cell culture adapted to non-fixed field RABVs. Although pathogenicity studies have not been performed yet, it can be speculated that the level of virulence is determined by the balance of replication competence and virus release. However, it remains to be investigated whether more efficient virus replication and release indeed inversely correlate with virulence, or whether other factors contribute to this. On the one hand it is conceivable that higher replication levels might lead to higher levels of antigen presentation, stronger immune responses and thus to progressive attenuation of RABVs. On the other hand it is also

120

Discussion possible that increased RABV replication efficiency, to a certain extent, supports efficient virus spread in vivo and therefore disease development. This could explain the observation that some fixed RABVs are still virulent but exhibit a more stable time course of disease. Some fixed RABVs induce a much stronger immune response than non-fixed field viruses, including increased neuronal degradation and inflammation (Miyamoto and Matsumoto, 1967; Yan et al., 2001). Direct comparison of non-fixed silver-haired bat virus (SHBV) and fixed CVS-24 B2C RABV strains showed that the non-fixed virus was more pathogenic and less inflammatory, while the fixed virus induced a stronger immune reaction due to the upregulation of pro-inflammatory genes (Wang et al., 2005). However, since the SHBV and CVS-24 viruses do not have the same origin, it is unclear whether the observed differences in pathogenicity and inflammation are directly connected to fixation. In contrast to those studies, the here developed cell-culture adapted RABV of fox and dog origin with both, adapted and progenitor field viruses available, now allow the experimental dissection of adaptation, pathogenicity and attenuation on the basis of genetically defined and phenotypically characterized virus pairs. Limited virus production and G protein surface presentation, together with a more or less strict trans-synaptic RABV spread may lead to late recognition of the virus in vivo and therefore to delayed immune responses and a lethal outcome of the infection. In order to confirm this hypothesis, further experiments need to be performed, e. g. by infection and direct comparison of neuronal cultures with passaged and non-passaged RABVs from Fox and Dog. Interestingly, infection experiments with cell culture adapted RABV in mice led to the identification of non-productively infected microglia cells as the main producer of antiviral interferon (Pfefferkorn et al., 2016), demonstrating that the non-synaptic release of infectious virus and infection of non-neuronal cells in infected tissues may be a major factor in host immune responses to RABV infections in the central nervous system

7.3. Generation of RABV expressing shRNA against cellular targets

A main benefit of the RABV expressing shRNAs could be a selective host gene targeting in virus infected cells. Generally shRNA targets genes in infected and not infected cells, but such approaches would offer novel possibilities to study the host cell reaction to RABV infection in vivo without undesired manipulation of surrounding, not-infected cellular 121

Discussion environments. In the particular case of RABV, where only neurons are infected through specific trans-synaptic spread (Tsiang et al., 1983), expression of shRNA would represent an achievement in the RABV research in the delivery of shRNAs. In case of RABV induced upregulation of cellular genes like DYNLL1 (Bauer et al., 2015; Tan et al., 2007), RABV expressed shRNAs may allow for direct counteracting in the infected cell without deregulation of affected pathways in not infected cells. Generally, shRNAs can be transduced into the host cells by DNA virus vectors such as Adeno-associated virus (AAV) (Machida et al., 2013). The shRNAs are transcribed by cellar DNA polymerases and the transcripts are accessible for RNA modification by nuclear Drosha. In case of cytoplasmically replicating negative sense RNA viruses, like RABV, transcription of viral 5´-capped and poly-adenylated mRNA depends on the viral RNA-polymerase and these mRNAs are considered not accessible for RNA modification by nuclear factors. Neither direct synthesis of siRNAs with correct 5’- and 3’-ends nor Drosha mediated processing of miR-shRNAs were considered likely. However, examples of shRNA expressing RNA viruses like SIBV, TBEV and VSV (Langlois et al., 2012; Rouha et al., 2010; Shapiro, 2013), the latter closely related to the here investigated RABV, indicated that either cytoplasmically transcribed miR-shRNAs enter the nucleus for processing or that cytoplasmic processing of the transcripts can occur. Cytoplasmic RNA viruses like VSV are highly cytopathic and it cannot be excluded that processing of the shRNA transcripts was a result of nuclear membrane leakiness and release of Drosha into the cytoplasm. It was unclear whether similar approaches can be successful with less cytopathic rhabdoviruses, like RABV. Successful rescue of the miR-shRNA encoding recombinant RABVs and stability of the inserted sequences as determined by RT-PCR sequencing of rRABV shDYNLL and rRABV shANP, together with replication kinetics comparable to control RABVs (figure 23) showed that neither expression of an RNA with a potentially strong hairpin secondary structure nor the presence of miR-30 sequences in the virus genome affected virus replication. Recombinant RABVs expressing functional internal ribosome entry site (IRES) sequences with strong RNA secondary structures already showed that the essential packaging of viral RNAs in ribonucleoproteins is not affected by strong RNA secondary structures (Marschalek et al., 2009). Moreover, miR-30 sites may not be accessible for Drosha cleavage after packaging of the genomic virus RNA into RNPs, even at presence of some RNAse activity in the cytoplasm of infected cells as suggested for TBEV and SINB (Rouha et al., 2010; Shapiro

122

Discussion et al., 2012). Therefore cleavage of the genomic virus RNA during virus replication is not likely. Stability of shRNA encoding rhabdovirus genomes was indicated by the here shown growth kinetics (cf. figure 23, A + B) and previous results for shRNA expressing VSV (Langlois et al., 2012). Although disruption of DYNLL1 binding motifs in P and L resulted in decreased viral titers (Bauer et al., 2015), unaffected replication kinetics of the RABVs expressing DYNLL1 specific miR-shRNAs indicated that upregulation of DYNLL1 mRNA and protein level are not directly connected to RABV replication level in cell cultures. Interestingly, the role of DYNLL1 in primary transcription of RABV after release of the RNP into the cytoplasm is considered independent of DYNLL1 mRNA upregulation (Bauer et al., 2015; Tan et al., 2007). According to a proposed model (Bauer et al., 2015) in which DYNLL1 is trapped in RABV inclusion bodies at later stages of the infection and thereby the level of free DYNLL1 is reduced, the main reason for DYNLL1 upregulation may be DYNLL1 gene auto- regulation through the transcription factor ATM/ATR-Substrate CHK2-Interacting Zinc Finger Protein (ASCIZ). It is most likely that the here generated shRNA expressing viruses with shRNA expression, earliest at the onset of primary transcription, are selectively affected in later phase ASCIZ-dependent DYNLL1 upregulation but not during primary transcription. The potential use of the corresponding viruses for the analysis of the impact on DYNLL1 and other ASCIZ regulated host genes is possible, but may also be limited, since shRNA activities in non-dividing neurons remains unclear (see discussion below).

7.3.1. Downregulation of DYNLL1 mRNA and protein level by RABV expressing miR- shRNAs

Even though it was not possible to demonstrate expression of functional miR-shRNAs in rat neurons, downregulation of DYNLL1 at mRNA and protein level in murine NA 42/13 and NIH 3T3 cells (cf. figure 24 and 25) by a mouse specific miR-shRNA against DYNLL1 and down regulation of ANP32B in human HEK 293T cells by a human specific miR-shRNA against ANP32B (cf. figure 27) strongly indicated that the employed strategy works in principle in standard cell lines. Efficient downregulation of DYNLL1 mRNA and protein level by rRABV GFP-shDNYLL and rRABV shDYNLL expressing murine specific miR- shRNA in murine neuroblastoma and fibroblastoid cell lines (cf. figure 24 and 25) and some

123

Discussion downregulation of DYNLL1 mRNA level even in human embryonic kidney cells (cf. figure 27, C) showed that the expressed miR-shRNAs were active in cells of both species. As both, DYNLL1 mRNA and protein levels were downregulated in rRABV GFP-shDYNLL1 and rRABV shDYNLL infected NIH 3T3 cells and no similar effects were observed for the control viruses expressing no or human ANP32B specific miR-shRNAs, it can be concluded that the observed downregulation was shRNA sequence specific. Notably, in the NA 42/13 neuroblastoma cells downregulation of DYNLL1 protein level even in rRABV GFP-shANP infected cells at 3 and 4 days post infection indicated some influence of the miR-shRNA expressing control virus on DYNLL1 level. Since, in contrast to HEK 293T cells, a decrease in ANP32B mRNA level was not detectable in the NA 42/13 cells (cf. figure 24, A + C), it is unlikely that ANP32B knock-down was responsible for the observed decrease of DYNLL1 protein levels at 3 and 4 dpi. So far it remains unclear, whether infection of the neuroblastoma cells with rRABV GFP-shANP was associated with negative effects on cellular and viral protein expression or whether slight differences in the virus growth kinetics led to a less efficient upregulation of DYNLL1 replication. Although the replication curves for RABV GFP-shANP did not show strongly reduced virus production (cf. figure 23, A), the titers of rRABV GFP-shANP remained below those of rRABV L16 GFP and rRABV GFP shDYNLL. In contrast to the DYNLL1 miR-shRNAs, which led to DYNLL1 knock down in the murine and human cell lines, the ANP32B mRNA knock down by rRABV GFP-shANP and rRABV shANP was only detectable in human HEK293T cells (cf. figure 27). This strongly indicated a more species-specific activity of the ANP32B miR-shRNA, which might be caused by three nt differences between the murine and human target sequences (cf. figure 26). The results confirmed previously reported downregulation of ANP32B in HEK 293T cells by plasmid derived miR-shRNAs of the same sequence (Bauer et al., 2014a). Similar to DYNLL1, a reduction of ANP32B mRNA levels was detectable already at 2 days post infection. However, a clear reduction of ANP32B protein levels was visible only at 3 and 4 days post-infection (cf. figure 27, B + C). The delayed and rather late effect on protein levels may be a result of long half-life times of ANP32B protein, present at the time point of infection. By investigating mRNA and protein levels at days two, three and four post infection, the earliest time point of downregulation tested was two days post infection, according to the theory that only later phase host gene regulation may be affected by the virus expressed

124

Discussion

RABVs (see above). Reproducibility of the shRNA virus specific downregulation was not only demonstrated by the use of different cell lines but also by analysis of three different time points, which provided reproducible data for each infection experiment and largely excluded individual variations because of sample preparation, RT-PCR reactions and western blotting. However, in individual samples, for instance the lower ANP32B mRNA level at 2 dpi in not infected NA 42/13 cells (cf. figure 24, A) as well as the lower protein level of DYNLL1 in rRABV GFP-shANP infected NA 42/13 cells (cf. figure 24, B), individual variations could not be excluded. The RNA and protein level may have been also influenced by general effects of the RABV infection on the cellular gene expression, as lower ß-tubulin levels in virus infected cells compared to not infected cells were detected (cf. figure 24, B). Moreover, potential secondary effects of shRNA knock-downs on the cellular gene expression could have an effect in rRABV shDYNLL infected cells, possibly due to alterations in the transcription factor ASCIZ dependent host cell gene expression, which is regulated by DYNLL1 (Jurado et al., 2012) (see also discussion above). Also in rRABV shANP infected cells, host cell expression could be affected due to the role of ANP32B in host gene expression and apoptosis regulation (Munemasa et al., 2008; Shen et al., 2010). The actual processing of cytoplasmically expressed miR-shRNA by RABVs is still unknown. To elucidate this, a truncation of the rRABV GFP-shRNA construct was performed to generate a shorter “shRNA - only - construct” since it was speculated that shorter mRNAs may more easily enter the nucleus by diffusion for efficient Drosha processing. For this, the GFP coding sequence was deleted and rRABV shRNA expressing a 0.5 kb miR-shRNA was generated (cf. figure 22, B). Although a direct comparison of GFP comprising and non- comprising miR-shRNA viruses has not been done, multiple experiments in which the truncated miR-shRNA transcripts exhibited a less pronounced effect on the DYNLL1 mRNA and protein level in NA 42/13 and NIH 3T3 cells (cf. figure 24 and 25) make an increased nuclear import of the truncated mRNA for Drosha processing unlikely. Potential positive effects of the upstream GFP ORF on the shRNA knockdown of the target mRNAs could be due to differences in the mRNA stabilities and increased accumulation of miRNA-shRNA transcripts. Moreover the GFP ORF could have positive effects on the mRNA secondary structure as well as the formation of the hairpin structure for the required miR-shRNA processing. Still, there is no reasonable explanation on how the cytoplasmically transcribed miR-shRNAs are processed by Drosha or other nucleases. It was shown that Drosha could translocate to the

125

Discussion cytoplasm during a viral infection (Shapiro et al., 2014). Upregulated Drosha protein level were detected for SINV, VSV and influenza virus (lacking NS1) as well as cells treated with poly (I:C) (dsRNA), indicating an antiviral effect of Drosha (Shapiro et al., 2014). Drosha was present in the cytoplasm of cells infected with positive strand RNA viruses (Aguado et al., 2017; Rouha et al., 2010; Shapiro et al., 2012; Shapiro et al., 2010), which is most likely due to cytopathic effects or induction of nuclear export. The RABV tested here, used as a vector for the shRNA expression is known to not be cytolytic and does not induce strong cytopathic effects (Finke et al., 2000). The data provided here are in favor of a model in which a major impact of cytopathic effects on the mRNA processing can be neglected and may be due to the presence of Drosha in the cytoplasm. One possibility is virus-induced nuclear export of Drosha to the cytoplasm as proposed by Aguado et al. (2017). However, the easiest explanation is uptake of shRNA-encoding mRNAs in the course of nucleus reformation or release of Drosha to the cytoplasm in the course of cell division, which includes the envelope breakdown and reformation. This would mean that cell division is essential for the shRNA-mediated downregulation of cellular genes by RABV vectors described here. In fact, this correlates with the findings, that neither the expression of shRNA from rRABV GFP-shRNA nor from the truncated rRABV shRNA did result in a detectable downregulation of cellular DYNLL1 or ANP32B mRNA in hippocampus neurons (cf. figure 28 B). This also questions the usability of such shRNA-.expressing RABVs in non-dividing neuronal cells. Two follow-up experiments are required to clarify this issue: infection experiments on cell cycle inhibitor-treated NA 42/13 cells and the use of non-dividing mouse neurons for infection with rRABV GFP-shRNA and rRABV-shRNA. Overall, the downregulation of cellular genes with specific miR-shRNAs expressed by an RABV vector was effective in dividing, immortalized cells. This makes RABV a potential vector for the delivery of miR-shRNA and the regulation of cellular genes in dividing cellular systems and allows for further investigations of host responses, e.g. DYNLL1 upregulation, in those RABV-infected cell systems. However, as first experiments in primary neurons did not indicate shRNA activity, it remains unclear whether this approach can be applied to investigate RABV-host-interactions in vivo.

