DOCSLIB.ORG

View the Journal Article About Endogenous Opioids

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
View the Journal Article About Endogenous Opioids Journal of Pain Research Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH Activation of endogenous opioid gene expression in human keratinocytes and fibroblasts by pulsed radiofrequency energy fields John Moffett1 Background: Pulsed radiofrequency energy (PRFE) fields are being used increasingly for Linley M Fray1 the treatment of pain arising from dermal trauma. However, despite their increased use, little Nicole J Kubat2 is known about the biological and molecular mechanism(s) responsible for PRFE-mediated analgesia. In general, current therapeutics used for analgesia target either endogenous factors 1Life Science Department, 2Independent Consultant, involved in inflammation, or act on endogenous opioid pathways. Regenesis Biomedical Inc, Methods and Results: Using cultured human dermal fibroblasts (HDF) and human epider- Scottsdale, AZ, USA mal keratinocytes (HEK), we investigated the effect of PRFE treatment on factors, which are involved in modulating peripheral analgesia in vivo. We found that PRFE treatment did not inhibit cyclooxygenase enzyme activity, but instead had a positive effect on levels of endog- enous opioid precursor mRNA (proenkephalin, pro-opiomelanocortin, prodynorphin) and corresponding opioid peptide. In HEK cells, increases in opioid mRNA were dependent, at least in part, on endothelin-1. In HDF cells, additional pathways also appear to be involved. PRFE treatment was also followed by changes in endogenous expression of several cytokines, including increased levels of interleukin-10 mRNA and decreased levels of interleukin-1β mRNA in both cell types. Conclusion: These findings provide a new insight into the molecular mechanism underlying PRFE-mediated analgesia reported in the clinical setting. Keywords: peripheral analgesia, endogenous opioids, endothelin-1, endothelin receptor A, endothelin receptor B, pulsed radiofrequency energy field, cyclooxygenase Introduction Understanding the cellular and molecular basis of nociception is a challenge that has important implications for pain management and the development of new analgesics. Nociception plays a vital role in the survival of the organism, serving to transmit warning signals of impending harm.1–3 However, beyond this function, the experience of prolonged nociceptive and inflammatory pain, such as following surgery or other trauma, requires effective management, both to provide comfort for the patient and to reduce the possible risk of development of chronic pain.4,5 As somatosensory neurons of the peripheral nervous system, nociceptors innervate the periphery and function to detect noxious mechanical, temperature, and chemical stimuli. Via communication with the central nervous system, nociceptor activity func- Correspondence: John Moffett tions to evoke pain sensation at the site of injury, and nociceptor sensitivity (ie, firing 5301 N Pima Road Scottsdale, AZ 85250-3773, USA threshold) to stimuli at the site can be modulated by soluble factors released by local non- Tel +1 480 970 4970 neuronal cells, eg, keratinocytes, fibroblasts, and infiltrating immune cells.1–3 Certain Fax +1 866 857 8792 Email [email protected] factors, such as nerve growth factor alpha, prostaglandins, eg, prostaglandin E2, and submit your manuscript | www.dovepress.com Journal of Pain Research 2012:5 347–357 347 Dovepress © 2012 Moffett et al, publisher and licensee Dove Medical Press Ltd. This is an Open Access article http://dx.doi.org/10.2147/JPR.S35076 which permits unrestricted noncommercial use, provided the original work is properly cited. Moffett et al Dovepress proinflammatory cytokines, eg, tumor necrosis factor-alpha as well as their