IGF-II) Gene in Villus During 610 Gestational Weeks, Jianhong Chen, Qun Fang, Baojiang Chen, Yi Zhou, and Yanmin Luo Volume 2010, Article ID 965905, 4 Pages

Obstetrics and Gynecology International

Epigenetic Regulation in Reproductive Medicine and Gynecologic Cancers

Guest Editors: Shi-Wen Jiang, Brian Brost, Sean Dowdy, Xing Xie, and Fan Jin Epigenetic Regulation in Reproductive Medicine and Gynecologic Cancers Obstetrics and Gynecology International

Epigenetic Regulation in Reproductive Medicine and Gynecologic Cancers

This is a special issue published in volume 2010 of “Obstetrics and Gynecology International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Obstetrics and Gynecology International

Editorial Board

Sean Blackwell, USA Howard D. Homesley, USA Faustino R. Perez-L´ opez,´ Spain Diane C. Bodurka, USA Shi-Wen Jiang, USA Tonse N.K. Raju, USA Curt W. Burger, The Netherlands Marc J. N. C. Keirse, Australia Neal S. Rote, USA Linda D. Cardozo, UK Russell K. Laros Jr., USA Giovanni Scambia, Italy Nancy Chescheir, USA Jonathan Ledermann, UK Peter E. Schwartz, USA Robert Coleman, USA Kimberly K. Leslie, USA John J. Sciarra, USA W. T. Creasman, USA Lawrence D. Longo, USA J. L. Simpson, USA Mary E. D’Alton, USA G. A. Macones, USA Anil Sood, USA Gian Carlo Di Renzo, Italy Everett Magann, USA Wiebren A. A. Tjalma, Belgium Keith A. Eddleman, USA James A. McGregor, USA J. R. Van Nagell, USA Edmund F. Funai, USA Liselotte Mettler, Germany John M. G. van Vugt, The Netherlands Norbert Gleicher, USA Daniel R. Mishell, USA M. A. Williams, USA Thomas Murphy Goodwin, USA Bradley J. Monk, USA Deborah A. Wing, USA WilliamA.Grobman,USA John J. Moore, USA Judith K. Wolf, USA Enrique Hernandez, USA J. C. Morrison, USA Edward V. Younglai, Canada Thomas Herzog, USA Errol R. Norwitz, USA Wolfgang Holzgreve, Switzerland Julian T. Parer, USA Contents

Epigenetic Regulation in Reproductive Medicine and Gynecologic Cancers, Shi-Wen Jiang, Brian Brost, Sean Dowdy, Xing Xie, and Fan Jin Volume 2010, Article ID 567260, 2 pages

Eﬀects of In Vitro Maturation on Histone Acetylation in Metaphase II Oocytes and Early Cleavage Embryos, Ning Wang, Fang Le, Qi-Tao Zhan, Li Li, Min-Yue Dong, Guo-Lian Ding, Chen-Ming Xu, Shi-Wen Jiang, He-Feng Huang, and Fan Jin Volume 2010, Article ID 989278, 9 pages

Imprinting and Promoter Usage of Insulin-Like Growth Factor II in Twin Discordant Placenta, Yan-Min Luo, Qun Fang, Hui-Juan Shi, Lin-Huan Huang, Run-Cai Liang, and Guang-Lun Zhuang Volume 2010, Article ID 498574, 5 pages

Oxidative Stress and DNA Methylation in Prostate Cancer,KrishnaVanajaDonkena,CharlesY.F.Young, and Donald J. Tindall Volume 2010, Article ID 302051, 14 pages

Preimplantation Genetic Screening: An Eﬀective Testing for Infertile and Repeated Miscarriage Patients?, Ning Wang, Ying-Ming Zheng, Lei Li, and Fan Jin Volume 2010, Article ID 120130, 6 pages

Study on the Imprinting Status of Insulin-Like Growth Factor II (IGF-II) Gene in Villus during 610 Gestational Weeks, Jianhong Chen, Qun Fang, Baojiang Chen, Yi Zhou, and Yanmin Luo Volume 2010, Article ID 965905, 4 pages

Eﬀects of Assisted Reproduction Technology on Placental Imprinted Gene Expression, Yukiko Katagiri, Chizu Aoki, Yuko Tamaki-Ishihara, Yusuke Fukuda, Mamoru Kitamura, Yoichi Matsue, Akiko So, and Mineto Morita Volume 2010, Article ID 437528, 4 pages

Speciﬁcity of Methylation Assays in Cancer Research: A Guideline for Designing Primers and Probes, Zeinab Barekati, Ramin Radpour, Corina Kohler, and Xiao Yan Zhong Volume 2010, Article ID 870865, 7 pages

Epigenetic Regulatory Mechanisms Associated with Infertility, Sheroy Minocherhomji, Prochi F. Madon, and Firuza R. Parikh Volume 2010, Article ID 198709, 7 pages

Hypermethylation of SOX2 Promoter in Endometrial Carcinogenesis, Oscar Gee-Wan Wong, Zhen Huo, Michelle Kwan-Yee Siu, HuiJuan Zhang, LiLi Jiang, Ester Shuk-Ying Wong, and Annie Nga-Yin Cheung Volume 2010, Article ID 682504, 7 pages Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 567260, 2 pages doi:10.1155/2010/567260

Editorial Epigenetic Regulation in Reproductive Medicine and Gynecologic Cancers

Shi-Wen Jiang,1 Brian Brost,2 Sean Dowdy,3 Xing Xie,4 and Fan Jin5

1 Mercer University, Macon, GA 31207-0001, USA 2 Division of Maternal-Fetal Medicine, Department of Obstetrics and Gynecology, Mayo Clinic, USA 3 Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Mayo Clinic, USA 4 Women’s Hospital, Zhejiang University School of Medicine, Zhejiang 310006, China 5 Zhejiang University, Hangzhou 310058, China

Correspondence should be addressed to Shi-Wen Jiang, jiang [email protected]

Received 24 October 2010; Accepted 24 October 2010

Copyright © 2010 Shi-Wen Jiang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Recent progress in the field of epigenetics has provided a new In the first paper entitled “Effects of in vitro maturation on study angle for our research efforts on reproductive medicine histone acetylation in metaphase II oocytes and early cleavage and gynecologic malignancies. We have acquired valuable embryos,” Wang et al. document a reduced expression insight into the regulatory mechanism and biological effects of histone acetyltransferase GCN5 (GCN5) and histone of DNA methylation and histone modification, the two deacetylase 1 (HDAC1) in two-cell embryos but a normal major epigenetic pathways. The newly acquired knowledge level of these enzymes after the two-cell stage. The results effectively complements that gained from the genetic stand- indicate that in vitro maturation could affect protein and point and holds great potential for the prevention, diagnosis, gene expression related to histone acetylation in oocytes and risk assessment, and treatment of these diseases. Specifically, early cleavage embryos. However, by function of selection, the DNA methylation and imprinting mechanisms are parts of the changes could be recovered in late embryo implicated in fertilization, early embryonic development, development. placental function, and pathogenesis of preeclampsia and In the second paper entitled “Imprinting and promoter intrauterine growth retardation. Aberrant DNA methylation usage of insulin-like growth factor II in twin discordant pla- and chromatin modification lead to gene-specific silencing centa,” Luo et al. analyze the imprinting and promoter usage of numerous tumor suppressor genes, DNA repair genes, of IGF-II in placenta of normal twins and twins with weight and steroid hormone receptors. This special issue presents or phenotype discordance and conclude that promoter 3 a collection of peer-reviewed papers focusing on these specific LOI of the IGF-II gene may be closely related to areas. While the issue is not intended as an exhaustive phenotype discordance, but not to weight discordance. representation of all of the potential topics, they nevertheless In the third paper entitled “Oxidative stress and DNA provide insightful and multifaceted information that we methylation in prostate cancer,” Donkena et al. present a consider a pleasure to share with the readers. comprehensive review on the effects of oxidative stress on This special issue includes 9 articles: three of which are DNA methylation and cancer progression, life style and diet related to the IGF-II imprinting in placenta and the effects as factors involved in ontogenesis and epigenetic interference of reproduction procedures on imprinting; two describe epi- for cancer prevention, and DNA methylation as a biomarker genetic mechanisms and genetic test for infertility; another for cancer detection. Updates on the application of DNMT paper documents the effects of in vitro maturation on inhibitors to chemotherapy are also provided. histone acetylation in oocytes and early cleavage embryos; In the fourth paper entitled “Preimplantation genetic two address DNA methylation changes in cancers; one paper screening: an effective testing for infertile and repeated miscar- discusses rational design of primer for methylation assays. riage patients?,” Wang et al. compare results from different 2 Obstetrics and Gynecology International laboratories on preimplantation screening of aneuploidy and assess the efficacy, risks, and benefits of the procedure. They conclude that the use of preimplantation genetic screening should be reconsidered. In the fifth paper entitled “Study on the imprinting status of insulin-like growth factor II (IGF-II) gene in villus during 6–10 gestational weeks,” Chen et al. compared the rate of loss of GF-II imprinting in the placental villous tissues between normal and abnormal embryo development and observed a significantly increased loss of imprinting in the abnormal group, suggesting that the imprinting status of IGF-II may be functionally related to embryo development. In the sixth paper entitled “Effects of assisted reproduction technology on placental imprinted gene expression,” Katagiri et al. investigate the impact of assisted reproduction techniques (ART) on imprinted gene expression in human placenta. Different changes in the mRNA levels of imprinted genes are observed in the ART group compared with the spontaneous conception group, suggesting that ART may modify epigenetic status. In the seventh paper entitled “Specificity of methylation assays in cancer research: a guideline for designing primers and probes,” Barekati et al. discuss the critical parameters to be considered for a rational design of PCR primers used for the detection of methylated DNA. The authors also provided applicable tools/algorithms and useful websites. In the eighth paper entitled “Epigenetic regulatory mechanisms associated with infertility,” Minocherhomji et al. review the epigenetic mechanisms involved in spermatogenesis and infertility. Topics discussed in detail include the regulation and potential role of epigenetics in infertility by high- order chromatin organization, epigenetic control of genes associated with pericentromeric regions of chromosome 9 and Y, and noncoding RNAs. In the ninth paper entitled “Hypermethylation of SOX2 promoter in endometrial carcinogenesis”, Wong et al. report their studies on the methylation profiles of SOX2, a gene encoding the stem cell-related transcription factor SOX2 in endometrial carcinomas. Compared to normal control tissues, cancer tissues show hypermethylation and decreased expression of SOX2. The authors conclude that epigenetic silencing mechanisms may play a crucial role in transcriptional regulation of SOX2 and loss of SOX2 expression. Shi-Wen Jiang Brian Brost Sean Dowdy Xing Xie Fan Jin Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 989278, 9 pages doi:10.1155/2010/989278

Research Article Effects of In Vitro Maturation on Histone Acetylation in Metaphase II Oocytes and Early Cleavage Embryos

Ning Wang,1 Fang Le,1 Qi-Tao Zhan,1 Li Li,1 Min-Yue Dong,1 Guo-Lian Ding,1 Chen-Ming Xu,1 Shi-Wen Jiang,2, 3 He-Feng Huang,1 and Fan Jin1

1 Department of Reproductive Endocrinology, Women’s Hospital, School of Medicine, Zhejiang University, 310006 Hangzhou, China 2 Department of Biomedical Science, Mercer University School of Medicine, Savannah, GA 31499, USA 3 Department of Obstetrics and Gynecology, Mayo Clinic, Rochester, MN 55905, USA

Correspondence should be addressed to Fan Jin, [email protected]

Received 1 December 2009; Revised 3 April 2010; Accepted 3 May 2010

Academic Editor: Sean Dowdy

Copyright © 2010 Ning Wang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

In vitro maturation (IVM) of oocyte is an effective procedure for avoiding ovarian hyperstimulation syndrome in patients with polycystic ovaries (PCOS) during in vitro fertilization (IVF). To investigate the influences of IVM on epigenetic reprogramming and to search for the possible reasons for the lower rates of fertilization and cleavage in IVM oocytes, we examined the expression of two enzymes controlling histone acetylation, histone acetyltransferase GCN5 (GCN5) and histone deacetylase 1 (HDAC1), as well as their common target, acetyl-histone H3 (Ac-H3), in mouse metaphase II (MII) oocytes and preimplantation embryos. Results showed that IVM downregulated the protein expression of GCN5 in MII oocytes and two-cell embryos and changed the distribution of GCN5 in two-cell embryos. Expression of HDAC1 mRNA in MII oocytes and two-cell embryos decreased in the IVM group. However, none of these changes persisted after two-cell embryos. Levels of Ac-H3 in both oocytes and embryos remained unchanged after IVM. Our studies indicated that IVM could affect the protein and gene expression related to histone acetylation in oocytes and early cleavage embryos. By function of selection, parts of the changes could be recovered in late embryo development.

1. Introduction Some concern has been voiced regarding the safety of this new method with respect to the health of the children [6]. In vitro fertilization and embryo transfer (IVF-ET) are an Questions have arisen on whether human oocytes matured effective treatment for infertility [1, 2]. However, the high in vitro are intrinsically compromised or whether culture costs of gonadotropin administration, the risk of ovarian conditions are inadequate to support the full developmental hyperstimulation syndrome (OHSS), and the possible asso- potential of the oocytes [7]. ciation between repeated ovarian stimulation and hormone- Oocyte maturation is one of the most critical periods for related cancers are the main drawbacks of IVF-ET. normal development and differentiation for an individual In-vitro maturation (IVM) offers an alternative to con- [8]; however, little is known about the mechanisms that ventional IVF that minimizes medicine administration and regulate early folliculogenesis and oocyte maturation in avoids ovarian hyperstimulation. Meanwhile, poor respon- human. The oocyte genome is epigenetically reprogrammed ders to gonadotropin stimulation may also benefit from during meiosis, which is followed by fertilization, to allow the IVMastheydonotneedtoreceivealargedosageof remarkable transformation from differentiated oocytes into gonadotropins. With the cryopreservation of reproductive the totipotent embryos of the next generation [9]. Epigenetic cells, IVM can offer to preserve fertility in women who are reprogramming is a scheduled genome-wide modification undergoing cancer treatment [3]. So far more than 1000 that occurs in the periods of gametogenesis and embryoge- children have been born from IVM procedures, particularly nesis, which regulates the gene activity without alteration in the patients with PCOS [4, 5]. However, IVM remains of DNA sequences [10]. Epigenetic reprogramming leads a challenge in mammalian species, especially for human. to re-establishment of gene imprinting patterns, silences or 2 Obstetrics and Gynecology International activates genes systematically, and represents a stage suscep- 100 tive to the changes of environment [11]. Oocyte growth and 90 b maturation appear to be vulnerable to environmental factors 80 70 that can induce the epigenetic alteration, deregulation gene a a 60 a expression, and ultimately, embryo defects or loss. 50 a (%) a Although the technique of IVM in human has been 40 gradually improved, its successful rate remains low compared 30 with IVF. The changes of some imprint genes in the 20 b oocytes or embryos from IVM suggested that IVM procedure 10 0 might influence the DNA methylation during the oocyte Bip 2-cell 4-cell 8-cell Morula Blastula BR maturation in-vitro [12–14]. However, the influence of IVM on the process of histone modification in oocyte, another IVM important mechanism in epigenetic reprogramming, has not Control been documented. Histone modification includes acetylation and methyla- Figure 1: Rates of fertilization, cleavage, developmental compe- tion of lysines (K) and arginines (R), phosphorylation of tence, and birth. Bip: Bipronucleus; BR: total number of born serines (S) and threonines (T), ubiquitylation of lysines, as mice/total number of 2-cell embryos for transplantation. (a) P< well as ribosylation. Recent studies have shown that these .01; (b) P<.05. histone modifications play important roles in the regulation of gene expression in mitotic cells. Some modifications such 1.2 as acetylation of lysine residues in histones H3 upregulate transcription while other modifications like methylation of 1 H3K9 downregulate transcription [15, 16]. Among all the modifications, histone acetylation happens most frequently [17]. Histone acetylation is catalyzed by histone acetyltrans- 0.8 ferases (HATs) that transfer acetyl groups from acetyl coenzyme A (acetyl-CoA) onto the ε-amino groups of conserved 0.6 lysine residues within the core histones. The levels of histone acetylation in chromatin are determined by the cooperations 0.4 of HATs and histone deacetylases (HDACs) [18]. Histone acetyltransferase GCN5 (GCN5), a type-A HAT, 0.2

catalyzes the acetylation of nucleosomes in nuclei or free Relative levels of gcn5 mRNA expression histones in cytoplasm and acts as transcriptional coactivator 0 in gene regulation. Histone deacetylase 1 (HDAC1) is one Oocyte 2-cell 4-cell 8-cell of Rpd3-like HDACs [19, 20], first identified as an IL- 2 inducible gene. Overexpression of HDAC1 could cause IVM aberrant morphologies and a partial blockage in the G2/M Control phases of the cell cycle [21]. GCN5 and HDAC1 are crucial for epigenetic reprogramming, regulation of gene expression, Figure 2: mRNA expressions of GCN5 in oocytes and embryos. The comparison of GCN5 mRNA expression was made between IVM and cell proliferation during embryo development, but their and control groups. Summary data showed the relative expression exact roles and the underlying mechanisms during oocytes levels of GCN5 in oocytes and embryos after real-time PCR maturation in vitro remain unclear. Lysine residues of the analysis. The relative mRNA levels represent the amount of mRNA amino terminal tail domain of histone H3 are common expression normalized with GAPDH. targets for histone acetylation which results in an allosteric change in the nucleosomal conformation and an increased accessibility to transcriptional factors by DNA. Laboratory Animal of the Animal Care of Usage Committee The active roles of GCN5 and HDAC1 in epigenetic (ACUC) of Zhejiang University, and the protocol was reprogramming and embryonic development prompted us approved by the ACUC of Zhejiang University School of to examine if IVM procedure may have an impact on these Medicine. Female ICR mice (6-7 weeks old) and male mice enzymes’ expressions and functions. We determined the (8–12 weeks old) were housed in 12/12-hour light/dark cycle expression and distribution of GCN5, HDAC1, and Ac-H3 in at 25 ± 0.5◦C and 50–60% humidity. The mice were fed ad metaphase II oocytes matured in vitro and in vivo. Toobserve libitum with a standard pellet diet and water. The female the extended effects of IVM, the levels of these factors were mice are divided into two groups randomly, IVM group and followed in the embryos from IVM and control groups. control group.

2. Materials and Methods 2.2. Collection of Oocytes. For IVM group, female mice (6- 7 weeks old) received 5 IU PMSG (pregnant mare serum 2.1. Experimental Animals. Animal care and procedures gonadotropin; Gestyl, Organon, Oss, The Netherlands) 46– were carried out following Institutional Guidance of the 48 h before being sacriﬁced by cervical dislocation. The Obstetrics and Gynecology International 3

Table 1: Reference genes selected for the study, and sizes of the PCR products.

Genbank Gene name Accession Primer sequences Product size (bp) GCN5 NM 020004 5-CGAGTTGTGCCGTAGCTGTGA-3 96 5-ACCATTCCCAAGAGCCGGTTA-3 HDAC1 NM 008228 5-CTGAATACAGCAAGCAGATGCAGAG-3’ 92 5-TCCCGTGGACAACTGACAGAAC-3 GAPDH NM 008084 5–TGACGTGCCGCCTGGAGAAA-3 98 5-AGTGTAGCCCAAGATGCCCTTCAG-3 ovaries were excised, and antral follicles were punctured with pseudopregnant female mice. Embryos at the 2-cell stage 27 G needles in HEPES-buffered human tubal fluid medium were transferred into the oviducts (maximum of 15 per (MHTF, Irvin Scientific, Santa Ana, CA, USA) supplemented oviduct) of 0.5 d.p.c. pseudopregnant ICR recipient female with 10% Quinn’s Advantage Serum Protein Substitute mice anesthetized with 2.5% Avertin i.p. Recipients were kept (SPS,SAGE/CooperSurgicalInc.,Trumbull,CT,USA).The warm on a heating pad until fully recovered from anesthesia cumulus-enclosed oocytes at GV stage were selected. Oocytes [25, 26]. were matured as previously described [22, 23]. Briefly, GV stage oocytes were cultured in human tubal fluid (HTF, 2.4. Quantitative Real-Time RT-PCR. All the pools were Irvin Scientific, Santa Ana, CA, USA) medium containing done in triplicate and contained 60 oocytes or embryos 10% SPS supplemented with 0.1 IU/ml follicle stimulating from different developmental stages: MII oocytes, 2-cell hormone (FSH, Gonal F, Serono, Aubonne, Switzerland) and embryos, and 8-cells embryos [27]. The total RNA was 0.5 IU/ml human chorionic gonadotropin (hCG, Pregnyl, extracted from those pools using Absolutely RNA Microprep Organon, Oss, The Netherlands) for 16–18 hours at 37◦Cin Kit (Stratagene, La Jolla, CA, USA) as described by the a humidified atmosphere of 5% CO2.Oocyteswereobserved manufacturer. The entire RNA pellet was used for the RT. under microscopy, and the disappearance of germ vesicle and RT-PCR was carried out using the SYBR PrimeScript RT- the extrusion of the first polar body were used as the criteria PCR Kit (Takara, China). 4 μl 5X PrimeScript Buffer PCR of the maturation of oocytes. buffer, 1 μl PrimeScriptTM RT Enzyme Mix I, 1 μlOligodT For the control group, mice were superovulated as Primer (50 μM), and 1 μl Random oligos (100 μM) were described previously [24]. Briefly, mice received intraperi- added to the pool to obtain a total reaction mix volume of ◦ toneal injection of 7.5 IU hCG 46–48 hrs after the admin- 20 μl reaction system. The mixture was incubated at 37 Cfor ◦ istration of 7.5 IU PMSG. Mice were sacrificed by cervi- 15 min, and the reaction was inactivated at 85 Cfor5sec.RT cal dislocation 12–14 hours after hCG injection, and the products were amplified by real-time PCR with SYBR-Green oviducts were excised. Cumulus masses were recovered from I (Takara, China) on ABI real-time PCR system (Applied the dilated ampullae under a dissecting microscope. The Biosystems) according to the manufacturer’s instructions. collected cumulus masses were digested with hyaluronidase GAPDH was used as an internal reference gene. Real-time to remove granulosa cells. The naked oocytes were either PCR was carried out in 20 μl reactions containing 10 μl placed in a drop of HTF for in vitro fertilization or washed SYBR Premix Ex Taq, 0.4 μlPCRForwardPrimer(10μM), three times with phosphate-buffered saline (PBS) for oocyte 0.4 μlPCRReversePrimer(10μM), 0.4 μlROXReference fixation or mRNA extraction. Dye, and 2 μl cDNA sample. PCR was performed with one denaturation cycle at 95◦C for 10 sec and 40 amplification ◦ ◦ 2.3. IVF-ET. Sperm collected from caudal epididymides cycles at 95 Cfor5secand60 C for 30 sec. Primer sequences of ICR male mice were allowed to disperse in 10% SPS for the genes are shown in Table 1. Data were analyzed by the ◦ HTF and incubated at the conditions of 5% CO2,37C comparative threshold cycle (CT) method and the standard for 1 hr. For IVF, matured MII oocytes from either IVM formula [28]. group or the control group were inseminated with 4 × 105 sperm/ml in drops of 30 μlof10%SPSHTF.About 2.5. Fluorescence Immunocytochemistry. Immunofluorescent 4–6 hrs after insemination, oocytes were removed from staining was conducted as previously described [29]. Fol- fertilization medium to fresh 10% SPS HTF [22]. lowing fixation in 4% formaldehyde (Sigma, St. Louis, Intact oocytes were cultured in fresh 10% SPS HTF under MO, USA) at 25◦Cfor30min,oocytesandembryos ◦ oil at 37 Cin5%CO2 in air. Fertilization was judged if the were permeabilized with 1% Tween-20 in PBS containing oocyte showed extrusion of second polar body or the appear- 0.1% BSA at 4◦C for 60 min. Nonspecific binding was ance of bi-pronucleus 9 hrs after insemination. Two-cell, blocked with heat-inactivated sheep serum in PBS (30% v/v) four-cell, and eight-cell embryos were harvested for fixation containing 2% BSA at 25◦C for 30 min. Oocytes and embryos or mRNA extraction after being washed three times in PBS. were incubated with antibodies against HDAC1 (rabbit, 1: Estrous ICR female mice were mated with vasectomized 200; Upstate Biotechnology Inc., Lake Placid, NY, USA), males (1 : 1) on the same day as IVF for preparing the GCN5 (goat, 1 : 200; Santa Cruz Biotechnology, Inc., Santa 4 Obstetrics and Gynecology International

IVM Control IVM Control IVM Control IVM Control Oocyte Oocyte 2-cell 2-cell 4-cell 4-cell 8-cell 8-cell

DAPI

GCN5

100 μm Merged 200× (a)

350

300

250 b a b 200

150

100 Mean gray value of GCN5

0 Oocyte 2-cell 4-cell 8-cell N = Nuclei; C = Cytoplasm a, IVM-N versus Control-N, P<.05 b, IVM-C versus Control-C, P<.05 IVM-N IVM-C Control-N Control-C (b)

Figure 3: Fluorescence immunocytochemistry of GCN5 in oocytes and embryos. (a) Expressions of GCN5 in MII oocytes, 2-cell, 4-cell, and 8-cell embryos from IVM and control groups. Each sample was counterstained with DAPI (blue) to visualize the DNA. Speciﬁc goat polyclonal GCN5 was detected by ﬂuorescein-conjugated antigoat secondary antibodies (green colour, FITC-labeled). Bar represents 100 μm. (b) The gray value of GCN5 in oocytes and embryos.

Cruz, CA, USA), or Ac-H3 (rabbit, 1: 800; Cell Signaling images were analyzed by using the program Image-J from Technology, Inc., Danvers, MA, USA) at 4◦C overnight. the National Institutes of Health (http://rsb.info.nih.gov/ij/) The cells were washed three times with PBS, incubated (USA). Each developmental panel was repeated three times, in fluorescein isothiocyanate- (FITC- ) labeled secondary and at least 20 oocytes or embryos were evaluated each time. antibody (rabbit antigoat IgG, 1 : 200, for GCN5; goat In each experiment, samples without primary antibody were anti-rabbit IgG, 1 : 200, for HDAC1 or Ac-H3; Zhongshan included as negative controls. Golden Bridge Biotechnology, Co., Beijing, China) at 25◦C for 30 min. The slides were washed, and a drop of DAPI 3. Results (Vector Laboratories, Burlingame, CA) was added. The slides were then sealed with a coverslip. The fluorescent signals 3.1. IVM Decreased the Rates of Fertilization, Cleavage, were detected with a Laser-Scanning Confocal Microscopy and Developmental Competence. The rates of fertilization, (Zeiss, LSM 510 META, Jena, Germany). Instrument settings cleavage, blastulation, and birth were significantly lower in were kept constant for each replicate. The fluorescence IVM group than those in the control group (P<.05) Obstetrics and Gynecology International 5

(Figure 1). Meanwhile, 69.13% of 2-cell embryos in IVM 1.2 group could develop to 4-cell embryos while 89.21% in the control group (P<.05). 1

0.8 3.2. Statistical Analyses. Chi-square test was applied for the comparison of fertilization and cleavage and early develop- a 0.6 a ment rates. Data of fluorescence immunocytochemistry and RT-PCR between IVM and control groups was compared by independent-test using SPSS 16.0 (Statistical Package for the 0.4 Social Science, SPSS Inc., Chicago, USA), and P<.05 was considered statistically significant. 0.2 Relative levels of hdac1 mRNA expression 0 3.3. The mRNA Expression of GCN5. The GCN5 mRNA was Oocyte 2-cell 4-cell 8-cell detected in both MII oocytes and embryos. The mRNA a, IVM versus control, P<.05 expressions were decreased in IVM oocytes; and embryos, IVM however, no significant statistically differences were detected Control (P<.05) (Figure 2). Figure 4: mRNA expression of HDAC1 in oocytes and embryos. The comparison of HDAC1 mRNA expression was made between 3.4. Localization and Intensity of GCN5. Fluorescence IVM and control groups. Summary data showed the relative immunocytochemistry showed that GCN5 was expressed expression levels of HDAC1 in oocytes and embryos after real-time PCR analysis. The relative mRNA levels represent the amount of in oocytes and embryos in both IVM and control groups. mRNA expression normalized with GAPDH. Quantitative analysis showed that the fluorescent signals in oocytes and the cytoplasm of blastomeres in 2-cell embryo in IVM group were significantly lower than those in the control group (P<.01). Meanwhile, in the 2-cell embryos of the control group, GCN5 expression was obviously around 4. Discussion karyotheca while in the same stage of embryo from IVM, the In this study, we found that histone acetylation in oocytes, distribution of the fluorescent staining of GCN5 was almost early cleavage embryos, and (two-cell embryos) was changed even. However, after 2-cell stage embryos, no significant in IVM group. The rates of fertilization, cleavage, and ff di erence was found in the fluorescent intensities and developmental competence from two-cell to four-cell stage distributions of GCN5 (Figure 3). were significantly lower in IVM group, so as the birth rate (BR) with two-cell transfer. We confirmed that IVM affected the quality of oocytes during the process of epigenetic 3.5. The mRNA Expression of HDAC1. The HDAC1 mRNA reprogramming and led to the results above. was expressed in both MII oocytes and embryos. The mRNA expression was significantly lower in the IVM group than that Although the decreased expressions of GCN5 mRNA ff in the control group in oocytes and 2-cell embryos (P<.05) were detected in IVM group, no statistically di erences were (Figure 4). This trend continues in the 4-cell and 8-cell stages, shown. The absence of change in GCN5 mRNA expression in but the differences did not reach a statistically significant both MII oocytes and two-cell embryos from IVM indicated ff level. that IVM might not a ect GCN5 transcription, and the maternally inherited GCN5 mRNAs that were transcribed during the oocyte growth phase were abundant [30]. 3.6. Localization and Intensity of HDAC1. The intensities and However, GCN5 protein expressions were decreased in localizations of HDAC1 in the cytoplasm of MII oocytes and ff IVM oocytes and two-cell embryos. These changes were most two-cell embryos were not significantly di erent between likely caused by the difference between a relatively simple IVM and the control groups. But in the nuclei of 2-cell in vitro culture condition and the complex in vivo system embryos, the mean gray value of HDAC1 in IVM group was supported by multiple interactions of various factors and significantly lower than that in the control group (P<.05). ff cells in ovary [31–33]. The polarity of blastomere was funda- After 2-cell stage embryos, no significant di erences were mental for the subsequent development and differentiation detected between IVM and the control groups either in the of the embryos [34–37]. It was reported that cytoplasm is nuclei or in the cytoplasm (Figure 5). polarized by cortical proteins, and this polarization then influences the stability of other maternally expressed proteins 3.7. Localization and Intensity of Ac-H3. No appreciable that in turn determine early embryonic cell fates [35]. In expression of Ac-H3 was observed in MII oocytes. Ac-H3 was the present study, the distribution polarity of GCN5 protein only detected in the nuclei in embryos, and no significant in the blastomere of two-cell embryos disappeared in the differences of fluorescent intensities were found between IVM group, which might affect the subsequent develop- IVM and the control groups (Figure 6). ment. The decreased expression and altered distribution 6 Obstetrics and Gynecology International

IVM Control IVM Control IVM Control IVM Control Oocyte Oocyte 2-cell 2-cell 4-cell 4-cell 8-cell 8-cell

DAPI

HDAC1

100 μm Merged 200× (a) 2000 1800 1600 1400 1200 1000 a 800 600 Mean gray value of HDAC1 400 200 0 Oocyte 2-cell 4-cell 8-cell N = nuclei; C = cytoplasm a, IVM-N versus Control-N, P<.05

IVM-N IVM-C Control-N Control-C (b)

Figure 5: Fluorescence immunocytochemistry of HDAC1 in oocytes and embryos. (a) Expressions of HDAC1 in MII oocytes, 2-cell, 4-cell, and 8-cell embryos from IVM and control groups. Each sample was counterstained with DAPI (blue) to visualize the DNA. Speciﬁc rabbit polyclonal HDAC1 was detected by ﬂuorescein-conjugated antirabbit secondary antibodies (green, FITC-labeled). Bar represents 100 μm. (b) The gray value of GCN5 in oocytes and embryos.

of GCN5 in IVM oocytes and two-cell embryos suggested stable RNA to support early embryonic cleavage. However, that IVM could disturb the function of GCN5 during the on the attainment of its full size, transcription ceased and period of reprogramming, which might lead to epigenetic the previously stored mRNA derived development through alterations. oocyte maturation, fertilization, and the early cleavage stages HDAC1 played a role in the ATP-dependent chromatin up to the activation of the embryonic genome [30]. In mice, remodeling [38], participated in the downregulation of a the maternal/zygotic transition (MZT) occurs in the late variety of DNA-binding transcription factors [19, 39], and two-cell stage. The defects of HDAC1 mRNA in MII oocytes modulated cell proliferation. The signiﬁcantly decreased suggested that the down-regulation of HDAC1 gene resulted HDAC1mRNAlevelsinbothoocytesandtwo-cellembryos from IVM occurred at the early stage of oocyte maturation. from IVM strongly implied that IVM procedure downregu- The low rate of developmental competence from two-cell to lated the transcription of HDAC1 gene in oocytes before and four-cell embryos could be explained by the delay of zygotic after fertilization. During the growth of the mammalian fol- gene activation (ZGA) associated with expression alteration licular oocyte, the oocyte actively transcribed and produced of HDAC1 and/or other genes [40]. Obstetrics and Gynecology International 7

IVM Control IVM Control IVM Control 2-cell 2-cell 4-cell 4-cell 8-cell 8-cell

DAPI

Ac-H3

100 μm Merged 200× (a)

1400

1200

1000

800

600

400 Mean gray value of Ac-H3 200

0 2-cell 4-cell 8-cell

IVM Control (b)

Figure 6: Fluorescence immunocytochemistry of Ac-H3 in oocytes and embryos. (a) Expression of Ac-H3 in 2-cell, 4-cell, and 8-cell embryos from IVM and control groups. Cells were immunostained with the Ac-H3 antibody. Each sample was counterstained with DAPI (blue) to visualize the DNA. Speciﬁc rabbit polyclonal Ac-H3 was detected by ﬂuorescein-conjugated antirabbit secondary antibodies (green, FITC- labeled). Bar represents 100 μm. (b) The gray value of GCN5 in oocytes and embryos.