126

References

8. References

Aguado, L.C., S. Schmid, J. May, L.R. Sabin, M. Panis, D. Blanco-Melo, J.V. Shim, D. Sachs, S. Cherry, A.E. Simon, J.P. Levraud, and B.R. tenOever. 2017. RNase III nucleases from diverse kingdoms serve as antiviral effectors. Nature. Anilionis, A., W.H. Wunner, and P.J. Curtis. 1981. Structure of the Glycoprotein Gene in Rabies Virus. Nature. 294:275-278. Arechiga Ceballos, N., S. Vazquez Moron, J.M. Berciano, O. Nicolas, C. Aznar Lopez, J. Juste, C. Rodriguez Nevado, A. Aguilar Setien, and J.E. Echevarria. 2013. Novel lyssavirus in bat, Spain. Emerg Infect Dis. 19:793-795. Astic, L., D. Saucier, P. Coulon, F. Lafay, and A. Flamand. 1993. The Cvs Strain of Rabies Virus as Transneuronal Tracer in the Olfactory System of Mice. Brain Research. 619:146-156. Badrane, H., C. Bahloul, P. Perrin, and N. Tordo. 2001. Evidence of two Lyssavirus phylogroups with distinct pathogenicity and immunogenicity. Journal of virology. 75:3268-3276. Banerjee, A.K. 1987. Transcription and replication of rhabdoviruses. Microbiol Rev. 51:66-87. Banyard, A.C., D. Selden, G. Wu, L. Thorne, D. Jennings, D. Marston, S. Finke, C.M. Freuling, T. Muller, J.E. Echevarria, and A.R. Fooks. 2018. Isolation, antigenicity and immunogenicity of Lleida bat lyssavirus. J Gen Virol. Barr, J.N., S.P. Whelan, and G.W. Wertz. 1997. cis-Acting signals involved in termination of vesicular stomatitis virus mRNA synthesis include the conserved AUAC and the U7 signal for polyadenylation. Journal of virology. 71:8718-8725. Bartel, D.P. 2004. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281-297. Bartel, D.P. 2009. MicroRNAs: target recognition and regulatory functions. Cell. 136:215-233. Bartel, D.P., and C.Z. Chen. 2004. Micromanagers of gene expression: the potentially widespread influence of metazoan microRNAs. Nat Rev Genet. 5:396-400. Bauer, A., S. Neumann, A. Karger, A.K. Henning, A. Maisner, B. Lamp, E. Dietzel, L. Kwasnitschka, A. Balkema-Buschmann, G.M. Keil, and S. Finke. 2014a. ANP32B is a nuclear target of henipavirus M proteins. PLoS One. 9:e97233. Bauer, A., T. Nolden, S. Nemitz, E. Perlson, and S. Finke. 2015. A Dynein Light Chain 1 Binding Motif in Rabies Virus Polymerase L Protein Plays a Role in Microtubule Reorganization and Viral Primary Transcription. Journal of virology. 89:9591-9600. Bauer, A., T. Nolden, J. Schroter, A. Romer-Oberdorfer, S. Gluska, E. Perlson, and S. Finke. 2014b. Anterograde glycoprotein-dependent transport of newly generated rabies virus in dorsal root ganglion neurons. Journal of virology. 88:14172-14183. Begeman, L., C. GeurtsvanKessel, S. Finke, C.M. Freuling, M. Koopmans, T. Muller, T.J.H. Ruigrok, and T. Kuiken. 2017. Comparative pathogenesis of rabies in bats and carnivores, and implications for spillover to humans. Lancet Infect Dis. Ben Khalifa, Y., S. Luco, B. Besson, F. Sonthonnax, M. Archambaud, J.M. Grimes, F. Larrous, and H. Bourhy. 2016. The matrix protein of rabies virus binds to RelAp43 to modulate NF-κB- dependent gene expression related to innate immunity. Scientific Reports. 6. Benmansour, A., H. Leblois, P. Coulon, C. Tuffereau, Y. Gaudin, A. Flamand, and F. Lafay. 1991. Antigenicity of rabies virus glycoprotein. Journal of virology. 65:4198-4203. Birnboim, H.C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523. Blaney, J.E., C. Wirblich, A.B. Papaneri, R.F. Johnson, C.J. Myers, T.L. Juelich, M.R. Holbrook, A.N. Freiberg, J.G. Bernbaum, P.B. Jahrling, J. Paragas, and M.J. Schnell. 2011. Inactivated or live- attenuated bivalent vaccines that confer protection against rabies and Ebola viruses. Journal of virology. 85:10605-10616.

127

References

Botvinkin, A.D., E.M. Poleschuk, I.V. Kuzmin, T.I. Borisova, S.V. Gazaryan, P. Yager, and C.E. Rupprecht. 2003. Novel lyssaviruses isolated from bats in Russia. Emerg Infect Dis. 9:1623- 1625. Boulger, L.R., and J.S. Porterfield. 1958. Isolation of a virus from Nigerian fruit bats. Trans R Soc Trop Med Hyg. 52:421-424. Boussif, O., F. Lezoualc'h, M.A. Zanta, M.D. Mergny, D. Scherman, B. Demeneix, and J.P. Behr. 1995. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc Natl Acad Sci U S A. 92:7297-7301. Braman, J., C. Papworth, and A. Greener. 1996. Site-directed mutagenesis using double-stranded plasmid DNA templates. Methods in molecular biology (Clifton, N.J.). 57:31-44. Brito, M.G., T.L. Chamone, F.J. da Silva, M.Y. Wada, A.B. Miranda, J.G. Castilho, M.L. Carrieri, I. Kotait, and F.L. Lemos. 2011. Antemortem diagnosis of human rabies in a veterinarian infected when handling a herbivore in Minas Gerais, Brazil. Rev Inst Med Trop Sao Paulo. 53:39-44. Brzozka, K., S. Finke, and K.K. Conzelmann. 2006. Inhibition of interferon signaling by rabies virus phosphoprotein P: activation-dependent binding of STAT1 and STAT2. J Virol. 80:2675-2683. Buchholz, U.J., S. Finke, and K.K. Conzelmann. 1999. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. Journal of virology. 73:251-259. Burger, S.R., A.T. Remaley, J.M. Danley, J. Moore, R.J. Muschel, W.H. Wunner, and S.L. Spitalnik. 1991. Stable expression of rabies virus glycoprotein in Chinese hamster ovary cells. J Gen Virol. 72 ( Pt 2):359-367. Burnett, C.D. 1989. Bat rabies in Illinois: 1965 to 1986. J Wildl Dis. 25:10-19. Caillet-Saguy, C., P. Maisonneuve, F. Delhommel, E. Terrien, N. Babault, M. Lafon, F. Cordier, and N. Wolff. 2015. Strategies to interfere with PDZ-mediated interactions in neurons: What we can learn from the rabies virus. Progress in Biophysics & Molecular Biology. 119:53-59. Canter, D.M., and J. Perrault. 1996. Stabilization of vesicular stomatitis virus L polymerase protein by P protein binding: a small deletion in the C-terminal domain of L abrogates binding. Virology. 219:376-386. Ceccaldi, P.E., J. Fayet, K.K. Conzelmann, and H. Tsiang. 1998. Infection characteristics of rabies virus variants with deletion or insertion in the pseudogene sequence. J Neurovirol. 4:115-119. Celis, E., D. Ou, B. Dietzschold, and H. Koprowski. 1988. Recognition of rabies and rabies-related viruses by T cells derived from human vaccine recipients. Journal of virology. 62:3128-3134. Charlton, K.M., and G.A. Casey. 1981. Experimental rabies in skunks: persistence of virus in denervated muscle at the inoculation site. Can J Comp Med. 45:357-362. Charlton, K.M., S. Nadin-Davis, G.A. Casey, and A.I. Wandeler. 1997. The long incubation period in rabies: delayed progression of infection in muscle at the site of exposure. Acta Neuropathol. 94:73-77. Chenik, M., K. Chebli, and D. Blondel. 1995. Translation initiation at alternate in-frame AUG codons in the rabies virus phosphoprotein mRNA is mediated by a ribosomal leaky scanning mechanism. Journal of virology. 69:707-712. Chenik, M., K. Chebli, Y. Gaudin, and D. Blondel. 1994. In vivo interaction of rabies virus phosphoprotein (P) and nucleoprotein (N): existence of two N-binding sites on P protein. J Gen Virol. 75 ( Pt 11):2889-2896. Cliquet, F., E. Robardet, and E.P. Meyer. 2013. Genetic strain modification of a live rabies virus vaccine widely used in Europe for wildlife oral vaccination. Antiviral Research. 100:84-89. Conzelmann, K.K., J.H. Cox, L.G. Schneider, and H.J. Thiel. 1990. Molecular-Cloning and Complete Nucleotide-Sequence of the Attenuated Rabies Virus Sad-B19. Virology. 175:485-499.

128

References

Coulon, P., C. Derbin, P. Kucera, F. Lafay, C. Prehaud, and A. Flamand. 1989. Invasion of the peripheral nervous systems of adult mice by the CVS strain of rabies virus and its avirulent derivative AvO1. Journal of virology. 63:3550-3554. Cox, J.H., B. Dietzschold, and L.G. Schneider. 1977. Rabies virus glycoprotein. II. Biological and serological characterization. Infect Immun. 16:754-759. Cullen, B.R. 2004. Transcription and processing of human microRNA precursors. Molecular Cell. 16:861-865. Cullen, B.R. 2005. RNAi the natural way. Nat Genet. 37:1163-1165. Dacheux, L., F. Larrous, A. Mailles, D. Boisseleau, O. Delmas, C. Biron, C. Bouchier, I. Capek, M. Muller, F. Ilari, T. Lefranc, F. Raffi, M. Goudal, and H. Bourhy. 2009. European Bat Lyssavirus Transmission among Cats, Europe. Emerging Infectious Diseases. 15:280-284. Daoust, P.Y., A.I. Wandeler, and G.A. Casey. 1996. Cluster of rabies cases of probable bat origin among red foxes in Prince Edward Island, Canada. J Wildl Dis. 32:403-406. De Benedictis, P., A. Minola, E.R. Nodari, R. Aiello, B. Zecchin, A. Salomoni, M. Foglierini, G. Agatic, F. Vanzetta, R. Lavenir, A. Lepelletier, E. Bentley, R. Weiss, G. Cattoli, I. Capua, F. Sallusto, E. Wright, A. Lanzavecchia, H. Bourhy, and D. Corti. 2016. Development of broad-spectrum human monoclonal antibodies for rabies post-exposure prophylaxis. Embo Molecular Medicine. 8:407-421. Dietzschold, B., M. Gore, D. Marchadier, H.S. Niu, H.M. Bunschoten, L. Otvos, W.H. Wunner, H.C.J. Ertl, A.D.M.E. Osterhaus, and H. Koprowski. 1990. Structural and Immunological Characterization of a Linear Virus-Neutralizing Epitope of the Rabies Virus Glycoprotein and Its Possible Use in a Synthetic Vaccine. Journal of virology. 64:3804-3809. Dietzschold, B., M. Lafon, H. Wang, L. Otvos, Jr., E. Celis, W.H. Wunner, and H. Koprowski. 1987. Localization and immunological characterization of antigenic domains of the rabies virus internal N and NS proteins. Virus Res. 8:103-125. Dietzschold, B., J. Li, M. Faber, and M. Schnell. 2008. Concepts in the pathogenesis of rabies. Future Virol. 3:481-490. Dubridge, R.B., P. Tang, H.C. Hsia, P.M. Leong, J.H. Miller, and M.P. Calos. 1987. Analysis of Mutation in Human-Cells by Using an Epstein-Barr-Virus Shuttle System. Molecular and Cellular Biology. 7:379-387. Etessami, R., K.K. Conzelmann, B. Fadai-Ghotbi, B. Natelson, H. Tsiang, and P.E. Ceccaldi. 2000. Spread and pathogenic characteristics of a G-deficient rabies virus recombinant: an in vitro and in vivo study. Journal of General Virology. 81:2147-2153. Evans, J.S., D.L. Horton, A.J. Easton, A.R. Fooks, and A.C. Banyard. 2012. Rabies virus vaccines: Is there a need for a pan-lyssavirus vaccine? Vaccine. 30:7447-7454. Faber, M., M. Bette, M.A.R. Preuss, R. Pulmanausahakul, J. Rehnelt, M.J. Schnell, B. Dietzschold, and E. Weihe. 2005. Overexpression of tumor necrosis factor alpha by a recombinant rabies virus attenuates replication in neurons and prevents lethal infection in mice. Journal of virology. 79:15405-15416. Faber, M., R. Pulmanausahakul, S.S. Hodawadekar, S. Spitsin, J.P. McGettigan, M.J. Schnell, and B. Dietzschold. 2002. Overexpression of the rabies virus glycoprotein results in enhancement of apoptosis and antiviral immune response. Journal of virology. 76:3374-3381. Finke, S., K. Brzozka, and K.K. Conzelmann. 2004. Tracking fluorescence-labeled rabies virus: enhanced green fluorescent protein-tagged phosphoprotein P supports virus gene expression and formation of infectious particles. Journal of virology. 78:12333-12343. Finke, S., and K.K. Conzelmann. 1997. Ambisense gene expression from recombinant rabies virus: random packaging of positive- and negative-strand ribonucleoprotein complexes into rabies virions. Journal of virology. 71:7281-7288. Finke, S., and K.K. Conzelmann. 2003. Dissociation of rabies virus matrix protein functions in regulation of viral RNA synthesis and virus assembly. Journal of virology. 77:12074-12082.

