Journal of Cell Science o:10.1242/jcs.122440 doi: 1268–1277 126, ß Science Cell of Journal 2012 December 14 Accepted oneuain(on-eree l,20)sosta h oeof role APP the of that case shows ko the 2007) in triple al., migration et blocked the al., (Young-Pearse the downregulation and in et 2004) effects al., et (Herms overmigration (Herms The and lissencephaly. the zone cobblestone between 2 overmigrate marginal discrepancy type human the mice APP/ resembling an in 2004), in (ko) neurons ectopically that knockout reported accumulate had triple 2004) al., APLP1/APLP2 et (Herms in al. APP Herms Conversely, et plate. of cortical the sometimes towards downregulation neurons of cortex migration the developing the are that of neurons demonstrated and precursors (Young-Pearse 2007) models al. al., et for Young-Pearse et functions instance, different opposing For for family. and glance APP the first in 2009) at argue reviews, and al., for contradictory made 2008; et al., et observations (Nikolaev Ma Mu pruning 2011; see al., axonal et (Aydin 2006), neurogenesis signalling al., intracellular 2011), et al., et Su Weyer and (Cao 2009; al., function al., et and et (Leyssen formation synapse (Wang outgrowth neuronal 2008), the neurite al., in et 2005), Young-Pearse APP 2005), 2005; al., of et cell–cell al., role (Soba 2007), loss al., adhesion a et Young-Pearse and 2004; et suggested al., Gain et have unclear. (Herms migration (Reinhard largely studies still function is understood of APP Alzheimer’s of of well context role the physiological is in beta amyloid disease of of role precursor the as Although APLP2. amyloid APP and (APP), 1 (APLP) protein evolutionary protein three precursor precursor-like of amyloid consists members: family gene conserved APP the mammals, In Introduction in role distinct a has thus and progenitors, neuronal of exit cycle words: cell Key proper summary, In for differentiation. neurons. required neuronal show cortical we specifically excitatory for addition, migrating progenitors is In of cortical cells. APLP2 position mitotic priming or that of speed reveal number during the higher APLP2 impact data a of not our displaying role does longer, the downregulation much depth APLP2 state in neuron-specific undifferentiated that contradictory analysed their we to in issue, led remain this have progenitors address studies cortical To shRNA APLP2 key development. and with silencing brain coincides knockout by development embryonic genetic neurogenesis brain during However, during role migration. APLP2 their and and about differentiation APLP1 conclusions neuronal paralogues, as two its such and events (APP) cellular protein precursor amyloid of Expression Summary ( correspondence for *Authors 4 3 2 1 Shariati M. Ali S. development differentiation cortical cell during stem neuronal regulates APLP2 1268 atD Strooper De Bart nttt fPamc n oeua itcnlg,Uiest edleg 92 edleg Germany Heidelberg, Belgium 69120 Leuven, Heidelberg, 3000 University Belgium (LIND), Biotechnology, Biologı Leuven, Diseases de Molecular 3000 Centro Neurodegenerative and Disease, for Pharmacy of Institute of Biology Leuven Institute the and for Genetics Center Human VIB for Center Leuven, KU 03 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2013. le ta. 02 enade l,20) Moreover, 2005). al., et Reinhard 2012; al., et ¨ller do,20;Dyse l,21)sehwvr(He however see 2012) al., et Deyts 2001; ¨dhof, mli rcro rti,Ayodpeusrlk rti,Cl yl xt ernmgain Progenitors migration, Neuron exit, cycle Cell protein, precursor-like Amyloid protein, precursor Amyloid aMlclrSvr co,CI/A,C/Nicola CSIC/UAM, Ochoa, Severo Molecular ´a 1,2 1,2, [email protected] ireLau Pierre , n net Ga Annette and * nvivo in ; 1,2 [email protected] asmA Hassan A. Bassem , na P/PP obekoku os akrud efn htudrteeconditions these under that find We background. mouse knockout double APP/APLP1 an in ¨rtner nvivo in 1,2, * lcsthe blocks sCbea1 apsd aUiesddAuto Universidad la de Campus 1, Cabrera ´s ´ bert ; 1,2 [email protected] lieMu Ulrike , eurdfrpoe rgeso fnuoa differentiation neuronal Results is of APLP2 progression progenitors. that cortical reveal of proper and data program proliferation for Our the neurons. required in excitatory positioning function cortical final and APLP2 the of migration of and investigated progenitors, loss of We differentiation the embryos. of (dko) APP/ effect and knockout (wt) wild-type double both of APLP1 cortices developing in APLP2 of progenitors. APLP2 cortical of involvement development. of the cortical on in specification attention our and focused we Therefore development function specific a the for candidate interesting in developing very a the it of makes (VZ/SVZ) cortex zones proliferative the Lo to 2011; expression al., et (Diez-Roux and only zone (CP) CP Sa subventricular the plate and in the VZ APLP1 cortical and the cortex. in the (SVZ) in APLP2 differ in (VZ), developing found patterns zone ventricular is expression the APP APLP2 because cortex: and idea developing of APLP1 this support and regions data APP expression different mRNA Interestingly, distinct in regulate may is APLPs development processes and cortical APP of Alternatively, course unclear. the still in members family APP the h oigsqec fteAL2tasrp.Wsenbo analysis Western-blot transcript. APLP2 the of of regions sequence different coding targeting the two constructs used shRNA we driven development, cortical U6 in different APLP2 of role the examine To cortical affects cortices positioning dko in downregulation APLP2 ´ ce ta. 05 ie ta. 04.Tersrcino APLP2 of restriction The 2004). al., et Visel 2005; al., et nchez oadesti usin esilenced, we question, this address To ller ¨ 3 alsG Dotti G. Carlos , ) nm eMdi,209Mdi,Spain Madrid, 28049 Madrid, de ´noma 1,2,4, nutero in *, eerhArticle Research h expression the , ´ pez- Journal of Cell Science ** rjcin f1–5consecutive 10–15 of projections ( GPpstv el hw nD a rpsso rqec itiuino GPpstv el ntneulydvddbn rmvnrce()t h pi the to (1) ventricle from bins divided equally ten in cells ( mean EGFP-positive cells the of dko represent distribution of Values frequency positioning wall. show cortical cortical graphs alters of Bar expression (10) D. shRNA APLP2 in (E14.5–E18.5). mean shown electroporation cells the after EGFP-positive represent days Values 4 wall. EGFP, coexpressing cortical construct the ( of cells (10) EGFP-positive surface of in median pial differences distribution developmental the population to to the lead (1) compares not ventricle does from expression shRNA bins APLP2 divided (E14.5–E18.5). electroporation ( after conditions. days wild-type 4 to EGFP, with together shRNA control PP hN2mr hn8%kokon i.1) Since 1A). Fig. knockdown; 80% than more and shRNA2 knockdown 95% than APLP2 downregulation more shRNA1 the (APLP2 confirmed protein constructs APLP2 of shRNA those of transfected one were with which cells HEK293 overexpressing APLP2-V5 of oto)o E el xrsigAL2V rnfce ihU rvnAL2sRA,AL2sRA rcnrlsRA ih:dwrglto fAPLP2 of downregulation Right: shRNA. control or shRNA2 APLP2 shRNA1, APLP2 ( driven actin U6 total with the transfected cortices. to APLP2-V5 dko normalized in expressing cells cells of HEK positioning of the control) changes downregulation APLP2 1. Fig. n 5 P , ,3040clsfrcaiyo rp;vle ersn h median the represent values graph; of clarity for cells 300–400 3, .1 *** 0.01, 6 neqatl ag;Mn–hte et.( test). Mann–Whitney range; interquartile P , 0.001. C uniiaino GPpstv el hw nB a rpsrpeetfeunydsrbto fEF-oiieclsi e equally ten in cells EGFP-positive of distribution frequency represent graphs Bar B. in shown cells EGFP-positive of Quantification ) n 5 ) ( 4). z scin.Uprcria aesaesandwt u1atbd n AIi sdfrncersann.Saebr:50 bars: Scale staining. nuclear for used is DAPI and antibody Cux1 with stained are layers cortical Upper -sections. B ofcliae fcrnlsie fwl-ye(T riseetooae ihcntut xrsigAL2sRAor shRNA APLP2 expressing constructs with electroporated brains (WT) wild-type of slices coronal of images Confocal ) 6 ..