Gioia et al. revealed that IVM oocytes failed to acquire No differences were detected in the expression of GCN5 full remodeling competence because of the disturbance of and HDAC1 after two-cell stage embryos, which indicated acetylation [41]. HDAC1 protein in cytoplasm of two-cell that the insufficiency induced by IVM might be rectified embryos was inherited from maternal storage while in the during the process of growing from two-cell to four-cell nuclei it was synthesized by the embryos themselves [42–45]. stage. The significantly lower rates of fertilization and cleav- The reduced level of HDAC1 protein expression in nuclei of age in this IVM mouse model suggested that the mechanism IVM 2-cell embryos suggested that IVM affected the HDAC1 of selection was functioned, and the oocytes and embryos protein syntheses and might interrupt its nucleus-cytoplasm seriously affected by IVM were eliminated before the embryo distributions at this stage of embryos [20]. developed to two-cell stage. 8 Obstetrics and Gynecology International

The level of acetyl-histone H3 is an index for the [4] R.-C. Chian, “In-vitro maturation of immature oocytes evaluation of global histone acetylation in chromatin. H3 for infertile women with PCOS,” Reproductive BioMedicine acetylationisinvolvedingeneexpressionregulationand Online, vol. 8, no. 5, pp. 547–552, 2004. genome reprogramming in oocytes and embryos [46, 47]. [5] A.-M. Suikkari and V. Soderstr¨ om-Anttila,¨ “In-vitro matura- Although IVM could affect the expression and distribution tion of eggs: is it really useful?” Best Practice and Research, vol. of GCN5 and HDAC1 in MII oocytes and 2-cell embryos, 21, no. 1, pp. 145–155, 2007. [6]K.Y.Cha,H.M.Chung,D.R.Lee,etal.,“Obstetricoutcome which might be one reason for the low BR after 2-cell of patients with polycystic ovary syndrome treated by in transfer, the levels of acetyl-histone H3 were not significantly vitro maturation and in vitro fertilization-embryo transfer,” changed in IVM group. Thus, global histone acetylation Fertility and Sterility, vol. 83, no. 5, pp. 1461–1465, 2005. levels remain comparable in IVM oocytes and embryos. [7] A. Mikkelsen, “In vitro maturation of human ova,” Interna- Other acetyltransferases or deacetylases may complement the tional Congress Series, vol. 1266, pp. 160–166, 2004. function of GCN5 and HDAC1 on regulation of histone [8] J. Fulka Jr., N. L. First, and R. M. Moor, “Nuclear and cytoplas- modification [48]. The global changes of acetylation in mic determinants involved in the regulation of mammalian these residues of histone or specific changes in a target oocyte maturation,” Molecular Human Reproduction, vol. 4, locus of chromatins associated with CGN5 and HDAC1 no. 1, pp. 41–49, 1998. will require further investigation. The seeming inconsis- [9] R. M. Schultz, W. Davis Jr., P. Stein, and P. Svoboda, tency between GCN5/HDAC1 levels and H3 acetylation “Reprogramming of gene expression during preimplantation levels is partially caused by protein localization, as IVM- development,” Journal of Experimental Zoology, vol. 285, no. 3, pp. 276–282, 1999. induced changes of GCN5 were observed in the cytoplasm, [10] D. Lucifero, J. R. Chaillet, and J. M. Trasler, “Potential while Ac-H3 is associated with chromatins that localize in significance of genomic imprinting defects for reproduction nuclei. and assisted reproductive technology,” Human Reproduction In conclusion, our studies showed that IVM could affect Update, vol. 10, no. 1, pp. 3–18, 2004. the expressions of GCN5 and HDAC1 in MII oocytes and [11] S. Bao, Y. Obata, J. Carroll, I. Domeki, and T. Kono, two-cell embryos. However, these changes appear to be “Epigenetic modifications necessary for normal development transient and normal levels resumed in later development are established during oocyte growth in mice,” Biology of stages. Although recent reports had shown that IVM might Reproduction, vol. 62, no. 3, pp. 616–621, 2000. be safe to the newborn [49], the detrimental effects of IVM [12] A. Kerjean, P. Couvert, T. Heams, et al., “In vitro follicular ff on the development of embryo, fetus, or even newborn could growth a ects oocyte imprinting establishment in mice,” not be totally ruled out. Indeed, the lower pregnancy rate European Journal of Human Genetics, vol. 11, no. 7, pp. 493– of IVM indicated that the impact of IVM procedures persist 496, 2003. [13] N. Borghol, J. Lornage, T. Blachere,` A. Sophie Garret, and A. beyond the stage of implantation. The precise mechanisms ff Lefevre,` “Epigenetic status of the H19 locus in human oocytes by which IVM a ect, the GCN5 and HDAC1 levels and the following in vitro maturation,” Genomics,vol.87,no.3,pp. ff implication of these changes for the safety of o spring need 417–426, 2006. to be investigated in future studies. [14] R. Khoureiry, S. Ibala-Rhomdane, L. Mery,´ et al., “Dynamic CpG methylation of the KCNQ1OT1 gene during maturation of human oocytes,” Journal of Medical Genetics, vol. 45, no. 9, Acknowledgments pp. 583–588, 2008. [15] T. Jenuwein and C. D. Allis, “Translating the histone code,” The research was supported by National Basic Research Science, vol. 293, no. 5532, pp. 1074–1080, 2001. Program of China (2007CB948104) and Natural Science [16] S. K. Kurdistani, S. Tavazoie, and M. Grunstein, “Mapping Foundation Projects of Zhejiang (Z207021). The authors global histone acetylation patterns to gene expression,” Cell, would like to thank the staff at Women’s Reproductive vol. 117, no. 6, pp. 721–733, 2004. Health Laboratory of Zhejiang Province for assistance with [17] P.Gavazzo, L. Vergani, G. C. Mascetti, and C. Nicolini, “Effects the experiment. of histone acetylation on chromatin structure,” Journal of Cellular Biochemistry, vol. 64, no. 3, pp. 466–475, 1997. [18] S. Yamagoe, T. Kanno, Y. Kanno, et al., “Interaction of histone References acetylases and deacetylases in vivo,” Molecular and Cellular Biology, vol. 23, no. 3, pp. 1025–1033, 2003. [1]D.Horwath,J.H.Check,B.Katsoff,J.Amui,andD. [19]J.Taunton,C.A.Hassig,andS.L.Schreiber,“Amam- Brasile, “Subsequent therapeutic options and outcome in malian histone deacetylase related to the yeast transcriptional couples who fail to fertilize despite in vitro fertilization (IVF) regulator Rpd3p,” Science, vol. 272, no. 5260, pp. 408–411, and intracytoplasmic sperm injection (ICSI),” Clinical and 1996. Experimental Obstetrics and Gynecology,vol.34,no.2,pp. [20] A. J. M. de Ruijter, A. H. van Gennip, H. N. Caron, S. Kemp, 109–110, 2007. andA.B.P.VanKuilenburg,“Histonedeacetylases(HDACs): [2] M. Szamatowicz, “The role and place of the assisted reproduc- characterization of the classical HDAC family,” Biochemical tive technology (ART) in treatment of infertility,” Ginekologia Journal, vol. 370, no. 3, pp. 737–749, 2003. Polska, vol. 78, no. 3, pp. 175–179, 2007 (Polish). [21] A. P. Wolffe and J. J. Hayes, “Chromatin disruption and [3] K. L. Singh, M. Davies, and R. Chatterjee, “Fertility in female modification,” Nucleic Acids Research, vol. 27, no. 3, pp. 711– cancer survivors: pathophysiology, preservation and the role 720, 1999. of ovarian reserve testing,” Human Reproduction Update, vol. [22] Y. Nishi, T. Takeshita, K. Sato, and T. Araki, “Change of the 11, no. 1, pp. 69–89, 2005. mitochondrial distribution in mouse ooplasm during in vitro Obstetrics and Gynecology International 9

maturation,” Journal of Nippon Medical School,vol.70,no.5, [37]N.Wiper-Bergeron,H.A.Salem,J.J.Tomlinson,D.Wu, pp. 408–415, 2003. and R. J. G. Hache,´ “Glucocorticoid-stimulated preadipocytes [23] S. M. Junk, A. Dharmarajan, and J. L. Yovich, “FSH priming differentiation is mediated through acetylation of C/EBPβ by improves oocyte maturation, but priming with FSH or hCG GCN5,” Proceedings of the National Academy of Sciences of the has no effect on subsequent embryonic development in an in United States of America, vol. 104, no. 8, pp. 2703–2708, 2007. vitro maturation program,” Theriogenology, vol. 59, no. 8, pp. [38] J. K. Tong, C. A. Hassig, G. R. Schnitzler, R. E. Kingston, and S. 1741–1749, 2003. L. Schreiber, “Chromatin deacetylation by an ATP-dependent [24] H.-C. Ruan, X.-M. Zhu, Q. Luo, et al., “Ovarian stimulation nucleosome remodelling complex,” Nature, vol. 395, no. 6705, with GnRH agonist, but not GnRH antagonist, partially pp. 917–921, 1998. restores the expression of endometrial integrin β3and [39] M. J. Pazin and J. T. Kadonaga, “What’s up and down with leukaemia-inhibitory factor and improves uterine receptivity histone deacetylation and transcription?” Cell, vol. 89, no. 3, in mice,” Human Reproduction, vol. 21, no. 10, pp. 2521–2529, pp. 325–328, 1997. 2006. [40] J. C. Conover, G. L. Temeles, J. W. Zimmermann, B. Burke, [25] O. Lacham-Kaplan, J. Shaw, L. G. Sanchez-Partida, and A. and R. M. Schultz, “Stage-specific expression of a family of Trounson, “Oocyte activation after intracytoplasmic injection proteins that are major products of zygotic gene activation in with sperm frozen without cryoprotectants results in live the mouse embryo,” Developmental Biology, vol. 144, no. 2, pp. offspring from inbred and hybrid mouse strains,” Biology of 392–404, 1991. Reproduction, vol. 69, no. 5, pp. 1683–1689, 2003. [41] L. Gioia, B. Barboni, M. Turriani, et al., “The capability [26] O. Lacham-Kaplan and A. Trounson, “Reduced developmental of reprogramming the male chromatin after fertilization is competence of immature, in-vitro matured and postovulatory dependent on the quality of oocyte maturation,” Reproduction, aged mouse oocytes following IVF and ICSI,” Reproductive vol. 130, no. 1, pp. 29–39, 2005. Biology and Endocrinology, vol. 6, article 58, 2008. [42] R. F. Bachvarova, “A maternal tail of poly(A): the long and the [27] S. McGraw, C. Robert, L. Massicotte, and M.-A. Sirard, shortofit,”Cell, vol. 69, no. 6, pp. 895–897, 1992. “Quantification of histone acetyltransferase and histone [43] B. V. Paynton and R. Bachvarova, “Polyadenylation and deacetylase transcripts during early bovine embryo develop- deadenylation of maternal mRNAs during oocyte growth ment,” Biology of Reproduction, vol. 68, no. 2, pp. 383–389, and maturation in the mouse,” Molecular Reproduction and 2003. Development, vol. 37, no. 2, pp. 172–180, 1994. [28] J. H. Schefe, K. E. Lehmann, I. R. Buschmann, T. Unger, [44] T. C. Rodman and R. Bachvarova, “RNA synthesis in preovu- and H. Funke-Kaiser, “Quantitative real-time RT-PCR data latory mouse oocytes,” JournalofCellBiology, vol. 70, no. 1, analysis: Current concepts and the novel ”gene expression’s C pp. 251–257, 1976. Tdifference” formula,” Journal of Molecular Medicine, vol. 84, [45] G. Lagger, D. O’Carroll, M. Rembold, et al., “Essential function no. 11, pp. 901–910, 2006. of histone deacetylase 1 in proliferation control and CDK [29] T. Stojanov and C. O’Neill, “In vitro fertilization causes inhibitor repression,” EMBO Journal, vol. 21, no. 11, pp. 2672– epigenetic modifications to the onset of gene expression from 2681, 2002. the zygotic genome in mice,” Biology of Reproduction, vol. 64, [46] J.-M. Kim, H. Liu, M. Tazaki, M. Nagata, and F. Aoki, no. 2, pp. 696–705, 2001. “Changes in histone acetylation during mouse oocyte meio- [30] T. Fair, M. Murphy, D. Rizos, et al., “Analysis of differential sis,” Journal of Cell Biology, vol. 162, no. 1, pp. 37–46, 2003. maternal mRNA expression in developmentally competent [47] S.-I. Kageyama, H. Liu, N. Kaneko, M. Ooga, M. Nagata, and and incompetent bovine two-cell embryos,” Molecular Repro- F. Aoki, “Alterations in epigenetic modifications during oocyte duction and Development, vol. 67, no. 2, pp. 136–144, 2004. growth in mice,” Reproduction, vol. 133, no. 1, pp. 85–94, 2007. [31] T. Ducibella, S. Kurasawa, S. Rangarajan, G. S. Kopf, and R. [48] C. L. Peterson and M. A. Laniel, “Histones and histone M. Schultz, “Precocious loss of cortical granules during mouse modifications,” Current Biology, vol. 14, no. 14, pp. 546–551, oocyte meiotic maturation and correlation with an egg- 2004. induced modification of the zona pellucida,” Developmental [49] W. M. Buckett, R.-C. Chian, H. Holzer, N. Dean, R. Usher, and Biology, vol. 137, no. 1, pp. 46–55, 1990. S. L. Tan, “Obstetric outcomes and congenital abnormalities [32] Y. Nagao, R. Iijima, and K. Saeki, “Interaction between after in vitro maturation, in vitro fertilization, and intracyto- embryos and culture conditions during in vitro development plasmic sperm injection,” Obstetrics and Gynecology, vol. 110, of bovine early embryos,” Zygote, vol. 16, no. 2, pp. 127–133, no. 4, pp. 885–891, 2007. 2008. [33] K. Yoshioka, C. Suzuki, and A. Onishi, “Defined system for in vitro production of porcine embryos using a single basic medium,” Journal of Reproduction and Development, vol. 54, no. 3, pp. 208–213, 2008. [34]W.Xu,D.G.Edmondson,andS.Y.Roth,“Mammalian GCN5 and P/CAF acetyltransferases have homologous amino- terminal domains important for recognition of nucleosomal substrates,” Molecular and Cellular Biology, vol. 18, no. 10, pp. 5659–5669, 1998. [35] B. Bowerman, “Embryonic polarity: protein stability in asym- metric cell division,” Current Biology, vol. 10, no. 17, pp. 637– 641, 2000. [36] S. Y. Roth, J. M. Denu, and C. D. Allis, “Histone acetyltransferases,” Annual Review of Biochemistry, vol. 70, pp. 81–120, 2001. Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 498574, 5 pages doi:10.1155/2010/498574

Clinical Study Imprinting and Promoter Usage of Insulin-Like Growth Factor II in Twin Discordant Placenta

Yan-Min Luo, 1 Qun Fang,1 Hui-Juan Shi,2 Lin-Huan Huang,1 Run-Cai Liang,3 and Guang-Lun Zhuang3

1 Fetal Medicine Center, Department of Obstetrics and Gynecology, First Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong 510080, China 2 Department of Pathology, First Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong 510080, China 3 Department of Obstetrics and Gynecology, First Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong 510080, China

Correspondence should be addressed to Qun Fang, fang [email protected]

Received 9 October 2009; Accepted 12 May 2010

Academic Editor: Shi-Wen Jiang

Copyright © 2010 Yan-Min Luo et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Case reports from infant twins suggest that abnormal genomic imprinting may be one of the important causes of twin discordance, but it is unknown whether abnormal genomic imprinting occurs in the placenta. Therefore, we sought to determine the relationship between the imprinting of insulin-like growth factor II (IGF-II) in placenta and twin discordance. We analyzed the imprinting and promoter usage of IGF-II in placenta of normal twins (T0 group), weight discordance (T1 group), and phenotype discordance (T2 group). We found the incidence of loss of imprinting (LOI) for IGF-II was higher in the T2 group than that in the T0 and T1 groups, while there was no difference between T0 and T1 groups. The transcripts of promoter 3 were lower in the T2 group than in the T0 and T1 groups, and lower in the twin placenta with LOI than in those with normal imprinting. Our findings indicate that the promoter 3 specific LOI of the IGF-II gene may be closely related with phenotype discordance, not weight discordance.

1. Introduction parental origin. Loss of imprinting (LOI) is an epigenetic alteration associated with the expression of the normally Twin discordance is a complication that is unique to multiple repressed parental allele or silence of the normally active gestations. It is defined as discordance in the growth pattern, allele. Imprinted genes play a key role in fetal and placental genotype, and phenotype of the twins. It can also just refer growth, development of particular lineages, and behaviour to a birth weight discordance of more than 20% between [5, 6]. It has been reported that an abnormal adjustment the twins [1]. Perinatal outcomes are worse in discordant of genomic imprinting may result in congenital anomalies, twins than in concordant twins. Discordant twins have been some genetic diseases, and tumours [7, 8]. found to have a significant increase in perinatal death, congenital anomalies, severe intracranial haemorrhage, neu- Insulin-like growth factor II (IGF-II) is one of the crucial rological morbidity, neonatal asphyxia, and respiratory dis- imprinted genes related to fetal growth and placental devel- tress [2, 3]. It is important to study the causes of twin opment. It has 4 promoters and is expressed by the paternal discordance in order to find a treatment and improve the allele. The expression of IGF-II is very complex since its prognosis. imprinting is periodic, as well as tissue and promoter specific. Abnormal genomic imprinting may be one of the impor- Placental IGF-II can control fetal growth by modulating tant causes that results in twin discordance [4]. Genomic placental development and nutritional transfusion [9]. The imprinting is a special phenomenon that operates outside LOI of the IGF-II gene is associated with fetal anomalies, of Mendel’s law and directs the nonrandom monoallelic while mutations of the IGF-II gene promoter result in fetal expression of specific autosomal genes according to their growth restriction [5]. 2 Obstetrics and Gynecology International

Table 1: Detail description of phenotype discordant in T2 group.

Twin A Twin B No. Chorion Abnormity PM∗ I∗∗ Abnormity PM∗ I∗∗ 1 MCMA Transposition of the great vessels, ventricular septal defect AB AB N AB AB 2 DCDA Mass on right back AB AB N AB B 3 DCDA Hydatidiform mole AB AB N AB A 4 DCDA Intrauterine death AB AB N AB B 5 DCDA Anencephaly, spinal bifida, omphalocele AB AB N BB 6 MCDA Thoracogastroschisis, ventricular septal defect, aortic overriding AB AB N AB B 7 DCDA Fetal hydrops AB A N AA 8 DCDA Hypospadias AB A N AA 9 DCDA Abdominal-wall defect, spinal bifida AB A N BB 10 DCDA Double outlet right ventricle AB B N AB B 11 DCDA Omphalocele AA N AA 12 MCDA Acardiac twin AA N AA 13 MCDA Hypospadias AA N AA ∗AA, BB, and AB are three different gene polymorphisms; AA/BB reflects homozygosity, and AB reflects heterozygosity. ∗∗A, B, and AB are three different imprinting states; A/B is the normal imprinting expression, while AB reflects loss of imprinting. Abbreviations: Polymorphisim (PM), Imprinting (I), monochorionic monoamniotic twin (MCMA), dichorionic diamniotic twin (DCDA), monochorionic diamniotic twin (MCDA), and normal (N).

Few studies have examined the changes of IGF-II in twin and quantity of the extracted RNA was assessed using an pregnancies, and there are no reports dealing with IGF- Ultraviolet Bioanalyzer (Eppendorf, Hamburg, Germany). II imprinting and promoter regulation in twin placenta. Total RNA was treated with 10 Units of DNase I (Fermentas, It is uncertain whether IGF-II gene imprinting and pro- Vilnius, Lithuania) for 30 minutes at 37◦C to eliminate any moter regulation in the placenta are associated with twin genomic DNA residue. discordance. To clarify the role of imprinted IGF-II genes in the pathogenesis of twin discordance, the imprinting and 2.3. Identification of Genomic Polymorphisms. To assess the promoter usage of IGF-II were studied. heterozygosity of the IGF-II gene, Apa I polymorphism within exon 9 of IGF-II was screened. For PCR amplification 2. Materials and Methods of the IGF-II gene, the following primers were used: sense strand (P1F), 5CTTGGACTTTGAGTCAAATTGG-3,and 2.1. Placenta Collection. Human placentas were collected antisense strand (P1R), 5-CCTCCTTTGGTCTTACTGGG- after birth in the first Affiliated Hospital of Sun Yat-sen 3.Foreach50μlPCR,2μl gDNA, 5 μl10×PCR buffer, University (Guangzhou, China). Eighty sets of twins were and 0.5 U Taq DNA Polymerase (TaKaRa, Dalian, China), enrolled, including 55 sets (64.71%) of normal twins (T0 1 μl sense and antisense primer (10 pmol) and 1 μldNTPs group), 17 sets (20.00%) of twins with weight discordance (2.5 mM) were amplified using an initial denaturation step (T1 group), and 13 sets (15.29%) of twins with phenotype at 94◦C for 7 minutes, followed by 35 cycles of denaturation discordance (T2 group). Weight discordance was defined as at 94◦ C for 30 s, annealing at 60◦ C for 40 s with a 40 s a birth weight discordance of more than 20% between the extension, and a final extension at 72◦ Cfor9minutes. twins. Phenotype discordance was defined as being present Theamplificationresultedinagenefragmentof236bp when only one of the twins had a malformation or both twins whose allele had an ApaI restriction site at 173 bp. The had different abnormalities. Detailed description of T2 group PCR products were digested with the restriction enzyme was listed in Table 1. ApaI (New England Biolabs, Ipswich, UK) and loaded onto For each twin, tissue samples were collected from under 3% agarose gel, which was followed by ethidium bromide the umbilical cord even when the twins shared the same staining. placenta. The tissues were washed with a saline solution to remove maternal blood, then frozen in liquid nitrogen, and 2.4. Allele-Specific Expression of IGF-II Genes. Allele-specific − ◦ stored at 80 C until analysis. expression of the IGF-II genes was examined using reverse transcription-PCR (RT-PCR) followed by enzyme digestion 2.2. Preparation of Genomic DNA and RNA. Approximately as described above. cDNA was synthesized using about 1 μg 0.1 g of the frozen tissues was homogenized using Teflon RNA and reverse transcriptase reagents (RevertAid H Minus tissue grinders. Genomic DNA (gDNA) was extracted using First Strand cDNA Synthesis Kit, Fermentas, Vilnius, Lithua- phenol and chloroform. Total RNA isolation was performed nia) as suggested by the manufacturer. The resulting cDNA using TRI-reagent as suggested by the manufacturer (Molec- samples were heated at 70◦ C for 10 minutes to inactivate the ular Research Center Inc, Cincinnati, OH, USA). The quality reverse transcriptase, and then used for PCR amplification Obstetrics and Gynecology International 3

Table 2: Primers for promoter-speciﬁc expression of the IGF-II gene and internal control.

Name Sequence (5-3)Length P1 (F) AG TCC TGA GGT GAG CTG CTG 181 bp P2 (F) ACC GGG CAT TGC CCC CAG TC 277 bp P3 (F) ACA TTC GGC CCC CGC GAC TC 201 bp P4 (F) TCC TCC TCC TCC TGC CCC AG 118 bp P1-4(R) CAA TGC AGC ACG AGG CGA AG B-actin(F) GCG GGA AAT CGT GCG TGA CAT T 228 bp B-actin(R) GAT GGA GTT GAA GGT AGT TTG GTG

Table 3: Polymorphisms and imprinting of the IGF-II gene in placenta [n (%)].

Polymorphisim Imprinting Group n AA/BB∗ AB∗ n A/B∗∗ AB∗∗ T0 group 110 41 (37.3) 69 (62.7) 68 56 (82.4) 12 (17.6) T1 group 34 15 (44.1) 19 (55.9) 19 16 (84.2) 3 (15.8) T2 group 26 10 (38.5) 16 (61.5) 16 9 (56.2) 7 (43.8)# ∗AA, BB, and AB are three different gene polymorphisms; AA/BB reflects homozygosity, and AB reflects heterozygosity. ∗∗A, B, and AB are three different imprinting states; A/B is the normal imprinting expression, while AB reflects loss of imprinting. In the T0 group, the imprinting status could not be detected in one case with AB gene polymorphism.# The frequency of loss of imprinting of the IGF-II gene was statistically significantly different between the T0 group and the T2 group, P = .035. as described above. The primers used for RT-PCR of IGF- 1 2 3456 M II were P1F and P1R as described above. The PCR products were digested with ApaI (yielding either a 236 bp fragment 236 bp or a 173 and 63 bp fragment), electrophoresed through a 3% agarose gel, and visualized with ethidium bromide. 173 bp

2.5. Promoter-Specific Expressions of IGF-II. Promoter- (a) specific expressions of IGF-II were quantified using the 12 3 45M Absolute QPCR SYBR Green Mix plus ROX vial Kit (Abgene, Epsom, UK) and the OpticonTM 2 continuous fluorescence 236 bp detection system (MJ Research, Boston, MA, USA). The 173 bp primers used in real-time quantitative PCR (RT-PCR) for each promoter specific expression of IGF-II are listed in Table 2. The OpticonTM 2 was programmed as follows: (b) preincubation and denaturation of template cDNA for 15 minutes at 94◦ C; followed by 40 cycles of amplification: Figure 1: Polymorphisms and imprinting of the IGF-II gene 96◦ C for 15 s, 66◦ Cfor40s(P1)or69◦ Cfor20s(P2)or in the placenta. (a) polymorphisms of IGF-II: 1 had type AA 60◦ Cfor30s(P3)or63◦ C for 30 s (P4), and 72◦ Cfor40s homozygosity; 4 had type BB homozygosity; 2,3,5,6 had type AB (P1) or 20 s (P2) or 30 s (P3, P4). The melting curve analysis heterozygosity; and M, marker. (b) imprinting of IGF-II: 1, loss of ◦ ◦ ◦ imprinting AB; 2–4, normal imprinting A; 5, normal imprinting B; was performed at 65 Cto98 C, 0.2 C /read, 2 seconds hold. and M, marker.

2.6. Statistics. The statistical analysis was performed using 2 the χ test, Fisher’s exact test, Student’s t-test, and ANOVA, that in the T0 and T1 groups (17.6% and 15.8%, resp., P< as appropriate. A P value of less than .05 was considered .05) (Table 3). All LOI occurred in abnormal twins except in significant. one twin pair in which one twin was large for gestational age. There were 4 cases of twin-twin transfusion syndrome, 3. Results including 1 acardiac twin. Among these 4 cases, 3 sets were IGF-II homozygous, and 1 set, which was a Stage 3.1. Imprinting of IGF-II. For the imprinting study, DNA III case of twin-twin transfusion syndrome, was IGF-II specimens from the placenta were first analyzed for heterozy- heterozygous. Polyhydramnios occurred in the recipient twin gosity using IGF-II gene polymorphisms at ApaI. Then, RT- at 23 gestational weeks, and the maximal vertical amniotic PCR products were analyzed for LOI by biallelic expression fluid pocket was 16.5 cm. The donor twin, whose bladder of IGF-II ( Figure 1). The incidence of LOI of the IGF-II gene was not visible, was a “stuck twin”, and the reverse end- was 43.8% in the T2 group placenta, which was higher than diastolic velocity of the umbilical artery could be seen. 4 Obstetrics and Gynecology International

The woman decided to abort the pregnancy. After induction, It is reported that LOI of the IGF-II gene was relevant to the imprinting status was analyzed. The donor twin had malformation like macroglossia and exomphalos, but not normal imprinting expression, while the recipient twin had other malformation. The malformation cases in our data LOI. are diverse. It is not known whether fetal abnormalities are due to a direct effect of LOI of the IGF-II gene in the placenta, or whether LOI of the IGF-II gene in the placenta 3.2. Promoter Usage of IGF-II. The usage of IGF-II promoters reflects LOI of the IGF-II gene in other fetal tissue, even was similar in the T0, T1, and T2 groups. In each group, other gene imprinting. Further investigation of methylation among the 4 promoters, the transcripts of IGF-II gene of other related imprinting genes is warranted to delineate promoter 3 were the highest. The transcripts of IGF-II gene the possible mechanism of the diverse malformation. And promoter 3 in group T2 were significantly lower than in a larger series of phenotype discordant twins should be the T0 and T1 groups (P<.05). The transcripts of IGF- followed up, in which each type of specific malformation is II gene promoter 3 were lower in twin placenta with LOI represented by more cases. than in those with normal imprinting (P<.05). Intrapair During the life cycle of the organism, genomic imprints transcriptions of the 4 IGF-II gene promoters did not differ change in characteristic ways. They undergo erasure, estab- among the T0, T1, and T2 groups (P>.05). There was a lishment, and maintenance of methylation imprints at positive correlation between the transcription of IGF-II gene imprinting centers during germ cell and embryonic devel- promoter 3 and the transcription of IGF-II gene promoter 4 opment. Imprint patterns are maintained as chromosomes (r = 0.229, P<.05); there were no correlations with other duplicate and segregate, although there is genome-wide promoters (P>.05). demethylation after fertilization and a wave of de novo methylation after implantation. Any changes in the microen- 4. Discussion vironment around the implantation could interfere with the mechanism of maintenance, so twins might be more sensitive The paternally expressed, imprinted gene, IGF-II, located on to get LOI with the epigenetic risks related to assisted chromosome 11 p15.5, encodes an autocrine growth factor reproductive technologies and monochorionic twins. As that plays an important role in embryonic growth. LOI of the the changes occur around the implantation, imprints may IGF-II gene results in generalized constitutional overgrowth, sometimes be discordant in twins, even in monozygotic malformation, and a predisposition to the development twins. of specific embryonal tumours, most commonly Wilm’s In our data, among 4 cases of twin-twin transfusion tumour. Our data shows that the incidence of LOI of the IGF- syndrome, 3 sets were homozygous for IGF-II, and 1 set II gene was higher in T2 than in T0 and T1 group placenta, was heterozygous (the donor twin had normal imprinting and that all LOI occurred in abnormal twins, except in one expression, while the recipient twin had LOI). There have case. The incidence of LOI of the IGF-II gene was similar been no reports dealing with the relationship between twin- in the T0 and T1 groups. Ravenel et al. [10], observed that twin transfusion syndrome and LOI. Bajoria et al. [11], there was virtually complete segregation of the intralobar found that fetal IGF-II levels in recipient twins with TTTS nephrogenic rest (ILNR)-like and perilobar nephrogenic rest were higher than those in donor twins. It was also reported (PLNR)-like tumours, depending on the imprinting status; 9 that IGFs may be involved in endothelial dysfunction [12]. (90%)of10PLNR-liketumourshadLOI,butonly1(6.7%) Thus, more research is needed to determine whether LOI of of 15 ILNR-like tumours had LOI, although the ILNR- the IGF-II gene induced the abnormality of the vessels in the like and PLNR-like tumours were both Wilm’s tumours. twin placenta that leads to twin-twin transfusion syndrome Thus, it is possible that the pathology involved in phenotype or was just related to the complications, such as twin-twin discordant twins and weight discordant twins is different, transfusion syndrome with abnormal vessels. and that LOI of the IGF-II gene may be closely related IGF-II is transcribed from four distinct promoters, P1– with phenotype discordant twins, as in PLNR-like tumours. P4. It has been found that the fetal liver uses only three Among the weight discordant twins, most of the small promoters (P2, P3, and P4) for IGF-II transcription, with fetuses were selective fetal growth restriction and the larger the P3 promoter having the highest activity [13, 14]. Late ones were appropriate for gestational age, not overgrowth. placental tissues of twin pregnancies show similar use of the Furthermore, LOI of the IGF-II gene is much more relevant IGF-II promoter as in fetal liver. The P3 transcript levels to classical cases of Beckwith-Wiedemann syndrome (BWS) were higher than those of P4, while the P2 and P1 transcript or Silver-Russell syndrome (SRS) than to sporadic growth levels were low or zero. Compared to normal twins, the P3 deficiencies or overgrowth. These might be the possible transcript levels in the T2 group were dramatically lower. reason why LOI of the IGF-II gene in placentae is not a major This suggests that P3 plays the most important role in the contributor to weight discordance. placenta, and that its abnormal activity may affect fetal Placental IGF-II regulates the growth and transport growth. capacity of the placenta, thereby controlling the supply of Usually, P1 has biallelic expression, and P2-4 have nutrients. It may also directly regulate the growth rate of fetal paternally monoallelic expression [15, 16]. It has been tissues, thereby controlling fetal nutrient demand. LOI of the proposed that IGF-II expression through promoter P1 could IGF-II gene in the placenta might alter the balance between explain the biallelic expression patterns in some neoplasms placental and fetal growth and lead to fetal abnormalities. [17, 18]. In these neoplasms, P1 plays the most important Obstetrics and Gynecology International 5 role, and most transcripts are from P1 rather than P2-4. [10] J. D. Ravenel, K. W. Broman, E. J. Perlman et al., “Loss of However, we found that, when there was LOI of the IGF-II imprinting of insulin-like growth factor-II (IGF2) gene in gene in twin placenta, the activity of P3, not P1, was greatly distinguishing specific biologic subtypes of Wilms tumor,” changed. This suggests that methylation changes of P3 induce Journal of the National Cancer Institute, vol. 93, no. 22, pp. biallelic expression and decrease P3 activity. The mechanism 1698–1703, 2001. of LOI of the IGF-II gene in phenotype discordant twins may [11]R.Bajoria,M.J.Gibson,S.Ward,S.R.Sooranna,J.P.Neilson, be different from that in some neoplasms. For phenotype and M. Westwood, “Placental regulation of insulin-like growth factor axis in monochorionic twins with chronic twin-twin discordant twins, it was the biallelic expression of P3 and not transfusion syndrome,” Journal of Clinical Endocrinology and P1 that caused the discordance. Metabolism, vol. 86, no. 7, pp. 3150–3156, 2001. In conclusion, our data suggests that the promoter 3 [12] F. Miceli, A. Tropea, F. Minici et al., “Effects of insulin-like specific LOI of the IGF-II gene may be closely related with growth factor I and II on prostaglandin synthesis and plas- phenotype discordance, not weight discordance. Further minogen activator activity in human umbilical vein endothe- investigation of methylation of other related imprinting lial cells,” Journal of Clinical Endocrinology and Metabolism, genes and more phenotype discordant twins was warranted vol. 90, no. 1, pp. 372–378, 2005. to delineate the possible mechanism of the diverse malfor- [13] X. Li, H. Cui, B. Sandstedt, H. Nordlinder, E. Larsson, and T. J. mation. Following up the weight discordance twins with LOI Ekstrom,¨ “Expression levels of the insulin-like growth factor- will find out whether they are predisposed to embryonal II gene (IGF2) in the human liver: developmental relationships tumours. of the four promoters,” Journal of Endocrinology, vol. 149, no. 1, pp. 117–124, 1996. [14] X. Li, Z. Nong, C. Ekstrom¨ et al., “Disrupted IGF2 promoter Acknowledgments control by silencing of promoter P1 in human hepatocellular carcinoma,” Cancer Research, vol. 57, no. 10, pp. 2048–2054, This work was supported by the Natural Science Foundation 1997. of Guangdong Province (Project. no. 4009370) and Project [15] T. H. Vu and A. R. Hoffman, “Promoter-specific imprinting of Science and Technology of Guangdong Province (Project. of the human insulin-like growth factor-II gene,” Nature, vol. no. 2008B080701022). 371, no. 6499, pp. 714–717, 1994. [16] T. J. Ekstrom, H. Cui, X. Li, and R. Ohlsson, “Promoter- specific IGF2 imprinting status and its plasticity during References human liver development,” Development, vol. 121, no. 2, pp. 309–316, 1995. [1] A. C. Fleischer, F. A. Manning, P. Jeanty, et al., Sonography in [17] C.-L. Chen, S.-M. Ip, D. Cheng, L.-C. Wong, and H. Y. S. Ngan, Obstetrics and Gynecology, Principles & Practice, McGraw-Hill, “Loss of imprinting of the IGF-II and H19 genes in epithelial New York, NY, USA, 6th edition, 2001. ovarian cancer,” Clinical Cancer Research, vol. 6, no. 2, pp. 474– [2]V.Y.T.Cheung,A.D.Bocking,andO.P.Dasilva,“Preterm 479, 2000. ff discordant twins: what birth weight di erence is significant?” [18] S. J. Kim, S. E. Park, C. Lee et al., “Alterations in promoter American Journal of Obstetrics and Gynecology, vol. 172, no. 3, usage and expression levels of insulin-like growth factor-II and pp. 955–959, 1995. H19 genes in cervical carcinoma exhibiting biallelic expression ¨ [3]H.R.Yalçin, C. G. Zorlu, A. Lembet, S. Ozden, and O. of IGF-II,” Biochimica et Biophysica Acta, vol. 1586, no. 3, pp. ff Gokmen,¨ “The significance of birth weight di erence in 307–315, 2002. discordant twins: a level to standardize?” Acta Obstetricia et Gynecologica Scandinavica, vol. 77, no. 1, pp. 28–31, 1998. [4] R. Weksberg, C. Shuman, O. Caluseriu et al., “Discordant KCNQ1OT1 imprinting in sets of monozygotic twins discordant for Beckwith-Wiedemann syndrome,” Human Molecular Genetics, vol. 11, no. 11, pp. 1317–1325, 2002. [5] M. Constancia,ˆ M. Hemberger, J. Hughes et al., “Placental- specific IGF-II is a major modulator of placental and fetal growth,” Nature, vol. 417, no. 6892, pp. 945–948, 2002. [6] S. L. Thompson, G. Konfortova, R. I. Gregory, W. Reik, W. Dean, and R. Feil, “Environmental effects on genomic imprinting in mammals,” Toxicology Letters, vol. 120, no. 1–3, pp. 143–150, 2001. [7] J. C. Williams, K. W. Brown, M. G. Mott, and N. J. Maitland, “Maternal allele loss in Wilms’ tumour,” Lancet, vol. 1, no. 8632, pp. 283–284, 1989. [8] A. Murrell, S. Heeson, W. N. Cooper et al., “An association between variants in the IGF2 gene and Beckwith-Wiedemann syndrome: interaction between genotype and epigenotype,” Human Molecular Genetics, vol. 13, no. 2, pp. 247–255, 2004. [9] A. L. Fowden, “The insulin-like growth factors and feto- placental growth,” Placenta, vol. 24, no. 8-9, pp. 803–812, 2003. Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 302051, 14 pages doi:10.1155/2010/302051

Review Article Oxidative Stress and DNA Methylation in Prostate Cancer

Krishna Vanaja Donkena, Charles Y. F. Young, and Donald J. Tindall

Departments of Biochemistry/Molecular Biology and Urology, Guggenheim 501B, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN 55905, USA

Correspondence should be addressed to Krishna Vanaja Donkena, [email protected]

Received 2 October 2009; Accepted 12 May 2010

Academic Editor: Shi-Wen Jiang

Copyright © 2010 Krishna Vanaja Donkena et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

The protective effects of fruits, vegetables, and other foods on prostate cancer may be due to their antioxidant properties. An imbalance in the oxidative stress/antioxidant status is observed in prostate cancer patients. Genome oxidative damage in prostate cancer patients is associated with higher lipid peroxidation and lower antioxidant levels. Oxygen radicals are associated with different steps of carcinogenesis, including structural DNA damage, epigenetic changes, and protein and lipid alterations. Epigenetics affects genetic regulation, cellular differentiation, embryology, aging, cancer, and other diseases. DNA methylation is perhaps the most extensively studied epigenetic modification, which plays an important role in the regulation of gene expression and chromatin architecture, in association with histone modification and other chromatin-associated proteins. This review will provide a broad overview of the interplay of oxidative stress and DNA methylation, DNA methylation changes in regulation of gene expression, lifestyle changes for prostate cancer prevention, DNA methylation as biomarkers for prostate cancer, methods for detection of methylation, and clinical application of DNA methylation inhibitors for epigenetic therapy.