129

References

Finke, S., and K.K. Conzelmann. 2005. Replication strategies of rabies virus. Virus Res. 111:120-131. Finke, S., J.H. Cox, and K.K. Conzelmann. 2000. Differential transcription attenuation of rabies virus genes by intergenic regions: generation of recombinant viruses overexpressing the polymerase gene. Journal of virology. 74:7261-7269. Finke, S., H. Granzow, J. Hurst, R. Pollin, and T.C. Mettenleiter. 2010. Intergenotypic replacement of lyssavirus matrix proteins demonstrates the role of lyssavirus M proteins in intracellular virus accumulation. Journal of virology. 84:1816-1827. Finke, S., R. Mueller-Waldeck, and K.K. Conzelmann. 2003. Rabies virus matrix protein regulates the balance of virus transcription and replication. J Gen Virol. 84:1613-1621. Flamand, A., and J.F. Delagneau. 1978. Transcriptional mapping of rabies virus in vivo. Journal of virology. 28:518-523. Fodor, I., V.I. Grabko, V.V. Khozinski, and M.A. Selimov. 1994. Nucleotide and Deduced Amino-Acid- Sequences of the Glycoprotein Gene of Rabies Virus-Vaccine Strain Vnukovo-32 - Brief Report. Archives of Virology. 135:451-459. Fooks, A.R., S.M. Brookes, N. Johnson, L.M. McElhinney, and A.M. Hutson. 2003. European bat lyssaviruses: an emerging zoonosis. Epidemiol Infect. 131:1029-1039. Fooks, A.R., F. Cliquet, S. Finke, C. Freuling, T. Hemachudha, R.S. Mani, T. Müller, S. Nadin-Davis, E. Picard-Meyer, H. Wilde, and A.C. Banyard. 2017. Rabies. Nat. Rev. Dis. Primers. 3. Fraser, G.C., P.T. Hooper, R.A. Lunt, A.R. Gould, L.J. Gleeson, A.D. Hyatt, G.M. Russell, and J.A. Kattenbelt. 1996. Encephalitis caused by a Lyssavirus in fruit bats in Australia. Emerg Infect Dis. 2:327-331. Freuling, C.M., M. Beer, F.J. Conraths, S. Finke, B. Hoffmann, B. Keller, J. Kliemt, T.C. Mettenleiter, E. Muhlbach, J.P. Teifke, P. Wohlsein, and T. Muller. 2011. Novel lyssavirus in Natterer's bat, Germany. Emerg Infect Dis. 17:1519-1522. Gaudin, Y. 2000. Rabies virus-induced membrane fusion pathway. J Cell Biol. 150:601-612. Gaudin, Y., S. Moreira, J. Benejean, D. Blondel, A. Flamand, and C. Tuffereau. 1999. Soluble ectodomain of rabies virus glycoprotein expressed in eukaryotic cells folds in a monomeric conformation that is antigenically distinct from the native state of the complete, membrane- anchored glycoprotein. Journal of General Virology. 80:1647-1656. Gaudin, Y., R.W. Ruigrok, M. Knossow, and A. Flamand. 1993. Low-pH conformational changes of rabies virus glycoprotein and their role in membrane fusion. Journal of virology. 67:1365- 1372. Gaudin, Y., R.W. Ruigrok, C. Tuffereau, M. Knossow, and A. Flamand. 1992. Rabies virus glycoprotein is a trimer. Virology. 187:627-632. Genz, B., T. Nolden, A. Negatsch, J.P. Teifke, K.K. Conzelmann, and S. Finke. 2012. Chimeric rabies viruses for trans-species comparison of lyssavirus glycoprotein ectodomain functions in virus replication and pathogenesis. Berl Munch Tierarztl Wochenschr. 125:219-227. Gerard, F.C., A. Ribeiro Ede, Jr., A.A. Albertini, I. Gutsche, G. Zaccai, R.W. Ruigrok, and M. Jamin. 2007. Unphosphorylated rhabdoviridae phosphoproteins form elongated dimers in solution. Biochemistry. 46:10328-10338. Geue, L., S. Schares, C. Schnick, J. Kliemt, A. Beckert, C. Freuling, F.J. Conraths, B. Hoffmann, R. Zanoni, D. Marston, L. McElhinney, N. Johnson, A.R. Fooks, N. Tordo, and T. Muller. 2008. Genetic characterisation of attenuated SAD rabies virus strains used for oral vaccination of wildlife. Vaccine. 26:3227-3235. Gibbons, R.V. 2002. Cryptogenic rabies, bats, and the question of aerosol transmission. Ann Emerg Med. 39:528-536. Gluska, S., E.E. Zahavi, M. Chein, T. Gradus, A. Bauer, S. Finke, and E. Perlson. 2014. Rabies Virus Hijacks and accelerates the p75NTR retrograde axonal transport machinery. PLoS Pathog. 10:e1004348.

130

References

Gou, D., T. Weng, Y. Wang, Z. Wang, H. Zhang, L. Gao, Z. Chen, P. Wang, and L. Liu. 2007. A novel approach for the construction of multiple shRNA expression vectors. The journal of gene medicine. 9:751-763. Gunawardena, P.S., D.A. Marston, R.J. Ellis, E.L. Wise, A.C. Karawita, A.C. Breed, L.M. McElhinney, N. Johnson, A.C. Banyard, and A.R. Fooks. 2016. Lyssavirus in Indian Flying Foxes, Sri Lanka. Emerg Infect Dis. 22:1456-1459. Guo, C.P., C.H. Wang, S. Luo, S.M. Zhu, H. Li, Y.D. Liu, L.Z. Zhou, P. Zhang, X. Zhang, Y.J. Ding, W.R. Huang, K.Y. Wu, Y.P. Zhang, W.H. Rong, and H. Tian. 2014. The adaptation of a CTN-1 rabies virus strain to high-titered growth in chick embryo cells for vaccine development. Virology Journal. 11. Guo, L., N. Feng, S. Yang, X. Wang, J. ge, X. Xia, and Z. bu. 2009. [Reverse genetic system for rabies virus vaccine Evelyn-Rokitnicki-Abelseth strain]. 949-954 pp. Hamamoto, N., A. Uda, M. Tobiume, C.H. Park, A. Noguchi, Y. Kaku, A. Okutani, S. Morikawa, and S. Inoue. 2015. Association between RABV G Proteins Transported from the Perinuclear Space to the Cell Surface Membrane and N-Glycosylation of the Sequon Asn(204). Japanese Journal of Infectious Diseases. 68:387-393. Hanna, J.N., I.K. Carney, G.A. Smith, A.E. Tannenberg, J.E. Deverill, J.A. Botha, I.L. Serafin, B.J. Harrower, P.F. Fitzpatrick, and J.W. Searle. 2000. Australian bat lyssavirus infection: a second human case, with a long incubation period. Med J Aust. 172:597-599. Her, L.S., E. Lund, and J.E. Dahlberg. 1997. Inhibition of Ran guanosine triphosphatase-dependent nuclear transport by the matrix protein of vesicular stomatitis virus. Science. 276:1845-1848. Hierholzer, J.C., and R. A. Killington. 1996. Virus isolation and quantitation. Academic Press Limited, London, United Kingdom. 25–46. Hinton, T.M., T.G. Wise, P.A. Cottee, and T.J. Doran. 2008. Native microRNA loop sequences can improve short hairpin RNA processing for virus gene silencing in animal cells. Journal of RNAi and gene silencing : an international journal of RNA and gene targeting research. 4:295-301. Hoper, D., C.M. Freuling, T. Muller, D. Hanke, V. von Messling, K. Duchow, M. Beer, and T.C. Mettenleiter. 2015. High definition viral vaccine strain identity and stability testing using full- genome population data - The next generation of vaccine quality control. Vaccine. 33:5829- 5837. Hughes, G.J., L.A. Orciari, and C.E. Rupprecht. 2005. Evolutionary timescale of rabies virus adaptation to North American bats inferred from the substitution rate of the nucleoprotein gene. Journal of General Virology. 86:1467-1474. Ibanez, C.F. 2007. Message in a bottle: long-range retrograde signaling in the nervous system. Trends Cell Biol. 17:519-528. Ito, H., N. Minamoto, T. Watanabe, H. Goto, L.T. Rong, M. Sugiyama, T. Kinjo, K. Mannen, K. Mifune, T. Konobe, I. Yoshida, and A. Takamizawa. 1994. A Unique Mutation of Glycoprotein Gene of the Attenuated Rc-Hl Strain of Rabies Virus, a Seed Virus Used for Production of Animal Vaccine in Japan. Microbiology and Immunology. 38:479-482. Ito, N., M. Kakemizu, K.A. Ito, A. Yamamoto, Y. Yoshida, M. Sugiyama, and N. Minamoto. 2001a. A comparison of complete genome sequences of the attenuated RC-HL strain of rabies virus used for production of animal vaccine in Japan, and the parental Nishigahara strain. Microbiology and Immunology. 45:51-58. Ito, N., M. Takayama, K. Yamada, M. Sugiyama, and N. Minamoto. 2001b. Rescue of rabies virus from cloned cDNA and identification of the pathogenicity-related gene: Glycoprotein gene is associated with virulence for adult mice. Journal of virology. 75:9121-9128. Iverson, L.E., and J.K. Rose. 1981. Localized attenuation and discontinuous synthesis during vesicular stomatitis virus transcription. Cell. 23:477-484.

131

References

Jackson, A.C., M.J. Warrell, C.E. Rupprecht, H.C. Ertl, B. Dietzschold, M. O'Reilly, R.P. Leach, Z.F. Fu, W.H. Wunner, T.P. Bleck, and H. Wilde. 2003. Management of rabies in humans. Clin Infect Dis. 36:60-63. Jacob, Y., H. Badrane, P.E. Ceccaldi, and N. Tordo. 2000. Cytoplasmic dynein LC8 interacts with lyssavirus phosphoprotein. Journal of virology. 74:10217-10222. Jurado, S., K. Gleeson, K. O'Donnell, D.J. Izon, C.R. Walkley, A. Strasser, D.M. Tarlinton, and J. Heierhorst. 2012. The Zinc-finger protein ASCIZ regulates B cell development via DYNLL1 and Bim. J Exp Med. 209:1629-1639. Kapitein, L.C., and C.C. Hoogenraad. 2011. Which way to go? Cytoskeletal organization and polarized transport in neurons. Molecular and Cellular Neuroscience. 46:9-20. Kaur, M., A. Rai, and R. Bhatnagar. 2009. Rabies DNA vaccine: No impact of MHC Class I and Class II targeting sequences on immune response and protection against lethal challenge. Vaccine. 27:2128-2137. Khawplod, P., Y. Shoji, S. Ubol, C. Mitmoonpitak, H. Wilde, A. Nishizono, I. Kurane, and K. Morimoto. 2006. Genetic analysis of dog rabies viruses circulating in Bangkok. Infect Genet Evol. 6:235- 240. Klingen, Y., K.K. Conzelmann, and S. Finke. 2008. Double-labeled rabies virus: live tracking of enveloped virus transport. Journal of virology. 82:237-245. Knobel, D.L., S. Cleaveland, P.G. Coleman, E.M. Fevre, M.I. Meltzer, M.E. Miranda, A. Shaw, J. Zinsstag, and F.X. Meslin. 2005. Re-evaluating the burden of rabies in Africa and Asia. Bull World Health Organ. 83:360-368. Komarova, A.V., E. Real, A.M. Borman, M. Brocard, P. England, N. Tordo, J.W. Hershey, K.M. Kean, and Y. Jacob. 2007. Rabies virus matrix protein interplay with eIF3, new insights into rabies virus pathogenesis. Nucleic Acids Res. 35:1522-1532. Koser, M.L., J.P. McGettigan, G.S. Tan, M.E. Smith, H. Koprowski, B. Dietzschold, and M.J. Schnell. 2004. Rabies virus nucleoprotein as a carrier for foreign antigens. Proc Natl Acad Sci U S A. 101:9405-9410. Kuzmin, I.V., A.D. Botvinkin, S.N. Rybin, and A.B. Bayaliev. 1992. A Lyssavirus with an unusual antigenic structure isolated from a bat in Southern Kyrghyzstan. Voprosy Virusologii. 37:256- 259. Kuzmin, I.V., G.J. Hughes, A.D. Botvinkin, L.A. Orciari, and C.E. Rupprecht. 2005. Phylogenetic relationships of Irkut and West Caucasian bat viruses within the Lyssavirus genus and suggested quantitative criteria based on the N gene sequence for lyssavirus genotype definition. Virus Res. 111:28-43. Kuzmin, I.V., A.E. Mayer, M. Niezgoda, W. Markotter, B. Agwanda, R.F. Breiman, and C.E. Rupprecht. 2010. Shimoni bat virus, a new representative of the Lyssavirus genus. Virus Res. 149:197- 210. Kuzmin, I.V., L.A. Orciari, Y.T. Arai, J.S. Smith, C.A. Hanlon, Y. Kameoka, and C.E. Rupprecht. 2003. Bat lyssaviruses (Aravan and Khujand) from Central Asia: phylogenetic relationships according to N, P and G gene sequences. Virus Res. 97:65-79. Kuzmin, I.V., M. Shi, L.A. Orciari, P.A. Yager, A. Velasco-Villa, N.A. Kuzmina, D.G. Streicker, D.L. Bergman, and C.E. Rupprecht. 2012. Molecular Inferences Suggest Multiple Host Shifts of Rabies Viruses from Bats to Mesocarnivores in Arizona during 2001-2009. Plos Pathogens. 8. Kuzmina, N.A., I.V. Kuzmin, J.A. Ellison, and C.E. Rupprecht. 2013. Conservation of binding epitopes for Monoclonal Antibodies on the rabies virus glycoprotein. Journal of Antivirals and Antiretrovirals. 5:037-043. Lafay, F., A. Benmansour, K. Chebli, and A. Flamand. 1996. Immunodominant epitopes defined by a yeast-expressed library of random fragments of the rabies virus glycoprotein map outside major antigenic sites. J Gen Virol. 77 ( Pt 2 ):339-346.