( s.d. D ofcliae fAPAL1docrie rnfce ihAL2sRAo oto shRNA control or shRNA APLP2 with transfected cortices dko APP/APLP1 of images Confocal ) n 5 ;Student’s 5; n 5 ,ol 0–0 el nyaesonfrcaiyo rp;vle ersn the represent values graph; of clarity for shown are only cells 300–400 only 3, 6 t ts) h ne cte ltcmae h ouaindsrbto fEF-oiiecells EGFP-positive of distribution population the compares plot scatter inset The -test). neqatl ag;Mn–hte et.Alcnoa mgsaemxmlintensity maximal are images confocal All test). Mann–Whitney range; interquartile ( eodcntuti nta xeiet nodrt aiaethe validate shRNA to this order in analysis experiments our initial of the in utilized of construct and most shRNA) downregulation second APLP2 in as the hereafter used to for (referred construct we efficient protein, more APLP2 was shRNA1 APLP2 A et etr ltsoigpoenlvl fAL2V n ci (loading actin and APLP2-V5 of levels protein showing blot Western Left: ) PP nnuoa ifrnito 1269 differentiation neuronal in APLP2 6 ..( s.d. n 5 ;Student’s 5; t ts) h ne cte plot scatter inset The -test). E uniiainof Quantification ) lsurface al respect m m. Journal of Cell Science xrsigtecnrlsRAo h PP hN hog the through shRNA we APLP2 the the for migration, or either for shRNA neurons neuronal dko control required of the essential distance directly expressing and polarization speed not assess migration the process morphological To monitored is trailing migration. groups the APLP2 thinner proper both a of that in and acquisition indicating neurons edge neurons leading 2A), case: migrating (Fig. thickened of the a morphology in not bipolar analysis with changes typical is microscopic the observed Careful this displayed the cells. that the explain revealed of could positioning ‘triple which cortical versus dko neurons, in different is ko’ plate cortical the towards moving approach. our any of induce specificity Fig. the to material for constructs supplementary argues 1B,C; shRNA S1) (Fig. cortices APLP2 Moreover, wt in both S1). APP/ phenotype Fig. of in material inability shRNA2 (supplementary cortical the APLP2 the mice with in dko the transfected change APLP1 in a cells APLP2 only of target find to positioning we shRNA2) Again, (i.e. cortex. shRNA To developing construct, second plate. shRNA a APLP2 cortical used the we the of off-target towards possible against responsible progression guard machinery neuronal the that proper of indicates component the for important This shRNA of the an 1D). layer is Fig. control mice, upper APLP2 layer, the the (Cux1-positive wt to plate with to migrated cortical dko) electroporated Similar (APP/APLP1 neurons construct 1D,E). (Fig. of of cortex majority VZ/SVZ the developing in a predominantly residing i.e. the (54%) region, to dko cells negative APP/ EGFP-positive Cux1 APP/APLP1 the of led in from number in large downregulation we progenitors a have in this, APLP2 resulted cortical test mice. could in To dko function. APLP1 shRNA 2000) APLP2 throughout APLP2 of APLP2 al., loss expressed the and et for APLP1 compensation (Heber APP, of development function antibody Cux1 redundant by marked is the which in cortex, 1B). positioned the (Fig. mostly of were layers In cells 1B,C). upper (Fig. EGFP-positive shRNA cells cases, shRNA APLP2 control of both analysis to behaviour respect of the in in cells types entire difference expressing Both any the reveal Methods; inset). of not 1C, and difference did of (Fig. the Materials number distribution analysed (see relative population we bin the Moreover, each 1B,C). counted Fig. and in bins cells the equal of divided EGFP-positive cortical we position ten purpose the the into this analysed For of cortex and sections. layers coronal brains in the upper cells fixed labelled the into we 1B), in differentiated (Fig. residing have plate when are to point which expected time neurons are the electroporation, precursors transcript shRNA after mouse transfected NCBI control days any Four scrambled with significantly sequence. a align used not was does we EGFP that cells, control, electroporated As visualize to (Molyneaux coexpressed. order generated In are 2007). neurons al., layer et upper when 1995) al., et eeoigcre tE45(Lo E14.5 at using cortex by developing E14.5 at mice wt utero of progenitors cortical by in constructs downregulated transfection. clearly shown), after days not was three (data shRNA1 expression fibroblasts APLP2 embryonic APLP2 mouse in endogenous and material in (supplementary S2A) mice Also E14 Fig. effects. from off-target neurons cortical of of possibility cultures the exclude and phenotype 1270 et eakdwehrtemrhlg fnuosta are that neurons of morphology the whether asked we Next, well-described the that possibility the considered We oadesAL2fnto,w xrse h PP shRNA APLP2 the expressed we function, APLP2 address To lcrprto.AL2i ihyepesdi the in expressed highly is APLP2 electroporation. ora fCl cec 2 (5) 126 Science Cell of Journal ´ pez-Sa ´ ce ta. 05 Lorent 2005; al., et nchez in rnhdbsledfe n pclcnetos(i.2C) (Fig. connections apical and feet with 2000). The al., wall end et cortical (Chanas-Sacre E14.5. entire and basal the radially shRNA spanned were from branched and APLP2 they aligned in cortices: APLP2 well dko similar oriented, electroporated was downregulated plasmid glia control radial the with of analysed morphology we slices mice dko E16.5 neurons, in cells of migrating glia radial radially EGFP-labelled of provide morphology for which cells, scaffold glia the radial of differentiation morphological positioning. neurons cortical is altered neurons migrating of of behaviour neither cause the migratory Thus, the the 2). nor of and defect 1 morphological behaviour Movies the a material in the supplementary nor 2B; migration in (Fig. neuronal not of nor did speed neurons morphology the migrating distance in of the differences explants imaging the reveal in live from differences Moreover, away migrate any 2B). neurons (Fig. detect ko ‘triple’ not or did double that We 2008). al., et an of use pr rmtedfciecria oiinn f‘rpeknockout’ ‘triple of positioning cortical defective the from Apart proliferative a state in progenitor remain cells knockout’ ‘Triple oneuainwspoe ywsenbo nlssof APLP2 analysis for blot functionality western Its by shown). proven was not microRNA downregulation (data miR-30 be used commonly downregulation can the system in to that compared effective mCherry more shRNA of let-7 was embedded The shRNA 3A). based microRNA (Fig. microRNA promoters let-7 cell-type-specific a from on expressed based of shRNA, use APLP2 to the construct the of a expression designed we cell-specific hypothesis, achieve above the substantiate To migration is radial and for function dispensable progenitor-specific a has APLP2 neurons. from program post-mitotic differentiation to neuronal precursors the of cell progression glia normal radial of number the small very with a electroporated progenitors. observed PH3/EGFP-positive only cortices mitotic and found dko cells rarely undergoing very were in we they shRNA contrast, control that showing In during 1999), condensation mitosis. al., glia a et chromosome (PH3), some (Goto to radial 3 and mitosis associated phospho-histone 2D,E) likely expressing tightly (Fig. still marker most present were 2E) still zone, (Fig. was cells later), ventricular negative (see Tbr2 the progenitors a addition, in ( In 2D). 