secretion, possibly via an endothelin pathway- (TNF-α) and interleukin (IL)-1β, can promote nocicep- based mechanism. tor hypersensitivity,1,3,6 whereas other factors, such as anti-inflammatory cytokines, eg, IL-10 and IL-4, and endog- Materials and methods enous opioids, can have the opposite effect on nociceptor Materials firing, thereby acting as analgesics.3,6 Culture medium (Minimal Essential Medium) was purchased New analgesic pharmaceuticals are actively being pursued. from Cell Applications Inc (San Diego, CA) and from Many of these drugs fall into the class of nonsteroidal anti- Mediatech Inc (Herndon, VA) for general culture of human inflammatory drugs, which primarily target cyclooxygenases dermal fibroblasts (HDF). Fetal calf serum, penicillin- (ie, COX-1 and COX-2),7 which are enzymes involved in streptomycin, trypsin, 1 × ­phosphate-buffered solution, prostaglandin synthesis. Opioids are still the most widely sodium pyruvate, and nonessential amino acids were pur- used drugs for treatment of severe and pathological pain. chased from Hyclone (Logan, UT). Reagents for reverse However, important side effects associated with these phar- transcription polymerase chain reaction (RT-PCR) were macological options continue to be a major drawback.8,9 This from Life Technologies (Carlsbad, CA). Oligonucleotide has spurred an interest in multimodal therapy as a way of primers for PCR were purchased/ synthesized by Real Time facilitating decreased intake of any one type of analgesic.10 To Primers (Elkins Park, PA). General chemicals were purchased optimize such an approach, novel adjunctive therapy options from Sigma-Aldrich (St Louis, MO) or VWR International with limited side effects are needed. Recently, biophysical (Radnor, PA). Endothelin A and B receptor antagonists were treatment modalities have been shown to be useful as an purchased from American Peptide (Sunnyvale, CA). adjunctive analgesic therapy option. One such modality, pulsed radiofrequency energy (PRFE), is an adjunctive Cell culture therapy which involves local noninvasive delivery of PRFE HDF cells were purchased from Cell Applications Inc (San (27.12 mHz carrier frequency) to superficial soft tissue, Diego, CA). Routine culture was performed as recommended a treatment which has been reported to provide analgesic ben- by the manufacturer in a 5% CO2 humidified incubator efit in patients following surgery or other soft tissue trauma, at 37°C.18 For the experiments, cells were cultured on 10 cm with few reports of side effects.11 Three recent, randomized, plates at a density of 1.14 × 104 cells/cm2 in Minimum double-blind clinical trials that used PRFE field treatment Essential Medium supplemented with 1 mM sodium pyru- for pain in post-surgical patients found significantly reduced vate, 1 mM nonessential amino acids, 100 units penicillin, levels of reported pain as well as analgesic consumption in 100 µg streptomycin, and 5% fetal calf serum. Cells were used patients treated with PRFE relative to control patients treated for experimentation after 16 hours in a humidified incubator 12–14 with a sham device. A meta-analysis of studies assessing at 37°C with 5% CO2. Cells were used for experimentation the clinical efficacy of PRFE also found that a significant from passage 5 to 10. Human epidermal keratinocytes (HEK) proportion of studies that assessed PRFE use for pain reported cells were purchased from Cell Applications Inc. Routine a beneficial outcome (11 positive studies).15 culture was performed as recommended by the manufacturer While clinical results are promising, little is known in a 5% CO2 humidified incubator at 37°C. For experiments, regarding the underlying mechanism of action of PRFE- keratinocytes were cultured on 10 cm plates at a density of mediated analgesia. In previous studies using