1. Introduction curcumin, Epigallocatechin-3-gallate (EGCG) and genistein have demethylation activity [5–7]. Epidemiological studies When diet is wrong medicine is of no use. have indicated a link between a low occurrence of prostate When diet is correct medicine is of no need. cancer and diets rich in these compounds [7–9]. Ayurvedic Proverb “Oxidative stress” is the state of a cell, which is characterized by excess production of reactive oxygen species [In Sanskrit, the word Ayurveda consists of the words Ayur, (ROS) and/or a reduction in antioxidant defenses respon- meaning “life”, and veda, meaning related to knowledge’ or sible for metabolism. ROS are formed as a natural by- “science”]. product of the normal metabolism of oxygen. Under normal Prostate cancer is the most commonly diagnosed cancer circumstances, the cell is able to maintain an adequate and a second leading cause of cancer death in men in homeostasis between the formation of ROS and its removal the United States, with the vast majority of the mortality through enzymatic pathways or via antioxidants [10]. If, arising from the castration-resistant and/or metastatic forms however, this balance is disturbed, then oxidative stress of the disease [1]. Obesity and inadequate eating habits may occurs. This generates an imbalance of production/removal promote prostate cancer development [2]. A healthy weight of ROS, which is either directly or indirectly involved in and a diet low in total fat, saturated, monounsaturated, initiation, promotion, and progression phases of carcinogen- and polyunsaturated fat and rich in omega-3 fatty acids, esis [11]. Oxygen radicals may cause damage to DNA and vitamin C, vitamin E, lycopene, alpha-tocopherol, selenium, chromosomes, induce epigenetic alterations, interact with beta carotene, and quercetin are inversely associated with oncogenes or tumor suppressor genes, and impart changes prostate cancer risk [3, 4]. The beneficial effects of these in immunological mechanisms [12, 13]. The extent of ROS- nutrients in prevention of prostate cancer may be related induced oxidative damage can be exacerbated by a decreased to antioxidant levels. Among chemicals present in food, efficiency of antioxidant defense mechanisms. Endogenous 2 Obstetrics and Gynecology International

Oxidative stress ROS

ABCD Antioxidant enzymes and/or antioxidants

CH3 CH3 CH3 CH3 CH3 CH3 CpG CpG CpG CpG CpG CpG CpG CpG CpG CpG CpGCpG CpG

DNMT ROS ROS MBPs HDAC GSTP1 ROS ROS

CH3 CH3 CH3 CH3 OXO OXO OXO CH2OH CH2OH CH2OH CpG CpG CpG CpG CpG CpG CpG CpG CpG CpG CpG CpG CpG Base modiﬁcation DNMT ROS CH3 MBPs HDAC GSTP1 MBPs MBPs CpG CpG CpG Deletion

CH3 CH3 CH3 CH3 OXO OXO OXO CH2OH CH2OH CH2OH CpG CpG CpG CpG CpG CpG CpG CpG CpG CpG CpG CpG Chromosomal breakage Hypermethylation Hypomethylation Hypomethylation

DNMT

Hypomethylation DNA damage Genomic instability Genomic instability cellular deregulation

Stability Plasticity Genomic instability

Figure 1: Effect of oxidative stress on DNA methylation. Antioxidant enzymes, for example, GSTP1 or antioxidants scavenge the ROS in normal cells. (A) depicts hypomethylation of DNA by ROS. , ,and represent DNA base modification, DNA deletion, and chromosomal breakage, respectively, all of which interfere DNMT activity. (B) Under increased ROS concentrations; the MBPs, HDAC and DNMT complex methylate the CpG sites resulting in reduced GSTP1 expression. Further increase in ROS results in complete loss of GSTP1 ( )by hypermethylation. (C) and (D) represent ROS-mediated oxidation of guanine to 8-Oxy guanine and cytosine to hydroxymethyl cytosine, respectively. Both modifications interfere with MBP-mediated methylation (details are given in the text). defenses against ROS include antioxidant enzymes such as increased DNA damage and chromosomal degradation with glutathione-s-transferase P1 (GSTP1), glutathione peroxi- alterations of both hypermethylation and hypomethylation dase, catalase, and superoxide dismutase [14]. Many factors of the DNA [21]. Chronic increase of ROS in the cells can also such as diet, environmental carcinogens, aging, and other result in lipid peroxidation and generation of a wide range of inflammatory diseases associated with aberrant changes in other reactive products with the potential to damage DNA ROS may play important roles in the development and [22]. Antioxidant enzymes and/or antioxidants scavenge the progression of prostate cancer [15–17]. Regulating such ROS produced in the cells. An increased vulnerability to factors may offer an effective means for preventing or treating genome-damaging stresses from electrophiles and oxidants, prostate cancer. attributable to lack of GSTP1, may be the critical feature per- mitting prostate carcinogenesis. Inactivation of GSTP1 may leave cells vulnerable to oxidative damage and/or tolerant 2. Oxidative Stress and DNA Methylation to accumulation of oxidized DNA base adducts. Hyperme- thylation of the GSTP1 promoter with reduced expression Oxidative stress either by metabolic, dietary, environmental, levels is detected in precursor high-grade intraepithelial or other means leads to increased production of ROS. neoplasia (HG-PIN) [23]. Absence of GSTP1 expression with Generation of the hydroxyl radical can cause a wide range of promoter hypermethylation is evident in prostate cancer DNA lesions including base modifications, deletions, strand (Figure 1(B)) [24, 25]. In CpG dinucleotides, the cytosine is breakage, and chromosomal rearrangements [18, 19]. Such the preferred base for DNA methylation, whereas the guanine DNA lesions have been shown to interfere with the ability is the site for oxidative damage. The guanine oxidative of DNA to function as a substrate for the DNA methyl product, 8-oxoguanine (8-oxoG), is a major form of DNA transferases (DNMTs), resulting in global hypomethylation damage [26–28].Thus,itiswidelyusedasabiomarkerof (Figure 1(A)) [20]. ROS production is associated with oxidative damage [29]. The N7 position of guanine acts as Obstetrics and Gynecology International 3 a hydrogen bond acceptor in the formation of the methyl DNA methylation abnormalities, either gain of methyla- binding protein (MBP)-DNA complex. The oxidation of tion in normally unmethylated promoters or other regula- guanine to 8-oxoG converts the N7 position of guanine from tory regions (hypermethylation), contribute to tumorigen- a hydrogen bond acceptor into a hydrogen bond donor, esis by decreasing activity of tumor suppressor genes. Loss as well as replaces the 8-proton with an oxygen atom. of methylation in normally methylated repetitive sequences Replacement of guanine to 8-oxoG substantially diminishes (hypomethylation) that leads to activation of protoonco- MBP binding when 8-oxoG is adjacent to the 5-methyl- genes and genomic instability is evident in almost all human cytosine (Figure 1(C)) [30–33]. In addition, the methyl tumor types [42, 47, 48]. DNA methylation is the best- group of 5-methyl-cytosine is susceptible to oxidation and established epigenetic mark that is critical for the allele- can generate 5-hydroxymethyl cytosine [34]. Methyl group of specific expression of imprinted genes [49]. Hypomethyla- 5-methyl cytosine is important for sequence-specific DNA- tion of specific chromosomal domains has been linked to protein interactions [31, 35]. Replacement of 5-methyl- chromosomal instability [50]. Chromosomal abnormalities cytosine to hydroxymethyl cytosine reverses the binding associated with hypomethylation include isochromosomes, affinity to MBPs, interfering with subsequent steps in the unbalanced juxtacentromeric translocations, and whole-arm chromatin condensation cascade, resulting in potentially deletions. DNA hypomethylation of repetitive elements, heritable epigenetic alterations (Figure 1(D)). retrotransposons, and CpG poor promoter regions plays an important role in tumorigenesis [51]. Hypomethylation of repetitive sequences and retrotransposons is associated with 3. Regulation of Gene Expression by chromosomal rearrangements and translocation to other DNA Methylation genomic regions, thereby promoting genomic instability [44, 52, 53]. In mammalian cells, most of the chromatin exists in a condensed, transcriptionally silent form called heterochromatin. Euchromatin is less condensed, and contains most 4. Lifestyle Changes and Prostate Cancer of the actively transcribed genes. Histones and DNA are The doctor of the future will give no medication, but will chemically modified with epigenetic markers that influence interest his patients in the care of the human frame, diet and chromatin structure by altering the electrostatic nature of in the cause and prevention of disease. ∼Thomas Edison. the chromatin or by altering the affinity of chromatin- binding proteins. DNA methylation is usually associated with histone deacetylation, chromatin condensation, and gene 4.1. Dietary Factors. Epigenetic changes can be modulated by silencing [36–38]. DNA methylation leads to gene silencing molecules that are part of our daily diet. Caloric restriction either by inhibiting the access of target binding sites to the is associated with myriad changes, including an increased life transcriptional activators [39] or by promoting the binding span, at least in animal models, and potentially delays a wide of methyl-binding domain proteins, which can mediate range of diseases including cancer [54]. Increasing evidence repression through interaction with histone deacetylases from epidemiology and laboratory studies suggests that diet (HDACs) [40, 41] that promote chromatin condensation and lifestyle may have a role in the development of prostate into transcriptionally repressive conformations. cancer [55–57]. In a recent Prostate Cancer Lifestyle Trial DNA methylation involves the addition of a methyl (PCLT) [58], 93 men with early prostate cancer (who had group to the fifth carbon position of the cytosine pyrimidine opted for active surveillance before the study) were randomly ring via a methyltransferase. This covalent modification of assigned to either a 1-year intensive lifestyle change program multiple sites on DNA by methylation is a heritable and or to a usual care control group [55–60]. The intensive reversible epigenetic process, which is involved in regulation lifestyle program included a vegan diet (supplemented of a diverse range of biological processes [42–44]. The de with soy, fish oil, vitamin E, selenium, and vitamin C), novo methyltransferases DNMT3A and DNMT3B methylate moderate aerobic exercise (walking 30 minutes 6 days the genome during embryonic development, whereas the weekly), stress management techniques (gentle yoga-based maintenance DNA methyltransferase DNMT1 methylates stretching, breathing, meditation, imagery, and progressive hemimethylated DNA following DNA replication. The pre- relaxation for a total of 60 minutes daily), and participation ponderance of DNA methylation occurs at 5 ...CpG...3 in a 1-hour weekly support group to enhance adherence to dinucleotides, but other methylation patterns do exist. In the intervention [57]. The diet was predominantly fruits, fact, 80 percent of all 5 ...CpG...3 dinucleotides are vegetables, whole grains (complex carbohydrates), legumes, methylated, whereas the majority of the 20% that remain and soy products, was low in simple carbohydrates, and nonmethylated are within promoters or in the first exons included approximately 10% of calories from fat [61]. This of genes [45]. CpG dinucleotides are relatively infrequent study found that the patients in the experimental group in the human genome, except in CpG islands, which had a significant reduction in PSA levels and had fewer are (0.2 to 2 kb) regions highly enriched in CpGs [46]. prostate cancer-related clinical events compared with the Approximately 50% to 60% of gene promoters lie within controls at the end of the 1-year program. Also, after 1 CpG islands. CpG methylation outside of CpG islands is year, the growth of prostate cancer cell line, LNCaP cells thought to suppress transcription of transposable elements was inhibited almost 8 times more by serum from the and spurious initiation of transcription elsewhere. experimental than from the control group (70% versus 9%) 4 Obstetrics and Gynecology International

[55]. Furthermore, the experimental patients had greater CD44, ESR, and CDH1 genes is associated with prostate improvements in cardiovascular health parameters than did cancer. A 1.7-fold higher frequency of CD44 methylation control patients, as shown by lowered total and low-density was observed among African Americans (43%) relative lipoprotein and cholesterol levels, which might translate into to Caucasians (25%) [69]. Cigarette smoke is potentially a reduction in cardiac events over the long term. This is capable of generating a high load of free radicals in the especially important because, in general, men with prostate body. The effect of dietary and environmental risk factors cancer are more likely to die of cardiovascular disease than of on prostate cancer was evaluated in a recent NIH-AARP prostate cancer [62].Thepreventiveeffects of this trial may Diet and Health study. The data confirmed a number of beduetothereductionofstresslevelsandtheprotective observational studies linking smoking to prostate cancer effects of antioxidants from the vegetables and fruits. Many mortality [70]. Interestingly, current (but not former) smok- men are making changes in diet and lifestyle in the hope ers had a higher mortality from prostate cancer, suggesting of preventing or slowing the progression of prostate cancer that smoking cessation could lead to improved survival. [57]. A significant correlation of methylation status of multiple The anticancer properties attributed to several bioactive genes with smoking status in prostate cancer has been food components, encompassing both essential nutrients observed [71]. Epigenetic alterations are also attractive and nonessential components, may relate to DNA methy- targets of environmental carcinogenesis. Nickel and arsenic lation patterns [63]. Global DNA methylation alterations metals, butyrate: a short chain fatty acid, Phenobarbital: in prostate cancer are correlated with adaptive changes the tumor promoting agent, nicotine-derived nitrosamine in several signaling pathways that may be influenced by ketone (NNK): a tobacco-specific carcinogen and methylene lifestyle changes. Dietary factors may influence the sup- chloride: an occupational carcinogen, methionine and cyti- ply of methyl groups available for the formation of S- dine analogs are some of the agents known to alter cytosine adenosylmethionine (SAM), a coenzyme involved in methyl methylation patterns of the promoter tumor suppressor group transfer. Moreover, dietary factors may modify the genes and oncogenes [72–77]. utilization of methyl groups by processes including shifts in DNMT1 activities. Finally, DNA methylation patterns may influence the response to a bioactive food component. 4.3. Aging. The concept that environment might change your Several lines of evidence suggest that DNA hypomethylation hereditary without changing a gene sequence is the front lines and chromosome instability may result from insufficient of Epigenetics. As life is changing all the time, the epigenetic dietary folate. Folate provides carbon units for a number code that controls the DNA is turning out to be the mechanism of biochemical processes, including production of SAM, through which we change along with it. a universal methyl donor that also supplies the methyl Prostate cancer is mostly a disease of elderly men. group on cytosines in DNA. The effect of reduced dietary The progressive inherent or acquired changes in cellular folate on hypomethylation is observed in dietary studies in metabolism occurring with aging may play an important humans, and the hypomethylation is reversible by controlled role in the development of this disease. ROS generated either folate repletion [64]. SAM is required for the biosynthesis endogenously (mitochondria, metabolic process, inflamma- of the polyamines spermidine and spermine, which are tion, etc.) or from external sources, due to decreases in produced by normal prostate secretory cells. One of the intracellular ROS scavenging system plays a vital role in possible explanations for a limitation in SAM is the increased regulating several biological phenomena [78, 79]. There is requirement for folate biosynthesis in proliferating cancer a growing evidence that the epigenetics of an individual cells. Insufficient concentrations of SAM for DNA methy- changes with aging, especially the accumulation of DNA lation in cancers may be caused by an insufficient supply methylation and histone deacetylation [69, 80–82]. Aging of of metabolic precursors, for example, methionine, folate, the immune system, or immunosenescence, is characterized vitamin B12, zinc and choline, or increased demands from by a decline of both T and B cell function, and paradoxically various other methylation reactions [65–67]. Methionine the presence of low-grade inflammation. Androgen receptor deprivation stress induces apoptosis, which is mediated (AR) is up-regulated in an age-associated manner in man by downregulation of TP53 and increased production of and promotes continued proliferation and differentiation of TRAIL and proinflammatory cytokines [68]. Imbalances of the prostate [83]. Normal androgen levels can promote the nutrients and other bioactive food components have been production and accumulation of ROS in prostate cancer shown to lead to global DNA hypomethylation, and gene- cells. Androgen-induced increase in ROS levels in prostate specific hypomethylation and/or hypermethylation. epithelial cells plays a key role in prostate cancer occurrence, recurrence, and progression [84]. The involvement of oxidative stress as an early event in prostate cancer development 4.2. Risk Factors. A few well-established risk factors for was suggested by Miyake et al. [85] who showed that andro- prostate cancer incidence include increasing age, race, eth- gen suppression is capable of decreasing oxidative stress. nicity, and a positive family history. Higher ROS-mediated In addition, overproduction of H2O2 plays a major role oxidative stress was detected more in the epithelium of in androgen-independent cell proliferation and migration prostate cancer patients than men without the disease [12]. of LNCaP cells [86]. However, metastatic human prostate The association of ROS with race remains to be elucidated. cancers from anorchid men express transcripts encoding Aracialdifference in the methylation status of the GSTP1, androgen-synthesizing enzymes and sustain intratumoural Obstetrics and Gynecology International 5 androgens at concentrations capable of activating AR target progresses [102–104]. Aberrant DNA methylation of CpG genes and maintaining tumor cell survival [87]. sites in cancer cells may be used to detect cancer cells in Epigenetic mechanisms linking aging to cancer include biopsy samples or cancer-derived DNA in plasma. When hypermethylation of the promoter of tumor suppressor imbalances in methylation contribute to tumor progression, genes such as RB1, p16 and Wnt-associated factors, aberrant methylation changes should increase in frequency and/or DNMT activity, loss of genomic imprinting, and chromoso- severity coordinately with increasing malignancy grades [24, mal translocations in hypomethylated DNA sequences [88, 105]. If methylation of CpG sites is associated with a disease 89]. Serum levels of Interleukin-6 (IL-6), which regulates phenotype, then it can be used as a marker to predict the promoter activity of DNMT1, increase with age [90]. phenotype, which may facilitate prognosis or prediction of Total genomic 5-methylcytosine decreases during aging and responses to therapy. is inversely proportional to the maximum life span potential Evidence for DNA methylation as an early event comes of an individual [91]. A longitudinal study of 718 elderly from studies of clinical samples, where DNA methylation individuals between 55 and 92 years of age demonstrated changes were detected in early preneoplastic lesions [106]. that repetitive element methylation, particularly in ALU Of all the genes known to be methylated in prostate cancer, sequences, decreases throughout aging [92]. It has been GSTP1 is the most frequently methylated gene. GSTP1 postulated that the reduction of DNMT1 activity with age is a detoxifying enzyme that helps to catalyze conjuga- contributes to the decrease in global DNA methylation tion reactions between potentially damaging oxidants, elec- [93]. Telomerase activity is linked to multiple developmental trophiles, and glutathione [107, 108]. Expression of GSTP1 processes, including cell proliferation, differentiation, aging, is diminished or absent in prostate cancer, and this absence and senescence. Telomere length and rate of telomere is tightly regulated by hypermethylation of the promoter shorting are indicators of mitotic cell age, because telomers CpG Island [24]. Although hypermethylation of GSTP1 shorten during normal cell divisions [94]. The aspect of is rarely detected in normal prostate or benign prostatic cellular aging that is conferred by diminished telomere hyperplasia (BPH), it is hypermethylated in >90% of cancers maintenance appears to be an important precursor to the and about 70% of precursor high grade intraepithelial development of many types of cancer. Shortened telomers neoplasia (PIN) lesions [109, 110]. Thus, GSTP1 methylation predict poor clinical outcomes, including increased risk has improved the standard histological diagnosis in sextant of metastasis and prostate-cancer recurrence in patients biopsies [111]. In addition, GSTP1 methylation is correlated undergoing radical prostatectomy [95]. Comprehensive with Gleason grade and prostate cancer volume, suggesting lifestyle changes significantly increase telomerase activity that quantitative GSTP1 methylation may be of prognostic and consequently increased telomere maintenance capacity significance [112]. GSTP1 methylation is evident in 90% in human immune-system cells [96]. Recent studies have of lymph nodes from prostate cancer patients but in only shown that tumor telomere length and integrity can be 11.1% of lymph nodes from noncancer patients, suggesting influenced by the epigenetic status of cancer cells [97]. that detection of GSTP1 could have a role in molecular Methylation status of subtelomeric DNA repeats negatively staging of prostate cancer [113]. The inactivation of GSTP1 correlates with telomere length and telomere recombination may leave cells vulnerable to oxidative DNA damage and/or in cancer cell lines. Treatment of human cancer cell lines tolerant to accumulation of oxidized DNA base adducts. with demethylating drugs results in hypomethylation of Taken together, these results suggest that prostatic cells subtelomeric repeats and increased telomere recombination, in proliferative inflammatory atrophy lesions, which are which in turn could facilitate telomere elongation [98]. exposed to inflammatory oxidants, induce GSTP1 expression as a defense against oxidative genomic damage. Cells with adefectiveGSTP1 gene may become vulnerable to oxidants 5. DNA Methylation for Early Detection and and electrophiles that can inflict genomic damage, which in Prediction of Metastatic Risk turn may promote transformation of PIN to prostate cancer [114]. In recent years, there has been an enormous effort to Analysis of multiple gene methylation patterns, as com- develop specific and sensitive biomarkers for precise and pared to that of a single gene, can improve the ability accurate screening, diagnosis, prognosis, and monitoring to distinguish cancerous from benign prostate tissues, and of high risk cancer. The cancer epigenome is characterized also improves correlations with pathological features such by global changes in DNA methylation and histone mod- as, stage, grade, and recurrence [115]. Hypermethylation ification patterns as well as altered expression profiles of of multiple genes (including GSTP1, RAR-2β,andAPC) chromatin modifying enzymes. Indeed, DNA methylation identified prostate cancer in histopathologically negative changes appear to be more frequent events than genetic biopsy samples collected from men who were later positively mutations [99, 100]. If aberrant methylation of CpG sites diagnosed during a follow-up biopsy procedure [116]. We in noncancer tissues is associated with a risk for cancer have shown that hypermethylation of RAR-2β, GSTP1, development, it may be used as a cancer risk marker. PDLIM4, and FLNC facilitates the diagnosis of prostate Aberrant DNA methylation may be among the earliest cancer with a sensitivity and specificity of 87.3% and changes to occur during oncogenesis [101]. Once epigenetic 87.1%, respectively [24, 82, 117]. Methylation of the RAR- modifications are established in premalignant tissues, the 2β promoter could discriminate between neoplastic and extent of modifications may accumulate as the disease nonneoplastic tissues with 94.9% sensitivity and 100% 6 Obstetrics and Gynecology International specificity [118]. Hypermethylation of a combination of [136]. There appears to be a causal relationship between genes including APC, RASSF1A, PTGS2, PDLIM4, and hypomethylation and chromosomal instability [137]. DNA MDR1 could distinguish cancer from benign prostate tissues hypomethylation occurs late in prostate cancer progression with sensitivities of 97.3%–100% and specificities of 92%– and is likely to be involved in the formation and progression 100% [24, 119]. The increase in methylation of these genes of metastases [135]. DNA hypomethylation is a significant with cancer progression indicates that they could be used source of tumor heterogeneity in metastatic prostate cancer for biomarkers for both diagnosis and risk assessment and may contribute to the development of therapeutic [120, 121]. Furthermore, we showed significant differences resistance [138, 139]. Gene-specific hypomethylation can in the frequency of methylation at individual CpG sites cause heterogeneous overexpression of a series of cancer- of PITX2, PDLIM4, KCNMA1, GSTP1, FLNC, EFS, and testis antigen genes (CTA), many of which are currently being ECRG4 in recurrent and nonrecurrent subtypes of prostate evaluated as targets of immunotherapy. Clinical trials have tumors [24]. Indeed, hypermethylation of a CpG island shown regression of tumors when patients are treated with in PITX2 portended an increased risk of prostate cancer immunotherapies targeted to these CTA antigens [140, 141]. recurrence [105] and was a predictor of distant disease Noninvasive and minimally invasive tests, particularly recurrence in tamoxifen-treated, node-negative breast cancer those that provide molecular signatures in blood samples, patients [122]. Moreover, specific CpG sites of FLNC and may enhance our ability to detect prostate cancer [142, 143]. EFS, genes involved in cell attachment, are associated with Cell-free circulating DNA in blood plasma exhibits cancer- systemic recurrence [24]. Remarkably, the combination of associated changes in DNA methylation, and thus represents methylation score with GPSM score improved the theoretical an attractive biomarker assay. Hypermethylation of GSTP1 prediction of recurrence. A GPSM score is a prognostic was found in 94% of tumors, 72% of plasma or serum model using the weighted sum of the pathological Gleason samples, 50% of ejaculate, and 36% of urine from patients score, preoperative PSA, seminal vesicle involvement, and with prostate cancer [144, 145]. Hypermethylation of GSTP1 marginal status to predict biochemical progression after CpG island sequences could be detected in prostatic secre- radical prostatectomy [82]. These data suggest that DNA tions collected from 96% of radical prostatectomy specimens methylation analysis could augment the ability of currently [146]. The abnormal DNA methylation patterns in these available predictors of prostate cancer progression. secretions may have come from prostate cancer cells, or from CpG island methylation may precede genetic instability PIN cells shed into prostate ducts. Methylated DNA in blood in cancer cells. The MLH1 and 14-3-3 sigma genes, both and urine may serve as a screen for prostate cancer and may important for genome integrity, are frequently silenced identify men at risk for developing aggressive disease. Indeed, by aberrant methylation [123]. MLH1 encodes a DNA a dual-assay based on both genetic and epigenetic alterations mismatch repair protein. MLH1 promoter methylation and in multiple microsatellite and methylation markers in circu- gene silencing are significantly correlated with microsatellite lating DNA from serum samples exhibited greater sensitivity instability [124, 125]. Experimental demethylation in tumor for prostate cancer detection than that of a single-marker cell lines results in reexpression of MLH1 and restoration of assay and was independent of PSA levels or the American a DNA mismatch repair proficient phenotype [126]. Hyper- Joint Cancer Committee (AJCC) stage [147]. Prognostic methylation of hMLH1 and p14/INK4a CpG islands is rare markers may help to identify those patients who will recur in primary cancers and more common in metastatic disease with cancer. Furthermore, accurate risk prediction may help [127, 128]. DNA methylation-induced silencing of genes may identify patients who would benefit from more aggressive be involved in the regulation of the self-renewal capacity of treatments immediately following primary therapy or select stem-precursor cells. For example, hypermethylation of p16 patients for active surveillance. and APC is commonly observed in the early stages of prostate cancer [129]. Also, other hypermethylated genes, including CDH1, CDKN2A, CD44, CAV1, HOXD3, and BMP7, have 6. Methods for Detection of DNA Methylation been demonstrated in prostate cancer [130–132]. Methyla- tion of CDH1 and CD44 is increased in advanced prostate Epigenome mapping is inherently complex, since the tumors, suggesting that they might be useful markers to epigenome varies with age, differs between tissues, is altered assess tumor progression [131]. Comparison of methylation by environmental factors, and shows aberrations in disease. patterns in low and high-grade cancers suggests that HOXD3, In an era of synthetic genomics and personalized medicine, BMP7, and EDNRB may play a role in the development mapping of the epigenome at different ages, in different of high-grade tumors [133]. Hypermethylation of APC and tissue types and disease states should shed light on novel RUNX3 was associated with increased risk of prostate cancer- biological functions and phenotypic differences of hetero- specific mortality [134]. geneous prostate cancer. The ability to detect and quantify In contrast to hypermethylation, hypomethylation of DNA methylation efficiently and accurately is important genomic 5meCytosine content in LINE1 elements and CpG for prostate cancer diagnosis. High resolution analysis of islands of gene promoters may lead to overexpression of individual CpG sites involves the chemical modification genes [135]. LINE1 elements are the largest class of repetitive of DNA by bisulfite treatment, where sodium bisulfite elements in the human genome. Hypomethylation of LINE1 deaminates cytosine into uracil, whereas methylated cytosine elements can lead to transcriptional activation, induction is resistant to this conversion. Measurement of methylation of retrotransposition, and facilitation of genetic instability levels involves bisulfite conversion, followed by real-time Obstetrics and Gynecology International 7