29% population (Fig. which neurons of post-mitotic into VZ/SVZ the dko number in in large n contrast, a remained In shRNA, cells 2D). APLP2 of (Fig. the plate with electroporated cortical post-mitotic cortices the became cells to the migrated of and most 7% electroporation, only after and days VZ/SVZ the number in dko located small In ( were a 2D). cells shRNA positive (Fig. control EGFP Tbr2 of the marker with to brain progenitor electroporated fail the basal cortices labelled which the we neurons determine zones, with or proliferative slices To the state, which from proliferative progenitors 1D,E). away are a migrate (Fig. VZ/SVZ in the VZ/SVZ longer in ‘triple remain arrested the of cells retention the in whether detected cells also we knockout’ above, described neurons 6 5 ots hte h irto ea a u oacag nthe in change a to due was delay migration the whether test To loehr hs aasgetta PP ly oei the in role a plays APLP2 that suggest data these Altogether, ..2.4%, s.d. )epesdTr ugsigta hyfie odifferentiate to failed they that suggesting Tbr2 expressed 3) nvitro in n 5 )wr b2pstv,dmntaigta four that demonstrating positive, Tbr2 were 3) irto sa nMtie Cleo eAnda de (Calderon Matrigel in assay migration 6 ..3.5%, s.d. Journal of Cell Science 94 lse ta. 94 ahmt-oi ta. 2008). al., T et of T EGFP Hashimoto-Torii co-electroporation al., by of 1994; et confirmed al., expression Feng 2006; et Differential al., Gloster et 1994; (Coksaygan of neurons Tubulin- respectively and post-mitotic expression (BLBP) promoters, protein and the lipid-binding progenitors Brain driving the neural by using in function shRNA APLP2 APLP2 of loss specific 1D). U6 (Fig. mice the dko by in obtained downregulation was APLP2 that driven phenotype S2B) the Fig. recapitulated material promoter (supplementary CAG ubiquitous the using T Fig. APLP2 material (supplementary with shRNA addition, In U6-driven S2A). transfected the endogenous 90%. of to cultures downregulation APLP2 about comparable by cortical showed shRNAmir, expression E14 and protein shRNAmir Moreover, APLP2 cDNA APLP2 the the reduced APLP2 to 1A), construct Similar (Fig. tagged 3B). constructs (Fig. shRNA V5 construct U6-APLP2 shRNAmir a a with expressing transfected cells HEK293 oprdwt oto hN Fg DE.I contrast, In 3D,E). (Fig. shRNA control when cells with EGFP-positive of positioning compared cortical the in changes a hssse loe st netgt h euto cell a of result the investigate to us allowed system This xrsino PP hNmrudrtecnrlo neuronal of control the under shRNAmir APLP2 of Expression rmtri k otmttcclsddntrsl nany in result not did cells post-mitotic dko in promoter nutero in Fg 3C). (Fig. nutero in lcrprto fAL2shRNAmir APLP2 of electroporation a n LPpooeswas promoters BLBP and a mhrywt BLBP- with -mCherry a (T a ) fe asms ftepoeydrvn from deriving progeny the of most whilst conditions, days different the 4 compare under Nakajima, to cells developing after and us of the allowing (Tabata fraction 2008), of proliferative Nakajima, conditions zone and control proliferative Tabata progenitors the 2001; under of in even number found substantial cortex analyse be a of precursor still days, instead to two can during electroporation chose After after APLP2 days. we days four of two detail, role brains more electroporated the in understand proliferation to APLP2 order by regulated In are variables cycle Cell ihihigteiprac fAL2i erldfeetainof differentiation neural progenitors. further in stage, cortical APLP2 progenitor of the importance from the exit of the highlighting function in specific expressing delay progenitor the shRNAmir a and APLP2 supports CAG APLP2 BLBP- This the 3F). detected cells ubiquitous (Fig. in we cortices only of electroporation the cells after EGFP-positive with progeny days Four construct the co-electroporated promoter. BLBP we mCherry-expressing neurons, the visualize young after in a off shRNAmir to switched is APLP2 promoter BLBP order with phenotype with In electroporated 3F,G the Fig. to (compare 1D,E). promoter similar U6 Fig. the VZ/SVZ using observed the the we in that caused cells shRNAmir of APLP2 accumulation of expression specific progenitor PP nnuoa ifrnito 1271 differentiation neuronal in APLP2 rohas.Saebr:25 (white bars: cells Scale transfected arrowheads). marker shRNA PH3 APLP2 mitotic mitotic the show with or labelled shRNA shRNA APLP2 control with transfected cortices ( dko cortices. APLP1 shRNA-treated VZ/ APLP2 the of in SVZ progenitors show electroporation antibody after Tbr2 days with 4 labelled sections cortical coronal images of Confocal EGFP. control coexpressing or construct shRNA shRNA APLP2 with transfected cortices PP k otcstasetdwt PP hN or shRNA APLP2 APP/ with in transfected (right) cortices feet dko end APLP1 and (left) fibres ascending (0.8 shRNA). sections control for cells 26 ( and shRNA APLP2 for of ( expression shRNA with APLP2 change not does movement neuronal Student’s explants; 18 t from cells 182 shRNA, explants; et ) 100 E); left, C ( are surface. that pial feet the end to the branched attached span with fibres wall the cortical groups, entire both In shRNA. control rpek ern.Vle ersn h mean the in represent change ( not Values does neurons. which ko explants, triple cells of EGFP-positive margin of the upper distance from The mean plating. the after shows days graph 3 Matrigel in explants neuronal embedded transfected shRNA APLP2 or in ( shRNA neurons comparable. of is morphology groups The both one CP. and the (blue) in neurons positioned the migrating depict two right of the morphology on or Drawings shRNA shRNA. APLP2 control with transfected neurons migrating consecutive n ioi akr u ontso morphological show not changes. progenitor do express but markers cells mitotic ko’ and ‘triple Arrested 2. Fig. ts) h oe rp hw httevlct of velocity the that shows graph lower The -test). C n 5 ofclpoeto mgso 02 consecutive 20–25 of images projection Confocal ) ifrn xeiet,cnrl 6 el rm16 from cells 161 control, experiments, different 3 ( A ofcliae f2–5(0.8 20–25 of images Confocal ) z scin lutaigmrhlg fdko of morphology illustrating -sections m )o ailgi el lutaigtheir illustrating cells glia radial of m) m n (D). m 5 needn xeiet,2 cells 29 experiments, independent 2 m B D A ih) 50 right); C (A, m mgso control of Images ) P/PP dko APP/APLP1 ) E APP/ ) nutero in nutero in 6 m m) m s.d. (B, m z - Journal of Cell Science olcigteban tE65 hswsfloe yKi67 by thus the Hence, and followed 2002). cycle Walsh, was and cell (5-bromo-2 (Chenn the cells This proliferating throughout all BrdU E16.5. expressed labels before is hours at which 24 and brains after staining, cells S-phase the cortices cells of collecting EGFP-positive labelling E14 the pulse of of deoxyuridine) of rates examined fraction we exit electroporation state, which proliferative cycle the determine and cell in control To remains under pool conditions. EGFP proliferating progenitor of still ko’ fraction progenitor were ‘triple the which of analysed cells we positive regulation simply possibilities, distinguish cells these the To that between of efficiencies. electroporation in number suggested in differences higher reflects involved observation the Alternatively, be initial proliferation. may This the APLP2 4A). to closer (Fig. to located were compared which cells ventricle of of many number cells higher transfected a control found and cells expressing neurons into differentiated 1D,E). been (Fig. has progenitors electroporated 1272 ntal,w nlsdtepsto fAL2shRNAmir APLP2 of position the analysed we Initially, ora fCl cec 2 (5) 126 Science Cell of Journal nutero in 9 - oemttcclsi til o odtos ots this mitotic an of test days number using the Two To in (Ser10). cells increase twofold conditions. 3 a mitotic histone electroporation ko’ after phosphorylated specifically ‘triple against labelled antibody in we cells hypothesis, neuronal mitotic the into more entry delayed a and rate program. exit delay differentiation from cycle results cell likely the cells ko’ cells, in ‘triple changes of the resulting dko positioning findings, and cortical these progression in shRNAmir neuronal of of in light regulation decrease APLP2 In the observed 4B). in (Fig. in APLP2 differentiation shRNAmir of neuronal 45% ctrl function in essential to demonstrating 74% cells from decreased expressing significantly was EGFP+/ between have ratio ratio the that as calculated cells was BrdU+/Ki67 of exit The cycle neurons. pool cell but young of hours are the rate negative consequently 24 and to Ki67 mitosis, after correspond exited while recently Ki67 cells pool, positive express proliferative BrdU and the BrdU to correspond integrate which cells eraoe htardcdcl yl xtrt a eutin result can rate exit cycle cell reduced a that reasoned We 2 el n h oa GP/rU ouain This population. EGFP+/BrdU+ total the and cells 50 hte et.