cultured human 0.75 × 104 cells/cm2 in keratinocyte growth medium supplied keratinocytes and fibroblasts, PRFE treatment was found to by the manufacturer. HEK were used for experimentation mediate rapid and widespread upregulation of endogenous after 16 hours in a humidified incubator at 37°C with 5% CO2. transcripts of multiple factors that, in vivo, are involved in HEK were used for experimentation from passage 5 to 7. cutaneous wound healing.16,17 In the current study, we used the same system to examine PRFE conditions and treatment whether PRFE treatment has an effect on the expression of Treatment was performed by exposing cells to the PRFE factors known to modulate nociception, including endog- field of a Provant® device from Regenesis Biomedical Inc enous targets of other analgesic therapeutics. The results (Scottsdale, AZ). This device emits a 27.12 mHz radiofre- suggest that, unlike nonsteroidal anti-inflammatory drugs, quency signal transmitted from a flat spiral antenna with a PRFE does not inhibit cyclooxygenase enzymes, but instead radius of 7.5 cm made up of six turns at a width of 0.70 cm has a positive effect on the expression of endogenous opioids spaced with a separation of 0.3 cm. The signal is delivered in 348 submit your manuscript | www.dovepress.com Journal of Pain Research 2012:5 Dovepress Dovepress PRFE activation of endogenous opioid expression 42 µsec pulses with a period of 1 kHz. This corresponds to Table 1 Primer Sequences used for qRT-PCR. energy parameters of 591 V/M and 6.7 A/M in electrical and Oligo Name Primer sequence (5´ to 3´) magnetic fields, respectively, when measured 5 cm from the GADPH GAGTCAACGGTTTGGTCGT surface of the radiating antenna. Cells were placed at a distance TTGATTTTGGAGGGATCTCG PENK AGCTGTCCCAACCCAGAGCTT of 5 cm from the source during treatment. Treatment was per- CCTCCTCTGCATCCTTCTTC formed at room temperature for 30 minutes after which the POMC CCCCTACAGGATGGAGCACT cells were returned to the incubator. Cells were harvested for CGTTCTTGATGATGGCGTTT
Load more

Recommended publications
  • 1 and ET-3 Inhibit Estrogen and Camp Production by Rat Granulosa Cells in Vitro
    209 Endothelin (ET)-1 and ET-3 inhibit estrogen and cAMP production by rat granulosa cells in vitro A E Calogero, N Burrello and A M Ossino Division of Andrology, Department of Internal Medicine, University of Catania, 95123 Catania, Italy (Requests for offprints should be addressed to A E Calogero at Istituto di Medicina Interna e Specialita` Internistiche, Ospedale Garibaldi, Piazza S.M. di Gesu`, 95123 Catania, Italy) Abstract Endothelin (ET)-1 and ET-3, two peptides with a potent and a maximally stimulatory (3 mIU/ml) concentration of vasoconstrictive property, produce a variety of biological FSH. ET-1 and ET-3 dose-dependently suppressed basal effects in different tissues by acting through two different and FSH (1 mIU/ml)-stimulated cAMP production. ET-3 receptors, the ET-1 selective ETA receptor and the non- and SFX-S6c were significantly more potent than ET-1 in selective ETB receptor. An increasing body of literature suppressing estrogen production, suggesting that this effect suggests that ET-1 acts as a paracrine/autocrine regulator was not mediated by the ETA receptor. Indeed, BQ-123, of ovarian function. Indeed, ETB receptors have been a selective ETA receptor antagonist, did not influence identified in rat granulosa cells and ET-1 is a potent the inhibitory effects of ET-1 and ET-3 on basal and inhibitor of progesterone production. In contrast, incon- FSH-stimulated estrogen release. To determine a possible sistent data have been reported about the role of ET-1 on involvement of prostanoids, we evaluated the effects of estrogen production and the effects of ET-3 are not maximally effective concentrations of ET-1 and ET-3 on known.