PCR [82, 148], base-specific cleavage and mass spectrometry targets for epigenetic therapy [160]. Some drugs that inhibit [24, 149], Pyrosequencing [150], combined with bisulfite DNA methyltransferases have been shown to reactivate restriction analysis (COBRA) [151] or methylation-sensitive silenced genes and induce differentiation or apoptosis of single nucleotide primer extension (Mu-SNuPE). The limi- malignant cells. tation of these methods is the cost and scalability. Two inhibitors of DNA methyltransferases, 5- To comprehensively characterize the molecular effects of azacytidine (Vidaza), and its derivative 5-aza-2- DNA methyltransferase inhibitors, high-resolution methods deoxycytidine (decitabine) have already been approved by need to be developed to analyze genome-wide methylation theFDAaseffective drugs for treatment of myelodysplastic patterns. These methods can also be used to develop and syndromes [161]. 5-Azacytidine is a nucleoside inhibitor refine epigenetic therapies for cancer. If such methods can be that is incorporated into DNA. DNA methyltransferase established, they will allow direct comparison of the biologic methylate both cytosine residues and 5-azacytosine residues effectiveness of demethylation agents, as well as the opti- in the DNA. However, 5-azacytosine prevents the resolution mization of schedules and the rational designs of combined of a covalent reactive intermediate [162]. This leads to the treatments with DNA methylation inhibitors and other anti- DNA methyltransferase being trapped and inactivated in the cancer drugs. Genome-wide approaches to analyze methyla- form of a covalent protein-DNA adduct, which results in tion involve comparative microarray hybridization following depletion of cellular DNA methyltransferase. 5-Azacytidine fractionation of the genome, based upon methyl-cytosine- is a ribose nucleoside and thus must be chemically specific antibodies and protein complexes or methylation- modified to a deoxyribonucleotide triphosphatase to be specific enzymes with sites in CpG-rich regions [152–154]. incorporated into DNA. Before 5-azacytidine is converted The sensitivity of the enzymatic approach is limited by the into deoxyribonucleoside triphosphate, a portion of it is sequence context of the digestion site and by the number incorporated into RNA, which affects a variety of cellular of sites available. Bisulfite sequencing represents the most processes independent of demethylation [162]. Decitabine, comprehensive, high-resolution method for determining the deoxyribose analogue of 5-azacytidine, exhibits more DNA methylation states. Accurate quantification of variable specificity with greater inhibition of DNA methylation methylation frequencies requires high sampling of individual and less toxicity than 5-azacytidine. However, it also has molecules. High-throughput, single-molecule sequencing substantial toxic effects. Other drugs affect the epigenome, instruments have facilitated the genome-wide application of such as zebularine, which is more stable than 5-azacytidine this approach. However, these approaches are cost ineffective or decitabine cytidine analog. The demethylation activity of and currently are impractical for routine application in com- zebularine may also be difficult to separate from the toxic plex genomes with many epigenomic states. Recent strate- effects of DNA methyltransferase depletion that results from gies for addressing methylation in large genomes include covalent enzyme trapping [163]. enzyme directed reduced genomic representation followed Some nonnucleoside compounds also inhibit DNA by parallel sequencing [155, 156] and bisulfite capture methylation. EGCG, the main polyphenol compound in technology, which combines bisulfite conversion with hybrid green tea, binds to and blocks the active site of DNMT1 selection techniques and deep sequencing [157]. Bisulfite [7]. However, degradation of EGCG generates a substantial capture directs focus to specified CpG regions in a highly amount of hydrogen peroxide [164] that might contribute parallelized process designed to selectively enhance sequence cytotoxic activity. RG108, a small-molecule inhibitor directly information content by deeper sampling of targeted bases. In and specifically inhibits DNMT1 with low toxicity [165]. addition, most of these techniques are highly labor intensive Oligonucleotides, including hairpin-loops of DNA and a and cannot be automated. Nanotechnology platforms based specific antisense oligonucleotide, MG98, represent another on nanopore or nanowire-transition based ultra sensitive class of DNA methyltransferase inhibitors. Hairpin-loops of detection of the methylated DNA show promise for routine DNA, which are competitive substrates for DNA methyl- clinical diagnostics in the future [158, 159]. transferases, are able to induce a weak expression of the tumorsuppressorgenep16 [166]. MG98 has exhibited antitumor activity in preclinical trials and is currently being 7. Epigenetic Therapy tested in a phase II clinical trials. Psammaplins, a natural product derived from the sea sponge pseudoceratina pur- Epigenetic changes are reversible, raising the possibility of purea, inhibits DNMTs as well as histone deacetylases. SAHA epigenetic therapy, which has led to the development of (suberoylanilide hydroxamic acid), an HDAC inhibitor, epigenetic anticancer drugs such as demethylation agents has been approved by FDA for the treatment of T cell and histone deacetylation inhibitors (HDAC-I). Many genes cutaneous lymphoma. Several other HDAC inhibitors such encoding enzymes, drug transporters, transcription factors, as depsipeptide and phenylbutyrate are currently in clinical cell cycle regulators, and nuclear receptors are under epige- trials. In addition to DNA methylation and HDAC inhibitors, netic control. Thus, pharmacoepigenetics offers a potential histone arginine methyltransferases are emerging anticancer mechanism for monitoring individual responses to treat- targets, due to their role as coregulators of the androgen ment that cannot be accounted for solely on the basis of receptor [167]. The histone methyltransferase inhibitor genetic polymorphisms. Ongoing studies to identify genes DZNep induces apoptosis in cancer cells by selectively that are differentially expressed in cancer cells versus normal targeting polycomb repressive complex 2 (PRC2) proteins, cells are providing valuable information about molecular which are generally overexpressed in cancer cells [168]. Also, 8 Obstetrics and Gynecology International combinations of DNA methylation and HDAC inhibitors Epigenetic alterations are clearly involved in prostate cancer with classic chemotherapeutics have shown promise in solid initiation and progression. Hypermethylated genes can be malignancies [169]. However, many studies suggest that used to detect early stage of prostate cancer. In addition to demethylation of specific genes need not always result in the use of epigenetic alterations as a means of screening, reexpression [170, 171]. For example, demethylation of the epigenetic alteration may help clinicians to predict the MAGE gene appears to lead to reexpression only when the risk of recurrence and drug resistance. A combinatorial appropriate tissue-specific transcription factors are present approach of epigenetic therapy with antioxidant agents along [172]. Thus, various factors including nonspecific global with standard radiotherapy and targeted anticancer therapy hypomethylation and cytotoxic side effects may contribute may help in sensitization of tumors which are resistant to to the complex alterations observed after epigenetic drug current approaches of treatment. Finally, a link between the treatments. The characterization of these effects and devel- biomarkers and therapy may have positive impact on health opment of compounds that specifically reverse abnormal care. DNA methylation patterns or epimutations will be required for future cancer therapies. The broad use of decitabine in Acknowledgments cell culture experiments indicates that demethylation of the tumor suppressor genes can occur at drug concentrations This work is in part supported by the Grants from Amer- lower than those required for cytotoxicity [173]. Treatment ican Cancer Society RSG-09-175-01-CCE, Department of schedules have to be modified to include multiple courses Defense W81XWH-09-1-0216, and NIH Grant 91956. of treatment to sustain demethylation and reduce drug concentrations to decrease the severity of side effects. As DNA methylation and hypoacetylation have been References shown to contribute to silencing of chemotherapeutic [1] A. Jemal, R. Siegel, E. Ward et al., “Cancer statistics, 2008,” sensitive genes; reversal of these modifications to allow CA: A Cancer Journal for Clinicians, vol. 58, no. 2, pp. 71–96, reexpression of such genes is one possible second-line 2008. treatment for prostate cancer. These treatments would then [2] B. J. Davies, M. C. Smaldone, N. Sadetsky, M. Dall’era, and be combined with conventional first-line therapies to elicit P. R. Carroll, “The impact of obesity on overall and cancer tumor regression. In a comprehensive study of several specific survival in men with prostate cancer,” Journal of tumor cell lines, 5-aza-deoxycytidine allowed for apoptotic Urology, vol. 182, no. 1, pp. 112–117, 2009. resensitization to a variety of agents, including doxorubicin [3] M. Messina and J. W. Erdman Jr., “Need to establish thresh- and cisplatin [174]. Demethylating agents, HDAC inhibitors old soy protein intake for cholesterol reduction,” American Journal of Clinical Nutrition, vol. 81, no. 4, pp. 942–943, 2005. or combinations may allow for reexpression of silenced [4]W.J.Craig,“Healtheffects of vegan diets,” American Journal tumor suppressors such as hMLH1 and RASSF1A. A loss of of Clinical Nutrition, vol. 89, no. 5, pp. 1627S–1633S, 2009. hMLH1 and RASSF1A contributes to multidrug resistance [5]E.P.Moiseeva,G.M.Almeida,G.D.D.Jones,andM. phenotype [175]. Epigenetic reexpressions of these genes M. Manson, “Extended treatment with physiologic concen- might allow for resensitization of tumors to the conven- trations of dietary phytochemicals results in altered gene tional first-line therapies. Other epigenetic targets could be expression, reduced growth, and apoptosis of cancer cells,” methyl binding proteins and miRNAs, which play a role Molecular Cancer Therapeutics, vol. 6, no. 11, pp. 3071–3079, in tumor suppressor silencing [176]. Resistance of human 2007. tumor xenografts to treatment with cisplatin, carboplatin, [6] B. Molinie´ and P. Georgel, “Genetic and epigenetic reg- temozolomide and epirubicin was decreased by adding ulations of prostate cancer by genistein,” Drug News and nontoxic doses of decitabine [177, 178]. Importantly the Perspectives, vol. 22, no. 5, pp. 247–254, 2009. [7] M. Z. Fang, Y. Wang, N. Ai et al., “Tea polyphenol (- timing of drug administration appears to be associated with )-epigallocatechin-3-gallate inhibits DNA methyltransferase therapeutic responses. Structurally designed small molecule and reactivates methylation-silenced genes in cancer cell inhibitors may enhance specificity in epigenetic targeting, lines,” Cancer Research, vol. 63, no. 22, pp. 7563–7570, 2003. avoiding the potential detriments of global demethylation [8]J.McLarty,R.L.H.Bigelow,M.Smith,D.Elmajian,M. and hyperacetylation. Ankem, and J. A. Cardelli, “Tea polyphenols decrease serum levels of prostate-specific antigen, hepatocyte growth factor, and vascular endothelial growth factor in prostate cancer 8. Conclusion patients and inhibit production of hepatocyte growth factor and vascular endothelial growth factor in vitro,” Cancer Chromatin structure and packaging of the genome is Prevention Research, vol. 2, no. 7, pp. 673–682, 2009. important for regulating the cellular homeostasis. ROS- [9] B. B. Aggarwal, “Prostate cancer and curcumin: add spice to induced oxidative stress is involved in the multistage process your life,” Cancer Biology & Therapy, vol. 7, no. 9, pp. 1436– 1440, 2008. of prostate cancer progression. In particular, there is a [10] A. Barzilai, G. Rotman, and Y. Shiloh, “ATM deficiency and growing interest in the involvement of oxidative stress in oxidative stress: a new dimension of defective response to the epigenetic regulation of gene expression and specifically DNA damage,” DNA Repair, vol. 1, no. 1, pp. 3–25, 2002. in controlling DNA methylation. Agents that prevent the [11] D. H. Kang, “Oxidative stress, DNA damage, and breast production and chronic accumulation of ROS might play cancer,” AACN Clinical Issues, vol. 13, no. 4, pp. 540–549, an important role in the treatment of prostate cancer. 2002. Obstetrics and Gynecology International 9

[12] Z. Arsova-Saraﬁnovska, A. Eken, N. Matevska et al., [28] M. Dizdaroglu, “Formation of an 8-hydroxyguanine moiety “Increased oxidative/nitrosative stress and decreased antiox- in deoxyribonucleic acid on γ-irradiation in aqueous solu- idant enzyme activities in prostate cancer,” Clinical Biochem- tion,” Biochemistry, vol. 24, no. 16, pp. 4476–4481, 1985. istry, vol. 42, no. 12, pp. 1228–1235, 2009. [29] N. H. Zawia, D. K. Lahiri, and F. Cardozo-Pelaez, “Epige- [13] M. W. Lawless, K. J. O’Byrne, and S. G. Gray, “Oxidative stress netics, oxidative stress, and Alzheimer disease,” Free Radical induced lung cancer and COPD: opportunities for epigenetic Biology and Medicine, vol. 46, no. 9, pp. 1241–1249, 2009. therapy,” Journal of Cellular and Molecular Medicine, vol. 13, [30] K. N. Rogstad, Y. H. Jang, L. C. Sowers, and W. A. Goddard

pp. 2800–2821, 2009. III, “First principles calculations of the pKa values and [14] M. Monari, J. Foschi, C. Calabrese et al., “Implications of tautomers of isoguanine and xanthine,” Chemical Research in antioxidant enzymes in human gastric neoplasms,” Interna- Toxicology, vol. 16, no. 11, pp. 1455–1462, 2003. tional Journal of Molecular Medicine, vol. 24, no. 5, pp. 693– [31] V. Valinluck, H.-H. Tsai, D. K. Rogstad, A. Burdzy, A. 700, 2009. Bird, and L. C. Sowers, “Oxidative damage to methyl-CpG [15] H.-M. Chen, Y.-C. Wu, Y.-C. Chia et al., “Gallic acid, a major sequences inhibits the binding of the methyl-CpG binding component of Toona sinensis leaf extracts, contains a ROS- domain (MBD) of methyl-CpG binding protein 2 (MeCP2),” mediated anti-cancer activity in human prostate cancer cells,” Nucleic Acids Research, vol. 32, no. 14, pp. 4100–4108, 2004. Cancer Letters, vol. 286, no. 2, pp. 161–171, 2009. [32] S. A. Weitzman, P. W. Turk, D. H. Milkowski, and K. [16] K. Boehm, F. Borrelli, E. Ernst et al., “Green tea (Camellia Kozlowski, “Free radical adducts induce alterations in DNA sinensis) for the prevention of cancer,” Cochrane Database of cytosine methylation,” Proceedings of the National Academy Systematic Reviews, no. 3, Article ID CD005004, 2009. of Sciences of the United States of America,vol.91,no.4,pp. [17] A. Minelli, I. Bellezza, C. Conte, and Z. Culig, “Oxidative 1261–1264, 1994. stress-related aging: a role for prostate cancer?” Biochimica [33] P. W. Turk, A. Laayoun, S. S. Smith, and S. A. et Biophysica Acta, vol. 1795, no. 2, pp. 83–91, 2009. Weitzman, “DNA adduct 8-hydroxyl-2-deoxyguanosine [18] M. Valko, C. J. Rhodes, J. Moncol, M. Izakovic, and M. (8-hydroxyguanine) affects function of human DNA Mazur, “Free radicals, metals and antioxidants in oxidative methyltransferase,” Carcinogenesis,vol.16,no.5,pp. stress-induced cancer,” Chemico-Biological Interactions, vol. 1253–1255, 1995. 160, no. 1, pp. 1–40, 2006. [34] T. Masuda, H. Shinohara, and M. Kondo, “Reactions of [19] M. Valko, M. Izakovic, M. Mazur, C. J. Rhodes, and J. hydroxyl radicals with nucleic acid bases and the related Telser, “Role of oxygen radicals in DNA damage and cancer compounds in gamma irradiated aqueous solution,” Journal incidence,” Molecular and Cellular Biochemistry, vol. 266, no. of Radiation Research, vol. 16, no. 3, pp. 153–161, 1975. 1-2, pp. 37–56, 2004. [35] W.-G. Zhu, K. Srinivasan, Z. Dai et al., “Methylation of [20] J. T. Wachsman, “DNA methylation and the association adjacent CpG sites affects Sp1/Sp3 binding and activity in between genetic and epigenetic changes: relation to carcino- the p21Cip1 promoter,” Molecular and Cellular Biology, vol. genesis,” Mutation Research, vol. 375, no. 1, pp. 1–8, 1997. 23, no. 12, pp. 4056–4065, 2003. [21] S.-O. Lim, J.-M. Gu, M. S. Kim et al., “Epigenetic changes [36] A. P. Feinberg, “The epigenetics of cancer etiology,” Seminars induced by reactive oxygen species in hepatocellular carci- in Cancer Biology, vol. 14, no. 6, pp. 427–432, 2004. noma: methylation of the E-cadherin promoter,” Gastroen- [37] L.-C. Li, P. R. Carroll, and R. Dahiya, “Epigenetic changes terology, vol. 135, no. 6, pp. 2128–2140, 2008. in prostate cancer: implication for diagnosis and treatment,” [22] K. B. Beckman and B. N. Ames, “The free radical theory of Journal of the National Cancer Institute, vol. 97, no. 2, pp. aging matures,” Physiological Reviews, vol. 78, no. 2, pp. 547– 103–115, 2005. 581, 1998. [38] P. A. Jones, “An epigenetic approach for finding tumor [23] M. Nakayama, C. J. Bennett, J. L. Hicks et al., “Hyper- suppressors,” Cell Cycle, vol. 2, no. 1, pp. 25–26, 2003. methylation of the human glutathione S-transferase-π gene [39] G. C. Prendergast and E. B. Ziff, “Methylation-sensitive (GSTP1) CpG island is present in a subset of proliferative sequence-specific DNA binding by the c-Myc basic region,” inflammatory atrophy lesions but not in normal or hyper- Science, vol. 251, no. 4990, pp. 186–189, 1991. plastic epithelium of the prostate: a detailed study using laser- [40] P. L. Jones, G. J. C. Veenstra, P. A. Wade et al., “Methylated capture microdissection,” American Journal of Pathology, vol. DNA and MeCP2 recruit histone deacetylase to repress 163, no. 3, pp. 923–933, 2003. transcription,” Nature Genetics, vol. 19, no. 2, pp. 187–191, [24] D. K. Vanaja, M. Ehrich, D. Van Den Boom et al., “Hyper- 1998. methylation of genes for diagnosis and risk stratification of prostate cancer,” Cancer Investigation, vol. 27, no. 5, pp. 549– [41] X. Nan, H.-H. Ng, C. A. Johnson et al., “Transcriptional 560, 2009. repression by the methyl-CpG-binding protein MeCP2 [25]D.S.Millar,K.K.Ow,C.L.Paul,P.J.Russell,P.L. involves a histone deacetylase complex,” Nature, vol. 393, no. Molloy, and S. J. Clark, “Detailed methylation analysis of the 6683, pp. 386–389, 1998. glutathione S-transferase π (GSTP1) gene in prostate cancer,” [42] S. B. Baylin, “DNA methylation and gene silencing in cancer,” Oncogene, vol. 18, no. 6, pp. 1313–1324, 1999. Nature Clinical Practice Oncology, vol. 2, supplement 1, pp. [26] K. C. Cheng, D. S. Cahill, H. Kasai, S. Nishimura, and L. S4–S11, 2005. A. Loeb, “8-Hydroxyguanine, an abundant form of oxidative [43] A. Bird, “DNA methylation patterns and epigenetic mem- DNA damage, causes G → T and A → C substitutions,” ory,” Genes and Development, vol. 16, no. 1, pp. 6–21, 2002. Journal of Biological Chemistry, vol. 267, no. 1, pp. 166–172, [44] A. P. Bird, “DNA methylation—how important in gene 1992. control?” Nature, vol. 307, no. 5951, pp. 503–504, 1984. [27] S. Shibutani, M. Takeshita, and A. P. Grollman, “Insertion [45] A. P. Bird, “CpG-rich islands and the function of DNA of specific bases during DNA synthesis past the oxidation- methylation,” Nature, vol. 321, no. 6067, pp. 209–213, 1986. damaged base 8-oxodG,” Nature, vol. 349, no. 6308, pp. 431– [46] J. F. Costello and C. Plass, “Methylation matters,” Journal of 434, 1991. Medical Genetics, vol. 38, no. 5, pp. 285–303, 2001. 10 Obstetrics and Gynecology International

[47] M. F. Clarke, “Epigenetic regulation of normal and cancer intakes,” Journal of Nutrition, vol. 133, no. 3, pp. 740–743, stem cells,” Annals of the New York Academy of Sciences, vol. 2003. 1044, pp. 90–93, 2005. [65] M. Balaghi and C. Wagner, “DNA methylation in folate defi- [48] P.W. Laird, “The power and the promise of DNA methylation ciency: use of CpG methylase,” Biochemical and Biophysical markers,” Nature Reviews Cancer, vol. 3, no. 4, pp. 253–266, Research Communications, vol. 193, no. 3, pp. 1184–1190, 2003. 1993. [49] J. R. Weaver, M. Susiarjo, and M. S. Bartolomei, “Imprinting [66] J. C. Wallwork and J. A. Duerre, “Effect of zinc deficiency on and epigenetic changes in the early embryo,” Mammalian methionine metabolism, methylation reactions and protein Genome, vol. 20, no. 9-10, pp. 532–543, 2009. synthesis in isolated perfused rat liver,” Journal of Nutrition, [50]S.Ogino,T.Kawasaki,K.Noshoetal.,“LINE-1hypomethy- vol. 115, no. 2, pp. 252–262, 1985. lation is inversely associated with microsatellite instability [67]G.C.Rampersaud,G.P.A.Kauwell,A.D.Hutson,J.J.Cerda, and CpG island methylator phenotype in colorectal cancer,” and L. B. Bailey, “Genomic DNA methylation decreases in International Journal of Cancer, vol. 122, no. 12, pp. 2767– response to moderate folate depletion in elderly women,” 2773, 2008. American Journal of Clinical Nutrition, vol. 72, no. 4, pp. 998– [51] S. Rohrs,¨ W. G. Dirks, C. Meyer et al., “Hypomethylation 1003, 2000. and expression of BEX2, IGSF4 and TIMP3 indicative of [68] D. M. Kokkinakis, A. G. Brickner, J. M. Kirkwood et al., MLL translocations in Acute Myeloid Leukemia,” Molecular “Mitotic arrest, apoptosis, and sensitization to chemotherapy Cancer, vol. 8, article 86, 2009. of melanomas by methionine deprivation stress,” Molecular [52] A. P. Feinberg, “Cancer epigenetics takes center stage,” Cancer Research, vol. 4, no. 8, pp. 575–589, 2006. Proceedings of the National Academy of Sciences of the United [69] K. Woodson, R. Hayes, L. Wideroff,L.Villaruz,andJ.Tan- States of America, vol. 98, no. 2, pp. 392–394, 2001. grea, “Hypermethylation of GSTP1, CD44, and E-cadherin [53] M. Ehrlich, “DNA methylation and cancer-associated genetic genes in prostate cancer among US blacks and whites,” instability,” Advances in Experimental Medicine and Biology, Prostate, vol. 55, no. 3, pp. 199–205, 2003. vol. 570, pp. 363–392, 2005. [70] J. L. Watters, Y. Park, A. Hollenbeck, A. Schatzkin, and [54] L. Guarente, “Mitochondria—a nexus for aging, calorie D. Albanes, “Cigarette smoking and prostate cancer in a restriction, and sirtuins?” Cell, vol. 132, no. 2, pp. 171–176, prospective US cohort study,” Cancer Epidemiology Biomark- 2008. ers and Prevention, vol. 18, no. 9, pp. 2427–2435, 2009. [55] D. Ornish, G. Weidner, W. R. Fair et al., “Intensive lifestyle ff [71] H. Enokida, H. Shiina, S. Urakami et al., “Smoking influences changes may a ect the progression of prostate cancer,” aberrant CpG hypermethylation of multiple genes in human Journal of Urology, vol. 174, no. 3, pp. 1065–1070, 2005. prostate carcinoma,” Cancer, vol. 106, no. 1, pp. 79–86, 2006. [56] J. J. Daubenmier, G. Weidner, R. Marlin et al., “Lifestyle and [72] I. Aurer, G. Lauc, J. Dumic´ et al., “Aberrant glycosylation of health-related quality of life of men with prostate cancer Igg heavy chain in multiple myeloma,” Collegium Antropolog- managed with active surveillance,” Urology,vol.67,no.1,pp. icum, vol. 31, no. 1, pp. 247–251, 2007. 125–130, 2006. [73] N. Shivapurkar, M. J. Wilson, and L. A. Poirier, “Hypomethy- [57] C. Kronenwetter, G. Weidner, E. Pettengill et al., “A qualita- lation of DNA in ethionine-fed rats,” Carcinogenesis, vol. 5, tive analysis of interviews of men with early stage prostate no. 8, pp. 989–992, 1984. cancer: the Prostate Cancer Lifestyle Trial,” Cancer Nursing, [74] R. E. Watson and J. I. Goodman, “Effects of phenobarbital vol. 28, no. 2, pp. 99–107, 2005. on DNA methylation in GC-rich regions of hepatic DNA [58] J. Frattaroli, G. Weidner, A. M. Dnistrian et al., “Clinical from mice that exhibit different levels of susceptibility to liver events in prostate cancer lifestyle trial: results from two years tumorigenesis,” Toxicological Sciences, vol. 68, no. 1, pp. 51– of follow-up,” Urology, vol. 72, no. 6, pp. 1319–1323, 2008. 58, 2002. [59] D. M. Ornish, K. L. Lee, W. R. Fair, E. B. Pettengill, and P. [75] J. C. Cheng, D. J. Weisenberger, F. A. Gonzales et al., “Contin- R. Carroll, “Dietary trial in prostate cancer: early experience ff and implications for clinical trial design,” Urology, vol. 57, no. uous zebularine treatment e ectively sustains demethylation 4, pp. 200–201, 2001. in human bladder cancer cells,” Molecular and Cellular [60] A. Dewell, G. Weidner, M. D. Sumner et al., “Relationship Biology, vol. 24, no. 3, pp. 1270–1278, 2004. ff of dietary protein and soy isoflavones to serum IGF-1 and [76] L. C. Bo a, G. Vidali, and V. G. Allfrey, “Selective synthesis IGF binding proteins in the prostate cancer lifestyle trial,” and accumulation of nuclear non histone proteins during Nutrition and Cancer, vol. 58, no. 1, pp. 35–42, 2007. carcinogenesis of the colon induced by 1,2 dimethylhy- [61] A. Dewell, G. Weidner, M. D. Sumner, C. S. Chi, and drazine,” Cancer, vol. 36, no. 6, pp. 2356–2363, 1975. D. Ornish, “A very-low-fat vegan diet increases intake of [77] Y.-W. Lee, C. B. Klein, B. Kargacin et al., “Carcinogenic nickel protective dietary factors and decreases intake of pathogenic silences gene expression by chromatin condensation and dietary factors,” Journal of the American Dietetic Association, DNA methylation: a new model for epigenetic carcinogens,” vol. 108, no. 2, pp. 347–356, 2008. Molecular and Cellular Biology, vol. 15, no. 5, pp. 2547–2557, [62] M. A. Moyad and P. R. Carroll, “Lifestyle recommendations 1995. to prevent prostate cancer, part I: time to redirect our [78] K. Naka, T. Muraguchi, T. Hoshii, and A. Hirao, “Regu- attention?” Urologic Clinics of North America, vol. 31, no. 2, lation of reactive oxygen species and genomic stability in pp. 289–300, 2004. hematopoietic stem cells,” Antioxidants and Redox Signaling, [63] S. A. Ross, “Diet and DNA methylation interactions in cancer vol. 10, no. 11, pp. 1883–1894, 2008. prevention,” Annals of the New York Academy of Sciences, vol. [79] H. Sauer and M. Wartenberg, “Reactive oxygen species 983, pp. 197–207, 2003. as signaling molecules in cardiovascular differentiation of [64] R. A. Jacob, G. M. Aiello, C. B. Stephensen et al., “Moderate embryonic stem cells and tumor-induced angiogenesis,” antioxidant supplementation has no effect on biomarkers of Antioxidants and Redox Signaling, vol. 7, no. 11-12, pp. 1423– oxidant damage in healthy men with low fruit and vegetable 1434, 2005. Obstetrics and Gynecology International 11

[80] L.-C. Li, H. Shiina, M. Deguchi et al., “Age-dependent [95] L. Donaldson, C. Fordyce, F. Gilliland et al., “Association methylation of ESR1 gene in prostate cancer,” Biochemical between outcome and telomere DNA content in prostate and Biophysical Research Communications, vol. 321, no. 2, pp. cancer,” Journal of Urology, vol. 162, no. 5, pp. 1788–1792, 455–461, 2004. 1999. [81] A. H. Ting, K. M. McGarvey, and S. B. Baylin, “The cancer [96] D. Ornish, J. Lin, J. Daubenmier et al., “Increased telomerase epigenome—components and functional correlates,” Genes activity and comprehensive lifestyle changes: a pilot study,” and Development, vol. 20, no. 23, pp. 3215–3231, 2006. The Lancet Oncology, vol. 9, no. 11, pp. 1048–1057, 2008. [82] D. K. Vanaja, K. V. Ballman, B. W. Morlan et al., “PDLIM4 [97] R. Benetti, M. Garc´ıa-Cao, and M. A. Blasco, “Telomere repression by hypermethylation as a potential biomarker for length regulates the epigenetic status of mammalian telom- prostate cancer,” Clinical Cancer Research, vol. 12, no. 4, pp. eres and subtelomeres,” Nature Genetics, vol. 39, no. 2, pp. 1128–1136, 2006. 243–250, 2007. [83] S. M. Dehm and D. J. Tindall, “Androgen receptor structural [98] I. Guilleret and J. Benhattar, “Demethylation of the and functional elements: role and regulation in prostate human telomerase catalytic subunit (hTERT) gene promoter cancer,” Molecular Endocrinology, vol. 21, no. 12, pp. 2855– reduced hTERT expression and telomerase activity and 2863, 2007. shortened telomeres,” Experimental Cell Research, vol. 289, [84] F. Mehraein-Ghomi, E. Lee, D. R. Church, T. A. Thompson, no. 2, pp. 326–334, 2003. H. S. Basu, and G. Wilding, “JunD mediates androgen- [99] Y. Zhao and R. J. Epstein, “Programmed genetic instability: induced oxidative stress in androgen dependent LNCaP a tumor-permissive mechanism for maintaining the evolv- human prostate cancer cells,” Prostate, vol. 68, no. 9, pp. 924– ability of higher species through methylation-dependent 934, 2008. mutation of DNA repair genes in the male germ line,” [85] H. Miyake, I. Hara, M. E. Gleave, and H. Eto, “Protection Molecular Biology and Evolution, vol. 25, no. 8, pp. 1737– of androgen-dependent human prostate cancer cells from 1749, 2008. oxidative stress-induced DNA damage by overexpression of [100] J.-M. Zingg and P. A. Jones, “Genetic and epigenetic aspects clusterin and its modulation by androgen,” Prostate, vol. 61, of DNA methylation on genome expression, evolution, no. 4, pp. 318–323, 2004. mutation and carcinogenesis,” Carcinogenesis, vol. 18, no. 5, [86] C. Polytarchou, M. Hatziapostolou, and E. Papadimitriou, pp. 869–882, 1997. “Hydrogen peroxide stimulates proliferation and migration [101] S. Castellv´ı-Bel and A. Castells, “Aberrant DNA methylation of human prostate cancer cells through activation of activator in nontumor gastric mucosa: a potential marker for early protein-1 and up-regulation of the heparin affin regulatory detection of gastric cancer?” Gastroenterology, vol. 131, no. peptide gene,” Journal of Biological Chemistry, vol. 280, no. 5, pp. 1647–1649, 2006. 49, pp. 40428–40435, 2005. [102] K. M. Kerr, J. S. Galler, J. A. Hagen, P. W. Laird, and [87] R. B. Montgomery, E. A. Mostaghel, R. Vessella et al., “Main- I. A. Laird-Offringa, “The role of DNA methylation in tenance of intratumoral androgens in metastatic prostate the development and progression of lung adenocarcinoma,” cancer: a mechanism for castration-resistant tumor growth,” Disease Markers, vol. 23, no. 1-2, pp. 5–30, 2007. Cancer Research, vol. 68, no. 11, pp. 4447–4454, 2008. [103] S. B. Baylin, M. Makos, J. Wu et al., “Abnormal patterns [88] M.-F. Robert, S. Morin, N. Beaulieu et al., “DNMT1 is of DNA methylation in human neoplasia: potential conse- required to maintain CpG methylation and aberrant gene quences for tumor progression,” Cancer Cells, vol. 3, no. 10, silencing in human cancer cells,” Nature Genetics, vol. 33, no. pp. 383–390, 1991. 1, pp. 61–65, 2003. [104] Y. Jiang, A. Dunbar, L. P. Gondek et al., “Aberrant DNA [89] A. P. Feinberg, R. Ohlsson, and S. Henikoff, “The epigenetic methylation is a dominant mechanism in MDS progression progenitor origin of human cancer,” Nature Reviews Genetics, to AML,” Blood, vol. 113, no. 6, pp. 1315–1325, 2009. vol. 7, no. 1, pp. 21–33, 2006. [105] S. Yegnasubramanian, J. Kowalski, M. L. Gonzalgo et al., [90] D. R. Hodge, E. Cho, T. D. Copeland et al., “IL-6 enhances the “Hypermethylation of CpG islands in primary and metastatic nuclear translocation of DNA cytosine-5-methyltransferase human prostate cancer,” Cancer Research,vol.64,no.6,pp. 1 (DNMT1) via phosphorylation of the nuclear localization 1975–1986, 2004. sequence by the AKT kinase,” Cancer Genomics and Pro- [106] M. V. Brock, C. M. Hooker, E. Ota-Machida et al., “DNA teomics, vol. 4, no. 6, pp. 387–398, 2007. methylation markers and early recurrence in stage I lung [91] B. Richardson, “Impact of aging on DNA methylation,” cancer,” New England Journal of Medicine, vol. 358, no. 11, Ageing Research Reviews, vol. 2, no. 3, pp. 245–261, 2003. pp. 1118–1128, 2008. [92] V. Bollati, J. Schwartz, R. Wright et al., “Decline in genomic [107] A. C. Blackburn, K. I. Matthaei, C. Lim et al., “Deficiency DNA methylation through aging in a cohort of elderly of glutathione transferase zeta causes oxidative stress and subjects,” Mechanisms of Ageing and Development, vol. 130, activation of antioxidant response pathways,” Molecular no. 4, pp. 234–239, 2009. Pharmacology, vol. 69, no. 2, pp. 650–657, 2006. [93] M. A. Casillas Jr., N. Lopatina, L. G. Andrews, and T. O. [108] J. D. Hayes, J. U. Flanagan, and I. R. Jowsey, “Glutathione Tollefsbol, “Transcriptional control of the DNA methyltrans- transferases,” Annual Review of Pharmacology and Toxicology, ferases is altered in aging and neoplastically-transformed vol. 45, pp. 51–88, 2005. human fibroblasts,” Molecular and Cellular Biochemistry, vol. [109] J. D. Brooks, M. Weinstein, X. Lin et al., “CG island 252, no. 1-2, pp. 33–43, 2003. methylation changes near the GSTP1 gene in prostatic [94] S. Katayama, G. Shiota, M. Oshimura, and H. Kawasaki, intraepithelial neoplasia,” Cancer Epidemiology Biomarkers “Clinical usefulness of telomerase activity and telomere and Prevention, vol. 7, no. 6, pp. 531–536, 1998. length in the preoperative diagnosis of gastric and colorectal [110] C. Jeronimo,´ H. Usadel, R. Henrique et al., “Quantitation cancer,” Journal of Cancer Research and Clinical Oncology, vol. of GSTP1 methylation in non-neoplastic prostatic tissue 125, no. 7, pp. 405–410, 1999. and organ-confined prostate adenocarcinoma,” Journal of the 12 Obstetrics and Gynecology International