** test). Whitney ersn h median the represent ( cells Cherry-positive of distribution population the compares plot scatter inset The etil 1 otepa ufc 1)o h otclwall. cortical the of mean the (10) represent surface Values pial the from to bins (1) divided ventricle equally of ten distribution in frequency cells the Cherry-positive represent graphs Bar F. in xrsino hN ed ortnino el nteVZ/ the in ( cells SVZ. of retention to leads shRNA Progenitor-specific of promoter. expression BLBP of control the shRNAmirunder control or shRNAmir APLP2 with transfected consecutive 10–15 anWinyts) ( test). Mann–Whitney rp;vle ersn h median the represent values graph; of ( distribution cells population EGFP-positive the compares plot scatter inset otepa ufc 1)o h otclwl.Values wall. cortical the of (10) surface pial the (1) ventricle to from bins divided equally ten in EGFP- cells of positive distribution frequency represent graphs Bar positioning. ( cortical change not does APLP2 ersn h mean the represent ihAL2sRAi rcnrlsRAi ne the T under of shRNAmir control control or shRNAmir APLP2 with consecutive open cells, ( 150 arrowheads). (6.12%; cells EGFP of and fraction mCherry small coexpress very a cell only different because target populations promoters two the that shows using BLBP-GFP h fiinyo h 6sRA osrc seFg 1A). Fig. (see construct ( shRNA1 U6 the to of comparable efficiency and the 90% about was construct the microRNA by obtained downregulation The shRNAmir. control or shRNAmir expressing APLP2 cells with transfected HEK APLP2-V5 of control) (loading actin and ( shRNA. microRNA-based and U6-shRNA proliferative the cortex. developing in of cells zone retain to sufficient is APLP2 shRNA of expression Progenitor-specific 3. Fig. E C B uniiaino GPpstv el hw nD. in shown cells EGFP-positive of Quantification ) etr ltsoigpoenlvl fAPLP2-V5 of levels protein showing blot Western ) otaseto fT of Co-transfection ) m C;100 (C); m G uniiaino hrypstv el shown cells Cherry-positive of Quantification ) a z scin)o k otclsie transfected slices cortical dko of -sections) rmtr ernldwrglto of downregulation Neuronal promoter. D ofcliae poeto f10–15 of (projection images Confocal ) m P (D,F). m nutero in , z 6 scin)o k otclslices cortical dko of -sections) .1 *** 0.01, n 6 F ..( s.d. 5 ofcliae poeto of (projection images Confocal ) a neqatl ag,Mann– range, interquartile ,3040clsfrcaiyof clarity for cells 300–400 3, n cer sldarwed)with arrowheads) (solid -cherry 5 lcrprto (E14.5–E16.5) electroporation 6 n ( ,3040cls values cells; 300–400 3, A 5 ..( s.d. P ceai oprsnof comparison Schematic ) ;Student’s 3; , .0.Saebars: Scale 0.001. n 6 5 ;Student’s 3; neqatl range, interquartile t ts) The -test). t -test). Journal of Cell Science rosidct GPTr obepstv rgntr.Tegahsosta ohcasso rgntr r nrae fe PP downregulation APLP2 after increased are progenitors of classes progen both mean double-positive that EGFP/Sox2 the shows indicate represent graph arrowheads white The progenitors. Solid double-positive shRNA. EGFP/Tbr2 control indicate or arrows shRNA APLP2 with transfected slices double-stained Sox2-Tbr2 h rgntradnuoa ol.Teblnebetween of balance ratio the The on depends pools. neurons neuronal post-mitotic and and of distribution progenitors different progenitor a in resulted the had this whether of question shRNAmir electroporated control to cortices compared dko 4C). when of (Fig. shRNAmir VZ/SVZ APLP2 in with observed was cells mean the represent Values show cells. Graph EGFP-positive arrowheads). of (white number increased total cells the mitotic by of divided number cells the PH3+ arrow downregulation of yellow APLP2 ratio After Open the marker. assay). by PH3 exit calculated mitotic cycle as the cell index with EGFP+/BrdU+/Ki67 the labelled of of B, scheme ratio in (see EGFP+/BrdU+/Ki67 the as indicate E16.5 arrowheads images by at yellow calculated Ki67 solid is cycle; and that cell BrdU the progenitors EGFP, leave shRNA-expressing for not staining did triple that fo ( then cells are cortices. the and cells indicate expressing E15.5 more electroporation, shRNA at after injection APLP2 days BrdU Two in by E14. cortex at followed developing shRNAmir control the or pools. of shRNAmir progenitor APLP2 VZ of expansion with the co-transfected and slices exit cortical cycle dko cell E16 decreased of to sections) leads APLP2 of Downregulation 4. Fig. h bevdcagsi rgntrpoieainrie the raised proliferation progenitor in changes observed The 6 .. * s.d.; P , .5 ** 0.05, P , .1 Student’s 0.01, t ts.Saebr:50 bars: Scale -test. B ofcliae fdocrie rnfce yAL2o oto hN tE14.5 at shRNA control or APLP2 by transfected cortices dko of images Confocal ) m A;100 (A); m fSx n b2t eemn h aac ewe proliferative between balance the determine to Tbr2 double-staining for and used Tbr2 Sox2 and therefore of glia We radial distinguished cells. for progenitor be Sox2 intermediate can the markers: progenitors molecular cells. to of specific A progenitor by classes leading intermediate principal and division. or cell two glia These cell self-renewing radial a be glia of generation can radial division proliferative proliferative versus neurogenic 2 el iie ytettlEF+Bd+pplto ( population EGFP+/BrdU+ total the by divided cells m B;25 (B); m PP nnuoa ifrnito 1273 differentiation neuronal in APLP2 2 el.Tegahsostedcesdcceei fAPLP2 of exit cycle decreased the shows graph The cells. ( m A C;20 (C); m ofcliae poeto f1–5consecutive 10–15 of (projection images Confocal ) m (D). m 6 ..( s.d. n 5 ) ( 3). D n ofcliae of images Confocal ) 5 ) ( 5). ( C n 5 Confocal ) n ls to close und tr;white itors; ) Values 3). mitotic s heads z - Journal of Cell Science oto fnuoeei uha a1(oaon ta. 1999; the al., in et involved (Homayouni Dab1 are as which Lakoma such of neurogenesis of bind of some can control molecules motif proliferation YENPTY adapter a several The contains the interactions. which be cell-adhesion domain, could in regulate intracellular domain or extracellular receptor–ligand The in therefore involved ways. various could in multidomain progenitors a extracellular and is large APLP2 a region 4B,D). with of (Fig. preservation protein stage and trans-membrane proliferative exit their cycle cell in of progenitors decrease to led progenitors redundant the for responsible be proliferation. could on effect VZ/SVZ the in residing 04,tepplto hc sas nrae fe APLP2 after 4D). Fig. increased 3F; (Fig. also mouse Thr dko is Interestingly, of al., progenitors which the in et population downregulation promoting (Yoon progenitors is the glia Notch 2004), radial Active specifically on 2002). of activity al., self-renewal as repressing et such its decisions (Roncarati fate by Notch cell differentiation in involved versus is proliferation Numb 2008). al., et (Ma differentiated the (Lo in where non-specifically CP In CP rather cortex. and present the is developing VZ/SVZ to APP the and restricted of reside neurons SVZ is and APLP1 VZ contrast, distributed proliferative specifically is the APLP2 APLP2: in indications of of role number central those a a studies reveals 1B,C), under to (Fig. our sufficient defects Although not developmental rate viable is 4). elicit alone proliferation 2, downregulation indeed APLP2 (Figs increased that morphology demonstrate even are normal their their we cells by and shown lethality, The as avoid conditions 1). (Fig. ventral to the in