    [Show full text]
  • Cooperation of Endothelin-1 Signaling with Melanosomes Plays a Role In
    © 2015. Published by The Company of Biologists Ltd | Biology Open (2015) 4, 1213-1221 doi:10.1242/bio.011973 RESEARCH ARTICLE Cooperation of endothelin-1 signaling with melanosomes plays a role in developing and/or maintaining human skin hyperpigmentation Daiki Murase1,2,*, Akira Hachiya1,*,‡, Mamiko Kikuchi-Onoe1, Rachel Fullenkamp2, Atsushi Ohuchi1, Takashi Kitahara1, Shigeru Moriwaki1, Tadashi Hase1 and Yoshinori Takema3 ABSTRACT both long-term sun-exposure and chronological aging. Such Skin hyperpigmentation is characterized by increased melanin hyperpigmentation is also thought to be related to the existence of synthesis and deposition that can cause significant psychosocial and uneven skin tones often observed on sun-exposed areas. Regardless of psychological distress. Although several cytokine-receptor signaling the significant psychosocial distress associated with age spots, little is cascades contribute to the formation of ultraviolet B-induced cutaneous known about the detailed mechanisms responsible for them, except for hyperpigmentation, their possible involvement in other types of skin ultraviolet B (UVB)-induced pigmentation, despite the fact that many hyperpigmentation has never been clearly addressed. Since our researchers have tried to identify the melanogenic stimulatory factor(s) continuous studies using skin specimens from more than 30 subjects involved. with ethnic skin diversity emphasized a consistent augmentation in the In the course of UVB-induced pigmentation, three major steps in expression of endothelin-1 (ET-1) and its receptor (Endothelin B the epidermis, melanocyte proliferation, activation of melanin receptor, ET-B) in hyperpigmented lesions, including senile lentigos synthesis and melanosome transfer to keratinocytes, have been (SLs), the precise function of ET-1 signaling was investigated in the reported to be responsible for the increased melanogenesis (Okazaki .
    [Show full text]
  • Nitric Oxide As a Second Messenger in Parathyroid Hormone-Related Protein Signaling
    433 Nitric oxide as a second messenger in parathyroid hormone-related protein signaling L Kalinowski, L W Dobrucki and T Malinski Department of Chemistry and Biochemistry, Ohio University, Athens, Ohio, USA (Requests for offprints should be addressed to T Malinski, Department of Chemistry and Biochemistry, Ohio University, Biochemistry Research Laboratories 136, Athens, Ohio 45701–2979, USA; Email: [email protected]) (L Kalinowski was on sabbatical leave from the Department of Clinical Biochemistry, Medical University of Gdansk and Laboratory of Cellular and Molecular Nephrology, Medical Research Center of the Polish Academy of Science, Poland) Abstract Parathyroid hormone (PTH)-related protein (PTHrP) is competitive PTH/PTHrP receptor antagonists, 10 µmol/l produced in smooth muscles and endothelial cells and [Leu11,-Trp12]-hPTHrP(7–34)amide and 10 µmol/l is believed to participate in the local regulation of vascu- [Nle8,18,Tyr34]-bPTH(3–34)amide, were equipotent in lar tone. No direct evidence for the activation of antagonizing hPTH(1–34)-stimulated NO release; endothelium-derived nitric oxide (NO) signaling pathway [Leu11,-Trp12]-hPTHrP(7–34)amide was more potent by PTHrP has been found despite attempts to identify it. than [Nle8,18,Tyr34]-bPTH(3–34)amide in inhibiting Based on direct in situ measurements, it is reported here for hPTHrP(1–34)-stimulated NO release. The PKC inhibi- the first time that the human PTH/PTHrP receptor tor, H-7 (50 µmol/l), did not change hPTH(1–34)- and analogs, hPTH(1–34) and hPTHrP(1–34), stimulate NO hPTHrP(1–34)-stimulated NO release, whereas the release from a single endothelial cell.
    [Show full text]
  • A Focus on the Kisspeptin Receptor, Kiss1r
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 12-1-2014 12:00 AM Pathway-Specific Signaling and its Impact on erF tility: A Focus on the Kisspeptin Receptor, Kiss1r Maryse R. Ahow The University of Western Ontario Supervisor Dr. Andy Babwah The University of Western Ontario Graduate Program in Physiology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Maryse R. Ahow 2014 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Molecular and Cellular Neuroscience Commons Recommended Citation Ahow, Maryse R., "Pathway-Specific Signaling and its Impact on erF tility: A Focus on the Kisspeptin Receptor, Kiss1r" (2014). Electronic Thesis and Dissertation Repository. 2537. https://ir.lib.uwo.ca/etd/2537 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. PATHWAY-SPECIFIC SIGNALING AND ITS IMPACT ON FERTILITY: A FOCUS ON THE KISSPEPTIN RECEPTOR, Kiss1r (Thesis format: Monograph) by Maryse R. Ahow Graduate Program in Physiology A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy The School of Graduate and Postdoctoral Studies The University of Western Ontario London, Ontario, Canada © Maryse R. Ahow, 2014 Abstract Hypothalamic gonadotropin-releasing hormone (GnRH) is the master regulator of the neuroendocrine reproductive (HPG) axis and its secretion is regulated by various afferent inputs to the GnRH neuron.