132

References

Lafon, M., T.J. Wiktor, and R.I. Macfarlan. 1983. Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J Gen Virol. 64 (Pt 4):843-851. Lahaye, X., A. Vidy, C. Pomier, L. Obiang, F. Harper, Y. Gaudin, and D. Blondel. 2009. Functional characterization of Negri bodies (NBs) in rabies virus-infected cells: Evidence that NBs are sites of viral transcription and replication. Journal of virology. 83:7948-7958. Lang, S.L., X.Y. Tao, Z.Y. Guo, Q. Tang, H. Li, C.P. Yin, Y. Li, and G.D. Liang. 2012. Molecular characterization of viral G gene in emerging and re-emerging areas of rabies in China, 2007 to 2011. Virologica Sinica. 27:194-203. Langevin, C., H. Jaaro, S. Bressanelli, M. Fainzilber, and C. Tuffereau. 2002. Rabies virus glycoprotein (RVG) is a trimeric ligand for the N-terminal cysteine-rich domain of the mammalian p75 neurotrophin receptor. Journal of Biological Chemistry. 277:37655-37662. Langlois, R.A., J.S. Shapiro, A.M. Pham, and B.R. tenOever. 2012. In vivo delivery of cytoplasmic RNA virus-derived miRNAs. Mol Ther. 20:367-375. Lee, Y., C. Ahn, J.J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O. Radmark, S. Kim, and V.N. Kim. 2003. The nuclear RNase III Drosha initiates microRNA processing. Nature. 425:415-419. Lee, Y., K. Jeon, J.T. Lee, S. Kim, and V.N. Kim. 2002. MicroRNA maturation: stepwise processing and subcellular localization. Embo Journal. 21:4663-4670. Lentz, T.L., T.G. Burrage, A.L. Smith, J. Crick, and G.H. Tignor. 1982. Is the acetylcholine receptor a rabies virus receptor? Science. 215:182-184. Lepine, P. 1938. On the evolution of fixed strains of rabies virus. J Hyg (Lond). 38:180-184. Leslie, M.J., S. Messenger, R.E. Rohde, J. Smith, R. Cheshier, C. Hanlon, and C.E. Rupprecht. 2006. Bat- associated rabies virus in Skunks. Emerg Infect Dis. 12:1274-1277. Li, J., A. Rahmeh, M. Morelli, and S.P.J. Whelan. 2008. A conserved motif in region V of the large polymerase proteins of nonsegmented negative-sense RNA viruses that is essential for mRNA capping. Journal of virology. 82:775-784. Liu, Y., S.F. Zhang, F. Zhang, and R.L. Hu. 2012. Adaptation of a Chinese ferret badger strain of rabies virus to high-titered growth in BHK-21 cells for canine vaccine development. Archives of Virology. 157:2397-2403. Luco, S., O. Delmas, P.O. Vidalain, F. Tangy, R. Weil, and H. Bourhy. 2012. RelAp43, a member of the NF-kappaB family involved in innate immune response against Lyssavirus infection. PLoS Pathog. 8:e1003060. Macfarlan, R.I., B. Dietzschold, and H. Koprowski. 1986. Stimulation of cytotoxic T-lymphocyte responses by rabies virus glycoprotein and identification of an immunodominant domain. Molecular Immunology. 23:733-741. Machida, A., H. Kuwahara, A. Mayra, T. Kubodera, T. Hirai, F. Sunaga, M. Tajiri, Y. Hirai, T. Shimada, H. Mizusawa, and T. Yokota. 2013. Intraperitoneal administration of AAV9-shRNA inhibits target gene expression in the dorsal root ganglia of neonatal mice. Mol Pain. 9:36. Madin, S.H., and N.B. Darby, Jr. 1958. Established kidney cell lines of normal adult bovine and ovine origin. Proc Soc Exp Biol Med. 98:574-576. Manning, S.E., C.E. Rupprecht, D. Fishbein, C.A. Hanlon, B. Lumlertdacha, M. Guerra, M.I. Meltzer, P. Dhankhar, S.A. Vaidya, S.R. Jenkins, B. Sun, and H.F. Hull. 2008. Human rabies prevention-- United States, 2008: recommendations of the Advisory Committee on Immunization Practices. MMWR Recomm Rep. 57:1-28. Marschalek, A., S. Finke, M. Schwemmle, D. Mayer, B. Heimrich, L. Stitz, and K.K. Conzelmann. 2009. Attenuation of rabies virus replication and virulence by picornavirus internal ribosome entry site elements. Journal of virology. 83:1911-1919. Marston, D.A., R.J. Ellis, E.L. Wise, N. Arechiga-Ceballos, C.M. Freuling, A.C. Banyard, L.M. McElhinney, X. de Lamballerie, T. Muller, A.R. Fooks, and J.E. Echevarria. 2017. Complete Genome Sequence of Lleida Bat Lyssavirus. Genome Announc. 5.

133

References

Marston, D.A., D.L. Horton, C. Ngeleja, K. Hampson, L.M. McElhinney, A.C. Banyard, D. Haydon, S. Cleaveland, C.E. Rupprecht, M. Bigambo, A.R. Fooks, and T. Lembo. 2012. Ikoma lyssavirus, highly divergent novel lyssavirus in an African civet. Emerg Infect Dis. 18:664-667. Marston, D.A., L.M. McElhinney, R.J. Ellis, D.L. Horton, E.L. Wise, S.L. Leech, D. David, X. de Lamballerie, and A.R. Fooks. 2013. Next generation sequencing of viral RNA genomes. BMC Genomics. 14:444. Masatani, T., N. Ito, Y. Ito, K. Nakagawa, M. Abe, S. Yamaoka, K. Okadera, and M. Sugiyama. 2013. Importance of rabies virus nucleoprotein in viral evasion of interferon response in the brain. Microbiol Immunol. 57:511-517. Masatani, T., N. Ito, K. Shimizu, Y. Ito, K. Nakagawa, M. Abe, S. Yamaoka, and M. Sugiyama. 2011. Amino acids at positions 273 and 394 in rabies virus nucleoprotein are important for both evasion of host RIG-I-mediated antiviral response and pathogenicity. Virus Res. 155:168-174. Masatani, T., N. Ito, K. Shimizu, Y. Ito, K. Nakagawa, Y. Sawaki, H. Koyama, and M. Sugiyama. 2010. Rabies virus nucleoprotein functions to evade activation of the RIG-I-mediated antiviral response. Journal of virology. 84:4002-4012. Masters, P.S., and A.K. Banerjee. 1988. Complex formation with vesicular stomatitis virus phosphoprotein NS prevents binding of nucleocapsid protein N to nonspecific RNA. Journal of virology. 62:2658-2664. Matsumoto, S. 1962. Electron Microscopy of Nerve Cells Infected with Street Rabies Virus. Virology. 17:198-&. Mavrakis, M., F. Iseni, C. Mazza, G. Schoehn, C. Ebel, M. Gentzel, T. Franz, and R.W. Ruigrok. 2003. Isolation and characterisation of the rabies virus N degrees-P complex produced in insect cells. Virology. 305:406-414. Mavrakis, M., A.A. McCarthy, S. Roche, D. Blondel, and R.W. Ruigrok. 2004. Structure and function of the C-terminal domain of the polymerase cofactor of rabies virus. J Mol Biol. 343:819-831. Mavrakis, M., S. Mehouas, E. Real, F. Iseni, D. Blondel, N. Tordo, and R.W. Ruigrok. 2006. Rabies virus chaperone: identification of the phosphoprotein peptide that keeps nucleoprotein soluble and free from non-specific RNA. Virology. 349:422-429. Mebatsion, T., M. Konig, and K.K. Conzelmann. 1996a. Budding of rabies virus particles in the absence of the spike glycoprotein. Cell. 84:941-951. Mebatsion, T., M.J. Schnell, J.H. Cox, S. Finke, and K.K. Conzelmann. 1996b. Highly stable expression of a foreign gene from rabies virus vectors. Proc Natl Acad Sci U S A. 93:7310-7314. Mebatsion, T., F. Weiland, and K.K. Conzelmann. 1999. Matrix protein of rabies virus is responsible for the assembly and budding of bullet-shaped particles and interacts with the transmembrane spike glycoprotein G. Journal of virology. 73:242-250. Mellon, M.G., and S.U. Emerson. 1978. Rebinding of transcriptase components (L and NS proteins) to the nucleocapsid template of vesicular stomatitis virus. Journal of virology. 27:560-567. Meredith, C.D., A.P. Prossouw, and H. Koch. 1971. An unusual case of human rabies thought to be of chiropteran origin. S Afr Med J. 45:767-769. Metzker, M.L. 2010. Sequencing technologies - the next generation. Nat Rev Genet. 11:31-46. Minoche, A.E., J.C. Dohm, and H. Himmelbauer. 2011. Evaluation of genomic high-throughput sequencing data generated on Illumina HiSeq and genome analyzer systems. Genome Biol. 12:R112. Miyamoto, K., and S. Matsumoto. 1967. Comparative Studies between Pathogenesis of Street and Fixed Rabies Infection. Journal of Experimental Medicine. 125:447-+. Morimoto, K., H.D. Foley, J.P. McGettigan, M.J. Schnell, and B. Dietzschold. 2000. Reinvestigation of the role of the rabies virus glycoprotein in viral pathogenesis using a reverse genetics approach. J Neurovirol. 6:373-381. Morimoto, K., D.C. Hooper, H. Carbaugh, Z.F. Fu, H. Koprowski, and B. Dietzschold. 1998. Rabies virus quasispecies: implications for pathogenesis. Proc Natl Acad Sci U S A. 95:3152-3156.

