Journal of Pain Research Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH Activation of endogenous opioid gene expression in human keratinocytes and fibroblasts by pulsed radiofrequency energy fields John Moffett1 Background: Pulsed radiofrequency energy (PRFE) fields are being used increasingly for Linley M Fray1 the treatment of pain arising from dermal trauma. However, despite their increased use, little Nicole J Kubat2 is known about the biological and molecular mechanism(s) responsible for PRFE-mediated analgesia. In general, current therapeutics used for analgesia target either endogenous factors 1Life Science Department, 2Independent Consultant, involved in inflammation, or act on endogenous opioid pathways. Regenesis Biomedical Inc, Methods and Results: Using cultured human dermal fibroblasts (HDF) and human epider- Scottsdale, AZ, USA mal keratinocytes (HEK), we investigated the effect of PRFE treatment on factors, which are involved in modulating peripheral analgesia in vivo. We found that PRFE treatment did not inhibit cyclooxygenase enzyme activity, but instead had a positive effect on levels of endog- enous opioid precursor mRNA (proenkephalin, pro-opiomelanocortin, prodynorphin) and corresponding opioid peptide. In HEK cells, increases in opioid mRNA were dependent, at least in part, on endothelin-1. In HDF cells, additional pathways also appear to be involved. PRFE treatment was also followed by changes in endogenous expression of several cytokines, including increased levels of interleukin-10 mRNA and decreased levels of interleukin-1β mRNA in both cell types. Conclusion: These findings provide a new insight into the molecular mechanism underlying PRFE-mediated analgesia reported in the clinical setting. Keywords: peripheral analgesia, endogenous opioids, endothelin-1, endothelin receptor A, endothelin receptor B, pulsed radiofrequency energy field, cyclooxygenase Introduction Understanding the cellular and molecular basis of nociception is a challenge that has important implications for pain management and the development of new analgesics. Nociception plays a vital role in the survival of the organism, serving to transmit warning signals of impending harm.1–3 However, beyond this function, the experience of prolonged nociceptive and inflammatory pain, such as following surgery or other trauma, requires effective management, both to provide comfort for the patient and to reduce the possible risk of development of chronic pain.4,5 As somatosensory neurons of the peripheral nervous system, nociceptors innervate the periphery and function to detect noxious mechanical, temperature, and chemical stimuli. Via communication with the central nervous system, nociceptor activity func- Correspondence: John Moffett tions to evoke pain sensation at the site of injury, and nociceptor sensitivity (ie, firing 5301 N Pima Road Scottsdale, AZ 85250-3773, USA threshold) to stimuli at the site can be modulated by soluble factors released by local non- Tel +1 480 970 4970 neuronal cells, eg, keratinocytes, fibroblasts, and infiltrating immune cells.1–3 Certain Fax +1 866 857 8792 Email [email protected] factors, such as nerve growth factor alpha, prostaglandins, eg, prostaglandin E2, and submit your manuscript | www.dovepress.com Journal of Pain Research 2012:5 347–357 347 Dovepress © 2012 Moffett et al, publisher and licensee Dove Medical Press Ltd. This is an Open Access article http://dx.doi.org/10.2147/JPR.S35076 which permits unrestricted noncommercial use, provided the original work is properly cited. Moffett et al Dovepress proinflammatory cytokines, eg, tumor necrosis factor-alpha as well as their secretion, possibly via an endothelin pathway- (TNF-α) and interleukin (IL)-1β, can promote nocicep- based mechanism. tor hypersensitivity,1,3,6 whereas other factors, such as anti-inflammatory cytokines, eg, IL-10 and IL-4, and endog- Materials and methods enous opioids, can have the opposite effect on nociceptor Materials firing, thereby acting as analgesics.3,6 Culture medium (Minimal Essential Medium) was purchased New analgesic pharmaceuticals are actively being pursued. from Cell Applications Inc (San Diego, CA) and from Many of these drugs fall into the class of nonsteroidal anti- Mediatech Inc (Herndon, VA) for general culture of human inflammatory drugs, which primarily target cyclooxygenases dermal fibroblasts (HDF). Fetal calf serum, penicillin- (ie, COX-1 and COX-2),7 which are enzymes involved in streptomycin, trypsin, 1 × ­phosphate-buffered solution, prostaglandin synthesis. Opioids are still the most widely sodium pyruvate, and nonessential amino acids were pur- used drugs for treatment of severe and pathological pain. chased from Hyclone (Logan, UT). Reagents for reverse