    [Show full text]
  • The Anti-Apoptotic Role of Neurotensin
    Cells 2013, 2, 124-135; doi:10.3390/cells2010124 OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Review The Anti-Apoptotic Role of Neurotensin Christelle Devader, Sophie Béraud-Dufour, Thierry Coppola and Jean Mazella * Institut de Pharmacologie Moléculaire et Cellulaire, CNRS UMR 7275, Université de Nice-Sophia Antipolis, 660 route des Lucioles, Valbonne 06560, France; E-Mails: [email protected] (C.D.); [email protected] (S.B.-D.); [email protected] (T.C.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +33-4-93-95-77-61; Fax: +33-4-93-95-77-08. Received: 24 January 2013; in revised form: 15 February 2013 / Accepted: 26 February 2013 / Published: 4 March 2013 Abstract: The neuropeptide, neurotensin, exerts numerous biological functions, including an efficient anti-apoptotic role, both in the central nervous system and in the periphery. This review summarizes studies that clearly evidenced the protective effect of neurotensin through its three known receptors. The pivotal involvement of the neurotensin receptor-3, also called sortilin, in the molecular mechanisms of the anti-apoptotic action of neurotensin has been analyzed in neuronal cell death, in cancer cell growth and in pancreatic beta cell protection. The relationships between the anti-apoptotic role of neurotensin and important physiological and pathological contexts are discussed in this review. Keywords: neurotensin; receptor; apoptosis; sortilin 1. Introduction The tridecapeptide neurotensin (NT) was isolated from bovine hypothalami on the basis of its ability to induce vasodilatation [1]. NT is synthesized from a precursor protein following excision by prohormone convertases [2].
    [Show full text]
  • Current Knowledge on the Multifactorial Regulation of Corpora Lutea Lifespan: the Rabbit Model
    animals Review Current Knowledge on the Multifactorial Regulation of Corpora Lutea Lifespan: The Rabbit Model Massimo Zerani , Angela Polisca *, Cristiano Boiti and Margherita Maranesi Dipartimento di Medicina veterinaria, Università di Perugia, via San Costanzo 4, 06126 Perugia, Italy; [email protected] (M.Z.); [email protected] (C.B.); [email protected] (M.M.) * Correspondence: [email protected] Simple Summary: Corpora lutea (CL) are temporary endocrine structures that secrete progesterone, which is essential for maintaining a healthy pregnancy. A variety of regulatory factors come into play in modulating the functional lifespan of CL, with luteotropic and luteolytic effects. Many aspects of luteal phase physiology have been clarified, yet many others have not yet been determined, including the molecular and/or cellular mechanisms that maintain the CL from the beginning of luteolysis during early CL development. This paper summarizes our current knowledge of the endocrine and cellular mechanisms involved in multifactorial CL lifespan regulation, using the pseudopregnant rabbit model. Abstract: Our research group studied the biological regulatory mechanisms of the corpora lutea (CL), paying particular attention to the pseudopregnant rabbit model, which has the advantage that the relative luteal age following ovulation is induced by the gonadotrophin-releasing hormone (GnRH). CL are temporary endocrine structures that secrete progesterone, which is essential for maintaining a healthy pregnancy. It is now clear that, besides the classical regulatory mechanism exerted by Citation: Zerani, M.; Polisca, A.; prostaglandin E2 (luteotropic) and prostaglandin F2α (luteolytic), a considerable number of other Boiti, C.; Maranesi, M. Current effectors assist in the regulation of CL. The aim of this paper is to summarize our current knowledge Knowledge on the Multifactorial of the multifactorial mechanisms regulating CL lifespan in rabbits.