134

References

Muller, T., H.J. Batza, C. Freuling, A. Kliemt, J. Kliemt, R. Heuser, H. Schluter, T. Selhorst, A. Vos, and T.C. Mettenleiter. 2012. Elimination of terrestrial rabies in Germany using oral vaccination of foxes. Berl Munch Tierarztl Wochenschr. 125:178-190. Muller, T., B. Dietzschold, H. Ertl, A.R. Fooks, C. Freuling, C. Fehlner-Gardiner, J. Kliemt, F.X. Meslin, R. Franka, C.E. Rupprecht, N. Tordo, A.I. Wanderler, and M.P. Kieny. 2009. Development of a mouse monoclonal antibody cocktail for post-exposure rabies prophylaxis in humans. PLoS Negl Trop Dis. 3:e542. Munemasa, Y., T. Suzuki, K. Aizawa, S. Miyamoto, Y. Imai, T. Matsumura, M. Horikoshi, and R. Nagai. 2008. Promoter region-specific histone incorporation by the novel histone chaperone ANP32B and DNA-binding factor KLF5. Mol Cell Biol. 28:1171-1181. Murphy, F.A., and S.P. Bauer. 1974. Early street rabies virus infection in striated muscle and later progression to the central nervous system. Intervirology. 3:256-268. Niwa, H., K. Yamamura, and J. Miyazaki. 1991. Efficient Selection for High-Expression Transfectants with a Novel Eukaryotic Vector. Gene. 108:193-199. Nolden, T., F. Pfaff, S. Nemitz, C.M. Freuling, D. Hoper, T. Muller, and S. Finke. 2016. Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof. Sci Rep. 6:23887. Okolo, M.I. 1986. Dumb (paralytic) rabies in dogs in Nigeria. Int J Zoonoses. 13:11-18. Orbanz, J., and S. Finke. 2010. Generation of recombinant European bat lyssavirus type 1 and intergenotypic compatibility of lyssavirus genotype 1 and 5 antigenome promoters. Arch Virol. 155:1631-1641. Park, C.H., M. Kondo, S. Inoue, A. Noguchi, T. Oyamada, H. Yoshikawa, and A. Yamada. 2006. The histopathogenesis of paralytic rabies in six-week-old C57BL/6J mice following inoculation of the CVS-11 strain into the right triceps surae muscle. Journal of Veterinary Medical Science. 68:589-595. Patton, J.T., N.L. Davis, and G.W. Wertz. 1984. N protein alone satisfies the requirement for protein synthesis during RNA replication of vesicular stomatitis virus. Journal of virology. 49:303-309. Paweska, J.T., L.H. Blumberg, C. Liebenberg, R.H. Hewlett, A.A. Grobbelaar, P.A. Leman, J.E. Croft, L.H. Nel, L. Nutt, and R. Swanepoel. 2006. Fatal human infection with rabies-related Duvenhage virus, South Africa. Emerg Infect Dis. 12:1965-1967. Perlman, S.M., and A.S. Huang. 1973. RNA synthesis of vesicular stomatitis virus. V. Interactions between transcription and replication. Journal of virology. 12:1395-1400. Petersen, J.M., L.S. Her, V. Varvel, E. Lund, and J.E. Dahlberg. 2000. The matrix protein of vesicular stomatitis virus inhibits nucleocytoplasmic transport when it is in the nucleus and associated with nuclear pore complexes. Molecular and Cellular Biology. 20:8590-8601. Pfefferkorn, C., C. Kallfass, S. Lienenklaus, J. Spanier, U. Kalinke, M. Rieder, K.K. Conzelmann, T. Michiels, and P. Staeheli. 2016. Abortively Infected Astrocytes Appear To Represent the Main Source of Interferon Beta in the Virus-Infected Brain. Journal of virology. 90:2031-2038. Piccinotti, S., T. Kirchhausen, and S.P. Whelan. 2013. Uptake of rabies virus into epithelial cells by clathrin-mediated endocytosis depends upon actin. Journal of virology. 87:11637-11647. Piccinotti, S., and S.P.J. Whelan. 2016. Rabies Internalizes into Primary Peripheral Neurons via Clathrin Coated Pits and Requires Fusion at the Cell Body. PLoS Pathogens. 12:e1005753. Pollin, R., H. Granzow, B. Kollner, K.K. Conzelmann, and S. Finke. 2013. Membrane and inclusion body targeting of lyssavirus matrix proteins. Cell Microbiol. 15:200-212. Prehaud, C., P. Coulon, F. LaFay, C. Thiers, and A. Flamand. 1988. Antigenic site II of the rabies virus glycoprotein: structure and role in viral virulence. Journal of virology. 62:1-7. Prehaud, C., S. Lay, B. Dietzschold, and M. Lafon. 2003. Glycoprotein of nonpathogenic rabies viruses is a key determinant of human cell apoptosis. Journal of virology. 77:10537-10547. Prehaud, C., N. Wolff, E. Terrien, M. Lafage, F. Megret, N. Babault, F. Cordier, G.S. Tan, E. Maitrepierre, P. Menager, D. Chopy, S. Hoos, P. England, M. Delepierre, M.J. Schnell, H. Buc,

135

References

and M. Lafon. 2010. Attenuation of rabies virulence: takeover by the cytoplasmic domain of its envelope protein. Sci Signal. 3:ra5. ProMED-mail. 2016. NOVEL BAT LYSSAVIRUS - TAIWAN: (TAINAN). Vol. 2017. Quail, M.A., M. Smith, P. Coupland, T.D. Otto, S.R. Harris, T.R. Connor, A. Bertoni, H.P. Swerdlow, and Y. Gu. 2012. A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers. BMC Genomics. 13:341. Rahmeh, A.A., L. Jianrong, P.J. Kranzusch, and S.P.J. Whelan. 2009. Ribose 2′-O methylation of the vesicular stomatitis virus mRNA cap precedes and facilitates subsequent guanine-N-7 methylation by the large polymerase protein. Journal of virology. 83:11043-11050. Rahmeh, A.A., A.D. Schenk, E.I. Danek, P.J. Kranzusch, B. Liang, T. Walz, and S.P.J. Whelan. 2010. Molecular architecture of the vesicular stomatitis virus RNA polymerase. P Natl Acad Sci USA. 107:20075-20080. Raux, H., A. Flamand, and D. Blondel. 2000. Interaction of the rabies virus P protein with the LC8 dynein light chain. Journal of virology. 74:10212-10216. Rouha, H., C. Thurner, and C.W. Mandl. 2010. Functional microRNA generated from a cytoplasmic RNA virus. Nucleic Acids Res. 38:8328-8337. Rupprecht, C.E., C.A. Hanlon, and D. Slate. 2004. Oral vaccination of wildlife against rabies: opportunities and challenges in prevention and control. Dev Biol (Basel). 119:173-184. Saito, M., H. Oshitani, J.R.C. Orbina, K. Tohma, A.S. de Guzman, T. Kamigaki, C.S. Demetria, D.L. Manalo, A. Noguchi, S. Inoue, and B.P. Quiambao. 2013. Genetic Diversity and Geographic Distribution of Genetically Distinct Rabies Viruses in the Philippines. Plos Neglected Tropical Diseases. 7. Sakamoto, S.I., T. Ide, H. Nakatake, S. Tokiyoshi, M. Yamamoto, A. Kawai, and J.S. Smith. 1994. Studies on the Antigenicity and Nucleotide-Sequence of the Rabies Virus Nishigahara Strain, a Current Seed Strain Used for Dog Vaccine Production in Japan. Virus Genes. 8:35-46. Sanger, F., S. Nicklen, and A.R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 74:5463-5467. Schnell, M.J., H.D. Foley, C.A. Siler, J.P. McGettigan, B. Dietzschold, and R.J. Pomerantz. 2000. Recombinant rabies virus as potential live-viral Vaccines for HIV-1. P Natl Acad Sci USA. 97:3544-3549. Schnell, M.J., J.P. McGettigan, C. Wirblich, and A. Papaneri. 2010. The cell biology of rabies virus: using stealth to reach the brain. Nat Rev Microbiol. 8:51-61. Schnell, M.J., T. Mebatsion, and K.K. Conzelmann. 1994. Infectious rabies viruses from cloned cDNA. Embo j. 13:4195-4203. Seif, I., P. Coulon, P.E. Rollin, and A. Flamand. 1985. Rabies virulence: effect on pathogenicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. Journal of virology. 53:926-934. Shakin-Eshleman, S.H., A.T. Remaley, J.R. Eshleman, W.H. Wunner, and S.L. Spitalnik. 1992. N-linked glycosylation of rabies virus glycoprotein. Individual sequons differ in their glycosylation efficiencies and influence on cell surface expression. J Biol Chem. 267:10690-10698. Shankar, V., B. Dietzschold, and H. Koprowski. 1991. Direct Entry of Rabies Virus into the Central- Nervous-System without Prior Local Replication. Journal of virology. 65:2736-2738. Shapiro, J.S. 2013. Processing of virus-derived cytoplasmic primary-microRNAs. Wiley Interdiscip Rev RNA. 4:463-471. Shapiro, J.S., R.A. Langlois, A.M. Pham, and B.R. Tenoever. 2012. Evidence for a cytoplasmic microprocessor of pri-miRNAs. RNA. 18:1338-1346. Shapiro, J.S., S. Schmid, L.C. Aguado, L.R. Sabin, A. Yasunaga, J.V. Shim, D. Sachs, S. Cherry, and B.R. tenOever. 2014. Drosha as an interferon-independent antiviral factor. Proc Natl Acad Sci U S A. 111:7108-7113.

136

References

Shapiro, J.S., A. Varble, A.M. Pham, and B.R. Tenoever. 2010. Noncanonical cytoplasmic processing of viral microRNAs. RNA. 16:2068-2074. Shen, S.M., Y. Yu, Y.L. Wu, J.K. Cheng, L.S. Wang, and G.Q. Chen. 2010. Downregulation of ANP32B, a novel substrate of caspase-3, enhances caspase-3 activation and apoptosis induction in myeloid leukemic cells. Carcinogenesis. 31:419-426. Shi, L.T., Y.X. Yu, J.H. Liu, J.R. Tang, X.H. Wu, S.C. Cao, J. Li, X.M. Qu, and G.M. Dong. 2010. Analysis of full-length gene sequence of a rabies vaccine strain CTN-1 for human use in China. Bing du xue bao = Chinese journal of virology / [bian ji, Bing du xue bao bian ji wei yuan hui]. 26:195- 201. Shimizu, K., N. Ito, T. Mita, K. Yamada, J. Hosokawa-Muto, M. Sugiyama, and N. Minamoto. 2007. Involvement of nucleoprotein, phosphoprotein, and matrix protein genes of rabies virus in virulence for adult mice. Virus Research. 123:154-160. Shope, R.E., F.A. Murphy, A.K. Harrison, O.R. Causey, G.E. Kemp, D.I. Simpson, and D.L. Moore. 1970. Two African viruses serologically and morphologically related to rabies virus. Journal of virology. 6:690-692. Sissoeff, L., M. Mousli, P. England, and C. Tuffereau. 2005. Stable trimerization of recombinant rabies virus glycoprotein ectodomain is required for interaction with the p75(NTR) receptor. Journal of General Virology. 86:2543-2552. Sleat, D.E., and A.K. Banerjee. 1993. Transcriptional activity and mutational analysis of recombinant vesicular stomatitis virus RNA polymerase. Journal of virology. 67:1334-1339. Sloan, S.E., C. Hanlon, W. Weldon, M. Niezgoda, J. Blanton, J. Self, K.J. Rowley, R.B. Mandell, G.J. Babcock, W.D. Thomas, C.E. Rupprecht, and D.M. Ambrosino. 2007. Identification and characterization of a human monoclonal antibody that potently neutralizes a broad panel of rabies virus isolates. Vaccine. 25:2800-2810. Smith, J.S., D.B. Fishbein, C.E. Rupprecht, and K. Clark. 1991. Unexplained rabies in three immigrants in the United States. A virologic investigation. N Engl J Med. 324:205-211. Smith, M.E., M. Koser, S. Xiao, C. Siler, J.P. McGettigan, C. Calkins, R.J. Pomerantz, B. Dietzschold, and M.J. Schnell. 2006. Rabies virus glycoprotein as a carrier for anthrax protective antigen. Virology. 353:344-356. Srinivasan, A., E.C. Burton, M.J. Kuehnert, C. Rupprecht, W.L. Sutker, T.G. Ksiazek, C.D. Paddock, J. Guarner, W.J. Shieh, C. Goldsmith, C.A. Hanlon, J. Zoretic, B. Fischbach, M. Niezgoda, W.H. El- Feky, L. Orciari, E.Q. Sanchez, A. Likos, G.B. Klintmalm, D. Cardo, J. LeDuc, M.E. Chamberland, D.B. Jernigan, and S.R. Zaki. 2005. Transmission of rabies virus from an organ donor to four transplant recipients. N Engl J Med. 352:1103-1111. St Pierre, C.A., D. Leonard, S. Corvera, E.A. Kurt-Jones, and R.W. Finberg. 2011. Antibodies to cell surface proteins redirect intracellular trafficking pathways. Exp Mol Pathol. 91:723-732. Steck, F., A. Wandeler, P. Bichsel, S. Capt, and L. Schneider. 1982. Oral immunisation of foxes against rabies. A field study. Zentralbl Veterinarmed B. 29:372-396. Superti, F., M. Derer, and H. Tsiang. 1984. Mechanism of rabies virus entry into CER cells. J Gen Virol. 65 ( Pt 4):781-789. Takayama-Ito, M., N. Ito, K. Yamada, N. Minamoto, and M. Sugiyama. 2004. Region at amino acids 164 to 303 of the rabies virus glycoprotein plays an important role in pathogenicity for adult mice. J Neurovirol. 10:131-135. Tan, G.S., M.A.R. Preuss, J.C. Williams, and M.J. Schnell. 2007. The dynein light chain 8 binding motif of rabies virus phosphoprotein promotes efficient viral transcription. P Natl Acad Sci USA. 104:7229-7234. Tao, X.Y., Q. Tang, S. Rayner, Z.Y. Guo, H. Li, S.L. Lang, C.P. Yin, N. Han, W. Fang, J. Adams, M. Song, and G.D. Liang. 2013. Molecular Phylodynamic Analysis Indicates Lineage Displacement Occurred in Chinese Rabies Epidemics between 1949 to 2010. Plos Neglected Tropical Diseases. 7.