National Cancer Institute, vol. 93, no. 22, pp. 1747–1752, in colorectal carcinoma,” Proceedings of the National Academy 2001. of Sciences of the United States of America, vol. 95, no. 12, pp. [111] S. V. Harden, H. Sanderson, S. N. Goodman et al., “Quan- 6870–6875, 1998. titative GSTP1 methylation and the detection of prostate [127] Y. Watanabe, H. Ueda, T. Etoh et al., “A change in promoter adenocarcinoma in sextant biopsies,” Journal of the National methylation of hMLH1 is a cause of acquired resistance to Cancer Institute, vol. 95, no. 21, pp. 1634–1637, 2003. platinum-based chemotherapy in epithelial ovarian cancer,” [112] M. Zhou, Y. Tokumaru, D. Sidransky, and J. I. Epstein, Anticancer Research, vol. 27, no. 3 B, pp. 1449–1452, 2007. “Quantitative GSTP1 methylation levels correlate with Glea- [128] H. Noda, Y. Kato, H. Yoshikawa et al., “Microsatellite son grade and tumor volume in prostate needle biopsies,” instability caused by hMLH1 promoter methylation increases Journal of Urology, vol. 171, no. 6, pp. 2195–2198, 2004. with tumor progression in right-sided sporadic colorectal [113] J. Kollermann,¨ M. Muller,¨ C. Goessl et al., “Methylation- cancer,” Oncology, vol. 69, no. 4, pp. 354–362, 2005. specific PCR for DNA-based detection of occult tumor [129] T. V. Kekeeva, O. P. Popova, P. V. Shegai et al., “Abberant cells in lymph nodes of prostate cancer patients,” European methylation of p16, HIC1, N33 and GSTP1 genes in tumor Urology, vol. 44, no. 5, pp. 533–538, 2003. epitelium and tumor-associated stromal cells of prostate [114] W. G. Nelson, A. M. De Marzo, T. L. Deweese et al., cancer,” Molekuliarnaia Biologiia, vol. 41, no. 1, pp. 79–85, “Preneoplastic prostate lesions: an opportunity for prostate 2007. cancer prevention,” Annals of the New York Academy of [130] D. K. Mishra, Z. Chen, Y. Wu, M. Sarkissyan, H. P. Koeffler, Sciences, vol. 952, pp. 135–144, 2001. J. V. Vadgama, et al., “Global methylation pattern of genes [115] G. H. Kang, S. Lee, H. J. Lee, and K. S. Hwang, “Aberrant CpG in androgen-sensitive and androgen-independent prostate island hypermethylation of multiple genes in prostate cancer cancer cells,” Mol Cancer Ther, vol. 9, pp. 33–45, 2010. and prostatic intraepithelial neoplasia,” Journal of Pathology, [131] K. Woodson, K. J. O’Reilly, D. E. Ward et al., “CD44 and vol. 202, no. 2, pp. 233–240, 2004. PTGS2 methylation are independent prognostic markers for [116] D. A. Troyer, J. Mubiru, R. J. Leach, and S. L. Naylor, “Promise biochemical recurrence among prostate cancer patients with and challenge: markers of prostate cancer detection, diagno- clinically localized disease,” Epigenetics, vol. 1, no. 4, pp. 183– sis and prognosis,” Disease Markers, vol. 20, no. 2, pp. 117– 186, 2006. 128, 2004. [132] W. Lou, D. Krill, R. Dhir et al., “Methylation of the [117] D. K. Vanaja, J. C. Cheville, S. J. Iturria, and C. Y. F. CD44 metastasis suppressor gene in human prostate cancer,” Young, “Transcriptional silencing of zinc finger protein 185 Cancer Research, vol. 59, no. 10, pp. 2329–2331, 1999. identified by expression profiling is associated with prostate [133] K. Kron, V. Pethe, L. Briollais et al., “Discovery of novel cancer progression,” Cancer Research, vol. 63, no. 14, pp. hypermethylated genesin prostate cancer using genomic CpG 3877–3882, 2003. island microarrays,” PLoS ONE, vol. 4, no. 3, article e4830, [118] C. Jeronimo,´ R. Henrique, M. O. Hoque et al., “Quantitative 2009. RARbeta2 hypermethylation: a promising prostate cancer [134] L. Richiardi, V.Fiano, L. Vizzini et al., “Promoter methylation marker,” Clinical Cancer Research, vol. 10, no. 12, pp. 4010– in APC, RUNX3, and GSTP1 and mortality in prostate cancer 4014, 2004. patients,” Journal of Clinical Oncology, vol. 27, no. 19, pp. [119] H. Enokida, H. Shiina, S. Urakami et al., “Multigene 3161–3168, 2009. methylation analysis for detection and staging of prostate ff cancer,” Clinical Cancer Research, vol. 11, no. 18, pp. 6582– [135] S. Yegnasubramanian, M. C. Ha ner, Y. Zhang et al., “DNA 6588, 2005. hypomethylation arises later in prostate cancer progres- [120] R. Maruyama, S. Toyooka, K. O. Toyooka et al., “Aberrant sion than CpG island hypermethylation and contributes to promoter methylation profile of prostate cancers and its metastatic tumor heterogeneity,” Cancer Research, vol. 68, no. relationship to clinicopathological features,” Clinical Cancer 21, pp. 8954–8967, 2008. Research, vol. 8, no. 2, pp. 514–519, 2002. [136] D. E. Symer, C. Connelly, S. T. Szak et al., “Human L1 [121] L. Liu, J.-H. Yoon, R. Dammann, and G. P. Pfeifer, “Frequent retrotransposition is associated with genetic instability in hypermethylation of the RASSF1A gene in prostate cancer,” vivo,” Cell, vol. 110, no. 3, pp. 327–338, 2002. Oncogene, vol. 21, no. 44, pp. 6835–6840, 2002. [137] R. Hernandez, A. Frady, X.-Y. Zhang, M. Varela, and M. [122] S. Maier, C. Dahlstroem, C. Haefliger, A. Plum, and C. Ehrlich, “Preferential induction of chromosome 1 multi- Piepenbrock, “Identifying DNA methylation biomarkers of branched figures and whole-arm deletions in a human pro- cancer drug response,” American Journal of Pharmacoge- B cell line treated with 5-azacytidine or 5-azadeoxycytidine,” nomics, vol. 5, no. 4, pp. 223–232, 2005. Cytogenetics and Cell Genetics, vol. 76, no. 3-4, pp. 196–201, [123] R. Henrique, C. Jeronimo,´ M. O. Hoque et al., “Frequent 14- 1997. 3-3σ promoter methylation in benign and malignant prostate [138] A. Karpf, S. Bai, S. R. James, J. L. Mohler, and E. M. Wilson, lesions,” DNA and Cell Biology, vol. 24, no. 4, pp. 264–269, “Increased expression of androgen receptor coregulator 2005. MAGE-11 in prostate cancer by DNA hypomethylation and [124] A. Vilkin, Y. Niv, T. Nagasaka et al., “Microsatellite instability, cyclic AMP,” Molecular Cancer Research, vol. 7, no. 4, pp. 523– MLH1 promoter methylation, and BRAF mutation analysis 535, 2009. in sporadic colorectal cancers of different ethnic groups in [139] P. Pakneshan, M. Szyf, and S. A. Rabbani, “Hypomethylation Israel,” Cancer, vol. 115, no. 4, pp. 760–769, 2009. of urokinase (uPA) promoter in breast and prostate cancer: [125] K. W. Choy, C. P. Pang, D. S. P. Fan et al., “Microsatellite prognostic and therapeutic implications,” Current Cancer instability and MLH1 promoter methylation in human Drug Targets, vol. 5, no. 7, pp. 471–488, 2005. retinoblastoma,” Investigative Ophthalmology and Visual Sci- [140] M. Marchand, P. Weynants, E. Rankin et al., “Tumor ence, vol. 45, no. 10, pp. 3404–3409, 2004. regression responses in melanoma patients treated with a [126] J. G. Herman, A. Umar, K. Polyak et al., “Incidence and func- peptide encoded by gene MAGE-3,” International Journal of tional consequences of hMLH1 promoter hypermethylation Cancer, vol. 63, no. 6, pp. 883–885, 1995. Obstetrics and Gynecology International 13

[141] E. Jager,¨ S. Gnjatic, Y. Nagata et al., “Induction of primary [157] E. Hodges, A. D. Smith, J. Kendall et al., “High definition NY-ESO-1 immunity: CD8+ T lymphocyte and antibody profiling of mammalian DNA methylation by array capture responses in peptide-vaccinated patients with NY-ESO-1+ and single molecule bisulfite sequencing,” Genome Research, cancers,” Proceedings of the National Academy of Sciences of vol. 19, no. 9, pp. 1593–1605, 2009. the United States of America, vol. 97, no. 22, pp. 12198–12203, [158] U. Mirsaidov, W. Timp, X. Zou et al., “Nanoelectromechanics 2000. of methylated DNA in a synthetic nanopore,” Biophysical [142] S. R. Payne, J. Serth, M. Schostak et al., “DNA methylation Journal, vol. 96, no. 4, pp. L32–L34, 2009. biomarkers of prostate cancer: confirmation of candidates [159] W. C. Maki, N. N. Mishra, E. G. Cameron, B. Filanoski, and evidence urine is the most sensitive body fluid for non- S. K. Rastogi, and G. K. Maki, “Nanowire-transistor based invasive detection,” Prostate, vol. 69, no. 12, pp. 1257–1269, ultra-sensitive DNA methylation detection,” Biosensors and 2009. Bioelectronics, vol. 23, no. 6, pp. 780–787, 2008. [143] F. Pouliot, M. Johnson, and L. Wu, “Non-invasive molecular [160] S. Sharma, T. K. Kelly, and P.A. Jones, “Epigenetics in cancer,” imaging of prostate cancer lymph node metastasis,” Trends in Carcinogenesis, vol. 31, no. 1, pp. 27–36, 2010. Molecular Medicine, vol. 15, no. 6, pp. 254–262, 2009. [161] G. S. Mack, “Epigenetic cancer therapy makes headway,” [144] C. Goessl, H. Krause, M. Miller et al., “Fluorescent Journal of the National Cancer Institute, vol. 98, no. 20, pp. methylation-specific polymerase chain reaction for DNA- 1443–1444, 2006. based detection of prostate cancer in bodily fluids,” Cancer [162] D. V. Santi, A. Norment, and C. E. Garrett, “Covalent bond Research, vol. 60, no. 21, pp. 5941–5945, 2000. formation between a DNA-cytosine methyltransferase and [145] C. Goessl, M. Muller,¨ R. Heicappell et al., “DNA-based DNA containing 5-azacytosine,” Proceedings of the National detection of prostate cancer in urine after prostatic massage,” Academy of Sciences of the United States of America, vol. 81, Urology, vol. 58, no. 3, pp. 335–338, 2001. no. 22 I, pp. 6993–6997, 1984. ff [146] M. L. Gonzalgo, M. Nakayama, S. M. Lee, A. M. De [163] M. Billam, M. D. Sobolewski, and N. E. Davidson, “E ects Marzo, and W. G. Nelson, “Detection of GSTP1 methylation of a novel DNA methyltransferase inhibitor zebularine on in prostatic secretions using combinatorial MSP analysis,” human breast cancer cells,” Breast Cancer Research and Urology, vol. 63, no. 2, pp. 414–418, 2004. Treatment, pp. 1–12, 2009. [147] E. Sunami, M. Shinozaki, C. S. Higano et al., “A multimarker [164] H. Nakagawa, K. Hasumi, J.-T. Woo, K. Nagai, and M. Wachi, circulating DNA assay for assessing prostate cancer patients’,” “Generation of hydrogen peroxide primarily contributes to Clinical Chemistry, vol. 55, no. 3, pp. 559–567, 2009. the induction of Fe(II)-dependent apoptosis in Jurkat cells by (-)-epigallocatechin gallate,” Carcinogenesis, vol. 25, no. 9, [148] C. A. Eads, K. D. Danenberg, K. Kawakami et al., “Methy- pp. 1567–1574, 2004. Light: a high-throughput assay to measure DNA methylation,” Nucleic Acids Research, vol. 28, no. 8, article E32, 2000. [165] B. Brueckner, R. G. Boy, P. Siedlecki et al., “Epigenetic reactivation of tumor suppressor genes by a novel small- [149] M. Ehrich, M. R. Nelson, P. Stanssens et al., “Quantitative molecule inhibitor of human DNA methyltransferases,” high-throughput analysis of DNA methylation patterns by Cancer Research, vol. 65, no. 14, pp. 6305–6311, 2005. base-specific cleavage and mass spectrometry,” Proceedings [166] J. Flynn, J.-Y. Fang, J. A. Mikovits, and N. O. Reich, “A potent of the National Academy of Sciences of the United States of cell-active allosteric inhibitor of murine DNA cytosine C5 America, vol. 102, no. 44, pp. 15785–15790, 2005. methyltransferase,” Journal of Biological Chemistry, vol. 278, [150] J.-M. Dupont, J. Tost, H. Jammes, and I. G. Gut, “De novo no. 10, pp. 8238–8243, 2003. quantitative bisulfite sequencing using the pyrosequencing [167] M. Bjorkman,¨ K. Iljin, P.Halonen et al., “Defining the molec- technology,” Analytical Biochemistry, vol. 333, no. 1, pp. 119– ular action of HDAC inhibitors and synergism with androgen 127, 2004. deprivation in ERG-positive prostate cancer,” International [151] Z. Xiong and P. W. Laird, “COBRA: a sensitive and quantita- Journal of Cancer, vol. 123, no. 12, pp. 2774–2781, 2008. tive DNA methylation assay,” Nucleic Acids Research, vol. 25, [168] J. Tan, X. Yang, L. Zhuang et al., “Pharmacologic disruption no. 12, pp. 2532–2534, 1997. of polycomb-repressive complex 2-mediated gene repression [152] L. Shen, Y. Kondo, Y. Guo et al., “Genome-wide profiling of selectively induces apoptosis in cancer cells,” Genes and DNA methylation reveals a class of normally methylated CpG Development, vol. 21, no. 9, pp. 1050–1063, 2007. island promoters,” PLoS Genetics, vol. 3, no. 10, pp. 2023– [169] S. Nuyts, J. Theys, W. Landuyt, L. van Mellaert, P. Lambin, 2026, 2007. and J. Anne,´ “Increasing specificity of anti-tumor ther- [153] M. Weber, J. J. Davies, D. Wittig et al., “Chromosome-wide apy: cytotoxic protein delivery by non-pathogenic clostridia ff and promoter-specific analyses identify sites of di erential under regulation of radio-induced promoters,” Anticancer DNA methylation in normal and transformed human cells,” Research, vol. 21, no. 2 A, pp. 857–862, 2001. Nature Genetics, vol. 37, no. 8, pp. 853–862, 2005. [170] C. De Bustos, E. Ramos, J. M. Young, et al., “Tissue- [154] B. Khulan, R. F. Thompson, K. Ye et al., “Comparative specific variation in DNA methylation levels along human isoschizomer profiling of cytosine methylation: the HELP chromosome 1,” Epigenetics Chromatin, vol. 2, no. 1, article assay,” Genome Research, vol. 16, no. 8, pp. 1046–1055, 2006. 7, 2009. [155] A. L. Brunner, D. S. Johnson, S. W. Kim et al., “Distinct [171] S.-J. Hong, M.-I. Kang, J.-H. Oh et al., “DNA methylation DNA methylation patterns characterize differentiated human and expression patterns of key tissue-specific genes in adult embryonic stem cells and developing human fetal liver,” stem cells and stomach tissues,” Journal of Korean Medical Genome Research, vol. 19, no. 6, pp. 1044–1056, 2009. Science, vol. 24, no. 5, pp. 918–929, 2009. [156] J. Deng, R. Shoemaker, B. Xie et al., “Targeted bisulfite [172] C. De Smet, A. Loriot, and T. Boon, “Promoter-dependent sequencing reveals changes in DNA methylation associated mechanism leading to selective hypomethylation within the with nuclear reprogramming,” Nature Biotechnology, vol. 27, 5 region of gene MAGE-A1 in tumor cells,” Molecular and no. 4, pp. 353–360, 2009. Cellular Biology, vol. 24, no. 11, pp. 4781–4790, 2004. 14 Obstetrics and Gynecology International

[173] C. M. Bender, M. M. Pao, and P. A. Jones, “Inhibition of DNA methylation by 5-Aza-2’-deoxycytidine suppresses the growth of human tumor cell lines,” Cancer Research, vol. 58, no. 1, pp. 95–101, 1998. [174] S. Fulda and K.-M. Debatin, “Sensitization for anticancer drug-induced apoptosis by the chemopreventive agent resveratrol,” Oncogene, vol. 23, no. 40, pp. 6702–6711, 2004. [175] C. Balch, J. S. Montgomery, H.-I. Paik, S. Kim, T. H.- M. Huang, and K. P. Nephew, “New anti-cancer strategies: epigenetic therapies and biomarkers,” Frontiers in Bioscience, vol. 10, no. 2, pp. 1897–1931, 2005. [176] Y. Saito, J. M. Friedman, Y. Chihara, G. Egger, J. C. Chuang, and G. Liang, “Epigenetic therapy upregulates the tumor suppressor microRNA-126 and its host gene EGFL7 in human cancer cells,” Biochemical and Biophysical Research Communications, vol. 379, no. 3, pp. 726–731, 2009. [177] E. Jabbour, J.-P. Issa, G. Garcia-Manero, and H. Kantarjian, “Evolution of decitabine development: accomplishments, ongoing investigations, and future strategies,” Cancer, vol. 112, no. 11, pp. 2341–2351, 2008. [178] N. Steele, P. Finn, R. Brown, and J. A. Plumb, “Combined inhibition of DNA methylation and histone acetylation enhances gene re-expression and drug sensitivity in vivo,” British Journal of Cancer, vol. 100, no. 5, pp. 758–763, 2009. Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 120130, 6 pages doi:10.1155/2010/120130

Review Article Preimplantation Genetic Screening: An Effective Testing for Infertile and Repeated Miscarriage Patients?

Ning Wang, Ying-Ming Zheng, Lei Li, and Fan Jin

Department of Reproductive Endocrinology, Women’s Hospital, School of Medicine, Zhejiang University, Hangzhou 310006, China

Correspondence should be addressed to Fan Jin, [email protected]

Received 30 November 2009; Accepted 15 May 2010

Academic Editor: Shi-Wen Jiang

Aneuploidy in pregnancy is known to increase with advanced maternal age (AMA) and associate with repeated implantation failure (RIF), and repeated miscarriage (RM). Preimplantation genetic screening (PGS) has been introduced into clinical practice, screening, and eliminating aneuploidy embryos, which can improve the chance of conceptions for infertility cases with poor prognosis. These patients are a good target group to assess the possible benefit of aneuploidy screening. Although practiced widely throughout the world, there still exist some doubts about the efficacy of this technique. Recent randomized trials were not as desirable as we expected, suggesting that PGS needs to be reconsidered. The aim of this review is to discuss the efficacy of PGS.

1. Introduction tool for embryo screening. In recent years, its trends become controversial after the report published by Mastenbroek et al. Preimplantation genetic screening (PGS) has been used more [7]. They found that PGS reduced the rates of pregnancies than 10 years for selecting genetically normal embryos giving and live births after IVF in women of AMA [7]. Actually the highest potential for preimplantation genetic diagnosis Mastenbroek was not the only one who claimed that PGS (PGD). PGS usually involves the aspiration of the first polar might not be as beneficial as expected. Conclusions drawn body from oocyte before fertilization or one or two cells from other studies in AMA patients after PGS showed that from a 5- to 8-cell embryo 3 days after insemination. Flu- PGS did not significantly improve implantation rate and orescence in situ hybridization (FISH), is often performed, pregnancy rate, on the contrary it worsened the outcome using probes for a specific number of chromosomes most [8, 9]. commonly involved in aneuploidy. The presence or absence In this paper, we will acknowledge the importance of of a normal pair of chromosomes can be identified visually aneuploidy screening and review the findings of currently by color, so we can eliminate the abnormal embryos and published studies of PGS, in order to discuss the efficacy of select normal embryos for transfer [1]. Thus, choosing this technique. embryos selected by PGS with normal chromosomes should increase implantation rate and live-birth rate and reduce miscarriages. The indications of PGS include advanced 2. Indications of PGS in AMA, RM, RIF maternal age (AMA), repeated implantation failure (RIF), and Severe Male-Factor Infertility repeated miscarriage (RM), and severe male-factor infertility [2]. Aneuploidies, that is, deviations from the regular number Currently, there have been a great many studies into in of chromosomes, are predominantly the result of mald- vitro fertilization (IVF) or intracytoplasmic sperm injection istributions of chromosomes during meiosis. Aneuploidy (ICSI) with and without PGS. Several of them found rates in oocytes and embryos are known to increase with that selecting embryos with normal chromosomes had a maternal age [10]. In a 40-year-old woman, an estimated significant impact on the implantation rate compared with 50% to 70% of the mature oocytes are affected by a the controls [3–6]. PGS has been advocated as a valuable chromosomal abnormality [11, 12]. In a series of 6733 2 Obstetrics and Gynecology International oocytes obtained during 1297 IVF cycles from patients of 3. Studies with Beneficial Outcome of PGS AMA (mean 38.5 years) [13], 3509 (52%) were aneuploidy, on the basis of FISH analysis using specific probes for 3.1. PGS in AMA. An early study published by Gianaroli chromosomes 13, 16, 18, 21, and 22. It is well known that et al. [3] on 157 cycles (73 for PGS group and 84 controls) the age-related increase in aneuploidy rate is correlated with with AMA using FISH in analysis of chromosomes X, Y, 13, a reduced implantation and a higher abortion rate. Most 14, 15, 16, 18, 21, and 22 in a blastomere biopsied from evidence collected so far suggests that failed implantation day 3 embryos showed that 64% of embryos presented with due to embryo aneuploidy rather than failed conception chromosomal abnormalities. 22 cycles in the study group had is the primary cause responsible for low human fertility clinical pregnancies versus 25 cycles in the control group, [14]. To date, these patients revealed an aneuploidy rate whereas in the study group, the mean number of embryos of over 50%, suggesting the practical relevance of PGS transferred per patient was significantly lower (2.2 ± 0.9 to women of advanced reproductive age. Screening for versus 3.2 ± 0.9), and the implantation rate was higher in aneuploidy in preimplantation embryos may help select comparison with the control group (25.8% versus 14.3%; the best embryo to transfer and may open the way to P<.01). Concomitantly, the implantation rate per pregnant significant improvements in live-birth rates from IVF/ICSI, patient was superior in the study group compared with the especially relevant for more effective single embryo transfer controls (57.9% versus 38.5%; P<.05). More interestingly, [15]. AMA patients, here defined as 35 years, are a good these patients were arbitrarily divided into three classes of target group to assess the possible benefit of aneuploidy age: 36–37 years, 38–39 years, and 40 years; the pregnancy screening. and implantation rates characterized in the control group RM is defined when two or more consecutive sponta- revealed a significant decrease when patients aged 38 neous abortions occur, which affects 1% of couples trying years. Conversely, in the study group, the percentages of to conceive [16]. The number of miscarriages stands out as pregnancy and implantation did not differ among the three a predictor of the chromosome abnormality rate,which is classes of age, and the implantation rate observed in the directly proportional to the number of miscarriages. A study oldest categories (38 years) was significantly higher after of 108 couples with history of repeated abortions found aneuploidy screening than the controls. that chromosome abnormalities were found in 5% of the Verlinsky et al. [28] performed a study of polar body couples with two abortions, in 10.3% with three abortions, diagnosis (PBD) with IVF cycles from patients of AMA. 5590 and in 14.3% with four or more abortions [17]. The most oocytes were obtained from 917 cycles and tested by polar common anomaly observed in abortus is aneuploidy, and body sampling and FISH analysis using specific probes for reported aneuploidy rate could reach to 34–66% [18, 19]. chromosomes 13, 16, 18, 21, and 22, this resulted in 22.2% This result suggested that aneuploidy was a common cause clinical pregnancies and 140 healthy children born. It seems of RM, and led to the proposal that PGS may be beneficial in that polar body testing provides an approach for improving these patients. pregnancy rate in IVF patients of AMA. But no control RIF can be defined as the failure of a couple to conceive group was presented in this report. Another study of women after the transfer of 10 or more good-quality embryos, or ageing 35 to 39 years with two or more previous IVF/ICSI after three IVF cycles [20]. Although multiple aetiologies, treatment trials showed that a higher implantation rate was such as disturbed endometrial receptivity, uterine pathology, achieved in the PBD group (17.5% versus 11.8%) [29]. These and an inadequate transfer technique, have been proposed, results suggested that an indication-based use of PBD could increased incidence of numerical chromosomal abnormali- certainly provide benefits in older patients. ties is obviously the most common cause [21]. It has been Some articles showed that aneuploidy screening in reported that the rate of chromosome abnormalities in the preimplantation embryos can also reduce embryo loss, embryos from RIF patients is almost twice as much as that increasing ongoing pregnancies and delivery rates. Munneet´ in the controls (67.4% versus 36.3%) [22]. Significantly al. [5] designed a multicentre IVF study to compare controls higher incidence of complex chromosome abnormalities and a test group that underwent aneuploidy screening, (which involves three or more chromosomes) was also found obtaining a significant improvement in the number of in RIF [23]. The generation of aneuploidy embryos was spontaneous abortions and ongoing pregnancies. Similar considered as a possible causative factor in RIF [24], and beneficial effects have been reported by other studies. it is suggested that PGS may improve the outcome in these Staessen et al. [8]observedatrendtowardasubsequent patients. higher ongoing implantation per transferred embryo rate Infertile couples due to severe male factor can be treated in tested group (16.5% versus 10.4%; P = .06). In the with ICSI. In order to generate normally fertilized oocytes recent study published in 2009 by Schoolcraft et al. [30], 62 after ICSI, a spermatozoon containing a functional genome infertile AMA couples undergoing fertility treatment were and centriole is required [25]. Current study in cases assigned to the PGS and control group. Results showed of macrocephalic spermatozoa demonstrated an increased that the implantation rates, the number of oocytes, oocyte incidence of chromosomal abnormalities, and the majority maturity, and fertilization rate were similar between the two of the abnormalities were aneuploidy [26, 27]. Due to the groups. Nevertheless, the authors noted that the spontaneous high incidence of aneuploidy these patients might benefit abortion rate was lower for the test group (25.9% versus from PGS owing to its effect of eliminating chromosomally 32.26% in the control group), resulting in an observed abnormal embryos. increase in delivery rate for the test group (78% versus Obstetrics and Gynecology International 3

67.74%). In addition, Hardarson et al. [9] found significantly biopsy [35]. The same group, comparing single-cell versus more good morphological quality embryos (GQEs) in the two-cell biopsy, demonstrated a detrimental effect of two- PGS group on day 3 compared with those found in the cell biopsy; they suggested that, if one-cell biopsy had control group. been used in their study, implantation rates may have improved. 3.2. PGS in RM, RIF, and Severe Male-Factor Infertility. Mastenbroek et al. [7] designed a multicenter, ran- The randomized, prospective study including 19 couples domized, double-blind, controlled trial. 408 women of with recurrent pregnancy loss (11 for PGS and 8 controls) AMA underwent 836 cycles of IVF, of which 206 women by Werlin et al. suggested an improved outcome after with 434 cycles were assigned to PGS and 202 women performing PGS [31]. Pregnancy rate was 63.6% in study with 402 cycles to the control group. The ongoing- group and 37.5% in controls. In another study performed pregnancy rate was significantly lower in the women assigned by Munne´ et al. [18], the rate of spontaneous abortions in to PGS (52 of 206 women, 25%) than in those not RM subjects undergoing PGS was compared with their own a assigned to PGS (74 of 202 women, 37%). The women priori expectations. After PGS, miscarriage rate was reduced assigned to PGS also had a significantly lower live-birth from previous 90% (expected 29%) to 23% in the women at rate (24% versus 35%) and reduced implantation rate of age <35 years, and from 86% (expected 44.5%) to 12% in the (11.7% versus 14.7%) compared with those in the control women at age 35 years. Similar results were also reported group. The study was criticized mainly for inappropri- by a multicenter retrospective controlled study [32], which ate patient selection, inadequate probe selection, possible showed that the spontaneous abortion rate in the PGS group biopsy-induced embryo damage, a low average number of was 14.1% for women ages 35–40 and 22.2% for over 40, embryos biopsied, and a high rate of undiagnosed embryos compared to 19.4% (P<.03) and 40.6% in the non-PGS [36, 37]. group (P<.001). In the Hardarson et al. study [9], 56 and 53 patients Improved outcomes in RIF were achieved with the with age 38 years were randomly assigned to the PGS selection of chromosomally normal embryos. In a study and control groups, respectively. Fertilization was performed with 57 RIF cycles by Pehlivan et al. [22], a pregnancy rate by IVF or ICSI following standard techniques and FISH of 34.0% and an implantation rate of 19.8% was observed analyzed by probes chromosomes X, Y, 13, 16, 18, 21, and in the PGS group. Recent data reported that, in women 22 in PGS group. Of the analyzed embryos (302 embryos), with unexplained RIF [33], two consecutive PGS cycles only 32.4% (98 of 302) had normal chromosome content showing euploidy embryo(s) were strongly associated with and70of98normalembryosweretransferred.Thenumber high ongoing pregnancy (40%) and implantation (18%) of patients who had embryos transferred was 45 (80.3%) rates. Conversely, the patients with no euploid embryos in in PGS group and 53 (100%) in control group (P = a PGS cycle were highly unlikely to achieve an ongoing .001). The clinical pregnancy rate/randomized patient in pregnancy in subsequent cycles. the PGS group was 8.9% compared with 24.5% in the Kahraman et al. compared the implantation and control group (P = .039). No significant differences were ongoing-pregnancy rates of PGS cycles with non-PGS cycles found in the implantation rates (11.4% versus 18.9%) or in cases with predominantly macrocephalic spermatozoa live-birth rate (5.4% versus 18.9%) per randomized patient and absolute teratozoospermia [34]. A statistically higher between the PGS group and the control group. As shown implantation rate as well as a significantly reduced missed in these randomized trials, no improvement in efficacy was abortion rate were found in PGS group (25.0% and 14.3%) observed. compared with non-PGS group (12.3% and 46.7%) 4.2. PGS in RM, RIF, and Severe Male-Factor Infertility. 4. Studies without Beneficial Outcome of PGS Platteau et al. designed prospective cohort PGS study in women with recurrent idiopathic miscarriages [19]. The 4.1. PGS in AMA. In the study by Staessen et al. [8] pregnancy results in the older group (37 years) were used FISH for the chromosomes X, Y, 13, 16, 18, 21, and disappointing, with an implantation rate of 2.77% and an 22 in AMA couples with a control group without PGS. ongoing-pregnancy rate of 2.94%. The probable cause for In the 400 (200 for PGS and 200 controls) couples were this poor result was that these older women had significantly allocated to the trial, ICSI was used to fertilize the oocytes, more chromosomally abnormal embryos than patients <37 and two blastomeres per embryo were removed on day 3 years (66.95% versus 43.85%). after injection and transferred on day 5. In this study, the As to the RIF, a prospectively randomized controlled trial implantation rates were not significantly different between of PGS in IVF/ICSI patients with recurrent failed implan- the two groups (17.1% in the test group versus 11.5% tation compared with conventional assisted reproduction in the control group). But the cycles that had embryos treatment procedures was carried out by Blockeel et al. transferred were significantly lower in test group (81 cycles [38]. A total of 139 patients underwent ovarian stimulation, versus 121; P<.001), and 38 couples in the test group and PGS was performed in 72 patients. No benefit to their had no genetically normal embryos to transfer. Less than implantation and clinical pregnancy rates was found. The expected success of PGS was attributed to a higher number implantation rate was 21.4% in the study group and 25.3% of embryos transferred in the control group (2.8 versus in the control group. Moreover, the clinical pregnancy rate 2.0) and the possible adverse effect of double-blastomere was much lower in the study group (25.0% versus 40.3%). 4 Obstetrics and Gynecology International