    [Show full text]
  • Capturing Peptide–GPCR Interactions and Their Dynamics
    molecules Review Capturing Peptide–GPCR Interactions and Their Dynamics Anette Kaiser * and Irene Coin Faculty of Life Sciences, Institute of Biochemistry, Leipzig University, Brüderstr. 34, D-04103 Leipzig, Germany; [email protected] * Correspondence: [email protected] Academic Editor: Paolo Ruzza Received: 31 August 2020; Accepted: 9 October 2020; Published: 15 October 2020 Abstract: Many biological functions of peptides are mediated through G protein-coupled receptors (GPCRs). Upon ligand binding, GPCRs undergo conformational changes that facilitate the binding and activation of multiple effectors. GPCRs regulate nearly all physiological processes and are a favorite pharmacological target. In particular, drugs are sought after that elicit the recruitment of selected effectors only (biased ligands). Understanding how ligands bind to GPCRs and which conformational changes they induce is a fundamental step toward the development of more efficient and specific drugs. Moreover, it is emerging that the dynamic of the ligand–receptor interaction contributes to the specificity of both ligand recognition and effector recruitment, an aspect that is missing in structural snapshots from crystallography. We describe here biochemical and biophysical techniques to address ligand–receptor interactions in their structural and dynamic aspects, which include mutagenesis, crosslinking, spectroscopic techniques, and mass-spectrometry profiling. With a main focus on peptide receptors, we present methods to unveil the ligand–receptor contact interface and methods that address conformational changes both in the ligand and the GPCR. The presented studies highlight a wide structural heterogeneity among peptide receptors, reveal distinct structural changes occurring during ligand binding and a surprisingly high dynamics of the ligand–GPCR complexes. Keywords: GPCR activation; peptide–GPCR interactions; structural dynamics of GPCRs; peptide ligands; crosslinking; NMR; EPR 1.
    [Show full text]
  • Dual Endothelin Receptor Blockade Acutely Improves Insulin Sensitivity in Obese Patients with Insulin Resistance and Coronary Artery Disease
    Emerging Treatments and Technologies ORIGINAL ARTICLE Dual Endothelin Receptor Blockade Acutely Improves Insulin Sensitivity in Obese Patients With Insulin Resistance and Coronary Artery Disease 1 2 GUNVOR AHLBORG, MD, PHD ADRIAN GONON, MD, PHD The vascular responses to ET-1 are 2 2 ALEXEY SHEMYAKIN, MD JOHN PERNOW, MD, PHD mediated via two receptor subtypes: ET 2 A FELIX B¨OHM, MD, PHD and ETB receptors (10,11). Both types of receptors are located on vascular smooth muscle cells and mediate vasoconstric- OBJECTIVE — Endothelin (ET)-1 is a vasoconstrictor and proinflammatory peptide that may tion. The ETB receptor is also located on inhibit glucose uptake. The objective of the study was to investigate if ET (selective ETA and dual endothelial cells and mediates vasodilata- ϩ ETA ETB) receptor blockade improves insulin sensitivity in patients with insulin resistance and tion by stimulating release of NO and coronary artery disease. prostacyclin. Early reports show that Ϯ ET-1 interferes with glucose metabolism RESEARCH DESIGN AND METHODS — Seven patients (aged 58 2 years) with as indicated by a drop in splanchnic glu- insulin resistance and coronary artery disease completed three hyperinsulinemic-euglycemic clamp protocols: a control clamp (saline infusion), during ET receptor blockade (BQ123), and cose production and peripheral glucose A utilization during ET-1 infusion in during combined ETA (BQ123) and ETB receptor blockade (BQ788). Splanchnic blood flow (SBF) and renal blood flow (RBF) were determined by infusions of cardiogreen and p- healthy subjects (12). Ferri et al. (4) dem- aminohippurate. onstrated a negative correlation between total glucose uptake and circulating ET-1 RESULTS — Total-body glucose uptake (M) differed between the clamp protocols with the levels in non–insulin-dependent diabe- highest value in the BQ123ϩBQ788 clamp (P Ͻ 0.05).