137

References

Taylor, M.P., and L.W. Enquist. 2015. Axonal spread of neuroinvasive viral infections. Trends Microbiol. 23:283-288. Thoulouze, M.I., M. Lafage, J.A. Montano-Hirose, and M. Lafon. 1997. Rabies virus infects mouse and human lymphocytes and induces apoptosis. Journal of virology. 71:7372-7380. Thoulouze, M.I., M. Lafage, M. Schachner, U. Hartmann, H. Cremer, and M. Lafon. 1998. The neural cell adhesion molecule is a receptor for rabies virus. Journal of virology. 72:7181-7190. Tian, D., Z. Luo, M. Zhou, M. Li, L. Yu, C. Wang, J. Yuan, F. Li, B. Tian, B. Sui, H. Chen, Z.F. Fu, and L. Zhao. 2015. Critical Role of K1685 and K1829 in the Large Protein of Rabies Virus in Viral Pathogenicity and Immune Evasion. Journal of virology. 90:232-244. Tjornehoj, K., A.R. Fooks, J.S. Agerholm, and L. Ronsholt. 2006. Natural and experimental infection of sheep with European bat lyssavirus type-1 of Danish bat origin. J Comp Pathol. 134:190-201. Todaro, G.J., and H. Green. 1963. Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. The Journal of cell biology. 17:299-313. Tordo, N., O. Poch, A. Ermine, and G. Keith. 1986a. Primary structure of leader RNA and nucleoprotein genes of the rabies genome: segmented homology with VSV. Nucleic Acids Res. 14:2671-2683. Tordo, N., O. Poch, A. Ermine, G. Keith, and F. Rougeon. 1986b. Walking along the rabies genome: is the large G-L intergenic region a remnant gene? Proc Natl Acad Sci U S A. 83:3914-3918. Tordo, N., O. Poch, A. Ermine, G. Keith, and F. Rougeon. 1988. Completion of the rabies virus genome sequence determination: highly conserved domains among the L (polymerase) proteins of unsegmented negative-strand RNA viruses. Virology. 165:565-576. Tsiang, H. 1979. Evidence for an intraaxonal transport of fixed and street rabies virus. J Neuropathol Exp Neurol. 38:286-299. Tsiang, H., A. Koulakoff, B. Bizzini, and Y. Berwald-Netter. 1983. Neurotropism of rabies virus: An in vitro study. Journal of Neuropathology and Experimental Neurology. 42:439-452. Tsiang, H., E. Lycke, P.E. Ceccaldi, A. Ermine, and X. Hirardot. 1989. The Anterograde Transport of Rabies Virus in Rat Sensory Dorsal-Root Ganglia Neurons. Journal of General Virology. 70:2075-2085. Tuffereau, C., J. Benejean, D. Blondel, B. Kieffer, and A. Flamand. 1998b. Low-affinity nerve-growth factor receptor (P75NTR) can serve as a receptor for rabies virus. The EMBO journal. 17:7250-7259. Ugolini, G. 2010. Advances in viral transneuronal tracing. Journal of Neuroscience Methods. 194:2-20. Ugolini, G. 2011. Rabies Virus as a Transneuronal Tracer of Neuronal Connections. Advances in Virus Research: Research Advances in Rabies, Vol 79. 79:165-202. Varki, A. 1993. Biological Roles of Oligosaccharides - All of the Theories Are Correct. Glycobiology. 3:97-130. Vidy, A., M. Chelbi-Alix, and D. Blondel. 2005. Rabies virus P protein interacts with STAT1 and inhibits interferon signal transduction pathways. Journal of virology. 79:14411-14420. Virojanapirom, P., P. Khawplod, A. Sawangvaree, S. Wacharapluesadee, T. Hemachudha, K. Yamada, K. Morimoto, and A. Nishizono. 2012. Molecular analysis of the mutational effects of Thai street rabies virus with increased virulence in mice after passages in the BHK cell line. Archives of Virology. 157:2201-2205. Virojanapirom, P., K. Yamada, P. Khawplod, A. Nishizono, and T. Hemachudha. 2016. Increased pathogenicity of rabies virus due to modification of a non-coding region. Archives of Virology. 161:3255-3261. Vos, A., A. Neubert, O. Aylan, P. Schuster, E. Pommerening, T. Muller, and D.C. Chivatsi. 1999. An update on safety studies of SAD B19 rabies virus vaccine in target and non-target species. Epidemiol Infect. 123:165-175.

138

References

Wang, Z.W., L. Sarmento, Y.H. Wang, X.Q. Li, V. Dhingra, T. Tseggai, B.M. Jiang, and Z.F. Fu. 2005. Attenuated rabies virus activates, while pathogenic rabies virus evades, the host innate immune responses in the central nervous system. Journal of virology. 79:12554-12565. Warrell, D.A. 1976. The clinical picture of rabies in man. Trans R Soc Trop Med Hyg. 70:188-195. Warrell, M.J., and D.A. Warrell. 2004. Rabies and other lyssavirus diseases. Lancet. 363:959-969. Whitt, M.A., L. Buonocore, C. Prehaud, and J.K. Rose. 1991. Membrane-Fusion Activity, Oligomerization, and Assembly of the Rabies Virus Glycoprotein. Virology. 185:681-688. Wickersham, I.R., S. Finke, K.K. Conzelmann, and E.M. Callaway. 2007a. Retrograde neuronal tracing with a deletion-mutant rabies virus. Nat Methods. 4:47-49. Wickersham, I.R., D.C. Lyon, R.J. Barnard, T. Mori, S. Finke, K.K. Conzelmann, J.A. Young, and E.M. Callaway. 2007b. Monosynaptic restriction of transsynaptic tracing from single, genetically targeted neurons. Neuron. 53:639-647. Willoughby, R.E., Jr. 2009. "Early death" and the contraindication of vaccine during treatment of rabies. Vaccine. 27:7173-7177. Willoughby, R.E., K.S. Tieves, G.M. Hoffman, N.S. Ghanayem, C.M. Amlie-Lefond, M.J. Schwabe, M.J. Chusid, and C.E. Rupprecht. 2005. Brief report - Survival after treatment of rabies with induction of coma. New England Journal of Medicine. 352:2508-2514. Wiltzer, L., K. Okada, S. Yamaoka, F. Larrous, H.V. Kuusisto, M. Sugiyama, D. Blondel, H. Bourhy, D.A. Jans, N. Ito, and G.W. Moseley. 2014. Interaction of rabies virus P-protein with STAT proteins is critical to lethal rabies disease. J Infect Dis. 209:1744-1753. Winkler, W.G., E.F. Baker, Jr., and C.C. Hopkins. 1972. An outbreak of non-bite transmitted rabies in a laboratory animal colony. Am J Epidemiol. 95:267-277. Winkler, W.G., T.R. Fashinell, L. Leffingwell, P. Howard, and P. Conomy. 1973. Airborne rabies transmission in a laboratory worker. JAMA. 226:1219-1221. World Health Organization. 2013. WHO Expert Consultation on Rabies. second report ; [Geneva from 18 to 20 September 2012]. Geneva WHO, 2013. Wu, X., X. Gong, H.D. Foley, M.J. Schnell, and Z.F. Fu. 2002. Both viral transcription and replication are reduced when the rabies virus nucleoprotein is not phosphorylated. Journal of virology. 76:4153-4161. Wunner, W.H., J.K. Larson, B. Dietzschold, and C.L. Smith. 1988. The molecular biology of rabies viruses. Rev Infect Dis. 10 Suppl 4:S771-784. Yamada, K., K. Noguchi, and A. Nishizono. 2014. Characterization of street rabies virus variants with an additional N-glycan at position 247 in the glycoprotein. Arch Virol. 159:207-216. Yamada, K., K. Noguchi, D. Nonaka, M. Morita, A. Yasuda, H. Kawazato, and A. Nishizono. 2013. Addition of a single N-glycan to street rabies virus glycoprotein enhances virus production. Journal of General Virology. 94:270-275. Yamada, K., C.H. Park, K. Noguchi, D. Kojima, T. Kubo, N. Komiya, T. Matsumoto, M.T. Mitui, K. Ahmed, K. Morimoto, S. Inoue, and A. Nishizono. 2012. Serial passage of a street rabies virus in mouse neuroblastoma cells resulted in attenuation: Potential role of the additional N- glycosylation of a viral glycoprotein in the reduced pathogenicity of street rabies virus. Virus Research. 165:34-45. Yamaoka, S., N. Ito, S. Ohka, S. Kaneda, H. Nakamura, T. Agari, T. Masatani, K. Nakagawa, K. Okada, K. Okadera, H. Mitake, T. Fujii, and M. Sugiyama. 2013. Involvement of the rabies virus phosphoprotein gene in neuroinvasiveness. Journal of virology. 87:12327-12338. Yan, X., M. Prosniak, M.T. Curtis, M.L. Weiss, M. Faber, B. Dietzschold, and Z.F. Fu. 2001. Silver-haired bat rabies virus variant does not induce apoptosis in the brain of experimentally infected mice. Journal of NeuroVirology. 7:518-527. Yang, J., D.C. Hooper, W.H. Wunner, H. Koprowski, B. Dietzschold, and Z.F. Fu. 1998. The specificity of rabies virus RNA encapsidation by nucleoprotein. Virology. 242:107-117.

139

References

Yang, J., H. Koprowski, B. Dietzschold, and Z.F. Fu. 1999. Phosphorylation of rabies virus nucleoprotein regulates viral RNA transcription and replication by modulating leader RNA encapsidation. Journal of virology. 73:1661-1664. Zampieri, N., T.M. Jessell, and A.J. Murray. 2014. Mapping sensory circuits by anterograde transsynaptic transfer of recombinant rabies virus. Neuron. 81:766-778. Zan, J., J. Liu, J.W. Zhou, H.L. Wang, K.K. Mo, Y. Yan, Y.B. Xu, M. Liao, S. Su, R.L. Hu, and J.Y. Zhou. 2016. Rabies virus matrix protein induces apoptosis by targeting mitochondria. Exp Cell Res. 347:83-94. Zeng, Y., R. Yi, and B.R. Cullen. 2005. Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. Embo Journal. 24:138-148. Zhang, Y.Z., C.L. Xiong, X.D. Lin, D.J. Zhou, R.J. Jiang, Q.Y. Xiao, X.Y. Xie, X.X. Yu, Y.J. Tan, M.H. Li, Q.S. Ai, L.J. Zhang, Y. Zou, C. Huang, and Z.F. Fu. 2009. Genetic diversity of Chinese rabies viruses: Evidence for the presence of two distinct clades in China. Infection Genetics and Evolution. 9:87-96. Zhao, L., H. Toriumi, H. Wang, Y. Kuang, X. Guo, K. Morimoto, and Z.F. Fu. 2010. Expression of MIP- 1alpha (CCL3) by a recombinant rabies virus enhances its immunogenicity by inducing innate immunity and recruiting dendritic cells and B cells. Journal of virology. 84:9642-9648.

140

Appendix

Supplementary data

Supplementary table 1: Comparison of rRABV Dog K14 to rRABV Fox. Shown are differences in amino acid (aa) at nucleotide (nt) positions in protein coding genes of rRABV Fox compared to rRABV Dog. The overall identity of both viruses is 95.5%.

pairwise identity (%): 95.5% N P M G L

nt 138 → V23A nt 1602 → K30R nt 2541 → A26T nt 3330 → T5A nt 5666 → G86D nt 372 → D101A nt 1698 → K62R nt 2645 → I60M nt 3354 → A13G nt 5840 → R144K

nt 1390 → E440D nt 1703 → A64S nt 3368 → F18V nt 6275 → M289T

nt1781 → S90G nt 3908 → M198L nt 6298 → I297V

nt 1958 → T149A nt 4081 → M255I nt 6307 → I300V

nt 1980 → E156G nt 4431 → P372H nt 6457 → R350G

nt 2075 → T188A nt 4703 → G463S nt 6472 → F355L

nt 2396 → A295T nt 4735 →M473I nt 6685 → A426S

nt 4788 → R491P nt 6754 → V449I

nt 4793 → L493F nt 8056 → S883R

nt 4796 → G494R nt 9365 → R1319K

nt 4806 → G497E nt 9409 → I1334V

nt 4826 → S504P nt 9828 → E1473D

nt 10074 → E1555D

nt 10090 → G1561S

nt 10276 → N1623Y

nt 10695 → D1762E

nt 10777 → S1790P

nt 10819 → A1804T

nt 11188 → I1927V

nt 11581 → S2058P

nt 11698 → G2097R

141

Appendix

Supplementary table 2: Deep sequence analysis with all synonymous and non-synonymous mutations comparing cDNA clone with rRABV after 10 passages on BHK, NA 42/13 or MDCK cell line. Mutations, which occur at frequencies above 50% are highlighted in bold. nt = nucleotide; aa = amino acid; ORF = openreading frame; NCR = non-coding region.

nt- cDNA- frequency- mutation frequency- aa cover codon change ORF / NCR position clone P1 [%] in P10 P10 [%] change age 2390 C 3.3 T 96.4 CGC→TGC R293C P 3002 P mRNA 2440 A 81.3 G 18.7 NCR 2683 3'-ncr P mRNA 2453 - 96.6 + A 3.4 NCR 2616 3'-ncr 4113 G 0.1 A 99.8 GAT→AAT D266N G 2498 4367 A 97.9 G 2.1 TCA→TCG None G 2677 4572 G 4.6 A 94.1 GCA→ACA A419T G 1552 4649 G 0.4 T 99.5 AAG→AAT K444N G 1474

rRAB Dog BHK BHK Dog rRAB 4728 G 0.3 A 99.5 TTG→TTA None G 1531 R→ 7840 A 97.3 T 2.7 AGA→TGA L 2700 stop 9837 C 97.9 T 2.1 CTT→CTC None L 2388 11175 T 90.3 C 9.7 TTC→TTT None L 2983

1105 G 97.6 A 2.4 CTG→CTA None N 334 1561 C 95.1 T 4.9 GCC→GCT None N 247 2342 T 31.7 G 68 TTA→GTA L277V P 334 2810 T 82.4 C 8.8 TCA→CCA P105S M 364 Frame 3368 - T 6,7 G 330 Shift 3859 T 96 C 4 ATA→ACA I181T G 327 4114 G 0 A 100 GAT→AAT D266N G 206 4166 G 7.1 T 92.5 CGC→CTC R283L G 240 4412 A 29.1 C 70.5 AGA→AGC R365S G 227 4728 G 0.8 A 99.2 TTG→TTA None G 130 rRABV Dog MDCK-II MDCK-II Dog rRABV Frame 5934 - T 7 L 329 Shift 8903 G 25.9 T 73.5 GGG→GGT None L 309 9778 A 96,1 G 3.9 ATC→GTC I1754V L 259 10014 G 24,5 T 74.7 GCT→TCT A1535S L 257