APLP2 order APLP2 cells by of of In subpopulation role telencephalon a mice. in the APLP2 dko analysed downregulated we APP/APLP1 genotype, function redundancy, APLP2 viable in preclude study to a APLP2 to order for in is and Therefore, role 2000). developmental ko al., APP/APLPs distinct et double (Heber and of crucial APP/APLP1 a deletions only suggesting genetic mice, combinatorial in family different gene us APP prompted of the This role phenotype. the obvious investigate al., any further to et find not (Bergmans did and cells and 2010) stem embryonic (McConnell APP/APLP1/APLP2 ko neurons is stages. the architecture developmental generated of early cortical at determination prospective the determined the already Hence, and of 1991). exit essential Kaznowski, cycle between fate is link cell close step the laminar a this of is of timing there control the since development The neuronal cortical a neuron. during differentiating a of role into key decision a progenitor biological plays APLP2 essential that the view the in with consistent are data Our is APLP2 Discussion that implying division. glia neurogenic division, radial in shifts neurons proliferative APLP2 involved of post-mitotic lack towards cortices that of APLP2 shows cells result paucity dko This after relative 4D). cells (Fig. corresponding EGFP-positive cells in Tbr2 a and glia with Sox2 downregulation both radial increased significantly of APLP2 division downregulation. neurogenic and idn rpriso h EPYmtfadtu couples thus and motif YENPTY the the changing kinase of CDK1 a properties by binding phosphorylated be can domain 1274 eso htrdcdlvlo PP nAPAL1dko APP/APLP1 in APLP2 of level reduced that show We rvosy eaaye ern generated neurons analysed we Previously, ´ ta. 01,Nm Rnaaie l,20)adFe65 and 2002) al., et (Roncarati Numb 2011), al., et ora fCl cec 2 (5) 126 Science Cell of Journal 668 nutero in ls oteAL2YNT interaction YENPTY APLP2 the to close ´ pez-Sa lcrprto fsRAagainst shRNA of electroporation ´ ce ta. 05.Tu,APP Thus, 2005). al., et nchez nvitro in nvivo in rmtriple from Among . PP oban Adne l,21) nti td,CDK study, this In mice. ko 2011). APLP2 in downregulated al., in be altered to et found is was (Aydin neurogenesis p21 inhibitor brains in involved ko genes APLP2 that of showed cortex expression microarray prefrontal progression DNA the adult al., recent the cycle A et of 2012). profiling cell (Bai al., et transcriptome RhoA Yang influence 2012; and al., potentially et Rac1 (Vidaki can as which such of family members 2008), RhoGTPase revealed analysis APLP2 the the An with of in differentiation. role specifically similar al., interacting progenitor a proteins investigate et neuronal to (Wang interest of of molecules context be will adhesion are it synaptic proteins and 2009) family novel APP as junction, proposed matrix neuromuscular 1994). the Davis, at and on cell–extracellular (Temple Indeed, dependent factors strongly associated proliferation is and membrane which progenitor specific neurons, neuronal between into cell–cell differentiation decision and of the in regulate which regulation directly role APLP2 the (Mu Alternatively, interactions a in CDK1 APLP2. involved plays APLP2, through be developing that suggesting to development of 2004) could al., VZ/SVZ et Similar Visel the CDK1 2011; 2009). al., in et concentrated (Diez-Roux al., cortex also al., et is et (Suzuki expression cycle cell Tamayev the to 1997; metabolism and function APLP2 h agnlzn Hbre l,20;YugPas ta. 2007). in not al., neurons et Young-Pearse of were 2000; accumulation al., et ectopic studies (Heber an cortical zone other marginal of these the the inhibition and complete of entry a cortical plate showing findings study during one the migration conclusive, 3E,F). findings (Fig. expressing Yet, neuronal other mice with by in development. contrasts dko defect abnormalities VZ/SVZ of migration showing a the progenitors of in to absence The only close shRNA cells APLP2 an of using neurons accumulation wt migration and in neurons ko’ differences progenitor vitro was ‘triple any in isolated detect defect of not primary mice speed cells a could towards of we ko’ progression consequence first, neuron a ‘triple function: knockdown likely cortical is in in CP delay positioning the APLP2 We This cortical 1B–E). 1D,E). (Fig. in (Fig. in mice differences excitatory wild-type double in found or cortical APP/APLP1 that from in of indistinguishable mice positioning migration neuron knockout radial Cortical the neurons. for dispensable intermediate completely cannot more progenitor intermediate but on migration. generating APLP2 support, and/or of division not influence are direct do a which exclude, data of Our cells pool larger progenitors. the This glia of 4D). consequence (Fig. a that cells radial is glia positive increase indicating their radial VZ that Tbr2 by suggests the recently neurons many generated in were into found Interestingly, they were symmetrically 2004). progenitors al., divide intermediate progenitors et mainly intermediate of (Haubensak which that also but 4D), of the pool, (Fig. expansion APLP2 cell an glia ubiquitous only radial analysed not after the observed days We 4D). (Tbr2 two we (Fig. intermediate cells downregulation and in downregulation, positive) progenitors (Sox2 positive) glia APLP2 radial of for proportion after relevant are affected mechanisms similar interesting regulation. be neurogenesis whether will embryonic It determine 2008). the al., to in et proliferation (Pechnick hippocampus progenitor adult enhances p21 of Downregulation u tde hwdta PP n P perdlargely appeared APP and APLPs that showed studies Our were populations progenitor which investigate to order In sa Fg D;scn,w ol hncp the phenocopy could we second, 2D); (Fig. assay le n hn,21;Sb ta. 05 could 2005) al., et Soba 2012; Zheng, and ¨ller in Journal of Cell Science nooi eoa ramn,wr banduigQae norePamdMaxi Plasmid EndoFree Qiagen using obtained were treatment, removal endotoxin lyn pcfcrl nrgltn rgntrpoieainand proliferation progenitor regulating in both differentiation. role is in specific APLP2 functional a whilst is neurons, playing APP migrating which post-mitotic in and model the progenitors a together, explanation Taken support additional defects. data or positioning current cortical alternative function observed possible progenitor the a for investigate be not could did which studies these However, rmtrwr bandfo rgn Rcvle MD). (Rockville, Origene from obtained were promoter 5 sequence: AGGCTCTGGAATGGCAGAACAAGAC-3 5 (sequence: (GI562807) CCAACCGAAC-3 shRNA1 APLP2 The constructs DNA Methods and Materials networks. early basis cortical the the correct lays of in which development cortex, APLP2 subsequent cerebral molecule for the family of steps APP developmental the of contribution sn w ne rmr:5 primers: inner two using edn h ehrad)wsPRapiiduigPoeaItoF(5 IntronF (Promega, Promega plasmid using psicheck2 amplified the PCR in was found Netherlands) intron CGAAGGTAAGTATCAAGGTTACAAGACAG-3 The synthetic The Leiden, follows. as TATGTGGG-3 TCCAGGAGCGCACCATCTTCTTC-3 5 for primers inner GGCATGGCGGACTTGAAG-3 two using overlap-PCR by EGFP TGTGGAGAGAAAGGCAAAGTG-3 CTCTGTTC-3 3 (5 CTCGAGGTGCTCTGTGGGAT-3 Xho Xho ACCACCGTGGGA-3 TTTGC-3 neln h olwn lgncetds PP-e7I(5 after APLP2-let7-I obtained TTG-3 were oligonucleotides: mCherry and following TCTGTGGGATCGCTGCTGGGTTCGGTTGGATTTAGGGTCATACCCCATC- APLP2 for the shRNAs let- annealing The the into sequence. shRNA cloning, the scaffold shRNA embed 7f to For designed were plasmid. oligonucleotides pCAG-EGFPintron-let-7f DNA overlapping the in resulting construct lndit h CGEF nrnvco ietdby digested vector intron pCAG-EGFP the into cloned 7Fhu- LET-7Fhu-MfeI using DNA genomic (5 human from amplified was sequence genomic AGAAACGCAAGAGTCTTCTCTG-3 GGGATGGCTCA-3 was promoter BLBP (5 the BLBP-F cells, using DNA glia genomic radial