    [Show full text]
  • New Drugs and Emerging Therapeutic Targets in the Endothelin Signaling Pathway and Prospects for Personalized Precision Medicine
    Physiol. Res. 67 (Suppl. 1): S37-S54, 2018 https://doi.org/10.33549/physiolres.933872 REVIEW New Drugs and Emerging Therapeutic Targets in the Endothelin Signaling Pathway and Prospects for Personalized Precision Medicine A. P. DAVENPORT1, R. E. KUC1, C. SOUTHAN2, J. J. MAGUIRE1 1Experimental Medicine and Immunotherapeutics, University of Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom, 2Deanery of Biomedical Sciences, University of Edinburgh, Edinburgh, United Kingdom Received January 26, 2018 Accepted March 29, 2018 Summary Key words During the last thirty years since the discovery of endothelin-1, Allosteric modulators • Biased signaling • G-protein coupled the therapeutic strategy that has evolved in the clinic, mainly in receptors • Endothelin-1 • Monoclonal antibodies • Pepducins • the treatment of pulmonary arterial hypertension, is to block the Single nucleotide polymorphisms action of the peptide either at the ETA subtype or both receptors using orally active small molecule antagonists. Recently, there Corresponding author has been a rapid expansion in research targeting ET receptors A. P. Davenport, Experimental Medicine and Immunotherapeutics, using chemical entities other than small molecules, particularly University of Cambridge, Addenbrooke's Hospital, Cambridge, monoclonal antibody antagonists and selective peptide agonists CB2 0QQ, United Kingdom. Fax: 01223 762576. E-mail: and antagonists. While usually sacrificing oral bio-availability, [email protected] these compounds have other therapeutic advantages with the potential to considerably expand drug targets in the endothelin Introduction pathway and extend treatment to other pathophysiological conditions. Where the small molecule approach has been During the last thirty years since the discovery retained, a novel strategy to combine two vasoconstrictor of endothelin-1 (ET-1), the therapeutic strategy that has targets, the angiotensin AT1 receptor as well as the ETA receptor evolved in the clinic, mainly in the treatment of in the dual antagonist sparsentan has been developed.
    [Show full text]
  • Paracrine Regulation of the Resumption of Oocyte Meiosis by Endothelin-1
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Biology 327 (2009) 62–70 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology Paracrine regulation of the resumption of oocyte meiosis by endothelin-1 Kazuhiro Kawamura a,c,⁎, Yinghui Ye a,d, Cheng Guang Liang c, Nanami Kawamura a,b, Maarten Sollewijn Gelpke e, Rami Rauch c, Toshinobu Tanaka a, Aaron J.W. Hsueh c a Department of Obstetrics and Gynecology, Akita University School of Medicine, Akita 010-8543, Japan b Dermatology and Plastic Surgery, Akita University School of Medicine, Akita 010-8543, Japan c Divison of Reproductive Biology, Department of Obstetrics and Gynecology, Stanford University School of Medicine, Stanford, CA 94305-5317, USA d Department of Reproductive Endocrinology, Women's Hospital, Zhejiang University School of Medicine, Zhejiang 310-006, China e Molecular Design and Informatics, Schering-Plough Corporation, Oss, P.O. Box 20, 5340 BH, The Netherlands article info abstract Article history: Mammalian oocytes remain dormant in the diplotene stage of prophase I until the resumption of meiosis Received for publication 13 August 2008 characterized by germinal vesicle breakdown (GVBD) following the preovulatory gonadotropin stimulation. Revised 5 November 2008 Based on genome-wide analysis of peri-ovulatory DNA microarray to identify paracrine hormone-receptor Accepted 24 November 2008 pairs, we found increases in ovarian transcripts for endothelin-1 and endothelin receptor type A (EDNRA) in Available online 7 December 2008 response to the preovulatory luteinizing hormone (LH)/human chorionic gonadotropin (hCG) stimulation. Keywords: Immunohistochemical analyses demonstrated localization of EDNRA in granulosa and cumulus cells.