28 G 6.5 A 80.5 NCR leader 76 52 A 77.0 A 23 NCR leader 352 1761 T 2.5 G 97.5 ATG→AGG M83R P 274 3935 C 1.4 T 97.9 ACG→ATG T206M G 288 4114 G 0 A 100 GAT→AAT D266N G 313 4728 G 1.2 A 98.8 TTG→TTA None G 169 L mRNA 5375 A 0.3 G 99 NCR 306 rRABV Dog NA 42/13 42/13 NA Dog rRABV 5'-ncr 11388 A 93.8 G 6 CCA→CCG None L 3908 142

Appendix

nt- cDNA- frequency- mutation frequency- aa cover codon change ORF / NCR position clone P1 [%] in P10 P10 [%] change age E2093 11687 A 95.3 G 4.7 GAG→GGG L 7482 G 721 T 97.1 A 1.7 RC none N 1883 2713 G 96.8 A 3 CR none M 1243 2829 T 97.3 T 2.4 CR none M 1692 4111 G 0.3 A 99.5 GAT→AAT D266N G 2412 4474 G 88.9 A 11 GAC→AAC D387N G 2116

4647 A 15.7 C 76.7 AAA→AAC K444N G 1263 5237 A 93.3 C 6.6 NCR none G/L 2117 insertio G mRNA 5354 A 76.2 - NCR 2073 n (A tail) 7638 C 92.9 A 7.1 TCT→TAT S744Y L 2878 D1224 rRABV Fox BHK Fox rRABV 9077 G 71.7 A 27.9 GAT→AAT L 3568 N 9828 C 97 T 2.4 CCG→CTG P1474L L 3310 9970 C 97.7 A 2 CR none L 2237 11005 A 21.9 T 77.5 CR none L 3513

638 A 57.4 G 42.4 ACT→GCT T190A N 884 non-coding 3173 A 88.2 G 11.4 none M/G border 474 region 3634 C 50.7 T 49.2 CGT→TGT R107C G 880 4111 G 0 A 99.5 GAT→AAT D266N G 1017 4471 C 90.9 A 9 CCT→ACT P386Y G 921 4474 G 64.4 A 35.2 GAC→AAC D387N G 915 5909 T 90.5 A 8.8 CR none L 546 rRABV Fox NA 42/13 42/13 NA Fox rRABV 9320 A 90.5 G 9.1 CR none L 740 11006 A 1.3 T 98,.6 CR none L 871

2391 G 7.6 A 92.4 CGC→CAC R293H P 198 2577 G 18.4 T 81.6 GAC→TAC D38Y M 98 4111 G 0 A 100 GAT→AAT D266N G 241 4420 A 11.1 G 88.1 AGG→GGG R369G G 126 4507 T 4.5 G 95.5 TCC→GCC S398A G 131 4590 C 4.6 T 94.5 CR none G 108 G mRNA 4908 G 5.4 A 94.6 NCR none 111 ncr

rRABV Fox MDCK-II MDCK-II Fox rRABV 7805 T 4.6 C 95.4 CR none L 263 11006 A 0 T 100 CR none L 133 11147 A 92 G 8 CR none L 176

143

Supplementary table 3: Primer combinations for amplicon-sequencing of RT-products in section 6.2.2.2 (page 84). product adapter target primer name complete sequence 5'→3' primer binding site 5'→3' length MID CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGA G1_A_IX44_fw 44 TGGTGGAAAGTGCTCAGGAA TTGGTGGAAAGTGCTCAGGAA CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGA G1_A_IX44_rv 44 CCAACTGATCAGGAGGGCA TCCAACTGATCAGGAGGGCA G1 CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGAT 308 G1_A_IX45_fw 45 TGGTGGAAAGTGCTCAGGAA 206+266 TGGTGGAAAGTGCTCAGGAA CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGAT G1_A_IX45_rv 45 CCAACTGATCAGGAGGGCA CCAACTGATCAGGAGGGCA G1_trP1_fw universal CCTCTCTATGGGCAGTCGGTGATTGGTGGAAAGTGCTCAGGAA TGGTGGAAAGTGCTCAGGAA G1_trP1_rv universal CCTCTCTATGGGCAGTCGGTGATCCAACTGATCAGGAGGGCA CCAACTGATCAGGAGGGCA CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGA G2_A_IX44_fw 44 CCCTCCTCCAGCAACATATG TCCCTCCTCCAGCAACATATG CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGA G2_A_IX44_rv 44 ACCAGCCTTCACAGTCTAGT TACCAGCCTTCACAGTCTAGT G2 CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGAT 391 G2_A_IX45_fw 45 CCCTCCTCCAGCAACATATG 419+444 CCCTCCTCCAGCAACATATG CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGAT G2_A_IX45_rv 45 ACCAGCCTTCACAGTCTAGT ACCAGCCTTCACAGTCTAGT G2_trP1_fw universal CCTCTCTATGGGCAGTCGGTGATCCCTCCTCCAGCAACATATG CCCTCCTCCAGCAACATATG G2_trP1_rv universal CCTCTCTATGGGCAGTCGGTGATACCAGCCTTCACAGTCTAGT ACCAGCCTTCACAGTCTAGT N CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGA 372 N_A_IX44_fw 44 GAAGAATGTTCGAGCCAGGG control TGAAGAATGTTCGAGCCAGGG

144

Appendix

product adapter target primer name complete sequence 5'→3' primer binding site 5'→3' length MID amplico CCATCTCATCCCTGCGTGTCTCCGACTCAGTTGGAGGCCAGCGA N_A_IX44_rv 44 AGTCCTCATCGTCAGAGTTGA n TAGTCCTCATCGTCAGAGTTGA CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGAT N_A_IX45_fw 45 GAAGAATGTTCGAGCCAGGG GAAGAATGTTCGAGCCAGGG CCATCTCATCCCTGCGTGTCTCCGACTCAGTGGAGCTTCCTCGAT N_A_IX45_rv 45 AGTCCTCATCGTCAGAGTTGA AGTCCTCATCGTCAGAGTTGA N_trP1_fw universal CCTCTCTATGGGCAGTCGGTGATGAAGAATGTTCGAGCCAGGG GAAGAATGTTCGAGCCAGGG N_trP1_rv universal CCTCTCTATGGGCAGTCGGTGATAGTCCTCATCGTCAGAGTTGA AGTCCTCATCGTCAGAGTTGA CTTTCCCTACACGACGCTCTTCCGATCTGGCCAATTCCAAGAAA 282 Illumina_PM_fw universal GGCCAATTCCAAGAAATTCCA TTCCA PM Border GGAGTTCAGACGTGTGCTCTTCCGATCGGAAGCCACAGGTCATC 281 Illumina_PM_rv universal GGAAGCCACAGGTCATCGT GT

145

Supplementary table 4 :Generated plasmids containing G sequence from rRABV DogA - B - 10 or rRABV DogA after site-directed mutagenesis (marked with *). Underlined aa exchanges were found in all clones. All plasmids were generated in the lab PD Dr. Stefan Finke.

plasmid name (#) mutations at aa position

pCAGGS DogA G (10. Passage BHK) K3 (1094) D266N, A419T, K444N

pCAGGS DogA G (10. Passage BHK) K5 (1095) D266N, A419T, K444N, V483F

pCAGGS DogA G (10. Passage BHK) K7 (1096) D266N, A419T, K444N

pCAGGS DogA G (10. Passage BHK) K10 (1097) D266N, A419T, K444N, V483F

pCAGGS DogA G (10. Passage BHK) K11 (1098) G175V, D266N, A419T, K444N

pCAGGS DogA G266 K10 (1170)* 266

pCAGGS DogA G266 K6 (1172)* 266

pCAGGS DogA G444 K2 (1168)* 444

pCAGGS DogA G444 K5 (1169)* 444

pCAGGS DogA G 419 K1 (1212)* 419

pCAGGS DogA G 419 K6 (1213)* 419

pCAGGS Dog A G 266/444 K8 (1176)* 266, 444

pCAGGS Dog A G 266/444 K13 (1177)* 266, 444

pCAGGS DogA G 419/444 K3 (1214)* 419, 444

pCAGGS DogA G 419/444 K9 (1215)* 419, 444

pCAGGS DogA G 266/419 K5 (1202)* 266, 419

pCAGGS DogA G 266/419 K7 (1203) * 266, 419

pCAGGS DogA G 266/419/444 K1 (1204)* 266, 419, 444

pCAGGS DogA G 266/419/444 K8 (1211)* 266, 419, 444

Supplementary table 5: Blast for mutations in G at position D266N and K444N in other RABV strains. Selected sequences of NCBI blast from 1000 sequences of rRABV Dog-B-10 glycoprotein with respective mutation at position 266.*-marked accession number have also mutation at position 444. accession # name strain passage history reference AAB30931 glycoprotein Nishigahara serial passage through several kinds of animal (Sakamoto et G [Rabies strain and cell cultures al., 1994) lyssavirus] BAD04913 glycoprotein Ni-CE Ni-CE strain was established from the (Shimizu et [Rabies strain, Nishigahara strain after 100 passages in chicken al., 2007) lyssavirus] avirulent embryo fibroblast cells 146

Appendix accession # name strain passage history reference Nishigahara strain Q9IPJ6 RC-HL, RC-HL stain was propagated on BHK-21 cell (Ito et al., avirulent culture; originally isolated from Homo sapiens 2001a; Nishigahara (Human) Shimizu et al., 2007) BAA03588 glycoprotein RC-HL, no further information not published precursor avirulent [Rabies Nishigahara lyssavirus] BAA03837 glycoprotein RC-HL, derived from the Nishigahara strain after 249 (Ito et al., [Rabies avirulent passages in chick embryos, 8 passages in CEF 1994) lyssavirus] Nishigahara cells, 5 passages in Vero cells and 23 passages in HmLu cells BAA24086 glycoprotein RC-HL, RC-HL stain was propagated on BHK-21 cell (Ito et al., [Rabies avirulent culture; originally isolated from Homo sapiens 2001a) lyssavirus] Nishigahara (Human)

AIT76589 glycoprotein Moscow used as vaccine strain not published [Rabies 3253 lyssavirus] AMR44686 glycoprotein 93127FRA selected RABVs and non-RABV lyssaviruses (De [Rabies were initially cultured on Neuro-2A cells and Benedictis et lyssavirus] further adapted on BSR cells (a clone of BHK- al., 2016) 21) AAY89391 glycoprotein Indian street isolated from “brain of mad dog in the street", in not published [Rabies virus India lyssavirus] Q08089* glycoprotein Vnukowo-32 Vnukovo-32 strain was derived from fixed SAD (Fodor et al., [Rabies strain and was attenuated by multiple passages 1994) lyssavirus] in different cell types, and it has been widely used since 1974 as a vaccine for human use ABN11344 glycoprotein SAD1-3670 vaccine viruses were once independently (Geue et al., [Rabies var 1 propagated in BHK-21 or BHK/BSR cells 2008) lyssavirus] attenuated rabies virus vaccine strain; derived from the Street Alabama Dufferin (SAD) field virus strain; Wistar 1965 AAP81750* glycoprotein ERA propagated on BSR cells, a baby hamster kidney (Prehaud et [Rabies (BHK-21) derived cell line al., 2003) lyssavirus] (Thoulouze et al., 1997) AAM18963 glycoprotein SRV9 avirulent vaccine strain; maintained in BHK-21 not published * [Rabies cells lyssavirus] BAM83860 glycoprotein ERA animal vaccine strain, probably propagated in not published * [Rabies BHK cell culture* lyssavirus] CEK41819 glycoprotein sadWistar_4 propagated on BHK-21 cell culture (Hoper et al., [Rabies _var01 2015) lyssavirus]

147

Appendix accession # name strain passage history reference AAF40476 glycoprotein PV11 isolated from sheep/ Chennai/ India/ 95 (street), not published [Rabies in India; lyssavirus] propagated in cell culture, no further information

AGN94507 glycoprotein Nepal_29 isolated from cell culture; vaccine strain, from (Kuzmina et [Rabies Nepal, collection date: 01-Jan-2010, genotype: al., 2013) lyssavirus] Cosmopolitan NP_056796 transmembra not published ne glycoprotein G [Rabies lyssavirus] AGN94506 glycoprotein Nepal_28 isolated from cell culture; vaccine strain, from (Kuzmina et , partial Nepal, collection date: 01-Jan-2010, genotype: al., 2013) [Rabies Cosmopolitan lyssavirus] AEV43289 glycoprotein PV-2061-2 serotype=1, isolated from cattle; not published [Rabies in France, collection_date=1882 lyssavirus] ABN11294* glycoprotein ERA vaccine viruses were once independently (Geue et al., [Rabies propagated in BHK-21 or BHK/BSR cells 2008) lyssavirus] attenuated rabies vaccine strain; derived from the Street Alabama Dufferin (SAD) field virus strain ABN11299* G [Rabies SAD Bern vaccine viruses were once independently (Geue et al., lyssavirus] (Lysvulpen) propagated in BHK-21 or BHK/BSR cells; 2008) attenuated rabies virus vaccine strain; derived from the Street Alabama Dufferin (SAD) field virus strain; vaccine batch from 2006; BIOVETA, Czech Republic" CEK41409* G [Rabies sadBatch793 propagated ob BHK-21 cell culture (Hoper et al., lyssavirus] _3_var03 2015) CAD34007* G [Rabies ERA from India, passage history unknown, probably not published lyssavirus] propagated on BHK* ACF08860* G [Rabies PV-11 propagated in BHK cells; (Kaur et al., lyssavirus] (Pitman- synthetic construct produced in 2009) Moore E. coli DH5alpha (pTPA.gp), in India; note=DNA vaccine against rabies virus ABV04332* G [Rabies ERA.KK laboratory strain, probably propagated on BHK not published lyssavirus] cell line* CEK41714* G [Rabies sadLysvulpe propagated on BHK-21 cell culture (Hoper et al., lyssavirus] n0609_3_var 2015) 01 ABN11339* G [Rabies SAD VA1 vaccine viruses were once independently (Geue et al., lyssavirus] (original) propagated in BHK-21 or BHK/BSR cells; 2008) attenuated rabies virus vaccine strain from 1983; derived from the Street Alabama Dufferin