mouse into from expression amplified cell-specific For mir BLBP-shRNA digested using were plasmid shRNAs pCAG-EGFPintron-let-7f resulting sites. the The into primers. cloned universal and pre-Let7R and pre-Let7F using CTGACGTTGTAGGCGCCATCTCCAAGATGGGGTATGAC-3 ACCCCATCTTG-3 CTCGAGGTGCTCTGTGGGATGATGTTGACGTTGTAGGCGCCTTAGGGTCAT- TCGGTTGGATATCTCCAAGATGGGGTATGAC-3 nldn h auelt7 eune nodrt eoeti auesqec and sequence mature this remove 5 to the precursor shRNAs, order of let-7f2 In cloning human facilitate sequence. let-7f of mature sequence the genomic including the contains construct intermediate rmmuegnmcDAuigT using GGCTGCC-3 DNA amplified and genomic expression neuronal mouse drive to chosen from was promoter alpha tubulin The T promoter. BLBP mouse the by by digested EGFPintron-let-7f CAGGAACTGGAGGAACTC-3 CACAGCAGAAAGGGAAAA-3 by 9 a 9 9 The -GCCACCGGTCGATCCACGCCACCATGGTGAGCAAGGGCGAGGAG-3 -TCATCAATTGTAACTCTCCTTCCCTTTCTCCCTTCTTAC-3 -shRNAmir nsmayordt otiuet u nesadn fthe of understanding our to contribute data our summary In (5 Spe I- and I Eco 9 Sal -GATTGTCGACTTACTTGTACAGCTCGTCCATGCCG-3 9 pCAG-EGFPintron-let-7f and I ;AL2lt-I(5 APLP2-let7-II ); I(5 IF(5 RI-F 9 Eco n Intron and ) 9 -GCACTACCAGAGCTAACTCAGATAGTACT-3 9 9 -TCATGTCGACCATCAAAGGACCAGCCACTT-3 Irsrcinstswr de oteito yPRuigIntron using PCR by intron the to added were sites restriction RI Asc rmr n lndit h CGEFito-e-fdigested pCAG-EGFPintron-let-7f the into cloned and primers ) 9 9 cfodadtootrpies e7-hI(5 Let7F-XhoI primers: outer two and scaffold ) n 3 and ) 9 -GAATTCCAATCTCGAGCTATTGGTCTTACTGACATCCAC- .For I. 9 9 ,teAL2sRA G520)(eune5 (sequence (GI562808) shRNA2 APLP2 the ), ;mhryLt-I(5 mCherry-Let7-II ); 9 n T and ) 9 .TePRpoutwscoe noteintermediate the into cloned was product PCR The ). Xho 9 r (5 arm nutero in 9 I- 9 -GAATTCGTACCACCGTGGGACGCCACT Eco r (5 arm a Sal bsdsRAepeso ytmwsconstructed was system expression shRNA -based 9 9 IR(5 RI-R 9 R(5 -R GCCCGAATTCTCTTCTCCGACTGG- -GGCGCGCCG n 3 and ) 9 9 rmr n lndit h pCAG- the into cloned and primers ) n LPR(5 BLBP-R and ) and I n 3 and 9 lcrprto,DApeaain,included preparations, DNA electroporation, n Let7F- and ) 9 -GGCGCGCCCTCGAGCCATCTTCAGCC- 9 9 rmr.Teito a hnisre into inserted then was intron The primers. ) rmr pA-GPito) h let-7f2 The intron). (pCAG-EGFP primers ) 9 9 9 9 a fEF n w ue rmr o 5 for primers outer two and EGFP of ) -ACCTACCGGTGGTTGCTGCTTCGC- -CTCGAGATTGGAATTCAGCCTATC- 9 Asc rso h e-fsafl eeamplified were scaffold let-7f the of arms -GAATTCGTACCACCGTGGGAGATA- F(5 -F 9 rs(5 arms 9 n oto hN (scrambled shRNA control and ) ,tu elcn h A promoter CAG the replacing thus I, 9 9 -ACCTACTAGTGTATTAGAA- -CGATTACAATGAGGAGAAT- Eco 9 9 9 -TCTCTCCACAGGCTACG- (5 R and ) (5 I(5 RI 9 -GGTGGGCGCGCCAGG- 9 9 ;mhrylt- (5 mCherry-let7-I ); -TGATACTTACCTTCG- Xho Xho 9 9 -CAATGTCGACAG- Iand -CAATGAATTCGT- 9 9 and I 9 )andPCRamplified rvnb h U6 the by driven ) -CTCGAGGTGC- 9 -GACGTAGCC- Eco 9 9 rs Next, arms. ) rmr and primers ) 9 n LET- and ) Eco Irestriction RI 9 9 I This RI. -ATGA- -CAAT- GGGT- 9 )and 9 9 - - 9 i Qae,Vno h ehlns,wt ia ocnrto ewe n 3 and 2 between concentration final with Nethelands), The Venlo, (Qiagen, Kit lsi DNA. plasmid uloeto Aaa olwdb vrih hkn 30rm t37 at rpm) (350 shaking overnight by followed (Amaxa) nucleofection arglasyfrmigration for assay Matrigel cells/cm 100,000 of density a at plated (Banker previously and described 1988) as Goslin, prepared were and neurons cortical embryonic Mouse cultures Cell cell in prepared 20 were PBS). HEK293 in or inhibitors protease cultures with neuron Triton-X100, (1% cortical buffer of lysate lysates cell Total blot Western h riswr olce,fxdadimn-tie sn niEF,anti-BrdU anti-EGFP, hours using 24 immuno-stained another and fixed After collected, Sigma-Aldrich). were mg/kg, brains (75 the BrdU after with intraperitoneally day One exit cycle Cell with prepared were brains embryonic fixed the of 100 sections vibratome Coronal Immunocytochemistry (1–2 K.U. plasmids the 88 of the of Committee and injections Ethics intramuscular exposed by the 132 anaesthetized and by were ketamine approved mice Pregnant were Leuven. experiments animal All utero C57/Bl6 In from loci were APLP1 embryos and Wild-type 2004). APP al., of et codon Herms initiation by background. 2000; and generated al., promoter and et previously the (Heber described of were deletion mice genomic knockout double APP/APLP1 mice Transgenic at minutes 20 for papain by digested and dissected 37 were cortices embryonic E14 ebae eeicbtdoengta 4 at overnight and incubated nitrocellulose to transferred were (Invitrogen), 4–12% membranes NuPAGE a on separated was Tfr1hu nPS .%Tio -0,3 S,5 oto okynormal donkey or 4 goat at 5% antibody BSA, 3% primary X-100, the Triton with 0.3% PBS, incubated in serum, hour 1 for RT brains 2–4 4 the After at and cortex. PFA PFA 4% 4% the and in of PBS hours part with 6–10 dorsal-medial perfused for and the postfixed head collected targeting the were V) embryos across (36 days, delivered embryos were pulses the interval) current of Five milliseconds embryos. pulse/950 mouse E14.5 milliseconds of (50 ventricles lateral the in microinjected Ivtoe) o rUdtcin lcswr r-rae ih1MHCl M 1 with pre-treated were slices temperature room detection, 4 at BrdU minutes hours (10 2 For for (Invitrogen). antibodies Alexa-Fluor-conjugated secondary eegoni MMF2wt 0 ea afsrm(C)adwr transfected were and (FCS) WI). APLP2 serum TransIT Madison, using calf tagged construct fetal expressing V5 10% shRNA with with overexpressing DMEM/F12 cells in nucleofection grown HEK293 using were plating Germany). before Cologne, transfected were (Amaxa, Neurons dishes. coated (PLL) tabnad,Gray n iert ftesga a etduigdifferent using tested was signal lysate. (Raytest, the cell 4.27 of of total Analyser of density linearity Image chemiluminescence dilution Aida The and using ECL Belgium). Germany) densitometry a Zaventem, Straubenhardt, by quantified Sciences, using was Life of antibodies bands (PerkinElmer detected University secondary kit and conjugated detection Belgium) Thinakaran, (1:5000-mouse, APP Diegem, HRP GAPDH G. Belgium), Sigma-Aldrich, antibody), with Gent, (1:1000-mouse, from rabbit Actin Invitrogen made gift HyTest), (1:10,000-mouse, custom kind (B63-1:5000, antibody antibody V5 a IL), (CT12 Chicago, APLP2 antibodies: nevl o pt 4husuiga netdOypsCell Olympus inverted minutes an 20 coverslips at using onwards, acquired hours plating were 24 images after to and day up chamber one for metal closed from intervals a imaging (PFA) in Biosciences, live paraformaldehyde mounted (BD 4% For were in Matrigel days. fixed 3–4 in and after embedded coverslips on were Belgium) aggregates Erembodegem, The aggregates. form at-rz edleg emn) otat-o2(:5;SnaCu) Nuclei Santa-Cruz). Cell (1:150; (1:500; DAPI. anti-Sox2 with anti-Cux1 (1:300; visualized goat rabbit were Belgium), Germany), anti-PH3 Vilvoorde, Heidelberg, anti- rabbit Roche, Santa-Cruz, rabbit (1:200; UK), rabbit anti-BrdU Netherlands), Belgium), mouse Cambridge, The Diegem, Leiden, Abcam, Novacastra, Signaling, (1:300; (1:1000; anti-Ki67 anti-Tbr2 rabbit Oregon), Labs, buffer. borate M 0.1 in washes subsequent h olwn rmr nioiswr sd hce niEF 150 Aves (1:500; anti-EGFP chicken used: were antibodies primary following The ˚ .Atrsbeun ehncldsoito,clswr rnfce by transfected were cells dissociation, mechanical subsequent After C. m hcns.Sbeunl,tescin eepreblzdadbokdat blocked and permeabilized were sections the Subsequently, thickness. m electroporation ˚ )ad2MHl(0mntsR n 0mnts37 minutes 20 and RT minutes (10 HCl M 2 and C) PP nnuoa ifrnito 1275 differentiation neuronal in APLP2 m nutero in yaieprga fbd egt h trn on were horns uterine The weight. body of gram per xylazine g lcrprto,penn iewr injected were mice pregnant electroporation, m g/ m )mxdwt atGen(im)were (Sigma) Green Fast with mixed l) ˚ C. H ˚ ihtefloigprimary following the with C L1taseto egn (Mirus, reagent transfection -LT1 b ˚ vrih olwdb the by followed overnight C I-uui 110,Abcam), (1:1000, III-tubulin R microscope. 