Although severe male-factor infertility is one of the PGS intensive. The long period required for hybridization (5 indications that have been put forward, current reports of days) has limited the widespread clinical implementation of PGS in severe male-factor infertility are rare. There is a lack this technique, as it is necessary to freeze all the embryos of scientific evidence to prove whether PGS is effective in after the biopsy. In addition, the survival rate of the thawed these patients. embryos was relatively poor (46% did not survive the thawing process). More recently, the development of highly 5. Reasons for Lack of Benefit in PGS efficient techniques has greatly reduced fears concerning the impact of cryopreservation on embryo viability. Array Technical reasons for lack of benefit in PGS include both CGH is one of the newest technologies developed for the biopsy damage to the remaining embryo that reduces its detection of a chromosomal imbalance; it is able to analyze developmental potential and limitations of current FISH the very limited amount of genetic material in a single cell technology that allows only a few chromosomes to be seen. and takes less time [42]. Accuracy microarray platforms also As a result, it is inevitable that some other abnormal chro- can offer the advantage of embryo fingerprinting and the mosomes will escape from detection [39]. Moreover, FISH potential for combined aneuploidy and single-gene disorder could be misdiagnosed by the probability of hybridization diagnosis [44].Thefirstreporttoshowapregnancyafter failure and the possibility that the fluorescent signals of two PGS using array CGH technology by Hellani et al. obtained chromosomes overlap each other. The testing of all chromo- a high pregnancy rate; six out of a total eight patients had somes would probably further increase observed aneuploidy embryos for transfer with five out of those six showing rates [40]. Mosaicism, a difference of the chromosomal positive pregnancy tests [45]. The result was encouraging constitution among individual cells in an embryo, is another and further studies on array CGH with larger sample sizes possible reason for confusion. A single blastomere that had will be required before it is suitable for clinical application. been biopsied might thus be classified as abnormal, whereas However, some disadvantages need to be addressed before the remaining blastomeres in the embryo are normal. Thus, array-CGH is suitable for clinical services. First of all, the the test results from the biopsied cell may not be an accurate accuracy needs further evaluation. Array sometimes gave indication of the embryo’s genetic status [41]. Besides incorrect results for chromosomes 2, 4, 9, 11, 17 and 22 [46]. technical limitations and mosaicism, contamination and Partial aneuploidy and imbalance of chromosome segments laboratory mistakes can also result in inaccurate diagnoses. are not currently detected. Besides, the present array CGH For example, DNA from sources other than the biopsied protocol is expensive and it doesn’t seem to fit easily into all cell may be read as part of the genetic analysis, mixup, or clinical PGS services. This requires us to find new ways to mislabeling of a sample or embryo from clinic or laboratory reduce costs and bring the advantages to more patients. mistakes in handling samples or embryos. All of these can lead to inaccurate results. 6.2. Blastocyst Biopsy. Blastocyst biopsy or trophectoderm biopsy is an emerging technique for performing PGS. It 6. Possible Future Trends in PGS shows several advantages over traditional day-3 biopsy [46]. One of them is more cells can be biopsied for genetic testing 6.1. Comparative Genomic Hybridization (CGH). Performed without damaging the inner cell mass. Biopsy at this stage on a single cell basis, CGH enables the assessment of all has little, if any, impact on the further development of the the chromosomes by comparing the studied DNA with a blastocysts. The data from McArthur et al. demonstrates high normal sample. In brief, normal DNA samples are labelled blastocyst survival rates with excellent implantation rates and with red and test DNA with green fluorochromes, and then low rates of twinning or miscarriage [47]. Recently, a study applied to a slide where hybridization occurs for 48–72 h involving 399 egg retrievals and 1879 embryo biopsies for [42]. The advantage of CGH over the conventional FISH is patients undergoing PGD to avoid a serious monogenic dis- that the copy number of all chromosomes can be determined. ease or an unbalanced chromosomal translocation has been CGH can provide a genome-wide profile without any prior published. The implantation rates per embryo transferred information of the chromosomal aberration [40]. were 43.4% if biopsied at the blastocyst stage and 25.6% Fragouli et al. [43] collected 270 oocytes from the 16 if biopsied at the cleavage stage (P<.01), with ongoing female patients (average age 38.4 years) and 168 embryos or live-birth pregnancy rates per egg retrieval at 34.2% were fertilized on day 3 (average 12 embryos per patient, (average transfer number 1.1) for blastocyst biopsies and range 6–18). Of the 168 embryos, 78 (46.4%) were cultured 25.5% (transfer number 1.6) for cleavage stage biopsies (P< further to the blastocyst stage and underwent trophectoderm .05). The results mean that taking the biopsy later in embryo biopsy with CGH screening. Their data displayed high development conferred considerable efficacy through not implantation and pregnancy rates for the patients with RIF testing embryos whose development was compromised [48]. who have received blastocyst analysis [43]. CGH yielded Nevertheless, more data is still needed to confirm these results for 73 of the 78 blastocysts, leading to a diagnostic promising results. efficacy of 94%. Of these, 40 were classified as euploidy and 24 were transferred in 13 patients, leading to nine 7. Conclusions ongoing pregnancies from 13 completed cycles (69.2%) and the implantation rate was 58.3% (14/24 ETs). The In conclusion, the efficacy of PGS is still controversial. limitations of CGH are that it is time-consuming and labour According to the studies, there is still insufficient evidence to Obstetrics and Gynecology International 5 support a beneficial effect of PGS in AMA women. The use [12] A. Kuliev, J. Cieslak, and Y. Verlinsky, “Frequency and dis- of PGS applied for RM, RIF and severe male factor infertility tribution of chromosome abnormalities in human oocytes,” needs more scientific data from clinical trials. The routine Cytogenetic and Genome Research, vol. 111, no. 3-4, pp. 193– use of PGS to avert the birth of an aneuploidy infant is still in 198, 2005. question. Application of micro-CGH and blastocyst biopsy [13] A. Kuliev, J. Cieslak, Y. Ilkevitch, and Y. Verlinsky, “Chro- might be new approaches for improvement of the efficacy of mosomal abnormalities in a series of 6733 human oocytes PGS. Furthermore, the cost-effectiveness of PGS for the IVF in preimplantation diagnosis for age-related aneuploidies,” Reproductive BioMedicine Online, vol. 6, no. 1, pp. 54–59, patients should be considered. 2003. [14] N. S. Macklon, J. P. M. Geraedts, and B. C. J. M. Fauser, Acknowledgments “Conception to ongoing pregnancy: the ‘black box’ of early pregnancy loss,” Human Reproduction Update,vol.8,no.4,pp. Ning Wang and Ying-Ming Zheng are contributed equally 333–343, 2002. to this paper. The research was supported by National Basic [15] P. Devroey and B. C. Fauser, “Preimplantation aneuploidy Research Program of China (2007CB948104) and Natural screening: a research tool for now,” The Lancet, vol. 370, no. Science Foundation Projects of Zhejiang (Z207021). 9604, pp. 1985–1986, 2007. [16] S. Tzioras, N. P. Polyzos, and D. L. Economides, “How do References you solve the problem of recurrent miscarriage?” Reproductive Biomedicine Online, vol. 19, no. 3, pp. 296–729, 2009. [1] B. C. J. M. Fauser, “Preimplantation genetic screening: the end [17] A. Kiss, R. F. M. Rosa, R. P. Dibi et al., “Chromosomal ff of an a air?” Human Reproduction, vol. 23, no. 12, pp. 2622– abnormalities in couples with history of recurrent abortion,” 2625, 2008. Revista Brasileira de Ginecologia e Obstetricia, vol. 31, no. 2, pp. [2] J. Harper, K. Sermon, J. Geraedts et al., “What next for 68–74, 2009. preimplantation genetic screening?” Human Reproduction, [18] S. Munne,´ S. Chen, J. Fischer et al., “Preimplantation genetic vol. 23, no. 3, pp. 478–480, 2008. diagnosis reduces pregnancy loss in women aged 35 years and [3] L. Gianaroli, M. C. Magli, A. P. Ferraretti, and S. Munne,´ older with a history of recurrent miscarriages,” Fertility and “Preimplantation diagnosis for aneuploidies in patients Sterility, vol. 84, no. 2, pp. 331–335, 2005. undergoing in vitro fertilization with a poor prognosis: iden- [19] P. Platteau, C. Staessen, A. Michiels, A. Van Steirteghem, I. tification of the categories for which it should be proposed,” Liebaers, and P. Devroey, “Preimplantation genetic diagnosis Fertility and Sterility, vol. 72, no. 5, pp. 837–844, 1999. for aneuploidy screening in patients with unexplained recur- [4] L. Gianaroli, A. Fiorentino, M. C. Magli, J. Garrisi, A. P. rent miscarriages,” Fertility and Sterility,vol.83,no.2,pp. Ferraretti, and S. Munne,´ “Preimplantation genetic diagnosis 393–397, 2005. increases the implantation rate in human in vitro fertiliza- [20] A. R. Thornhill, C. E. deDie-Smulders, J. P. Geraedts et tion by avoiding the transfer of chromosomally abnormal al., “ESHRE PGD Consortium ‘Best practice guidelines for embryos,” Fertility and Sterility, vol. 68, no. 6, pp. 1128–1131, clinical preimplantation genetic diagnosis (PGD) and preim- 1997. plantation genetic screening (PGS)’,” Human Reproduction, [5] S. Munne,´ C. Magli, J. Cohen et al., “Positive outcome after vol. 20, no. 1, pp. 35–48, 2005. preimplantation diagnosis of aneuploidy in human embryos,” Human Reproduction, vol. 14, no. 9, pp. 2191–2199, 1999. [21] P. Donoso, C. Staessen, B. C. J. M. Fauser, and P. Devroey, [6] S. Munne,´ M. Sandalinas, T. Escudero et al., “Improved “Current value of preimplantation genetic aneuploidy screen- implantation after preimplantation genetic diagnosis of ane- ing in IVF,” Human Reproduction Update,vol.13,no.1,pp. uploidy,” Reproductive BioMedicine Online,vol.7,no.1,pp. 15–25, 2007. 91–97, 2003. [22] T. Pehlivan, C. Rubio, L. Rodrigo et al., “Impact of preim- [7] S. Mastenbroek, M. Twisk, J. van Echten-Arends et al., “In plantation genetic diagnosis on IVF outcome in implantation vitro fertilization with preimplantation genetic screening,” failure patients,” Reproductive BioMedicine Online, vol. 6, no. The New England Journal of Medicine, vol. 357, no. 1, pp. 9– 2, pp. 232–237, 2003. 17, 2007. [23] L. Voullaire, V. Collins, T. Callaghan, J. McBain, R. [8] C. Staessen, P. Platteau, E. Van Assche et al., “Comparison of Williamson, and L. Wilton, “High incidence of complex blastocyst transfer with or without preimplantation genetic chromosome abnormality in cleavage embryos from patients diagnosis for aneuploidy screening in couples with advanced with repeated implantation failure,” Fertility and Sterility, vol. maternal age: a prospective randomized controlled trial,” 87, no. 5, pp. 1053–1058, 2007. Human Reproduction, vol. 19, no. 12, pp. 2849–2858, 2004. [24]V.I.Farfalli,M.C.Magli,A.P.Ferraretti,andL.Gianaroli, [9] T. Hardarson, C. Hanson, K. Lundin et al., “Preimplantation “Role of aneuploidy on embryo implantation,” Gynecologic genetic screening in women of advanced maternal age caused and Obstetric Investigation, vol. 64, no. 3, pp. 161–165, 2007. a decrease in clinical pregnancy rate: a randomized controlled [25] P. Devroey and A. Van Steirteghem, “A review of ten years trial,” Human Reproduction, vol. 23, no. 12, pp. 2806–2812, experience of ICSI,” Human Reproduction Update, vol. 10, no. 2008. 1, pp. 19–28, 2004. [10] C. Marquez,´ M. Sandalinas, M. Bahçe, M. Alikani, and S. [26] S. Viville, R. Mollard, M.-L. Bach, C. Falquet, P. Gerlinger, and Munne,´ “Chromosome abnormalities in 1255 cleavage-stage S. Warter, “Do morphological anomalies reflect chromosomal human embryos,” Reproductive Biomedicine Online, vol. 1, no. aneuploidies?” Human Reproduction, vol. 15, no. 12, pp. 2563– 1, pp. 17–26, 2000. 2566, 2000. [11]T.Hassold,P.A.Jacobs,M.Leppert,andM.Sheldon, [27] F. Devillard, C. Metzler-Guillemain, R. Pelletier et al., “Poly- “Cytogenetic and molecular studies of trisomy 13,” Journal of ploidy in large-headed sperm: FISH study of three cases,” Medical Genetics, vol. 24, no. 12, pp. 725–732, 1987. Human Reproduction, vol. 17, no. 5, pp. 1292–1298, 2002. 6 Obstetrics and Gynecology International

[28] Y. Verlinsky, J. Cieslak, V. Ivakhnenko et al., “Chromosomal [44] D. Wells, S. Alfarawati, and E. Fragouli, “Use of comprehensive abnormalities in the first and second polar body,” Molecular chromosomal screening for embryo assessment: microarrays and Cellular Endocrinology, vol. 183, no. 1, pp. S47–S49, 2001. and CGH,” Molecular Human Reproduction, vol. 14, no. 12, pp. [29] K. van der Ven, M. Montag, and H. Van Der Ven, “Polar body 703–710, 2008. diagnosis—a step in the right direction?” Deutsches Arzteblatt, [45] A. Hellani, K. Abu-Amero, J. Azouri, and S. El-Akoum, vol. 105, no. 11, pp. 190–196, 2008. “Successful pregnancies after application of array-comparative [30] W. B. Schoolcraft, M. G. Katz-Jaffe, J. Stevens, M. Rawlins, and genomic hybridization in PGS-aneuploidy screening,” Repro- S. Munne, “Preimplantation aneuploidy testing for infertile ductive BioMedicine Online, vol. 17, no. 6, pp. 841–847, 2008. patients of advanced maternal age: a randomized prospective [46]K.A.deBoer,J.W.Catt,R.P.S.Jansen,D.Leigh,andS. trial,” Fertility and Sterility, vol. 92, no. 1, pp. 157–162, 2009. McArthur, “Moving to blastocyst biopsy for preimplantation [31] L. Werlin, I. Rodi, A. DeCherney, E. Marello, D. Hill, genetic diagnosis and single embryo transfer at Sydney IVF,” and S. Munne,´ “Preimplantation genetic diagnosis as both Fertility and Sterility, vol. 82, no. 2, pp. 295–298, 2004. a therapeutic and diagnostic tool in assisted reproductive [47]S.J.McArthur,D.Leigh,J.T.Marshall,K.A.deBoer, technology,” Fertility and Sterility, vol. 80, no. 2, pp. 467–468, and R. P. S. Jansen, “Pregnancies and live births after 2003. trophectoderm biopsy and preimplantation genetic testing of [32] S. Munne,´ J. Fischer, A. Warner, S. Chen, C. Zouves, and human blastocysts,” Fertility and Sterility,vol.84,no.6,pp. J. Cohen, “Referring Centers PGD Group. Preimplantation 1628–1636, 2005. genetic diagnosis significantly reduces pregnancy loss in [48] S. J. McArthur, D. Leigh, J. T. Marshall, A. J. Gee, K. A. De infertile couples: a multicenter study,” Fertility and Sterility, Boer, and R. P. S. Jansen, “Blastocyst trophectoderm biopsy vol. 85, no. 2, pp. 326–332, 2006. and preimplantation genetic diagnosis for familial monogenic [33] K. Pagidas, Y. Ying, and D. Keefe, “Predictive value of disorders and chromosomal translocations,” Prenatal Diagno- preimplantation genetic diagnosis for aneuploidy screening sis, vol. 28, no. 5, pp. 434–442, 2008. in repeated IVF-ET cycles among women with recurrent implantation failure,” Journal of Assisted Reproduction and Genetics, vol. 25, no. 2-3, pp. 103–106, 2008. [34] S. Kahraman, S. Sertyel, N. Findikli et al., “Effect of PGD on implantation and ongoing pregnancy rates in cases with predominantly macrocephalic spermatozoa,” Reproduc- tive BioMedicine Online, vol. 9, no. 1, pp. 79–85, 2004. [35] V. Goossens, M. De Rycke, A. De Vos et al., “Diagnostic efficiency, embryonic development and clinical outcome after the biopsy of one or two blastomeres for preimplantation genetic diagnosis,” Human Reproduction,vol.23,no.3,pp. 481–492, 2008. [36] J. Cohen and J. A. Grifo, “Multicentre trial of preimplantation genetic screening reported in the New England Journal of Medicine: an in-depth look at the findings,” Reproductive BioMedicine Online, vol. 15, no. 4, pp. 365–366, 2007. [37] A. Kuliev and Y. Verlinsky, “Impact of preimplantation genetic diagnosis for chromosomal disorders on reproductive outcome,” Reproductive BioMedicine Online,vol.16,no.1,pp. 9–10, 2008. [38] C. Blockeel, V. Schutyser, A. De Vos et al., “Prospectively randomized controlled trial of PGS in IVF/ICSI patients with poor implantation,” Reproductive BioMedicine Online, vol. 17, no. 6, pp. 848–854, 2008. [39] D. Wells, “Advances in preimplantation genetic diagnosis,” European Journal of Obstetrics Gynecology and Reproductive Biology, vol. 115, pp. S97–S101, 2004. [40] D. Wells and B. Levy, “Cytogenetics in reproductive medicine: the contribution of comparative genomic hybridization (CGH),” BioEssays, vol. 25, no. 3, pp. 289–300, 2003. [41] S. Baruch, D. Kaufman, and K. L. Hudson, “Genetic testing of embryos: practices and perspectives of US in vitro fertilization clinics,” Fertility and Sterility, vol. 89, no. 5, pp. 1053–1058, 2008. [42] L. Wilton, “Preimplantation genetic diagnosis and chromosome analysis of blastomeres using comparative genomic hybridization,” Human Reproduction Update,vol.11,no.1,pp. 33–41, 2005. [43] E. Fragouli, M. Katz-Jaffe, S. Alfarawati et al., “Comprehensive chromosome screening of polar bodies and blastocysts from couples experiencing repeated implantation failure,” Fertility and Sterility. In press. Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 965905, 4 pages doi:10.1155/2010/965905

Research Article Study on the Imprinting Status of Insulin-Like Growth Factor II (IGF-II) Gene in Villus during 6–10 Gestational Weeks

Jianhong Chen, Qun Fang, Baojiang Chen, Yi Zhou, and Yanmin Luo

Department of Obstetrics and Gynecology, Fetal Medical Center, First Aﬃliated Hospital, Sun Yat-sen University, Guangzhou 510275, China

Correspondence should be addressed to Qun Fang, fang [email protected]

Received 31 October 2009; Accepted 12 May 2010

Academic Editor: Shi-Wen Jiang

Copyright © 2010 Jianhong Chen et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Objective. To compare the difference of imprinting status of insulin-like growth factor II (IGF-II) gene in villus between normal embryo development group and abnormal embryo development group and to investigate the relationship between karyotype and the imprinting status of IGF-II gene. Methods. A total of 85 pregnant women with singleton pregnancy were divided into two groups: one with abnormal embryo development (n = 38) and the other with normal embryo development (n = 47). Apa I polymorphism of IGF-II gene in chorionic villus was assayed with reverse transcriptase polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP). The relationship between chromosomal abnormal karyotype and IGF-II gene imprinting status was analyzed by primary cell culture and G-banding chromosomal karyotype analysis. Results. IGF-II imprinting loss rate was higher in the abnormal embryo development group than the normal embryo development group (44.7% versus 31.6%), but without significant difference (P>.05). The percentage of abnormal chromosomes of chorionic villus in the abnormal embryo development group was 42.5%, in which IGF-II imprinting loss rate reached 64.7%. No abnormal karyotypes were found in the normal embryo development group. However, there was significant difference in IGF-II imprinting loss rate between two groups (P>.05). Conclusion. During weeks 6–10 of gestation, abnormal embryonic development is correlated with chromosomal abnormalities. The imprinting status of IGF-II gene played important roles in embryonic development, and imprinting loss might be related to chromosomal abnormalities.

1. Introduction duplication, mutations, or alterations of imprinting of the only active allele as well as uniparental sisomy or loss of Genomic imprinting (also, namely, gene imprinting) is an imprinting of the inactive allele lead to and unbalance (loss epigenetic phenomenon inconsistent with the traditional of function or gain of function) in the dosage of the gene Mendelian inheritance. The definition of genomic imprint- product and may have phenotypic consequences. ing is that alleles from father or mother are modified when Insulin-like growth factors (IGFs) are polypeptides that they transmit genetic information to offspring, resulting play an important role in cellular proliferation and dif- in only one of alleles from father or mother expressed in ferentiation. Insulin-like growth factor II (IGF-II) is an offspring [1]. Imprinting is a dynamic process. It must important factor of human early embryo and placenta be possible to erase and re-establish the imprint through development, and its roles are closely related with the gene each generation. The nature of the imprint must therefore imprinting status [2]. Thus, gene imprinting loss will lead be epigenetic (modifications to the structure of the DNA to abnormal embryonic development. During the process rather than the sequence). The majority of imprinted genes ofhumanfetaldevelopment,3to8gestationalweeksare are related with embryonic development. The parental- the most important. Any factor impacting nutrition supply specific expression is obtained through epigenetic modifica- and transmission of embryonic growth and development tions (DNA methylation, histone tail modifications) which can result in abnormal differentiation of embryos and alter the conformation of chromatin fiber and therefore abortion. Spontaneous abortion accounts for 10–15% of all regulate the expression of the underlying genes. Deletions, pregnancies and the majority of them are early spontaneous 2 Obstetrics and Gynecology International abortion. At present, embryonic chromosomal abnormality in a 37◦C water bath for 60 min, followed by adding is a recognized etiological factor. Therefore, we detected 2 ml prefixing liquid, mixing, centrifugation, discarding IGF-II gene imprinting status and chromosomal karyotype supernatant, fixation with 6 ml 1 : 3 fixing solution for of villus in patients with embryonic growth arrest and 2 min, centrifugation for 10 min, discarding supernatant, investigate the relationship between them. adding 60% acetic acid, 2 ml methanol 2-3 min later, mixing, centrifugation, discarding supernatant, fixation with 4 ml 1 : 3 fixing solution for 1 h, discarding supernatant, 2. Materials and Methods preparing 1-2 conventional G-banding chromosome. At least 15 splitphases were observed, and karyotype analysis 2.1. Subjects. Case group: 47 pregnant women who visited wasperformedin3phasesineachspecimen. outpatient clinic of family planning and eugenic genetics in First Affiliated Hospital of Sun Yat-sen University because of single gestation sac, empty embryo pregnancy, and 2.2.2. Detection of IGF-II Gene Polymorphism. Chorionic embryonic development arrest from April 2002 to January villus genomic DNA was extracted with saturated phenol 2004 were enrolled in this study. The informed consent and chloroform, and then IGF-II gene polymorphism was was obtained from all subjects before participating in this detected by polymerase chain reaction (PCR)-restriction study. The inclusion criteria of this group included: B-type fragment length polymorphism analysis. The total volume ultrasonography that revealed embryonic growth arrest or of PCR reaction system was 50 μL, including template DNA no embryo observed by repeated B-type ultrasonography; 600 ng, 10× PCR reaction solution 5 μL, 10 U/μLTaqenzyme regular menstrual cycle 3 months before pregnancy; 6–10 (TaKaRa Inc., Japan) 0.5 L, 10 mmol/L dNTPs 1 μL, upstream gestational weeks; no case history of endocrine diseases primer 1 μL, and downstream primer 1 μL(designforApa and cancer; no administration with hormone drugs dur- I polymorphic restriction site of 9th exon of IGF-II gene). ing pregnancy; serum Toxplasma (TOX), Nubbavirs (RV), PCR reaction conditions were as follows: predenaturation at 94◦C for 5 min, 35 cycles of denaturation at 94◦Cfor Cytomegalo virus (CMV), Herpes simplex virus (HSV) ◦ ◦ infection detection was negative. In this group, the mean age s, annealing at 55 C for 40 s and extension at 72 Cfor 40 s, final extension at 72◦C for 7 min. IGF-II gene PCR was 26.7+0.2 years and the mean gestational age was 7.2+0.1 ◦ weeks. products (236 bp) were digested overnight at 25 Cwith Control group: at the same time, 38 women of normal restriction enzyme ApaI (BioLabs). Subsequently, their geno- early pregnancy with single gestation sac were randomly types were analyzed with 1.5% agarose gel electrophoresis. selected. B-type ultrasonography revealed that embryonic IGF-II genes expressed diallele (236 bp, 173 bp and 63 bp development was normal as well as embryo and fetal heart fragments (type AB)), indicating that the loss of imprinting beat. In this group, the mean age was 27.3+0.3yearsand occurred while monoalle (only 236 bp fragment (type A) the mean gestational age was 6.9+0.2 weeks. There were no or only 173 bp and 63 bp fragments (type B)), indicating ff normal imprinting status. IGF-II upstream and downstream significant di erences in age, gestational age, and number of pregnancies between the two groups. primers were 5 -CTTGGACTTTGACTCAAATTGG-3 and 5-CCTCCTTTGGTCTTACTGGG-3,respectively.

2.2. Methods 2.2.3. IGF-II Gene Imprinting Status Detection. Chorionic villus IGF-II gene imprinting status was detected by reverse 2.2.1. Chorionic Villus Cell Culture and Chromosome Analysis. transcription-polymerase chain reaction (RT-PCR) and ApaI Chorionic villus cell culture: During the termination by restriction enzyme digestion. Heterozygous genomic DNA artificial abortion, chorionic villi were collected under sterile specimens (type AB) were selected to extract RNA. QIAGEN conditions then dissected under a dissecting microscope. The Poly A+ mRNA extraction kit (Germany) and RT-PCR (two- dissected chorionic villi were separated and washed repeat- step) kit (Invitrigen company, USA) were used in this study edly with ice-cold normal saline to remove attached blood following the instructions. PCR reaction and Apa I restric- and deciduas, then shredded, digested with 0.25% trypsin for tion enzyme digestion method of RT-PCR products were 5 min, followed by centrifugation at 1000 r/min for 10 min, similar to IGF-II gene polymorphism detection (Figure 1). and discarding supernatant. Subsequently, 1 ml collagenase II (sigma company, USA) was added into the sediments. 5 min later, supernatant was removed after centrifugation 2.2.4. Statistical Analyses. All statistical analyses were per- at 1000 r/min, and the sediments were resuspended in formed by SPSS version 13.0 statistical software. The data in 2 ml complete medium (Complete Amnio Max, Invitrigen each group is presented as the mean ± SD, and comparison company, USA), and cell suspension was transferred into two between groups was determined by χ2 test, with P<.05 flasks (about 1 ml). Cell growth was daily observed under considered significant. inverted microscope. When cell fusion and good vitality were found in 40%–50% of cells, the cells were harvested for 3. Results chromosome analysis. G-banding chromosome preparation: Colchicine 3.1. Primary Culture of Chorionic Villus Cells and Chro- (0.15 μg/ml final concentration) was added in the harvested mosome Karyotype Analysis. In this study, a total of 47 cell suspensions. Subsequently, the mixture was put cases of chorionic villus were cultured in the abnormal Obstetrics and Gynecology International 3

123456789M Table 2: IGF-II gene imprinting status in the abnormal and normal embryonic development groups.

500 bp Group Genotype AA/BB AB 236 bp 250 bp n % n % 173 bp Normal group 26 68.4 12 31.6 100 bp 63 bp Abnormal group 26 55.3 21 44.7 M:Marker;1,2,4,7,8:Atype-monoallelic (chromosomal abnormality) 6 35.3 11 64.7 expression; 3: B type-monoallelic expression; 5, 6, 9: A, B, and AB indicates three kinds of genetic imprinting status, AA/BB AB type-diallelic expression, gene imprinting loss indicate normal imprinting, AB indicates gene imprinting loss. Figure 1: IGF-II gene imprinting status detected by RT-PCR.

2 Table 1: Villus karyotype analysis of embryonic maldevelopment. normal group, but without significant difference (χ = 1.52, P>.05). Gene imprinting loss rate of embryonic villus Chromosomal Caryotype n karyotype was similar between male and female, without abnormality type significant difference (Table 2). Trisomy 47, XX (XY), +21 4 The chromosomal abnormality rate was 42.5% in the 47, XX (XY), +8 1 abnormal embryonic development group. Of 17 specimens ff 47, XX (XY), +13 2 with abnormal karyotypes, 11 cases su ered from IGF-II Triplont 69, XXX 3 gene imprinting loss, with the loss rate up to 64.7%. While, no abnormal villus chromosomal karyotype analysis was 69, XXY 2 found in the normal embryonic development group. There Haplotype 45, XO 1 was no significant difference between two groups (χ2 = 5.3, Other 46, XY, t (9; 22) (p13; p12) 1 P<.05). 46, XX/46, XY 1 46, XX, del (5) (p15) 1 46, XX, 4. Comment → → 1 i(10)(qter cen qter) 4.1. Primary Culture of Chorionic Villus Cells in Embryonic Total 17 Development Arrest. The culture time of chorionic villus cells from abortion or dead fetus depended on cell survival rate. The culture time was up to 3 to 4 weeks if there were embryonic development group, including culture failure in less active cells in tissues. Culture failure was defined as 6 cases, primary culture failure in 1 case because of villus cell growth arrest for more than one month [3]. There- degeneration, with a failure rate of 15%, while 38 cases in fore, timely specimen collection was crucial for successful the normal embryonic development group were successfully chromosomal detection for villus in embryonic development cultured. The mean culture time in abnormal and normal arrest. In 2002, Greenwold and Jauniaux [4] reported that ± ± embryonic development groups was 13.1 1.4d and6.8 ultrasound-guided sucking villus from early spontaneous 0.9 d, respectively. Obviously, the former was twice longer abortion could obtain only 4.5% of villus cell culture failure than the latter in culture time, which might be related with rate. In this study, the specimens were collected by vacuum the long time embryonic death, would cause villus necrosis, uterine aspiration, which was easily polluted by vaginal low activity. secretions. However, intrauterine collection for villus could G-banding chromosome karyotype analysis of chorionic reduce the risk of pollution and improve culture survival rate villus was normal in the normal embryonic development of villus. group while abnormal karyotype was 17 cases (42.5%) in Villus culture in 40 cases of embryonic development the abnormal embryonic development group, including male arrest showed that chromosomal abnormality was 42.5%, karyotype in 6 cases, female karyotype in 5 cases, 45, XO in indicating that nearly one half of fetus with chromosomal one case, 69, XXX in three cases and 69, XXY in 2 cases. One diseases (the majority was severe chromosomal abnormali- ff case of cat cry syndrome su ered from dead fetus at one time ties, resulting in severe imbalance of genetic materials) could and induced abortion was performed in second pregnancy not survive to birth, due to natural selection. Except chro- because cord blood chromosome analysis revealed cat cry mosome 1, triplont was found in all human chromosomes. syndrome. This unwanted pregnancy expressed embryonic Of them, triplont in chromosome 1 accounted for one third development arrest, and its chorionic villus chromosomes of all triplonts and was one kind of highly lethal triplont. The were 46, XX and del (5) (p15). The detailed karyotypes were other common triplonts included triplonts in chromosomes as shown in Table 1. 21 and 22 [5]. Except triplont in chromosome 21, other triplonts could not survive [6]. Autosomal triplont was 3.2. Villus IGF-II Gene Imprinting Status. In the abnormal the most common chromosomal abnormality in embryos. embryonic development group, the imprinting loss rate of The experimental findings in this study confirmed this IGF-II gene was 44.7%, which was higher than 31.6% in the phenomenon. 4 Obstetrics and Gynecology International

4.2. IGF-II Gene Imprinting Loss and Embryonic Development. References The balance of cell apoptosis and proliferation was crucial to maintain pregnancy, and its functional regulation disorder [1] F. Gurrieri and M. Accadia, “Genetic imprinting: the paradigm might lead to early embryonic development arrest. Warner of prader-willi and angelman syndromes,” Endocrine Develop- ment, vol. 14, pp. 20–28, 2009. deemed that the dynamic balance of speed of development [2] Q. Fang, Y.-X. Wang, and Y. Zhou, “Insulin-like growth factor and apoptosis was an internal factor of embryo survival. binding protein 1 and human embryonic development during In the process of embryonic development, development 6-10 gestational weeks,” Chinese Medical Journal, vol. 117, no. and apoptosis-related genes, cytokines and corresponding 4, pp. 488–491, 2004. receptors played important roles in embryonic survival [7]. [3]G.H.Lu,C.S.Du,Y.Y.Hang,etal.,Prenatal Diagnosis of Imprinted genes of germ cells cycled with reproductive Genetic Diseases, Guangdong Science and Technology Press, cycle through three phases of erase, formation, and main- Guangzhou, China, 1st edition, 2002. tenance. After fertilization, the majority of genes experi- [4] N. Greenwold and E. Jauniaux, “Collection of villous tissue enced re-demethylation, while imprinted genes maintained under ultrasound guidance to improve the cytogenetic study original methylation status before and after fertilization and of early pregnancy failure,” Human Reproduction, vol. 17, no. nidation due to the protection of differentially methylated 2, pp. 452–456, 2002. regions. Meanwhile, internal and external environment [5] D. Warburton, “Cytogenetics of reproductive wastage: from conception to birth,” in Medical Cytogenetics, pp. 213–246, changes could lead to genetic alternations and gene imprint- Marcel Dekker, New York, NY, USA, 2000. ing loss. This study showed that IGF-II gene imprinting [6] A. E. Sullivan, R. M. Silver, D. Y. LaCoursiere, T. F. Porter, loss in the embryonic development arrest group was slightly and D. W. Branch, “Recurrent fetal aneuploidy and recurrent higher than the normal group, without significant difference. miscarriage,” Obstetrics and Gynecology, vol. 104, no. 4, pp. However, IGF-II gene imprinting loss of 17 abnormal kary- 784–788, 2004. otypes in the abnormal embryonic development group was [7] C. M. Warner, W. Cao, G. E. Exley et al., “Genetic regulation significantly higher than the normal embryonic development of egg and embryo survival,” Human Reproduction, vol. 13, no. group. Thus, we speculated that chromosomal abnormalities 3, pp. 178–196, 1998. of embryos could result in abnormal function expression of [8]S.J.Kim,S.E.Park,C.Leeetal.,“Alterationsinpromoter regulatory genes in early embryonic development, leading to usage and expression levels of insulin-like growth factor-II and increased IGF-II gene imprinting loss, which might destroy H19 genes in cervical carcinoma exhibiting biallelic expression of IGF-II,” Biochimica et Biophysica Acta, vol. 1586, no. 3, pp. the balance between villus and deciduas, leading to shallow 307–315, 2002. embryo implantation, spontaneous abortion, and embryonic [9] K. Nosho, H. Yamamoto, H. Taniguchi et al., “Interplay development arrest. However, the collected data in this study of insulin-like growth factor-II, insulin-like growth factor- was relatively less, and thus there should be a bigger sample I, insulin-like growth factor-I receptor, COX-2, and matrix size, to further discuss and explore whether IGF-2 imprinting metalloproteinase-7, play key roles in the early stage of loss was a new molecular genetic marker of spontaneous colorectal carcinogenesis,” Clinical Cancer Research, vol. 10, abortion or not. no. 23, pp. 7950–7957, 2004. Some scholars believe that IGF-II gene imprinting loss [10] W.-Z. He, Y. Qin, B. Li, J.-Y. Liu, Z.-L. Sun, and Z.-T. Sun, leads to overexpression [8, 9] because gene imprinting loss “The imprinting status and expression of insulin-like growth activates the original silent mother-derived alleles, resulting factor 2 gene in human hepatocellular carcinoma,” Journal of in two times of gene expression level and significantly Sichuan University (Medical Science Edition),vol.35,no.4,pp. elevated IGF-II protein expression. It was also deemed 466–469, 2004. [11] A. E. Micha, S. Hahnel,¨ H. Friess, M. W. Buchler,¨ G. Adler, that IGF-II gene imprinting loss could result in overgrow and T. M. Gress, “Genomic imprinting of IGF-II and H19 in diseases, including Beckwith-Wiedemann syndrome (BWS) adult human pancreatic tissues,” Digestion,vol.60,no.5,pp. as well as “fetal overgrowth syndrome”, resulting in prenatal 477–483, 1999. overgrowth, polyhydramnios, fetal, and neonatal deaths. [12] L. C. Giudice, F. De Zegher, S. E. Gargosky et al., “Insulin- However, some scholars also concluded that there were no like growth factors and their binding proteins in the term and significant correlation between IGF-II gene imprinting loss preterm human fetus and neonate with normal and extremes and IGF-II protein overexpression, and even IGF-II gene of intrauterine growth,” Journal of Clinical Endocrinology and imprinting loss resulted in the downregulation of IGF-II Metabolism, vol. 80, no. 5, pp. 1548–1555, 1995. protein expression [10–12]. Vambergue A et al. found that no [13] A. Vambergue, I. Fajardy, P. Dufour et al., “No loss of loss of genomic imprinting of IGF-II in placentas of diabetic genomic imprinting of IGF-II and H19 in placentas of diabetic pregnancies with fetal macrosomia [13]. pregnancies with fetal macrosomia,” Growth Hormone and IGF Research, vol. 17, no. 2, pp. 130–136, 2007. There might be a lot of complicated middle links between IGF-II gene imprinting loss and IGF-II expression regulation.

Acknowledgment This paper was supported by the National Natural Science Foundation of China (no. 30070788). Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 437528, 4 pages doi:10.1155/2010/437528

Clinical Study Effects of Assisted Reproduction Technology on Placental Imprinted Gene Expression

Yukiko Katagiri, Chizu Aoki, Yuko Tamaki-Ishihara, Yusuke Fukuda, Mamoru Kitamura, Yoichi Matsue, Akiko So, and Mineto Morita

Reproduction Center, Department of Obstetrics and Gynecology, Toho University Omori Medical Center, 6-11-1 Omori-Nishi, Ota-ku, Tokyo 143-8541, Japan

Correspondence should be addressed to Yukiko Katagiri, [email protected]

Received 30 September 2009; Accepted 16 June 2010

Academic Editor: Fan Jin

Copyright © 2010 Yukiko Katagiri et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

We used placental tissue to compare the imprinted gene expression of IGF2, H19, KCNQ1OT1, and CDKN1C of singletons conceived via assisted reproduction technology (ART) with that of spontaneously conceived (SC) singletons. Of 989 singletons examined (ART n = 65; SC n = 924), neonatal weight was significantly lower (P<.001) in the ART group than in the SC group, but placental weight showed no significant difference. Gene expression analyzed by real-time PCR was similar for both groups with appropriate-for-date (AFD) birth weight. H19 expression was suppressed in fetal growth retardation (FGR) cases in the ART and SC groups compared with AFD cases (P<.02 and P<.05, resp.). In contrast, CDKN1C expression was suppressed in FGR cases in the ART group (P<.01), while KCNQ1OT1 expression was hyperexpressed in FGR cases in the SC group (P<.05). As imprinted gene expression patterns differed between the ART and SC groups, we speculate that ART modifies epigenetic status even though the possibilities always exist.