    [Show full text]
  • Role of Endothelin Axis in Pancreatic Tumor Microenvironment
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 Role of Endothelin Axis in Pancreatic Tumor Microenvironment Suprit Gupta University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Cancer Biology Commons Recommended Citation Gupta, Suprit, "Role of Endothelin Axis in Pancreatic Tumor Microenvironment" (2017). Theses & Dissertations. 203. https://digitalcommons.unmc.edu/etd/203 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. i Role of Endothelin Axis in Pancreatic Tumor Microenvironment By Suprit Gupta Presented to the Faculty of The Graduate College in the University of Nebraska In Partial fulfillment of Requirements For the degree of Doctor of Philosophy Department of Biochemistry and Molecular Biology Under the Supervision of Dr. Maneesh Jain University of Nebraska Medical Center Omaha, Nebraska April 2017 ii iii Role of Endothelin Axis in Pancreatic Tumor Microenvironment (TME) Suprit Gupta, PhD. University of Nebraska Medical Center 2017 Supervisor: Maneesh Jain, PhD. Endothelins (ETs) are a family of three 21 amino-acid vasoactive peptides ET-1, ET-2 and ET-3 that mediate their effects via two G-protein couple receptors ETAR and ETBR which are expressed on various cell types. Apart from their physiological role in vasoconstriction, there is emerging evidence supporting the role of endothelin axis (ET- axis) in cancer. Due to the expression of ET receptors on various cell-types, ET-axis can exert pleotropic effects and contribute to various aspects of cancer pathobiology.
    [Show full text]
  • Leptin in Atherosclerosis: Focus on Macrophages, Endothelial and Smooth Muscle Cells
    International Journal of Molecular Sciences Review Leptin in Atherosclerosis: Focus on Macrophages, Endothelial and Smooth Muscle Cells Priya Raman 1,2,* and Saugat Khanal 1,2 1 Integrative Medical Sciences, Northeast Ohio Medical University, Rootstown, OH 44272, USA; [email protected] 2 School of Biomedical Sciences, Kent State University, Kent, OH 44240, USA * Correspondence: [email protected]; Tel.: +1-(330)-325-6425; Fax: +1-(330)-325-5912 Abstract: Increasing adipose tissue mass in obesity directly correlates with elevated circulating leptin levels. Leptin is an adipokine known to play a role in numerous biological processes including regu- lation of energy homeostasis, inflammation, vascular function and angiogenesis. While physiological concentrations of leptin may exhibit multiple beneficial effects, chronically elevated pathophysio- logical levels or hyperleptinemia, characteristic of obesity and diabetes, is a major risk factor for development of atherosclerosis. Hyperleptinemia results in a state of selective leptin resistance such that while beneficial metabolic effects of leptin are dampened, deleterious vascular effects of leptin are conserved attributing to vascular dysfunction. Leptin exerts potent proatherogenic effects on multiple vascular cell types including macrophages, endothelial cells and smooth muscle cells; these effects are mediated via an interaction of leptin with the long form of leptin receptor, abundantly expressed in atherosclerotic plaques. This review provides a summary of recent in vivo and in vitro studies that highlight a role of leptin in the pathogenesis of atherosclerotic complications associated with obesity and diabetes. Citation: Raman, P.; Khanal, S. Keywords: hyperleptinemia; endothelial cells; vascular smooth muscle cells; macrophages; atherosclerosis Leptin in Atherosclerosis: Focus on Macrophages, Endothelial and Smooth Muscle Cells.
    [Show full text]