2 npoly-L-lysine on m fprotein of g ˚ )with C) ˚ m Cto g/ m m g l Journal of Cell Science adrnd na . Ga F., Anda, de Calderon K. Goslin, and G. Wakutani, Banker, P., Horne, J., Watts, R., Weerasekera, F., Chen, K., Markham, Y., Bai, Tscha A., M. Filippov, D., Aydin, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.122440/-/DC1 online available material Supplementary the from MU1457/8-1 grants numbers [grant by MU1457/9-1]. (DFG) supported and Foundation was Research Research U.M. chair German Vanluffelen European disease. Anna and Alzheimer’s the Bax Arthur for by the is B.D.S. funding (ERC). Alzheimer Council and (K.U. for Methusalem Foundation (SAO/FRMA); the VIB, government); Research Scientific the Flemish for the Leuven; Fund and the K.U. Leuven from the grants Flanders; by possible Research, made was work This Funding contributed paper. U.M. the project; B.D.S., wrote S.A.M.S., research, the A.G. and data and performed the designed C.D. analyzed A.G. A.G. A.G. and S.A.M.S. and and reagents, P.L. C.D. B.D.S., S.A.M.S., B.A.H., S.A.M.S., contributions Author critical their Hendrickx, Marie V. for mice. G. and IL) antibody; and institute Chicago, CT12-APLP2 Verwaeren of the J. our (University with us Thinakaran L. from providing G. Bergmans, for project; B. Thathiah the Fazzari, on P. A. feedback Achsel, T. and Wahle, T. Serneels, thank to wish We non-parametric Acknowledgements a Prism5. using GraphPad using compared by performed was were neurons preparation Student’s graph ( of test using groups U Mann–Whitney two compared of were distribution bins for Corresponding negative or positive Statistics are that cells the positive by double was detected function BrdU/EGFP Ki67. same were find the Next, cells to software). BrdU+/EGFP+ (ImageJ used Calculator and Image of thresholded function were AND the images and the cells. EGFP- All bins EGFP-positive exit of of cycle equal bodies number cell cell total For ten the the into by counting divided by divided bin, calculated each was was in walls bin cells per positive cortical cells of of frequency length entire The positioning cortical For to (NIH). software Ten ImageJ imaging. the during using constant processed kept were consecutive parameters an fifteen using imaging A1) the Ti and (Eclipse; software microscope Nikon 10 a on Apo captured were images Confocal quantification and imaging of Confocal ratio the as calculated was rate exit cycle cell The EGFP antibodies. anti-Ki67 and 1276 ubro EGFP of number egas .A,Sait,S . aes .L,Vrtee,P,Shojn,L., Schoonjans, P., Verstreken, L., R. Habets, A., S. Shariati, A., B. Bergmans, . asa,R,Mtes .M,Fae,P .e al. et E. protein. P. precursor Fraser, amyloid M., the P. of interactome Mathews, R., Bagshaw, Y., cortex. adult the in members family protein Mu and ernplrt xsi eie ttebplrstage. bipolar the at defined is axis in polarity protein neuron precursor amyloid the of role autonomous in cell and differentiation. a vitro neuronal for in evidence normally of behave lack cells vivo: stem embryonic knockout triple APLP1/APLP2 Mu 185-186. le,U,Dti .G n eSroe,B. Strooper, De and G. C. Dotti, U., ¨ller, + /BrdU 6 le,U C. U. ¨ller, .0NA betv es h mgswr curdb Nis-Element by acquired were images The lens. objective N.A. 1.40 ora fCl cec 2 (5) 126 Science Cell of Journal + /Ki67 + /BrdU 2 z 21) oprtv rncitm rfln fayodprecursor amyloid of profiling transcriptome Comparative (2011). scin eeotie e ri lc.Aliae were images All slice. brain per obtained were -sections el clswihaenti h elcce iie ythe by divided cycle) cell the in not are which (cells cells P + rnr . si .H n ot,C G. C. Dotti, and H. L. Tsai, A., ¨rtner, , tmCells Stem el ttlnme fdvdn n o-iiigcells). non-dividing and dividing of number (total cells 18) eeomnsi ernlcl culture. cell neuronal in Developments (1988). .5a infcnelvl.Alsaitclaayi and analysis statistical All level). significance as 0.05 nfrtergettcnclassac with assistance technical great their for ¨n p,J . rt,N,Piz . is . rr,B. Brors, R., Eils, M., Prinz, N., Gretz, A., J. ¨pe, 28 399-406. , M Genomics BMC o.Cl.Proteomics Cell. Mol. 21) ern eeae rmAPP/ from generated Neurons (2010). .Cl Sci. Cell J. 20) h nvv brain vivo in The (2008). t ts.Tepopulation The -test. 12 160. , 121 20) Pyramidal (2008). 178-185. , 7 15-34. , Nature 336 , oyeu,B . rot,P,Mnzs .R n aki,J D. J. Macklis, and R. J. Menezes, P., Arlotta, J., B. E. Molyneaux, C. Kaznowski, and K. S. McConnell, a .H,Ftgw,T,Yn,W-. in,X-. eg . aea . Xu, Y., Takeda, L., Zeng, X.-D., Jiang, W.-L., Yang, T., Futagawa, Q.-H., Ma, Van and F. Leuven, Van B., Strooper, De D., Moechars, L., Overbergh, K., Lorent, Lakoma T. Curran, and M. Sheldon, H., S., D. Kretzschmar, Rice, M., R., Homayouni, Fuhrmann, S., Ring, S., Heber, B., Anliker, J., Herms, He Lo He D., Ayaz, M., Leyssen, Ru A., Aguzzi, J., Hainfellner, V., Gajic, J., Herms, S., Heber, enad . He C., Reinhard, abna,W,Atro . ek .adHtnr .B. W. Huttner, and W. Denk, A., Attardo, W., Haubensak, ehik .N,Zns . arwk,K,Pumrd,J n hsooa V. Chesnokova, and J. Pourmorady, K., Wawrowsky, S., Zonis, N., R. Pechnick, Mu oo . ooo . jr,K,Ksk,H,Fjt,M,Skri . kw,K., Okawa, M., Sakurai, M., Fujita, H., Kosako, K., Ajiro, Y., Tomono, H., Goto, B., Reynolds, C., Pozniak, C., Causing, S., Weiss, A., Speelman, W., Wu, A., Gloster, N. Heintz, and E. M. Hatten, L., Feng, ahmt-oi,K,Tri . aksa,M . ate,C . hn . Radtke, J., Shen, M., C. Bartley, R., M. Sarkisian, M., Torii, K., Hashimoto-Torii, ioav . cagln . ’er,D .adTsirLvge M. Tessier-Lavigne, and D. D. O’Leary, T., McLaughlin, A., Nikolaev, Mu izRu,G,Bni . utn . efr,L,Aad . oao . ae,A., Magen, D., Rozado, S., Anand, L., Geffers, M., Sultan, S., Banfi, G., Diez-Roux, et,C,Vtie,K . a,S,Sehr,Y . Dupre M., Y. Shepherd, S., Das, S., K. Vetrivel, C., Deyts, Su and X. Cao, osya,T,Mgu,T,Ci . uhl . eoe . u,H,Fshr .and I. Fischer, H., Xue, A., Lepore, M., Mughal, J., Cai, T., Magnus, T., Coksaygan, A. C. P. Walsh, Leprince, and A. and Chenn, G. Moonen, B., Rogister, G., Chanas-Sacre, ´pez-Sa br,S . enes . oi,A,Casars . ek,C,Flpo,M A., M. Filippov, C., Derks, K., Craessaerts, A., Tolia, L., Serneels, S., S. ´bert, le,U . itzk .U n elr T. Deller, and U. C. Pietrzik, C., U. ¨ller, le,U .adZeg H. Zheng, and C. U. ¨ller, utp pcfcto ntecrba cortex. cerebral the in specification subtype eemnto ndvlpn neocortex. developing in determination al. et J. neurogenesis. A. modulates negatively Furley, 10 Fe65 M., through pathway Schachner, signalling D., Bagnard, R.-X., molecular 40,000 protein. the receptor-associated and weight alpha-2-macroglobulin recept lipase, lipoprotein alpha-2-macroglobulin E, lipoprotein the apolipoprotein of family, density protein precursor receptor/low amyloid the of members three H. Berghe, den 1. protein precursor-like amyloid 7515. of domain cytoplasmic the members. family APP three all lacking 4115. mice genes. in Mu lissencephaly target and putative S. of Sisodia, expression of regulation and Rep. EMBO protein precursor amyloid Mu otclpeusr rmmc akn eaayodpeusrprotein. precursor beta-amyloid lacking 130 mice from precursors cortical neurogenesis. neocortical of functions redundant partially and members. al. essential family et protein P. reveal precursor Tremml, amyloid knock-outs S., Sisodia, gene C., combined Koch, von H., Kretzschmar, rti:itgaigsrcuewt ilgclfunction. biological with structure integrating protein: 284. 20) mli rcro rti rmtsps-eeomna ert arborization brain. neurite Drosophila post-developmental the promotes in protein precursor Amyloid (2005). of site major a telencephalon: mammalian early the of neurogenesis. neuroepithelium basal the 20) 2Cp etit ernlpoieaini h ugaua oeo h dentate the of hippocampus. zone subgranular the the of in gyrus proliferation neuronal restricts p21Cip1 (2008). 