1. Introduction health but also for long-term health. Here, we used human placental tissue to compare the imprinted gene expression Assisted reproduction technology (ART) is associated with of IGF2, H19, KCNQ1OT1, and CDKN1C genes known to epigenetic alterations [1–3] that can aﬀect fetal growth in be associated with fetal growth, in ART-conceived singletons animals and humans and usually results from imprinting. with that in spontaneously conceived (SC) singletons. Followup studies of ART-conceived children have shown that ART does not increase the incidence of congenital 2. Materials and Methods abnormalities [4–10]; however, it increases the incidence of epigenetic disorder diseases, such as Beckwith-Wiedemann A total of 1302 singletons delivered at our center from June Syndrome (BWS), Angelman Syndrome (AS), and Russell- 2005 to March 2007 were enrolled in this study. Of these 1302 Silver Syndrome (RSS) [11–17]. potential subjects, 313 were excluded due to complications. In BWS [MIM 130650] and RSS [MIM 180860], abnor- A total of 860 infants had appropriate-for-date (AFD) birth mal fetal growth is a major phenomenon, and abnormal weight (2500 g ≤ AFD birth weight < 3500 g), 64 cases prenatal development has been associated with the epigenet- exhibiting fetal growth retardation (FGR) had a birth weight ics of some imprinted genes. Reduced birth weight, which of <2500 g, and 65 cases had a birth weight of ≥3500 g. Thus, is occasionally observed in infants conceived by ART, is an 989 subjects (ART n = 65; SC n = 924) were assessed with important consideration as it is associated with adult diseases 3 idiopathic FGR cases in the ART group and 61 in the SC such as insulin insensitivity, polycystic ovary syndrome, and group (Table 1). cardiovascular diseases [18–20]. Therefore, normal prenatal For the gene expression study, placental tissue was development may be very important not only for childhood collected from 297 cases after receiving informed consent 2 Obstetrics and Gynecology International

Table 1: Subject characteristics. 1.2 1 ART (n)SC(n)Total(n) AFD (2500 g ≤, <3500 g) 62 798 860 0.8 FGR (≤ 2500 g) 3 61 64 0.6

OG (≥3500 g) — 65 65 expression 0.4 Total 65 924 989 0.2 n: number of cases, AFD: appropriate-for-date, FGR: fetal growth retar- Normalized to GAPDH 0 dation, OG: over growth, ART: assisted reproductive technology, and SC: IGF2 H19 KCNQ1OT1 CDKN1C spontaneous conception.

SC Table 2: Imprinted gene expression analysis in placental tissue ART samples. Figure 1: Gene expression of placental tissue. ART versus SC in ART (n)SC(n)Total(n) AFD birth weight cases. ART: assisted reproductive technology. SC: spontaneous conception. AFD: appropriate-for-date. Results of AFD (≥2500 g, <3500 g) 45 173 218 gene expression analysis compared with the endogenous control ≤ FGR ( 2500 g) 3 51 54 GAPDH. In AFD birth weight cases, gene expression patterns were OG (≥3500 g) — 25 25 similar in both the ART and SC groups. Total 48 249 297 n: number of cases, AFD: appropriate-for-date, FGR: fetal growth retar- 1 6 ∗∗∗ dation, OG: over growth, ART: assisted reproductive technology, and SC: . spontaneous conception. 1.4 ∗∗ ∗∗∗ ∗ 1.2 1 Table 3: Birth weight and placenta weight. 0.8 0 6 Weight (g) expression . n Neonate Placenta 0.4

ART 65 2905.1 ± 459.0∗ 589.3 ± 152.6 Normalized to GAPDH 0.2 SC 924 3607.9 ± 589.9∗ 613.0 ± 142.5 0 IGF2 H19 KCNQ1OT1 CDKN1C ∗P<.001. n: number of cases, ART: assisted reproductive technology, and SC: spontaneous conception. AFD ∗P<.01 ART in FGR ∗∗P<.02 SC in FGR ∗∗∗P<.05 under the IRB protocol of our center for genetic analysis Figure 2: Gene expression of placental tissue. ART versus SC in (Table 2). Total RNA was extracted from the fetal placenta, FGR cases. There were no differences in the gene expression of and reverse transcription was performed. Gene expressions IGF2; however, H19 expression was significantly reduced in FGR of IGF2, H19, KCNQ1OT1, and CDKN1C were analyzed cases both in the ART and SC groups compared with the AFD birth by real-time PCR with GAPDH serving as the endogenous weight cases (P < .02 and P < .05, resp.). Conversely, KCNQ1OT1 control. was hyperexpressed in FGR cases in the SC group (P < .05), while CDKN1C expression was reduced in FGR cases in the ART group (P < .01). 3. Results and Discussion The mean birth weight was significantly lower (P < .001) in the ART group (2905.1 ± 459.0 g) than in the SC group The results demonstrated that birth weight was signifi- (3607.9 ± 589.9 g). The mean placental weight, however, cantly lower in the ART group than in the SC group, which is showed no significant difference (ART = 689.3 ± 152.6 g; in agreement with the results of other studies [21–23]. Some SC = 613.0 ± 142.5 g) (Table 3). Gene expression patterns followup studies of ART-conceived children suggest that low in the AFD birth weight cases were similar in both the birthweightisduetomultiplepregnancies.However,even ART and SC groups (Figure 1). H19 expression was reduced in singleton cases, low birth weight has been observed in in FGR cases both in the ART and SC groups compared infants conceived by ART. For cases conceived using fresh with the AFD cases (P < .02 and P < .05, resp.) (Figure 2). embryo replacement, birth weight was comparably lower Conversely, H19 expression was significantly enhanced in SC than that for cases conceived using cryopreserved embryos caseswithabirthweightof≥3500 g (P < .01) (Figure 3). [24, 25]. Although we did not separate cases conceived with On the other hand, CDKN1C expression was reduced in fresh embryos and cryopreserved embryos, many cases in ART cases with FGR (P < .01), and KCNQ1OT1 appeared this study were conceived by fresh embryo replacement. to be hyperexpressed in SC cases with FGR (P < .05) On the other hand, placental weight showed no significant (Figure 2). The expression of other genes examined showed difference between the ART and SC groups. In other studies, no difference from the control. however, placental thickness was significantly larger in ART Obstetrics and Gynecology International 3

1.6 ∗∗ pregnancy, we speculate that epigenetic status is altered by 1.4 ∗ ∗∗ ART. Although ART has been widely accepted and safety per- 1.2 formed, epigenetics should remain an important factor for 1 evaluating the safe development of reproductive medicine, as 0.8 well as for considering the health of the next generation. 0 6 expression . 0.4 References Normalized to GAPDH 0.2 0 [1] E. R. Maher, “Imprinting and assisted reproductive technol- IGF2 H19 KCNQ1OT1 CDKN1C ogy,” Human Molecular Genetics, vol. 14, no. 1, pp. R133– R138, 2005. ∗ AFD P<.01 [2] C. Allen and W. Reardon, “Assisted reproduction technology ∗∗∗ FGR P<.05 and defects of genomic imprinting,” British Journal of Obstet- Over growth rics and Gynaecology, vol. 112, no. 12, pp. 1589–1594, 2005. [3] E. L. Niemitz and A. P. Feinberg, “Epigenetics and assisted Figure 3: Gene expression in placental tissue. FGR and birth weight reproductive technology: a call for investigation,” The Amer- ≥3500 g cases in the SC group. H19 expression was significantly ican Journal of Human Genetics, vol. 74, no. 4, pp. 599–609, reduced in FGR cases, but significantly enhanced in cases with a 2004. birth weight of ≥3500 g (P < .01). [4] M. Bonduelle, S. Desmyttere, A. Buysse et al., “Prospec- tive follow-up study of 55 children born after subzonal insemination and intracytoplasmic sperm injection,” Human cases than in SC cases, but there were no differences in Reproduction, vol. 9, no. 9, pp. 1765–1769, 1994. morphological or histopathological features of the placenta [5]M.Bonduelle,J.Legein,M.-P.Derdeetal.,“Comparative ff follow-up study of 130 children born after intracytoplasmic betweenbothgroups[26]. There were no di erences in the sperm injection and 130 children born after in-vitro fertiliza- gene expression patterns in the AFD cases between the ART tion,” Human Reproduction, vol. 10, no. 12, pp. 3327–3331, and SC groups. However, the expression of H19, a paternally 1995. methylated imprinted gene, was reduced in FGR cases in [6] M. Bonduelle, J. Legein, A. Buysse et al., “Prospective follow- both the ART and SC groups. As maternally expressed genes up study of 423 children born after intracytoplasmic sperm such as H19 enhance fetal development, the hypoexpression injection,” Human Reproduction, vol. 11, no. 7, pp. 1558–1564, of H19 affects fetal development. Here, we established 1996. the relationship between the hypoexpression of H19 and [7] M. Bonduelle, A. Wilikens, A. Buysse et al., “Prospective reduced fetal weight. Additionally, CDKN1C, another mater- follow-up study of 877 children born after intracytoplasmic nally expressed gene, exhibited reduced expression in FGR sperm injection (ICSI), with ejaculated epididymal and tes- cases conceived by ART. In contrast, the expression of ticular spermatozoa and after replacement of cryopreserved embryos obtained after ICSI,” Human Reproduction, vol. 11, KCNQ1OT1, a paternally expressed gene with a comple- supplement 4, pp. 131–155, 1996. mentary relationship to CDKN1C, was enhanced in FGR [8] M. Bonduelle, P. Devroey, I. A. Liebaers, A. Van Steirteghem, cases conceived by natural conception. In this study, we and Z. Rosenwaks, “Commentary: major defects are overesti- confirmed differences in the expression of imprinted genes mated,” British Medical Journal Articles, vol. 7118, pp. 1265– in the placental tissue of infants conceived by ART. However, 1266, 1997. even in the SC cases, epigenetic alteration has been observed. [9] G. D. Palermo, L. T. Colombero, G. L. Schattman, O. K. The loss of imprinting on genes located on chromosome Davis, and Z. Rosenwaks, “Evolution of pregnancies and initial 11 is identified as a cause of poor fetal growth in humans follow-up of newborns delivered after intracytoplasmic sperm [27], which is also reflected in our study. We postulate injection,” Journal of the American Medical Association, vol. that ART could affect the epigenetic characteristics of male 276, no. 23, pp. 1893–1897, 1996. and female gametes or it can have an impact on early [10] J. J. Kurinczuk and C. Bower, “Birth defects in infants embryogenesis. Additionally, ART could be associated with conceived by intracytoplasmic sperm injection: an alternative interpretation,” British Medical Journal, vol. 315, no. 7118, pp. an increased risk of genomic imprinting abnormalities as 1260–1266, 1997. epigenetic reprogramming occurs during gametogenesis or [11] M. R. DeBaun, E. L. Niemitz, and A. P. Feinberg, “Association immediately following fertilization [28–32]. of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and H19,” The American Journal of Human Genetics, vol. 72, no. 1, pp. 156–160, 2003. 4. Conclusions [12] E. R. Maher, L. A. Brueton, S. C. Bowdin et al., “Beckwith- Imprinted gene expression patterns of placental tissue in Wiedemann syndrome and assisted reproduction technology (ART),” Journal of Medical Genetics, vol. 40, no. 1, pp. 62–64, FGR cases were altered compared with cases of normal fetal 2003. growth. However, imprinted gene expression patterns of [13] C. Gicquel, V. Gaston, J. Mandelbaum, J.-P.Siffroi, A. Flahault, ff placental tissue in ART cases were di erent from those of SC and Y. Le Bouc, “In vitro fertilization may increase the risk cases. In cases with a birth weight of ≥3500 g, gene expression of Beckwith-Wiedemann syndrome related to the abnormal differed from cases with standard fetal growth. While we imprinting of the KCNQ1OT gene,” The American Journal of recognize the possibility of changes in epigenetic status in any Human Genetics, vol. 72, no. 5, pp. 1338–1341, 2003. 4 Obstetrics and Gynecology International

[14] G. F. Cox, J. Burger,¨ V. Lip et al., “Intracytoplasmic sperm [30] W. Reik, W. Dean, and J. Walter, “Epigenetic reprogramming injection may increase, the risk of imprinting defects,” The in mammalian development,” Science, vol. 293, no. 5532, pp. American Journal of Human Genetics, vol. 71, no. 1, pp. 162– 1089–1093, 2001. 164, 2002. [31] H. D. Morgan, F. Santos, K. Green, W. Dean, and W. Reik, [15] K. H. ∅rstavik, K. Eiklid, C. B. Van der Hagen et al., “Another “Epigenetic reprogramming in mammals,” Human Molecular case of imprinting defect in a girl with Angelman syndrome Genetics, vol. 14, no. 1, pp. R47–R58, 2005. who was conceived by intracytoplasmic sperm injection,” The [32] E. L. Niemitz and A. P. Feinberg, “Epigenetics and assisted American Journal of Human Genetics, vol. 72, no. 1, pp. 218– reproductive technology: a call for investigation,” The Amer- 219, 2003. ican Journal of Human Genetics, vol. 74, no. 4, pp. 599–609, [16] ∅. Lidegaard, A. Pinborg, and A. N. Andersen, “Imprinting 2004. disorders after assisted reproductive technologies,” Current Opinion in Obstetrics and Gynecology, vol. 18, no. 3, pp. 293– 296, 2006. [17] T. Ogata and M. Kagami, “Assisted reproductive technology and imprinting failure,” Journal of Mammalian Ova Research, vol. 23, pp. 158–162, 2006. [18] C. Junien, C. Gallou-Kabani, A. Vige,´ and M.-S. Gross, “Nutritional epigenomics of metabolic syndrome,” Medecine/Sciences, vol. 21, no. 4, pp. 396–404, 2005. [19] M. Eleftheriades, G. Creatsas, and K. Nicolaides, “Fetal growth restriction and postnatal development,” Annals of the New York Academy of Sciences, vol. 1092, pp. 319–330, 2006. [20] M. S. Martin-Gronert and S. E. Ozanne, “Experimental IUGR and later diabetes,” Journal of Internal Medicine, vol. 261, no. 5, pp. 437–452, 2007. [21] A. Hourvitz, S. Pri-Paz, J. Dor, and D. S. Seidman, “Neonatal and obstetric outcome of pregnancies conceived by ICSI or IVF,” Reproductive BioMedicine Online, vol. 11, no. 4, pp. 469– 475, 2005. [22] V. M. Allen, R. D. Wilson, A. Cheung, et al., “Pregnancy outcomes after assisted reproductive technology,” Journal of Obstetrics and Gynaecology Canada, vol. 28, no. 3, pp. 220– 250, 2006. [23]G.D.Palermo,Q.V.Neri,T.Takeuchi,J.Squires,F.Moy,and Z. Rosenwaks, “Genetic and epigenetic characteristics of ICSI children,” Reproductive BioMedicine Online,vol.17,no.6,pp. 820–833, 2008. [24] F. Belva, S. Henriet, E. Van Den Abbeel et al., “Neonatal outcome of 937 children born after transfer of cryopreserved embryos obtained by ICSI and IVF and comparison with outcome data of fresh ICSI and IVF cycles,” Human Reproduction, vol. 23, no. 10, pp. 2227–2238, 2008. [25] A. Pinborg, A. Loft, A. K. Aaris Henningsen, S. Rasmussen, S. Rasmussen, and A. Nyboe Andersen, “Infant outcome of 957 singletons born after frozen embryo replacement: the Danish National Cohort Study 1995–2006,” Fertility and Sterility.In press. [26] Y. Daniel, L. Schreiber, E. Geva et al., “Do placentae of term singleton pregnancies obtained by assisted reproductive technologies diﬀer from those of spontaneously conceived pregnancies?” Human Reproduction, vol. 14, no. 4, pp. 1107– 1110, 1999. [27] L. Guo, S. Choufani, J. Ferreira et al., “Altered gene expression and methylation of the human chromosome 11 imprinted region in small for gestational age (SGA) placentae,” Develop- mental Biology, vol. 320, no. 1, pp. 79–91, 2008. [28] S. Hartmann, M. Bergmann, R. M. Bohle, W. Weidner, and K. Steger, “Genetic imprinting during impaired spermatogenesis,” Molecular Human Reproduction, vol. 12, no. 6, pp. 407– 411, 2006. [29] A. Sato, E. Otsu, H. Negishi, T. Utsunomiya, and T. Arima, “Aberrant DNA methylation of imprinted loci in superovulated oocytes,” Human Reproduction, vol. 22, no. 1, pp. 26–35, 2007. Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 870865, 7 pages doi:10.1155/2010/870865

Review Article Speciﬁcity of Methylation Assays in Cancer Research: A Guideline for Designing Primers and Probes

Zeinab Barekati, Ramin Radpour, Corina Kohler, and Xiao Yan Zhong

Laboratory for Gynecological Oncology, Women’s Hospital and Department of Biomedicine, University of Basel, Basel 4031, Switzerland

Correspondence should be addressed to Xiao Yan Zhong, [email protected]

Received 20 February 2010; Accepted 21 June 2010

Academic Editor: Shi-Wen Jiang

Copyright © 2010 Zeinab Barekati et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

DNA methylation is an epigenetic regulation mechanism of genomic function, and aberrant methylation pattern has been found to be a common event in many diseases and human cancers. A large number of cancer studies have been focused on identification of methylation changes as biomarkers (i.e., breast cancer). However, still clinical use of them is very limited because of lack of specificity and sensitivity for diagnostic test. This highlights the critical need for specific primer and probe design to avoid false- positive detection of methylation profiling. The guideline and online web tools that are introduced in this paper might help to perform a successful experiment and to develop specific diagnosis biomarkers by designing right primer pair and probe prior to experimental step.

1. Introduction diagnosis, noninvasive diagnosis, prognosis, and prognosis therapy selection [7, 13–18]. DNA methylation of cytosine located 5 to a guanosine is Recent technology development has provided the anal- one of the most important modifications of genomic DNA ysis of DNA methylation in a genome-wide scale [19, 20] in eukaryotic cells. Methylation of cytosine at CpG dinu- which may not be easily accessible for many institutions. cleotides is described as an epigenetic regulation mechanism Thereby, in most of the research centers methylation assays of genomic function that plays an important role in different can be only determined on gene-by-gene-based methods biological processes including embryogenesis [1], genomic that use bisulfite conversion. The bisulfite reaction was first imprinting [2], X-chromosome inactivation, and cancer described in early 1970s [21, 22]. Since the first description [3, 4]. of bisulfite reaction in the application of studying CpG Aberrant methylation pattern has been found to be a sites, many methods based on the same principle have been common event in many cancers [5–7]. Global hypomethy- developed and categorized according to primer designing lation is considered to play a role in carcinogenesis; how- strategies. Based on primer designing strategies two dif- ever, local hypermethylation changes gene expression [8]. ferent DNA methylation assays are described, methylation- This hypermethylation alteration resulted in transcriptional independent-specific PCR (MIP) primers and methylation- inactivation followed by silencing of promoter at nearby specific PCR (MSP) primers [23]. tumor suppressor genes, contributing to development of Primer and probe design for methylation assays based cancer. The hypermethylation was thought to be an early on bisulfite conversion is challenging because of the DNA event in carcinogenesis [9–12]. A large number of studies in composition after bisulfite modification. One of the most cancers including breast cancer have focused on the use of critical steps for methylation study is designing primers and CpG island hypermethylation profiling as cancer biomarkers probes for the modified DNA and it needs special constrains in tissue and circulating cell-free DNA of patients, with on primers or probe and their location on the DNA. A large the aim of improving cancer treatment via accurate early number of studies have been focused on identification of 2 Obstetrics and Gynecology International biomarkers; however, the clinical use of these biomarkers is Table 1: The main characteristics for primer/probe designing in still very limited because of lack of specificity and sensitivity DNA methylation profiling techniques based on bisulfite conver- for diagnostic test. This highlights the critical need for sion. specific primer and probe design to avoid false-positive Primer/Probe Main characteristics detection of methylation. (i) No CpG sites within the sequence. We review a brief guideline of CpG island prediction, designing primers and probes for MIP and MSP assays that (ii) Including an adequate number of “C”s (no-CpG) in the sequence. are used for methylation studies based on bisulfite conver- MIP primer sion. Some important web-tools for methylation studies are (iii) Spanning a maximal number of CpG sites in the amplicon. introduced as well. (iv) Long length primer (25–30 mer). 2. CpG Island Prediction (v) Amplicon size maximum 500 bp. (i) Containing as much CpG sites as possible Methylation at the cytosine bases of CpG dinucleotide-rich especially at 3 -end of the primer. region mostly within 0.5–4 kb are known as CpG islands (ii) Considering the same CpG sites in the primer [24, 25]. Although analysis of the methylation status of sequence for methylated DNA and MSP primer some critical CpG sites as biomarkers are better than others, unmethylated DAN primers. it is essential to find CpG islands at the promoter region (iii) Similar Tm values for both the methylated of candidate genes which are in close proximity to the DNA and unmethylated DAN primers. transcription start site. (iv) Amplicon size maximum 500 bp. In order to predict CpG islands as target region, the fol- (i) Including CpG sites to maximize specificity. lowing rules should be applied. (ii) Including several “C”s (no-CpG) in the (I) If CpG island prediction is used for primer design Probe sequence. and more than one island is found, any of the (iii) Probes length 15–30 mer. predicted islands can be a target region for primer (iv) Amplicon size 50–150 bp (max 300 bp). selection. (II) If a CpG island size is smaller than the minimum product size, the primer pair should span the whole Toreduce bias of bisulfite-modified DNA against unmodified island. or incompletely modified DNA or even unsuccessful experimental PCR optimization, primer pair should be picked (III) If a CpG island size is greater than the maximum from a region that have adequate number of cytosines “C”s product size, the primer pair should be within the (no-CpG) in the original sequence [40]. Primer pairs with island. more “C”s will be preferred by receiving higher weighing (IV) If a CpG island size is between the minimum and scores and increasing the annealing temperature (Table 1). maximum product size, at least two thirds of the Besides general consideration for designing primer pair, the island region should be amplified. following constraints are enforced for MIP primer design.

3. Methylation-Independent-Specific (I) Primers should not contain any CpG sites within PCR (MIP) Primers their sequence to avoid discrimination against methylated or unmethylated DNA (Figure 1). ff MIP primers are used in di erent PCR-based methyla- (II) Primers should have an adequate number of “C”s tion analysis methods including bisulfite-sequencing PCR (no-CpG) in their sequence to amplify only bisulfite (BSP) (in 1992, [26]), pyrosequencing [27, 28], combined modified DNA. Primers with more “C”s will be bisulfite restriction analysis (COBRA) [29], methylation- preferred (at least 30%) [40](Figure 1). sensitive single-nucleotide primer extension (MS-SnuPE) [30–32], methylation-sensitive melting curve analysis (MS- (III) A good primer pair should span a maximal number MCA) [33], methylation-sensitive high-resolution melting of CpG sites in the selected amplicon to map as many (MS-HRM) [34], matrix-assisted laser desorption/ionization CpG sites as possible. time-of-flight (MALDI-TOF) mass spectrometry with base- specific cleavage and primer extension [35, 36], heavy methyl (IV) If CpG island prediction is not used for primer [37], and microarray DNA methylation profiling technique selection, selected amplicons must span at least based on bisulfite conversion, that is, methylation-specific 5 CpG sites as a default. oligonucleotide microarray (MSO) [38]. (V) Long length primer (25–30 mer) is preferred to Incomplete bisulfite modification of DNA is sometimes a ensure uniqueness of the primer [39]. concern [39] and results in high representation of methylation levels in studied samples. Successful application of MIP (VI) Primer sets should not amplify more than 500 bp methods depends on whether PCR primer could be designed because DNA degradation occurs by bisulfite modi- to amplify the complete modified fragment of interest. fication. Obstetrics and Gynecology International 3

m m ATGUTUAAUGAAUTCG···UG ··· CGTUUATTGUUGUTT ATGTTTAATGAATT AAATAACAACTAA Forward Reverse mm MIP ATGCTCAACGAACTCG··· CG··· CG TCCATTGCCGCTT

Bisulﬁte modiﬁcation (b) mm ATGUTUAAUGAAUTCG··· UG··· CGTUUATTGUUGUTT MSP mm ATGUTUAAUGAAUTCG··· UG ··· CGTUUATTGUUGUTT ATGTTTAATGAATTC GCAAATAAGAACTAA (a) (M)

Forward Reverse

(U) ATGTTTAATGAATTT ACAAATAAGAACTAA

(c) Figure 1: Primer design for DNA methylation profiling techniques based on bisulfite conversion. (a) First DNA is treated with sodium bisulfite to convert all unmethylated cytosines to uracil. To analyze DNA methylation status of the interest genes, converted DNA is amplified based on two different primer designing strategies: methylation-independent specific PCR (MIP) and methylation-specific PCR (MSP). (b) In MIP, DNA molecules are amplified using primer pairs containing cytosines (no-CpG) in their sequence. (c) In MSP, primer pairs are designed to specifically amplify either methylated (M) or unmethylated (U) DNA by containing CpG site in their sequence that makes possible to distinguish the methylated sequence from the unmethylated sequence.

4. Methylation-Specific PCR (MSP) Primers (III) Primers for methylated DNA and unmethylated DNA should contain the same CpG sites in their Methods based on MSP primers are considered to have the sequence. For example, a forward primer for highest analytical sensitivity and are designed to specifically methylated pair has this sequence: ATAAGTATT amplify either methylated or unmethylated DNA by using CGTTAATGGTTCGA, the forward primer in the primers that distinguish the methylated sequence from unmethylated pair must also contain the two CpG the unmethylated sequence [23, 40]. The precision and sites, for example, ATAAGTATTTGTTAATGGTT sensitivity of MSP depends on appropriate primer or probe TGA. But they may differ in length and start position design not prone to false-positive results [23]. MSP primers- [3]. based methods include methylation-specific PCR (MSP) [40], methylight [41, 42], SYBER green-based quantitative (IV) The two sets of primers for methylated and unmethylated DNA should have similar Tm values (max Tm MSP [43, 44], sensitive melting analysis after real-time MSP ff ◦ (SMART-MSP) [45], and methylation-specific fluorescent di erence 5 C). amplicon generation (MS-FLAG) [46]. The specificity of (V) Elimination of secondary structure formation and methylation-based PCR methods is achieved by appropriate primer-dimer pairs by increasing primer length. primer pair or probes design (Table 1). The following (VI) Primer sets should not amplify more than 500 bp constraints are recommended to reduce false-priming events because DNA degradation occurs by bisulfite modi- for amplification of methylated DNA. fication. (I) To discriminate between a methylated and unmethy- False-priming event can be prevented by designing appropri- lated DNA fragment, primers have to contain as ate primers and increasing annealing temperature. Having an much CpG sites as possible (at least one CpG) appropriate negative control in the experiment might help to preferably at the very 3 -end. At least one of the last find out false-priming events. three bases at 3-end of the primer has to be a CpG “C” (Figure 1). 5. Guidelines for Probe Designing (II) A part from CpG site(s) at the very 3-end, additional CpG sites in a primer sequence is preferred In methylation studies, the discrimination between methy- (Figure 1). lated and unmethylated DNA is achieved by three ways: 4 Obstetrics and Gynecology International design of primers that contain or does not contain CpG 6. Online Web Tools for Methylation Study sites, design of fluorescent labeled probe (for instance MSO and bead array), and design of the both primer 6.1. DNA Methylation Analysis Databases and probe, that is, methylight technology [41]. MIP and MSP methods are associated with false positive results. By (i) Entrez Gene: (http://www.ncbi.nih.gov/entrez). using fluorescent probes, for instance methylight method- (ii) GDB: Human Genome Database (http://www.gdb ology or applying heavy methyl probe-based method- .org/). ology, the false positives can be limited. Using probe (iii) DNA methylation database: public resource to as a detection method increases the specificity to dis- store and standardise DNA methylation data criminate between methylated and unmethylated DNA (http://www.methdb.de/). by designing probes that contain additional CpG sites [40]. The selection of new primer pairs for methylation- (iv) methBLAST: similarity search program designed to specific PCR and suitable hybridization probes for real- explore in silico bisulfite modified DNA, either or time PCR-based assays require the identification of the not methylated at its CpG dinucleotides (http:// CpG sites that are methylated (Table 1). Moreover, using medgen.ugent.be/methBLAST/). probe provides possibility to detect more than one target (v) DNA Methylation Society: an international scientific with multiplex reaction by different reporter dyes [38, society open to all those interested in any aspects of 47]. biological methylation (http://www.dnamethylation In addition probe-based assays can provide quantitative .net/). information; further advantages are the speed and high throughput of the 96-well-based, real-time PCR system 6.2. Promoter Prediction Tools and the omission of all postamplification steps, which has less labour and the risk of contamination. Also, the (i) FirstEF: first-exon and promoter prediction ffi e ciency of individual reactions is accessible from the program for human DNA (http://rulai.cshl.org/ slope of the amplification plot in the logarithmic phase. tools/FirstEF/). This allows for the direct quality control of every amplification reaction and the identification of samples con- (ii) Promoter 2.0 Prediction Server: Promoter 2.0 pre- taining impurities or poor template that interfered with dicts transcription start sites of vertebrate PolII optimal amplification and thereby with the quantification promoters in DNA sequences (http://www.cbs.dtu [48]. .dk/services/Promoter/). A general guideline for probe designing is described as (iii) WWW Promoter Scan: predicts Promoter regions follows. based on scoring homologies with putative eukaryotic Pol II promoter sequences (http://thr.cit.nih (I) The probe sequences should include 3 to 5 potential .gov/molbio/proscan/). methylation sites to maximize specificity and reduce (iv) McPromoter MM: The Markov Chain Promoter false-priming event. Prediction Server. McPromoter is a program aiming at the exact localization of eukaryotic RNA poly- (II) The probe binding sites should include several merase II transcription start sites (http://genes.mit cytosines in the original sequence to ensure speci- .edu/McPromoter.html). ficity for converted DNA and overcome false positives due to incomplete bisulfite conversion. 6.3. CpG Island Prediction Tools (III) Long repetitive stretches should be avoided. (i) CpG Island Searcher (http://cpgislands.usc.edu/). ◦ (IV) Probe Tm value should be 10 C higher than primers. (ii) CpG Plot (http://www.ebi.ac.uk/emboss/cpgplot/). (V) G + C content should be 30%–80%. (iii) MethPrimer (http://www.urogene.org/methprimer/).

(iv) CpGProD (CpG Island Promoter Detection): CpG- (VI) No G should be at the 5 end. ProD is a mammalian-specific software which pro- poses to identify the promoter regions associated (VII) Probes should have 15–30 mer in length. with CpG islands (CGIs). CpGProD uses the structural characteristics of the CGIs associated with (VIII) No more than two G + C should be at the 3 end. promoters (start CGIs). In the first step, CpGProD (IX) Amplicon size should be 50–150 bp (max 300 bp). searches for all the CGIs located over the sequences The PCR products should be as short as possible, and, in the second step, CpGProD identifies start to maximize efficiency (especially important for the CGIs and orientation of the potential promoters analysis of fragmented DNA isolated from formalin- (http://pbil.univ-lyon1.fr/software/). fixed, paraffin-embedded biopsies, and circulating (v) CpG island Explorer for local installation (http:// cell-free DNA). www.hku.hk/). Obstetrics and Gynecology International 5