However, important side effects associated with these phar- transcription polymerase chain reaction (RT-PCR) were macological options continue to be a major drawback.8,9 This from Life Technologies (Carlsbad, CA). Oligonucleotide has spurred an interest in multimodal therapy as a way of primers for PCR were purchased/ synthesized by Real Time facilitating decreased intake of any one type of analgesic.10 To Primers (Elkins Park, PA). General chemicals were purchased optimize such an approach, novel adjunctive therapy options from Sigma-Aldrich (St Louis, MO) or VWR International with limited side effects are needed. Recently, biophysical (Radnor, PA). Endothelin A and B receptor antagonists were treatment modalities have been shown to be useful as an purchased from American Peptide (Sunnyvale, CA). adjunctive analgesic therapy option. One such modality, pulsed radiofrequency energy (PRFE), is an adjunctive Cell culture therapy which involves local noninvasive delivery of PRFE HDF cells were purchased from Cell Applications Inc (San (27.12 mHz carrier frequency) to superficial soft tissue, Diego, CA). Routine culture was performed as recommended a treatment which has been reported to provide analgesic ben- by the manufacturer in a 5% CO2 humidified incubator efit in patients following surgery or other soft tissue trauma, at 37°C.18 For the experiments, cells were cultured on 10 cm with few reports of side effects.11 Three recent, randomized, plates at a density of 1.14 × 104 cells/cm2 in Minimum double-blind clinical trials that used PRFE field treatment Essential Medium supplemented with 1 mM sodium pyru- for pain in post-surgical patients found significantly reduced vate, 1 mM nonessential amino acids, 100 units penicillin, levels of reported pain as well as analgesic consumption in 100 µg streptomycin, and 5% fetal calf serum. Cells were used patients treated with PRFE relative to control patients treated for experimentation after 16 hours in a humidified incubator 12–14 with a sham device. A meta-analysis of studies assessing at 37°C with 5% CO2. Cells were used for experimentation the clinical efficacy of PRFE also found that a significant from passage 5 to 10. Human epidermal keratinocytes (HEK) proportion of studies that assessed PRFE use for pain reported cells were purchased from Cell Applications Inc. Routine a beneficial outcome (11 positive studies).15 culture was performed as recommended by the manufacturer While clinical results are promising, little is known in a 5% CO2 humidified incubator at 37°C. For experiments, regarding the underlying mechanism of action of PRFE- keratinocytes were cultured on 10 cm plates at a density of mediated analgesia. In previous studies using cultured human 0.75 × 104 cells/cm2 in keratinocyte growth medium supplied keratinocytes and fibroblasts, PRFE treatment was found to by the manufacturer. HEK were used for experimentation mediate rapid and widespread upregulation of endogenous after 16 hours in a humidified incubator at 37°C with 5% CO2. transcripts of multiple factors that, in vivo, are involved in HEK were used for experimentation from passage 5 to 7. cutaneous wound healing.16,17 In the current study, we used the same system to examine PRFE conditions and treatment whether PRFE treatment has an effect on the expression of Treatment was performed by exposing cells to the PRFE factors known to modulate nociception, including endog- field of a Provant® device from Regenesis Biomedical Inc enous targets of other analgesic therapeutics. The results (Scottsdale, AZ). This device emits a 27.12 mHz radiofre- suggest that, unlike nonsteroidal anti-inflammatory drugs, quency signal transmitted from a flat spiral antenna with a PRFE does not inhibit cyclooxygenase enzymes, but instead radius of 7.5 cm made up of six turns at a width of 0.70 cm has a positive effect on the expression of endogenous opioids spaced with a separation of 0.3 cm. The signal is delivered in 348 submit your manuscript | www.dovepress.com Journal of Pain Research 2012:5 Dovepress Dovepress PRFE activation of endogenous opioid expression 42 µsec pulses with a period of 1 kHz. This corresponds to Table 1 Primer Sequences used for qRT-PCR. energy parameters of 591 V/M and 6.7 A/M in electrical and Oligo Name Primer sequence (5´ to 3´) magnetic fields, respectively, when measured 5 cm from the GADPH GAGTCAACGGTTTGGTCGT surface of the radiating antenna. Cells were placed at a distance TTGATTTTGGAGGGATCTCG PENK AGCTGTCCCAACCCAGAGCTT of 5 cm from the source during treatment. Treatment was per- CCTCCTCTGCATCCTTCTTC formed at room temperature for 30 minutes after which the POMC CCCCTACAGGATGGAGCACT cells were returned to the incubator. Cells were harvested for CGTTCTTGATGATGGCGTTT