981-989. hshrlto ieo itn 3culdwt ioi hoooecondensation. chromosome mitotic with coupled al. H3 et histone T. on Takahashi, site T., phosphorylation Okigaki, A., Iwamatsu, regeneration and D. growth neuronal F. of mice. function Miller, transgenic a in and as expression G. gene specifies J. promoter Toma, E., Chang, oc inln euae ernlmgaini h eerlcortex. cerebral the P. in Rakic, migration neuronal and regulates N. signaling Sestan, Notch T., Gridley, F., id R otigrao rnn n erndahvadsic caspases. distinct via death neuron and pruning axon trigger to DR6 binds b Med Perspect Harb Spring Cold oe inln ytmi h eeoigmmainCNS. mammalian developing the in system signaling novel embryo. mouse the in al. transcriptome et I. the Peluso, of M., Pagani, E., Canidio, .Bo.Chem. Biol. J. ehrdayodpeusrpoenitaellrdomain. intracellular protein precursor amyloid tethered T. A. Parent, and eeomn n fe injury. after and S. development M. Rao, Tip60. acetyltransferase histone and Fe65 with 115-120. APP of complex active elcceei nnua precursors. neural in exit cycle cell transdifferentiation. and regulation, origin, phenotype: ayodpeusrpoenAPP. protein precursor -amyloid 283-294. , le,U n eSroe,B. Strooper, De and U. ¨ller, 51-60. , ,J,Gri-lno .adLqe .M. J. Luque, and L. Garcia-Alonso, J., ´, nhz . Mu N., ´nchez, do,T C. T. ¨dhof, 7 739-745. , rc al cd c.USA Sci. Acad. Natl. Proc. 20) ergnssi apa1tblntasei ieduring mice transgenic tubulin Talpha-1 in Neurogenesis (2006). br,S .adD topr B. Strooper, De and S. S. ´bert, 274 19) xrsini os mro n nautmuebanof brain mouse adult in and embryos mouse in Expression (1995). 25543-25549. , 21) oe G Novel (2012). .Neurosci. J. le,U. ¨ller, le,U n rd,J M. J. Frade, and U. ¨ller, br,S . ev,S,D topr .adHsa,B A. B. Hassan, and B. Strooper, De S., Reeve, S., S. ´bert, MOJ. EMBO Development 20) rncitoal creto ftranscriptively] of [correction transcriptionally A (2001). rc al cd c.USA Sci. Acad. Natl. Proc. 20) euaino eerlcria ieb oto of control by size cortical cerebral of Regulation (2002). 21) hsooia ucin fAPfml proteins. family APP of functions Physiological (2012). 20) otcldslsarsmln ua ye2 type human resembling dysplasia Cortical (2004). x.Neurol. Exp. 14 2 a006288. , x.BanRes. Brain Exp. 24 7319-7330. , 20) euae nrmmrn rtoyi of proteolysis intramembrane Regulated (2006). Neuroscience a Science 2944-2955. , -rti inln soitdwt membrane- with associated signaling S-protein 19) ri ii-idn rti BB) a (BLBP): protein lipid-binding Brain (1994). 138 Science 19) elccedpnec flaminar of dependence cycle Cell (1991). 101 21) ihrslto ntmclatlas anatomical high-resolution A (2011). 21) h hsooia ucin fthe of functions physiological The (2012). rrltdpoenado t ligands its of and protein or-related 5223-5234. , LSBiol. PLoS 197 .Neurosci. J. 297 20) neato ewe elnand Reelin between Interaction (2008). a.Rv Neurosci. Rev. Nat. 3196-3201. , 19) h lh alpha-tubulin 1 alpha T The (1994). 20) eghnn fG/ioi in G2/mitosis of Lengthening (2005). 475-485. , 365-369. , 254 20) h mli-eaprecursor amyloid-beta The (2005). 65 217 19) dniiaino novel a of Identification (1999). 282-285. , 21) elnst h aeof pace the sets Reelin (2011). 1009-1025. , .Nuoc.Res. Neurosci. J. MOJ. EMBO 325-329. , 9 105 e1000582. , .Neurosci. J. 19) iald1bnsto binds Disabled-1 (1999). 20 ,D . hnkrn G. Thinakaran, J., D. ´, 1358-1363. , 7951-7963. , 20) ern rs in arise Neurons (2004). Neuron 20) TAG1-APP A (2008). .Neurosci. J. MOJ. EMBO 24 8 20) ailglia Radial (2000). 20) iewith Mice (2000). 427-437. , 20) Neuronal (2007). 3996-4006. , Neuron lce . von T., ¨licke, 12 32 a.Cl Biol. Cell Nat. Neuroscience 895-908. , Science 1714-1729. , 61 20) APP (2009). Nature 357-363. , 23 19 60 4106- , 7507- , 273- , 457 293 , , Journal of Cell Science iai . ioa,S,Dugrk,K,Tblwc,V,Ksai,N,Pcns V. Pachnis, N., Kessaris, V., Tybulewicz, K., Doulgeraki, S., Tivodar, M., Vidaki, A. A. Davis, and S. Temple, aae,R,Zo,D n ’dmo L. D’Adamio, and D. Zhou, R., Tamayev, aaa .adNkjm,K. Nakajima, and H. Tabata, K. Nakajima, and H. Tabata, uui . no . shr,T,Osi . i,G . ao,Y,Wso W., Wasco, Y., Satoh, S., G. Lim, M., Oishi, T., Isohara, Lo K., S., Ando, Kreger, T., K., Suzuki, Siehl, H., Zentgraf, K., Wagner, S., Eggert, P., Soba, ocrt,R,S R., Roncarati, AAri nenuo irto otecortex. the to migration interneuron GABAergic D. Karagogeos, and ndvso nvtob ebaeascae factors. membrane-associated by vitro in division in intracellular their of phosphorylation by shaped is domains. members family protein precursor ytmclsb nueoelectroporation. utero in by cells system eeoigmuebanuigeetooain iulzto fnuoa irto in migration neuronal of cortex. al. visualization developing electroporation: et the using brain P. mouse Greengard, developing C., A. proteins. precursor-like Nairn, beta-amyloid E., Alzheimer R. Tanzi, P aiymmespooe neclua adhesion. al. intercellular et promotes R. members Paro, family APP G., Merdes, A., Langer, signaling. of domain intracellular . cld,J . ai,P n ’dmo L. D’Adamio, and P. Rakic, C., J. McGlade, O., o.Neurodegener. Mol. rc al cd c.USA Sci. Acad. Natl. Proc. ˇ sa,N,Shifl,M . eehd .E,Lpz .A,Meucci, A., P. Lopez, E., B. Berechid, H., M. Scheinfeld, N., estan, 21) a1dpnetcl yl xto G rcrosand precursors MGE of exit cycle cell Rac1-dependent (2012). Neuroscience b ayodpeusrpoenbnsNm n niisNotch inhibits and Numb binds protein precursor -amyloid 19) sltdrtcria rgntrclsaemaintained are cells progenitor cortical rat Isolated (1994). 20) fiin nueogn rnfrsse othe to system transfer gene utero in Efficient (2001). 4 20) aeigebyncmuecnrlnervous central mouse embryonic Labeling (2008). 28. , 103 99 7102-7107. , 865-872. , 20) h neatm fteayodbeta amyloid the of interactome The (2009). e.Got Differ. Growth Dev. 20) oo n eeoieiainof heterodimerization and Homo- (2005). Biochemistry ee.Cortex Cereb. 20) The (2002). Development MOJ. EMBO 19) hshrlto of Phosphorylation (1997). 50 36 c 22 -secretase-generated 507-511. , 4643-4649. , 24 680-692. , 120 3624-3634. , 999-1008. , wr A., ¨wer, on-ere .L,Bi . hn,R,Zeg .B,LTro .J n Selkoe, and J. J. LoTurco, B., J. Zheng, R., Chang, J., Bai, L., N. T. Gaiano, Young-Pearse, and G. Fishell, F., Radtke, L., M. Rutlin, S., Nery, K., Yoon, L. Aelst, Van and L. C. Wang, T., Y. Yang, ee,S . lvnk,M,Dlkt,A,Via,V,Adn . ik M., Hick, D., Aydin, V., Voikar, A., Delekate, M., Klevanski, W., S. Weyer, H. Zheng, and Z. Songyang, N., Aithmitti, Q., Guo, L., Yang, B., Wang, Z., Wang, ie,A,Talr .adEcee G. Eichele, and C. Thaller, A., Visel, on-ere .L,Ce,A . hn,R,Mruz .adSlo,D J. D. Selkoe, and C. Marquez, R., Chang, C., A. Chen, L., T. Young-Pearse, .J. D. 9506. neurogenesis. cortical and 1201-1210. migration nuclear interkinetic regulate ihNth inln ntlnehlcprogenitors. telencephalic in interacts signaling and identity glial Notch1 radial promotes with signaling receptor factor growth Fibroblast LTP. and learning spatial transmission, for al. synapses et J. CNS M. and Saar, PNS L., at K. essential Schaller, N., Drost, M., Filippov, protein precursor amyloid the and of 10801. interaction peripheral postsynaptic promotes and Presynaptic (2009). atrsi h os embryo. mouse the in patterns ertdAPrgltstefnto ffl-eghAPi ert ugot through outgrowth neurite in APP beta1. full-length integrin of with function interaction the regulates APP Secreted interference. RNA utero in by revealed migration 30 2266-2280. , 20) rtclfnto o eaayodpeusrpoeni neuronal in protein precursor beta-amyloid for function critical A (2007). PP nnuoa ifrnito 1277 differentiation neuronal in APLP2 eta synaptogenesis. central uli cd Res. Acids Nucleic erlDev. Neural 20) eean.r:a ta fgn expression gene of atlas an GenePaint.org: (2004). 21) OK neat ihTC3to TACC3 with interacts DOCK7 (2012). 3 15. , 2Dtbs issue Database 32 .Neurosci. J. 21) P n PP are APLP2 and APP (2011). .Neurosci. J. .Neurosci. J. 27 14459-14469. , a.Neurosci. Nat. D552-D556. , 29 24 10788- , ,9497- (2004). (2008). EMBO 15 ,