148

Appendix accession # name strain passage history reference (SAD) field virus strain ABX79156* G [Rabies Guizhou isolates from dog or human saliva: virus (Zhang et al., lyssavirus] Al0(H) isolation and propagation done on suckling mice 2009) brains ACR15154* G [Rabies ERA-VC vaccine strain adapted in Vero cells; in China, (Guo et al., lyssavirus] collection_date=Mar-2007, probably propagated 2009) in BHK cell culture* CEK41319* glycoprotein sadBatch744 propagated on BHK-21 cell culture (Hoper et al., [Rabies _3_var02 2015) lyssavirus] ABW97212 GP [Rabies Rb/E3-15-5 adapted from vaccine strain RB/E3-15 and not published * lyssavirus] propagated in Vero cells CEK41834* glycoprotein sag2BatchF0 propagated on BHK-21 cell culture (Hoper et al., [Rabies 4_1_var02 2015) lyssavirus] CEK41849* glycoprotein sag2BatchF0 propagated on BHK-21 cell culture (Hoper et al., [Rabies 4_3_var02" 2015) lyssavirus] ABN11354* glycoprotein SAG 2 vaccine viruses were once independently (Geue et al., [Rabies propagated in BHK-21 or BHK/BSR cells; 2008) lyssavirus] attenuated rabies virus vaccine strain Street Alabama Gif; derived from the Street Alabama Dufferin (SAD) field virus; vaccine batch from 2004; Rabigen; VIRBAC, France" CEK41299* glycoprotein sadBatch744 propagated on BHK-21 cell culture (Hoper et al., [Rabies _2_var01 2015) lyssavirus] CEK41529* glycoprotein sadBatch806 propagated on BHK-21 cell culture (Hoper et al., [Rabies _5_var01 2015) lyssavirus] CEK41254* glycoprotein sadB19p1_1 propagated on BHK-21 cell culture (Hoper et al., [Rabies _var01 2015) lyssavirus] AGT98666* glycoprotein SAD Bern attenuated rabies virus vaccine strain propagated (Cliquet et al., [Rabies onefold in BHK-21 cells 2013) lyssavirus] ACF08861* TPA.GP.LA propagated in BHK cells; synthetic construct (Kaur et al., MP-1 produced in E. coli DH5alpha (pTPA.gp), in 2009) (plasmid) India; note=DNA vaccine against rabies virus [synthetic construct] ACF08862* TPA.GP.LA propagated in BHK cells; synthetic construct (Kaur et al., MP-1 produced in E. coli DH5alpha (pTPA.gp), in 2009) (plasmid) India; note=DNA vaccine against rabies virus [synthetic construct] ACF08859* TPA.GP.LA propagated in BHK cells; synthetic construct (Kaur et al., MP-1 produced in E. coli DH5alpha (pTPA.gp), in 2009) (plasmid) India; note=DNA vaccine against rabies virus [synthetic

149

Appendix accession # name strain passage history reference construct] CEK41379* sadBatch793 propagated on BHK-21 cell culture (Hoper et al., _2_var01 2015) ABX79183* Jiangsu propagated in suckling mouse brain, isolated (Zhang et al., Wx0(H) from human , in china; note=genotype: 1 2009) P16288* RecName: SAD B19 vaccine strain, propagated in BHK-21 cell line (Conzelmann Full=Glycop et al., 1990) rotein; Flags: Precursor. ABN11309* SAD Bern vaccine viruses were once independently (Geue et al., original var propagated in BHK-21 or BHK/BSR cells; 2008) 1 attenuated rabies virus vaccine strain; derived from the Street Alabama Dufferin (SAD) field virus strain; seed virus, 1975; Bern, Switzerland CEK41659* GP [Rabies sadBernO_5 propagated on BHK-21 cell culture (Hoper et al., lyssavirus] _var03 2015) ABW97207 GP [Rabies RB/E3-15 adapted from vaccine strain was propagated on not published * lyssavirus] Vero cell culture AAA47204 glycoprotein no RABV was purified from BHK cell culture (Anilionis et * precursor information al., 1981) [Rabies lyssavirus] AAP81751* glycoprotein CVS propagated on BSR cells and cell culture (Prehaud et [Rabies supernatant was used as inoculum al., 2003) lyssavirus] (Thoulouze et al., 1997) P03524* RecName: ERA purified from BHK cell culture (Anilionis et Full=Glycop al., 1981) rotein; Flags: Precursor AFC38472 glycoprotein CHB1007H no further information on passage history; (Lang et al., [Rabies isolated from human saliva, in china; 2012) lyssavirus] collection_date=2010 ABU52977 glycoprotein CTN181 isolated from rabies patient, in China: Shandong not published [Rabies Province; collection_date=1956; lyssavirus] note="genotype: 1"; china fixed virus vaccine strain ctn-1 adapted to primary chicken embryo cells AFM52583 glycoprotein CHN0906H isolated from human saliva, in china; (Tao et al., [Rabies collection_date=2009 2013) lyssavirus] AFM52590 glycoprotein CJS0639D isolated from canine brain, in china; (Tao et al., [Rabies collection_date=2006 2013) lyssavirus] AFM52581 glycoprotein CHN0902D isolated from canine brain, in china; (Tao et al., [Rabies collection_date=2009 2013) lyssavirus] AFN26988* glycoprotein JX08-45CC 120 passages in BHK-21 cell culture (Liu et al.,

150

Appendix accession # name strain passage history reference [Rabies 2012) lyssavirus] ABG78578 glycoprotein CTN-7 china fixed virus vaccine strain ctn-1 adapted to not published [Rabies primary chicken embryo cells lyssavirus] ABG78579 glycoprotein CTN-26 china fixed virus vaccine strain ctn-1 adapted to not published [Rabies primary chicken embryo cells lyssavirus] ABG78580 glycoprotein CTN-27 china fixed virus vaccine strain ctn-1 adapted to not published [Rabies primary chicken embryo cells lyssavirus] AMY15625 glycoprotein CTN181-3 china fixed virus vaccine strain ctn-1 adapted to Not published [Rabies primary chicken embryo cells lyssavirus] AIA08921 glycoprotein CTNCEC25 china fixed virus vaccine strain ctn-1 adapted to (Guo et al., [Rabies primary chicken embryo cells 2014) lyssavirus] AFM52579 glycoprotein CHN0813H isolataed from human saliva, in china; (Tao et al., [Rabies source="saliva"; collection_date=2008 2013) lyssavirus] ABG78585 glycoprotein CTN-35 china fixed virus vaccine strain ctn-1 adapted to not published [Rabies primary chicken embryo cells, no further lyssavirus] information on passage history ACR39382 glycoprotein CTN-1 vaccine strain for human use; (Shi et al., [Rabies adapted to primary chicken embryo 2010) lyssavirus] BAN14340 glycoprotein RV/R1.PHL/ isolated from canis lupus familaris brain, in (Saito et al., [Rabies 2010/TRa- Philippines; no further information on passage 2013) lyssavirus] 286 history BAN14343 glycoprotein RV/R2.PHL/ isolated from canis lupus familaris brain, in (Saito et al., [Rabies 2009/TRa- Philippines; no further information on passage 2013) lyssavirus] 279 history AFN24515 glycoprotein A10-1431 isolated from red fox brain, in USA; (Kuzmin et [Rabies note=virus originally associated with Arctic; no al., 2012) lyssavirus] further information on passage history CUI02219 glycoprotein 148/lib0104 isolated from red fox brain, in Germany; (Nolden et al., [Rabies 1 collection_date=1998 2016) lyssavirus] ABL96599 glycoprotein BLY 1/99 isolated from dog, propagated on mice brain, in not published [Rabies India; collection_date = 05-Feb-1999; lyssavirus] note=virulent strain AAX85993 glycoprotein CHAND03 isolated from dog, in India; not published [Rabies collection_date=1999; no further information on lyssavirus] passage history ABN09632 glycoprotein CA isolated from shunk and passaged in MNA cell (Sloan et al., , partial culture, in USA 2007) [Rabies lyssavirus] ABN11334* SAD P5/88 vaccine viruses were once independently (Geue et al., (Rabifox) propagated in BHK-21 or BHK/BSR cells; 2008)

151

Appendix accession # name strain passage history reference attenuated rabies virus vaccine strain; derived from the Street Alabama Dufferin (SAD) field virus strain; vaccine batch from 2001; IDT, Germany"

152

Appendix

Eigenständigkeitserklärung

Hiermit erkläre ich, dass diese Arbeit bisher von mir weder an der Mathematisch- Naturwissenschaftlichen Fakultät der Ernst-Moritz-Arndt-Universität Greifswald noch einer anderen wissenschaftlichen Einrichtung zum Zwecke der Promotion eingereicht wurde. Ferner erkläre ich, dass ich diese Arbeit selbstständig verfasst und keine anderen als die darin angegebenen Hilfsmittel und Hilfen benutzt und keine Textabschnitte eines Dritten ohne Kennzeichnung übernommen habe.

______Ort, Datum Sabine Nemitz

153

Appendix

Posters and Presentations on Conferences

25th Annual Meeting of the Society for Virology 18 – 21 March 2015, Bochum, Germany, oral Presentation “Anterograde Glycoprotein Dependent Transport of Rabies Virus in Dorsal Root Ganglion Neurons” Anja Bauer, Sabine Nemitz, Shani Gluska, Eran Person and Stefan Finke

4th Junior Scientist Symposium 21st – 23rd September 2015, Züssow, Germany, Poster “Directed knockdown of cellular genes by rabies virus expressing shRNAs” Sabine Nemitz, Tobias Nolden and Stefan Finke

26th Annual Meeting of the Society for Virology 6 – 9 April 2016, Münster, Poster “Directed Knockdown of Cellular Genes by Rabies Virus Expressing shRNAs” Sabine Nemitz, Tobias Nolden and Stefan Finke

5th Junior Scientist Symposium 21st – 23rd September 2016, Jena, Germany, oral Presentation “Cell Culture Adaptation of Recombinant Non-Fixed Rabies Lyssavirus From Fox and Dog” Sabine Nemitz, Michael Christen, Florian Pfaff and Stefan Finke

1st Summerschool on “Infection Biology” 28. - 30. September 2016, Greifswald, Germany, Poster “Cell Culture Adaptation of wild-type Rabies virus from Fox and Dog” Sabine Nemitz, Michael Christen, Florian Pfaff and Stefan Finke

27th Annual Meeting of the Society for Virology 22 – 25 March 2017, Marburg, oral Presentation “Cell Culture Adaptation of Recombinant Non-Fixed Rabies Lyssavirus From Fox and Dog” Sabine Nemitz, Michael Christen, Florian Pfaff and Stefan Finke

154

Appendix

Acknowledgement

First I want to thank Prof. Dr. Dr. h. c. Thomas C. Mettenleiter for giving me the opportunity to compose a doctoral thesis at the Friedrich-Loeffler-Institute at the Institute of Molecular Virology and Cell Biology.

Special thanks goes to PD Dr. Stefan Finke for his extraordinary support and patience during this thesis process. Without his brilliant ideas and ongoing improvement this thesis may not have been realized.

All members of the former and current Rabies virus lab, including Dr. Tobias Nolden, Dr. Verena teKamp, Maria Günther, Luca Zaeck, Angela Hillner und Dietlind Kretzschmar, I want to thank you for always willing to help me out, for great discussions and sharing an amazing time together. Of course, I also thank all students, who were involved in the work for this thesis. The same thanks goes also the other half of the Rabies virus lab of Dr. Thomas Müller and Dr. Conrad Freuling, including Elisa Eggerbauer and Jeannette Kliemt. I am grateful to be part of the Rabies virus lab for those wonderful three years!

Moreover, I am thankful for the collaboration with the Lyssavirus Research Network, supported by all students and supervisors with great discussion and new ideas. Thanks goes also the Next Generation Sequencing Laboratory for the performance of the deep sequence analysis and the evaluation of sequencing data. Moreover, I would like to thank the Laboratory of Electron Microscopy for the performance of electron-microscopic analysis.

I am thankful to my fellow doctoral students and all colleges at the Institute of Molecular Virology and Cell Biology for their feedback and cooperation during this thesis.

My family was always the best emotional support at any time. Thank you Robert, my love and my best friend, for supporting all my decisions during the last seven years. Liebste Mama, liebster Papa und mein liebster Bruder, ihr seid wunderbar und ich bin glücklich euch immer an meiner Seite zu haben.

155