6.4. Methylation PCR Primer Design Tools another concern especially when studying microdissected DNA samples. All these factors pose challenges to down- (i) MethPrimer: CpG island prediction, MSP, MSI stream PCR applications and primacy of designing primers primer design. By using this software 5 and 3 and probe for such PCR-based assays. Mostly, amplification ends of primer pair should have sites where con- of a product size greater than 500 bp is difficult after bisulfite- version has occurred (C to T). This is to avoid modified DNA template; hence, it might be better to set the amplification bias towards the unconverted sequence default product size range as 100–500 bp for primer design. (http://www.urogene.org/methprimer/). Another option that differs from standard PCR is primer (ii) BiSearch: BSP and MSP primer design (http://bi- length. Bisulfite conversion-based PCRs generally require search.enzim.hu/). longer primers. Primers with a length of approximately (iii) PerlPrimer: PerlPrimer is a free, open-source appli- 30 mer usually yield successful results [39]. The reason is that cation written in Perl that designs primers for bisulfite modification decreases considerably GC content of DNA templates and produces long stretches of “T”s in standard PCR, bisulfite PCR, real-time PCR (QPCR) ffi and sequencing. It aims to automate and simplify the sequence that makes it di cult to pick primers with the process of primer designing (http://perlprimer acceptable Tm values or stability. In other words, in order to .sourceforge.net/). discriminate modified DNA and unmodified or incompletely modified DNA, enough number of “C”s is required in (iv) BiQ Analyzer: software tool for easy visualiza- primers and probes, which makes picking stable primers tion and quality control of DNA methylation more demanding. Thus, to achieve better duplex stability, data from bisulfite sequencing (http://biq-analyzer. choosing longer primer is necessary as Tm of DNA. In bioinf.mpi-inf.mpg.de/). practice, size of primers for such PCR-based assays usually ranges from 20 to 30 mer [3, 40, 51]. 6.5. Methylation BLAST (metthBLAST). methBLAST (http:// Much more effort is needed to validate an experiment for medgen.ugent.be/methBLAST/) is a sequence similarity clinical use of biomarkers such as easy to use method, sensi- search program designed to explore in silico bisulfite modi- tivity and specificity, appropriate primers and probes, easily fied DNA (either or not methylated at its CpG dinucleotides) interpretable results, and cost-effectiveness. The guidelines to provide a search portal for validated methylation assays. and the online web tools that are introduced in this review The tool is mainly developed to find primer binding sites might help to have a successful experiment and to develop and hence addresses specificity for PCR-based assays that use specific diagnosis biomarkers by designing right primer pair bisulfite converted DNA as input material, including bisulfite and probe prior to experimental step. sequencing, methylation-specific PCR, COBRA, bisulfite- PCR-SCCP (BiPS), Ms-SNuPE, and PCR melting curve analysis. References [1] M. Monk, M. Boubelik, and S. Lehnert, “Temporal and 7. Discussion regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo The large number of investigations such as human ep- development,” Development, vol. 99, no. 3, pp. 371–382, 1987. igenome project (HEP) and cancer studies focused on [2] J. Singer-Sam and A. D. Riggs, “X chromosome inactivation DNA methylation analysis based on bisulfite modification and DNA methylation,” EXS, vol. 64, pp. 358–384, 1993. provided valuable information about methylation vari- [3] L.-C. Li, R. Chui, K. Nakajima, B. R. Oh, H. C. Au, and able positions that might influence genes activity (http:// R. Dahiya, “Frequent methylation of estrogen receptor in prostate cancer: correlation with tumor progression,” Cancer www.epigenome.org)[7, 16, 49, 50]. Increasing knowledge Research, vol. 60, no. 3, pp. 702–706, 2000. about methylation status of genes involved in carcinogenesis [4] D. Nojima, K. Nakajima, J. Franks, et al., “CpG methylation can lead to discovering new biomarkers that could be used of promoter region inactivates E-cadherin gene in renal cell for early detection, management, diagnosis or therapeutic carcinoma,” Molecular Carcinogenesis, vol. 32, no. 1, pp. 19– approaches in cancer patients. Developing biomarkers by 27, 2001. methylation analyzing methods requires accuracy, sensi- [5] A. Bird, “DNA methylation patterns and epigenetic memory,” tivity, low-false-positive and false-negative rates and high- Genes and Development, vol. 16, no. 1, pp. 6–21, 2002. throughput evaluation of single CpG sites. Although dif- [6] Z.-J. Liu and M. Maekawa, “Polymerase chain reaction- ferent useful technologies exist for methylation assessment, based methods of DNA methylation analysis,” Analytical no method is universal. While besides choosing a method Biochemistry, vol. 317, no. 2, pp. 259–265, 2003. according to type of samples and possessed laboratory special [7] R. Radpour, Z. Barekati, C. Kohler, W. Holzgreve, and X. Y. equipment, right choice of CpG island and primer or probe Zhong, “New trends in molecular biomarker discovery for breast cancer,” Genetic Testing and Molecular Biomarkers, vol. will minimize the risk of failed experiment. 13, no. 5, pp. 565–571, 2009. Right primer and probe design is crucial for successful [8] M. Esteller, “Epigenetics in cancer,” The New England Journal PCR amplification of bisulfite-modified DNA. Bisulfite reac- of Medicine, vol. 358, no. 11, pp. 1148–1159, 2008. tion not only causes the expected conversion of cytosines [9] M. Esteller, M. Sanchez-Cespedes, R. Resell, D. Sidransky, S. to uracils, but also causes undesired DNA strand breakage. B. Baylin, and J. G. Herman, “Detection of aberrant promoter Loss of DNA during the subsequent purification step is hypermethylation of tumor suppressor genes in serum DNA 6 Obstetrics and Gynecology International

from non-small cell lung cancer patients,” Cancer Research, Proceedings of the National Academy of Sciences USA, vol. 89, vol. 59, no. 1, pp. 67–70, 1999. no. 5, pp. 1827–1831, 1992. [10] M. J. Fackler, M. McVeigh, J. Mehrotra et al., “Quantitative [27]S.Colella,L.Shen,K.A.Baggerly,J.-P.J.Issa,andR. multiplex methylation-specific PCR assay for the detection Krahe, “Sensitive and quantitative universal Pyrosequencing of promoter hypermethylation in multiple genes in breast methylation analysis of CpG sites,” Biotechniques, vol. 35, no. cancer,” Cancer Research, vol. 64, no. 13, pp. 4442–4452, 2004. 1, pp. 146–150, 2003. [11] P. A. Jones and S. B. Baylin, “The fundamental role of [28] J. Tost, J. Dunker, and I. G. Gut, “Analysis and quantification epigenetic events in cancer,” Nature Reviews Genetics, vol. 3, of multiple methylation variable positions in CpG islands by no. 6, pp. 415–428, 2002. Pyrosequencing,” Biotechniques, vol. 35, no. 1, pp. 152–156, [12] M. Widschwendter and P. A. Jones, “DNA methylation and 2003. breast carcinogenesis,” Oncogene, vol. 21, no. 35, pp. 5462– [29] Z. Xiong and P.W. Laird, “COBRA: a sensitive and quantitative 5482, 2002. DNA methylation assay,” Nucleic Acids Research, vol. 25, no. [13] A. Aggerholm, M. S. Holm, P. Guldberg, L. H. Olesen, and P. 12, pp. 2532–2534, 1997. Hokland, “Promoter hypermethylation of p15INK4B, HIC1, [30] O. El-Maarri, U. Herbiniaux, J. Walter, and J. Oldenburg, “A CDH1, and ER is frequent in myelodysplastic syndrome and rapid, quantitative, non-radioactive bisulfite-SNuPE- IP RP predicts poor prognosis in early-stage patients,” European HPLC assay for methylation analysis at specific CpG sites,” Journal of Haematology, vol. 76, no. 1, pp. 23–32, 2006. Nucleic Acids Research, vol. 30, no. 6, p. e25, 2002. [14] P. W. Laird, “The power and the promise of DNA methylation [31] M. L. Gonzalgo and P. A. Jones, “Rapid quantitation of markers,” Nature Reviews Cancer, vol. 3, no. 4, pp. 253–266, methylation differences at specific sites using methylation- 2003. sensitive single nucleotide primer extension (Ms-SNuPE),” [15] R. Radpour, M. M. Haghighi, A. X.-C. Fan et al., “High- Nucleic Acids Research, vol. 25, no. 12, pp. 2529–2531, 1997. throughput hacking of the methylation patterns in breast can- [32] Z. Wu, J. Luo, Q. Ge, and Z. Lu, “Microarray-based Ms- cer by in vitro transcription and thymidine-specific cleavage SNuPE: near-quantitative analysis for a high-throughput DNA mass array on MALDI-TOF silico-chip,” Molecular Cancer methylation,” Biosensors and Bioelectronics, vol. 23, no. 9, pp. Research, vol. 6, no. 11, pp. 1702–1709, 2008. 1333–1339, 2008. [16] R. Radpour, C. Kohler, M. M. Haghighi, A. X. C. Fan, [33] J. Worm, A. Aggerholm, and P. Guldberg, “In-tube DNA W. Holzgreve, and X. Y. Zhong, “Methylation profiles of methylation profiling by fluorescence melting curve analysis,” 22 candidate genes in breast cancer using high-throughput Clinical Chemistry, vol. 47, no. 7, pp. 1183–1189, 2001. MALDI-TOF mass array,” Oncogene, vol. 28, no. 33, pp. 2969– [34] I. L. Candiloro, T. Mikeska, P. Hokland, and A. Dobrovic, 2978, 2009. “Rapid analysis of heterogeneously methylated DNA using [17] H. Shi, M. X. Wang, and C. W. Caldwell, “CpG islands: their digital methylation-sensitive high resolution melting: applica- potential as biomarkers for cancer,” Expert Review of Molecular tion to the CDKN2B (p15) gene,” Epigenetics Chromatin, vol. Diagnostics, vol. 7, no. 5, pp. 519–531, 2007. 1, p. 7, 2008. [18]J.Yu,Y.Y.Cheng,Q.Taoetal.,“Methylationofprotocadherin 10, a novel tumor suppressor, is associated with poor progno- [35] M. Ehrich, M. R. Nelson, P. Stanssens et al., “Quantitative sis in patients with gastric cancer,” Gastroenterology, vol. 136, high-throughput analysis of DNA methylation patterns by no. 2, article e1, pp. 640–651, 2009. base-specific cleavage and mass spectrometry,” Proceedings [19] L. Shen and R. A. Waterland, “Methods of DNA methylation of the National Academy of Sciences of the United States of analysis,” Current Opinion in Clinical Nutrition and Metabolic America, vol. 102, no. 44, pp. 15785–15790, 2005. Care, vol. 10, no. 5, pp. 576–581, 2007. [36] D. van den Boom and M. Ehrich, “Mass spectrometric analysis [20] D. Zilberman and S. Henikoff, “Genome-wide analysis of of cytosine methylation by base-specific cleavage and primer DNA methylation patterns,” Development, vol. 134, no. 22, pp. extension methods,” Methods in Molecular Biology, vol. 507, 3959–3965, 2007. pp. 207–227, 2009. [21] H. Hayatsu, Y. Wataya, K. Kai, and S. Lida, “Reaction of [37] S. E. Cottrell, J. Distler, N. S. Goodman et al., “A real-time sodium bisulfite with uracil, cytosine, and their derivatives,” PCR assay for DNA-methylation using methylation-specific Biochemistry, vol. 9, no. 14, pp. 2858–2865, 1970. blockers,” Nucleic Acids Research, vol. 32, no. 1, p. e10, 2004. [22] R. Shapiro and J. M. Weisgras, “Bisulfite-catalyzed transam- [38] D. Zhou, W. Qiao, Y. Wan, and Z. Lu, “Microarray-based ination of cytosine and cytidine,” Biochemical and Biophys- methylation analysis using dual-color fluorescence hybridiza- ical Research Communications, vol. 40, no. 4, pp. 839–843, tion,” Journal of Biochemical and Biophysical Methods, vol. 66, 1970. no. 1–3, pp. 33–43, 2006. [23] L. S. Kristensen and L. L. Hansen, “PCR-based methods for [39] S. J. Clark, J. Harrison, C. L. Paul, and M. Frommer, “High detecting single-locus DNA methylation biomarkers in cancer sensitivity mapping of methylated cytosines,” Nucleic Acids diagnostics, prognostics, and response to treatment,” Clinical Research, vol. 22, no. 15, pp. 2990–2997, 1994. Chemistry, vol. 55, no. 8, pp. 1471–1483, 2009. [40] J. G. Herman, J. R. Graff,S.Myoh¨ anen,B.D.Nelkin,andS.¨ [24] M. Esteller and J. G. Herman, “Cancer as an epigenetic dis- B. Baylin, “Methylation-specific PCR: a novel PCR assay for ease: DNA methylation and chromatin alterations in human methylation status of CpG islands,” Proceedings of the National tumours,” Journal of Pathology, vol. 196, no. 1, pp. 1–7, 2002. Academy of Sciences of the United States of America, vol. 93, no. [25] D. Takai and P. A. Jones, “Comprehensive analysis of CpG 18, pp. 9821–9826, 1996. islands in human chromosomes 21 and 22,” Proceedings of the [41]C.A.Eads,K.D.Danenberg,K.Kawakamietal.,“MethyLight: National Academy of Sciences of the United States of America, a high-throughput assay to measure DNA methylation,” vol. 99, no. 6, pp. 3740–3745, 2002. Nucleic Acids Research, vol. 28, no. 8, p. E32, 2000. [26] M. Frommer, L. E. McDonald, D. S. Millar et al., “A [42]Y.M.D.Lo,I.H.N.Wong,J.Zhang,M.S.C.Tein,M.H.L. genomic sequencing protocol that yields a positive display Ng, and N. M. Hjelm, “Quantitative analysis of aberrant p16 of 5-methylcytosine residues in individual DNA strands,” methylation using real-time quantitative methylation-specific Obstetrics and Gynecology International 7

polymerase chain reaction,” Cancer Research, vol. 59, no. 16, pp. 3899–3903, 1999. [43]M.W.Chan,E.S.Chu,K.F.To,andW.K.Leung, “Quantitative detection of methylated SOCS-1 , a tumor suppressor gene, by a modified protocol of quantitative real time methylation-specific PCR using SYBR green and its use in early gastric cancer detection,” Biotechnology Letters, vol. 26, no. 16, pp. 1289–1293, 2004. [44] D.-C. Chu, C.-K. Chuang, J.-B. Fu, H.-S. Huang, C.-P. Tseng, and C.-F. Sun, “The use of real-time quantitative polymerase chain reaction to detect hypermethylation of the CpG islands in the promoter region flanking the GSTP1 gene to diagnose prostate carcinoma,” Journal of Urology, vol. 167, no. 4 I, pp. 1854–1858, 2002. [45] L. S. Kristensen, T. Mikeska, M. Krypuy, and A. Dobrovic, “Sensitive melting analysis after real time-methylation specific PCR (SMART-MSP): high-throughput and probe-free quantitative DNA methylation detection,” Nucleic Acids Research, vol. 36, no. 7, article e42, 2008. [46] C. Bonanno, E. Shehi, D. Adlerstein, and G. M. Makrigiorgos, “MS-FLAG, a novel real-time signal generation method for methylation-specific PCR,” Clinical Chemistry, vol. 53, no. 12, pp. 2119–2127, 2007. [47] B. N. Trinh, T. I. Long, and P. W. Laird, “DNA methylation analysis by methylight technology,” Methods,vol.25,no.4,pp. 456–462, 2001. [48] U. Lehmann, B. Hasemeier, R. Lilischkis, and H. Kreipe, “Quantitative analysis of promoter hypermethylation in laser- microdissected archival specimens,” Laboratory Investigation, vol. 81, no. 4, pp. 635–637, 2001. [49] Z. Barekati, R. Radpour, C. Kohler, et al., “Methylation profile of TP53 regulatory pathway and mtDNA alterations in breast cancer patients lacking TP53 mutations,” Human Molecular Genetics, vol. 19, no. 15, pp. 2936–2946, 2010. [50] R. Radpour, Z. Barekati, M. M. Haghighi et al., “Correlation of telomere length shortening with promoter methylation profile of p16/Rb and p53/p21 pathways in breast cancer,” Modern Pathology, vol. 23, no. 5, pp. 763–772, 2010. [51] J. R. Graff,J.G.Herman,S.Myoh¨ anen,S.B.Baylin,andP.¨ M. Vertino, “Mapping patterns of CpG island methylation in normal and neoplastic cells implicates both upstream and downstream regions in de novo methylation,” Journal of Biological Chemistry, vol. 272, no. 35, pp. 22322–22329, 1997. Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 198709, 7 pages doi:10.1155/2010/198709

Review Article Epigenetic Regulatory Mechanisms Associated with Infertility

Sheroy Minocherhomji,1 Prochi F. Madon,2 and Firuza R. Parikh2

1 Department of Cellular and Molecular Medicine, Wilhelm Johannsen Centre for Functional Genome Research, Faculty of Health Sciences, Blegdamsvej 3B, University of Copenhagen, 2200 N, Copenhagen, Denmark 2 Department of Assisted Reproduction and Genetics, Jaslok Hospital and Research Centre 15, Dr. G Deshmukh Marg, Mumbai 400 026, India

Correspondence should be addressed to Firuza R. Parikh, [email protected]

Received 29 September 2009; Accepted 29 June 2010

Academic Editor: Shi-Wen Jiang

Copyright © 2010 Sheroy Minocherhomji et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Infertility is a complex human condition and is known to be caused by numerous factors including genetic alterations and abnormalities. Increasing evidence from studies has associated perturbed epigenetic mechanisms with spermatogenesis and infertility. However, there has been no consensus on whether one or a collective of these altered states is responsible for the onset of infertility. Epigenetic alterations involve changes in factors that regulate gene expression without altering the physical sequence of DNA. Understanding these altered epigenetic states at the genomic level along with higher order organisation of chromatin in genes associated with infertility and pericentromeric regions of chromosomes, particularly 9 and Y, could further identify causes of idiopathic infertility. Determining the association between DNA methylation, chromatin state, and noncoding RNAs with the phenotype could further determine what possible mechanisms are involved. This paper reviews certain mechanisms of epigenetic regulation with particular emphasis on their possible role in infertility.

1. Introduction gene expression could facilitate a better understanding of this chronic condition [5, 6]. A deeper insight into the Identifying factors involved in the aetiology and physiology molecular genetics of complex disorders was revealed with of complex disorders and conditions such as infertility the initial sequencing analysis of the human genome, which is necessary in order to understand potential regulatory gave a wealth of information pertaining to the physical mechanisms involved in disease pathogenesis. Infertility has sequence of DNA but also provided significant details about previously been defined as the inability to conceive after a the vast majority of the human genome that is non- passage of twelve months of unprotected intercourse by a protein coding [7–10]. Although it has been established couple [1, 2]. The condition has been estimated to have an that the whole human genome is transcribed at some effect on 10% of the population within the reproductive point during the cell cycle [11, 12]; deciphering the role age group in the United States [2] and on 9% of the of the different molecular mechanisms involved in selective world’s population [3]. The infertility phenotype affects expression of protein coding and noncoding regions of the both men and women and has been shown to have an human genome at different time points of the cell cycle, impact on one’s mental state and lifestyle and has also in a tissue-specific manner during one’s development, [13– been implicated with being the cause or effect of certain 15] in normal and diseased tissue, will further promote the medical conditions [1, 4]. The occurrence of such a high understanding of complex human conditions and diseases, population incidence rate could be attributed to the afflicted such as infertility. Several studies have previously identified individual’s age, environment, and lifestyle. Studying the gene deletions and polymorphisms associated with male association of these factors in the part they play with factor infertility. Deletions in the Azoospermia Factor C genetic factors and altered epigenetic mechanisms regulating (AZFc, OMIM #415000) region of the long arm of the Y 2 Obstetrics and Gynecology International chromosome proximal to the large heterochromatic block, patterns of DNA methylation in genes and various mech- including polymorphisms and deletions in the Ubiquitin- anisms of epigenetic control such as histone modifications specific peptidase 9 and Y-linked (USP9Y, OMIM #400005) and chromatin rearrangements have been associated with the gene [16], have been identified as the most common cause regulation of genes and their expression or repression [13, of male factor infertility, particularly spermatogenic failure 44, 50, 51]. Chromatin is not uniform in gene density and [17]. Mechanisms involved in the proper regulation of transcriptional activity. Selective expression of certain genes genomic and chromosomal variants [18, 19] associated with serving functionally important purposes at different stages of infertility in individuals having bad obstetric history (BOH) development is required in an organism to maintain tissue or repeated spontaneous abortions (RSA) and idiopathic specificity [14, 52]. This process is done by compartmen- cases of infertility remain largely unknown, although an talisation, which involves the packaging of certain parts of understanding of the possible causes is beginning to emerge the genome into either actively transcribed euchromatin or [20]. Understanding the complex role of one’s genotype, transcriptionally silent/inert heterochromatin. Mechanisms environment, and age with changes in one’s epigenotype involved in the maintenance of both silent heterochromatin could further categorise the unknown causes of the disease and active euchromatin at different stages of the cell cycle in addition to understanding the regulatory mechanisms in relation to nuclear organisation are beginning to be involved in the control of expression and/or repression of understood [51, 53]. genes affecting the infertility phenotype. The derepression of otherwise repressed genes has previously been reported and includes the activation/expression of the sperm genome in the embryo [54], viral oncogenesis, 2. Regulatory Epigenetic Mechanisms and activation of Y chromosome genes during the foetal development of a male child [55].ThemultistepprocessofX Waddington (1953) first described mechanisms associated chromosome inactivation (XCI) induced by the coordinated with the alteration of gene expression in a cell during active transcription of the long noncoding RNA Xist and development as epigenetic [21]. An epigenetic change is Tsix [56] involves the random transcriptional inactivation defined as a heritable change that can alter the expression of either one of the X chromosomes in female mammals of a gene without actually changing the physical sequence [57] in response to certain cellular stimuli. This coordinated of DNA [22]. Epigenetic mechanisms may control the upregulation of the Xist transcript compared to the downreg- expression of a gene via transient or permanent changes in ulation of Tsix on the inactive X chromosome (Xi) of future its activity and are postulated to include three main processes daughter cells equalizes the expression of X linked genes in [23]. These include reversible covalent modifications of female (XX) and male (XY) embryos [56, 58], a process histone core proteins, long and short noncoding RNA known as dosage compensation [59]. Higher order structures (ncRNA) related silencing of gene expression, and reversible such as euchromatin and heterochromatin represent the methylation of DNA [24–26]. Each of these mechanisms degree of packaging of genomic DNA thereby rendering it has been associated with the initiation of the other [27] either accessible or inaccessible to transcription machinery. although the direction of control and regulation in different Particular modifications of core histones H2A, H2B, H3, and regions of the compartmentalised genome is under constant H4 that form the nucleosome and their variants including review [27–30]. Understanding the way these epigenetic H2A.Z, H3.1, H3.2, and H3.3 are seen to be conserved marks regulate each other or induce recruitment of factors in certain organisms [57, 60]. Mechanisms involved in involved in the silencing or activation of gene expression in covalently altering these histone modification marks partic- a locus-specific manner, in different regions of the genome, ularly on histone tails, include phosphorylation, acetylation, has yet to be determined. ubiquitination, and methylation [48]. Histone tails have Epigenetic alterations or epimutations, particularly in previously been linked with playing an essential role in the pattern of genomic DNA methylation including the 5 conformational changes associated with histone folding and promoter regions of genes, have been associated with various higher order chromatin packaging [61]. Unlike the globular human conditions and disorders [23]. These include certain core histone domains, histone tails do not have fixed struc- cancers [31], neurological disorders [26], abnormal sperm tures and can be modified by posttranslational mechanisms profiles in infertile men [20], the Rett syndrome [32](RTT, [62]. Covalent modifications of histone tails altering their OMIM# 312750), the Fragile X syndrome [33, 34](FRAXA, conformation and charge allow for potential activation of OMIM# 309550), the ICF syndrome (facial anomalies) transcription (hyperacetylated histone tails, histone 3 lysine syndrome [35] (ICF, OMIM# 242860), Dihydropyrimidine 4 trimethylated) or repression (hypoacetylated histone tails dehydrogenase deficiency [36] (DPYD, OMIM# 274270), histone 3 lysine 27 trimethylated) of the packaged DNA by Prader-Willi syndrome (PWS, OMIM# 176270), and Angel- the recruitment of certain protein complexes [63]atdifferent man syndrome [37] (AS, OMIM# 105830). Methylation stages of cell cycle progression. Differential chromatin modi- of CpG dinucleotides in the promoter regions of genes fication marks have been recently associated with pericentric [38] and DNA methyltransferases (DNMTs) involved in heterochromatin and the inactive X chromosome [28, 64]. A the catalysis of DNA methylation [39–44], including 5- study carried out by Maison et al. attributes the formation of hydroxymethylcytosine [38, 45, 46] and altered covalent higher order pericentromeric heterochromatin to a specific modifications of core histone proteins [47–49], have gener- RNA component and distinct covalent histone modification ated a great deal of interest in recent years. Tissue-specific marks that are unique to this region compared to the inactive Obstetrics and Gynecology International 3

X chromosome [28]. This study implicated the presence of male factor infertility in a Vietnamese male twin cohort of an RNA component with the initiation, formation, and [69]. The authors concluded that the environment or genetic maintenance of pericentromeric heterochromatin, identified makeup of individual twins did not have a significant effect by the presence of heterochromatin protein 1 (HP1) and on any one twin having infertility, but that conditions and histone 3 lysine 9 (H3K9) marks [28]. Another study carried factors unique to individual twins could be associated with out by Chen et al. (2008) looked at the dynamic nature the disorder, although it did not rule out an indirect effect of centromeric heterochromatin in the model organism of one’s environment on these factor [69]. This further Schizosaccharomyces pombe and implicated it with being established a link between epigenetic mechanisms unique to actively transcribed by RNA Pol II, albeit during a brief each individual and the onset of infertility. Both these studies period of the cell cycle. They examined this brief period of agreed on factors unique to each individual twin as being the cell cycle during the S-phase and found that RNA Pol associated with the disease phenotype. These epigenetic II is involved in transcribing centromeric repeats [65]. They factors including DNA methylation and chromatin state, implicated the maintenance of heterochromatin with that of unique to each monozygotic twin could be attributed in part RNA Pol II mediated transcription of repeat rich regions and to their infertile state. silencing of the same region with the involvement of factors recruited by the histone 3 lysine 9 (H3K9) modification mark [65]. This negative feedback loop associated in both studies 5. Epigenetic Factors Influencing the could possibly be associated with the proper maintenance Infertility Phenotype of heterochromatin including centromeric heterochromatin through subsequent cell divisions allowing for proper mitotic Several histone de/acetylases and demethylases have recently cell division, mechanistically similar to X chromosome been identified and attributed with regulation of chromatin inactivation, albeit involving different factors. Variations and state. However, their functional role and association with differences in higher order structural organisation of this diseased states is only just beginning to be understood, late replicating region of certain chromosomes particularly particularly those factors affecting male and female infertility heterochromatic blocks on chromosomes 9 and Y have [71, 72]. Post translational modifications of histone tails by previously been associated with infertility [19, 66, 67]. factors including histone chaperones and methyltransferases Although experimentally challenging, understanding the are involved in the proper regulation of gene expression molecular epigenetic and regulatory landscapes of these [73, 74]. Due its dynamic nature and plasticity, the landscape repeat rich regions in normal individuals compared to of chromatin can be altered, rendering a region of the those with infertility and deciphering their altered epigenetic genome active or inactive [74–76]. This altered state of signature, if any, would result in a broader comprehension of packaging renders certain regions of the genome more depicting reproductive outcome. accessible to transcription machinery (euchromatin) and are marked by DNA hypomethylation, RNA Pol II, and covalent histone modifications such as histone 3 trimethylated 3. Factors Associated with the at lysine 4 (H3K4me3) and the histone variant H2A.Z. Infertility Phenotype Inactive/repressed regions are known to be associated with ff DNA hypermethylation, histone 3 trimethylated at lysine Several studies have identified di erent genetic and epige- 27 (H3K27me3), and SUZ12 (part of the polycomb group netic factors as being involved with the onset and progression complex, PcG) [48]. of the infertility phenotype [17, 19, 68]. However, possible Due to this, the main focus of recent epigenetic research perturbed mechanisms involved in regulating gene expres- has focussed on discovering new factors involved in altering sion in the disease state are rather poorly understood. The chromatin state and further looking at its involvement in classic “nature versus nurture” argument on whether one’s diseased and normal tissue. Recent studies have identified a environment rather than genetic makeup could influence the critical role for the JHMD2A (Jumonji C domain-containing onset of infertility and other complex disorders has been histone demethylase 2A) histone demthylase in male infer- reviewed by various studies [69, 70]. tility, obesity [72], and spermatogenesis [77]. Using knock- out mice as models, these studies identified a critical role 4. Environment and the Infertility Phenotype for JHMD2A in the regulation and expression of two genes, protamine 1 (OMIM #182880, Prm1)andtransition Kohler et al. (1999) studied the presence of the infertility nuclear protein 1 (OMIM #190231, Tnp1) involved in the phenotype in a cohort of Danish twins to be able to condensation and proper packaging of chromatin in the male answer two fundamental questions in relation to infertility, sperm [77].AhigherdegreeofspermDNAcompactionhas whether there was a significant effect on an individual being previously been attributed to the increased presence of highly infertile due to his/her genetic predisposition or his/her basic protamine proteins compared to histones in chromatin environment. While the study concluded that genetic factors [78], a deficiency of which has been associated with infertility do play a part in infertility, it also raised the possibility of in mice [79, 80]. Identification of other regulatory mecha- a connection between infertility and one’s socioeconomic nisms involved in the recruitment of factors, in addition to status and particularly the environment [70]. Another study JHMD2A, involved in the deposition of histones along with carried out by Cloonan et al. (2007) examined the existence others affecting transcriptional activity of genes involved in 4 Obstetrics and Gynecology International infertility will increase our understanding of mechanisms involved. The further development of methods to advance involved in both perturbed and normal states. our understanding of regulatory control mechanisms of genes affecting human infertility and reproductive outcome in addition to what has been done so far could assist in 6. Epigenetic Modifications Affecting improving rates of pregnancy using assisted reproductive Reproductive Outcome techniques and provide better treatment options for individuals seeing treatment for infertility or subfertility. Imprinted regions of the human genome marked by one active and one inactive allele are known to be dependent on their parent of origin [25, 81]. These monoallelically Acknowledgments expressed genes are known to be significantly associated with fetal development, reproduction, and reproductive outcome SM is a Marie Curie Early Stage Research (ESR) fellow [82, 83]. Deregulation of imprinted regions associated with funded by the Marie Curie Research Training Network, the onset of Angelman syndrome has previously been “Chromatin Plasticity” EU FP6. The Wilhelm Johannsen document in cases undergoing ICSI (intracytoplasmic sperm Centre for Functional Genome Research is established by the injection) using assisted reproductive technologies (ART) Danish National Research Foundation. [84, 85]. Reprogramming of the epigenome and imprinted loci during gametogenisis and the preimplantation embry- References onic stage is essential for maintaining the pattern of proper inheritance, specifically at imprinted loci [82]. Deregulation [1]J.B.Stanford,T.A.Parnell,andP.C.Boyle,“Outcomesfrom of imprinted loci has previously been associated with mal- treatment of infertility with natural procreative technology in formed offspring including disruption of the Igf2 imprinted an Irish general practice,” Journal of the American Board of Family Medicine, vol. 21, no. 5, pp. 375–384, 2008. region in mice. Disruption of this imprinted region in ff [2] A. A. Mitchell, “Infertility treatment—more risks and chal- mice results in their o spring being retarded [86] and loss lenges,” The New England Journal of Medicine, vol. 346, no. 10, of imprinting (LOI) of this same region results in them pp. 769–770, 2002. having Beckwith-Wiedemann syndrome (BWS) [87]. Long- [3] J. Boivin, L. Bunting, J. A. Collins, and K. G. Nygren, “Inter- term cohort studies looking at the incidence of imprinting national estimates of infertility prevalence and treatment- disorders and the use of ART have failed to draw a significant seeking: potential need and demand for infertility medical relation between the two [88, 89]. Identifying mechanisms care,” Human Reproduction, vol. 22, no. 6, pp. 1506–1512, associated with the regulation of imprinted loci could 2007. further help in understanding their role in proper parental [4] F. R. Parikh, S. G. Nadkarni, S. A. Kamat, N. Naik, S. B. inheritance of expression pattern of imprinted genes and Soonawala, and R. M. Parikh, “Genital tuberculosis—a major their possible perturbed state associated with the infertility pelvic factor causing infertility in Indian women,” Fertility and phenotype. Sterility, vol. 67, no. 3, pp. 497–500, 1997. [5] R. Holliday, “The inheritance of epigenetic defects,” Science, vol. 238, no. 4824, pp. 163–170, 1987. 7. Conclusions and Future Prospects [6] H. T. Bjornsson, M. Daniele Fallin, and A. P. Feinberg, “An integrated epigenetic and genetic approach to common Studies facilitating the identification of factors involved in human disease,” Trends in Genetics, vol. 20, no. 8, pp. 350–358, the proper maintenance and organisation of repeat rich 2004. pericentromeric heterochromatic regions could be impor- [7]D.Baltimore,“Ourgenomeunveiled,”Nature, vol. 409, no. tant in understanding their association with their higher 6822, pp. 814–816, 2001. occurrence rate in certain infertile groups [19, 90]. Results [8]F.S.Collins,E.S.Lander,J.Rogers,andR.H.Waterson, from corelated epidemiological studies [91, 92] along with “Finishing the euchromatic sequence of the human genome,” factors such as one’s environment, age, epigenotype, and Nature, vol. 431, no. 7011, pp. 931–945, 2004. genotype could provide a greater understanding of how [9] E. S. Lander, L. M. Linton, B. Birren, et al., “Initial sequencing different gene regulatory pathways are controlled and affect and analysis of the human genome,” Nature, vol. 409, no. 6822, each other [6] in human diseases like infertility [20]. pp. 860–921, 2001. Deciphering which epigenetic mechanism/s, if any, are [10] S. G. Gregory, K. F. Barlow, K. E. McLay, et al., “The DNA altered in certain infertile subjects with increased pericen- sequence and biological annotation of human chromosome 1,” Nature, vol. 441, no. 7091, pp. 315–321, 2006. tromeric blocks of heterochromatin on chromosomes 9 and Y, both locally or globally would help further characterise [11] G. K.-S. Wong, D. A. Passey, and J. Yu, “Most of the human genome is transcribed,” Genome Research, vol. 11, no. 12, pp. the disorder at both molecular genetic and epigenetic levels. 1975–1977, 2001. Identifying the degree to which an altered epigenetic state ff [12] M. E. Dinger, K. C. Pang, T. R. Mercer, and J. S. Mattick, “Dif- can a ect the development of infertility remains largely ferentiating protein-coding and noncoding RNA: challenges unknown although studies using newer technologies are now and ambiguities,” PLoS Computational Biology, vol. 4, no. 11, able to question and understand the potential mechanisms Article ID e1000176, 2008. involved. Although the study of epigenetic factors affecting [13] R. Jaenisch and A. Bird, “Epigenetic regulation of gene expres- infertility is at its nascent stage, a clearer picture is beginning sion: how the genome integrates intrinsic and environmental to emerge that is helping in the identification of new factors signals,” Nature Genetics, vol. 33, pp. 245–254, 2003. Obstetrics and Gynecology International 5

[14] R. Holliday and J. E. Pugh, “DNA modification mechanisms [32] S. Kriaucionis and A. Bird, “DNA methylation and Rett and gene activity during development,” Science, vol. 187, no. syndrome,” Human Molecular Genetics,vol.12,no.2,pp. 4173, pp. 226–232, 1975. R221–R227, 2003. [15] E. Birney, J. A. Stamatoyannopoulos, A. Dutta, et al., “Identifi- [33] I. Craig, “Methylation and the fragile X,” Nature, vol. 349, no. cation and analysis of functional elements in 1% of the human 6312, pp. 742–743, 1991. genome by the ENCODE pilot project,” Nature, vol. 447, no. [34] J. S. Sutcliffe, D. L. Nelson, F. Zhang et al., “DNA methylation 7146, pp. 799–816, 2007. represses FMR-1 transcription in fragile X syndrome,” Human [16] A. Luddi, M. Margollicci, L. Gambera et al., “Spermatogenesis Molecular Genetics, vol. 1, no. 6, pp. 397–400, 1992. in a man with complete deletion of USP9Y,” The New England [35] M. Ehrlich, “The ICF syndrome, a DNA methyltransferase 3B Journal of Medicine, vol. 360, no. 9, pp. 881–885, 2009. deficiency and immunodeficiency disease,” Clinical Immunol- [17] T. Kuroda-Kawaguchi, H. Skaletsky, L. G. Brown et al., ogy, vol. 109, no. 1, pp. 17–28, 2003. “The AZFc region of the Y chromosome features massive [36] H. H. Ezzeldin, A. M. Lee, L. K. Mattison, and R. B. palindromes and uniform recurrent deletions in infertile Diasio, “Methylation of the DPYD promoter: an alternative men,” Nature Genetics, vol. 29, no. 3, pp. 279–286, 2001. mechanism for dihydropyrimidine dehydrogenase deficiency [18] J. L. Freeman, G. H. Perry, L. Feuk, et al., “Copy number in cancer patients,” Clinical Cancer Research, vol. 11, no. 24, variation: new insights in genome diversity,” Genome Research, pp. 8699–8705, 2005. vol. 16, no. 8, pp. 949–961, 2006. [37] C. Camprub´ı, M. D. Coll, S. Villatoro et al., “Imprinting center [19] S. Minocherhomji, A. S. Athalye, P. F. Madon, D. Kulkarni, analysis in Prader-Willi and Angelman syndrome patients S. A. Uttamchandani, and F. R. Parikh, “A case-control with typical and atypical phenotypes,” European Journal of study identifying chromosomal polymorphic variations as Medical Genetics, vol. 50, no. 1, pp. 11–20, 2007. forms of epigenetic alterations associated with the infertility [38] S. K. T. Ooi, A. H. O’Donnell, and T. H. Bestor, “Mammalian phenotype,” Fertility and Sterility, vol. 92, no. 1, pp. 88–95, cytosine methylation at a glance,” Journal of Cell Science, vol. 2009. 122, no. 16, pp. 2787–2791, 2009. [20] S. Houshdaran, V. K. Cortessis, K. Siegmund, A. Yang, P. W. [39] W. S. Post, P. J. Goldschmidt-Clermont, C. C. Wilhide et Laird, and R. Z. Sokol, “Widespread epigenetic abnormalities al., “Methylation of the estrogen receptor gene is associated suggest a broad DNA methylation erasure defect in abnormal with aging and atherosclerosis in the cardiovascular system,” human sperm,” PLoS ONE, vol. 2, no. 12, Article ID e1289, Cardiovascular Research, vol. 43, no. 4, pp. 985–991, 1999. 2007. [40] E. Li, C. Beard, and R. Jaenisch, “Role for DNA methylation in [21] C. H. Waddington, “Genetic assimilation of an acquired genomic imprinting,” Nature, vol. 366, no. 6453, pp. 362–365, character,” Evolution, vol. 7, no. 2, pp. 118–126, 1953. 1993. [22] E. Li, “Chromatin modification and epigenetic reprogram- [41] R. J. W. O’Neill, M. J. O’Neill, and J. A. M. Graves, ming in mammalian development,” Nature Reviews Genetics, “Undermethylation associated with retroelement activation vol. 3, no. 9, pp. 662–673, 2002. and chromosome remodelling in an interspecific mammalian hybrid,” Nature, vol. 393, no. 6680, pp. 68–72, 1998. [23] G. Egger, G. Liang, A. Aparicio, and P.A. Jones, “Epigenetics in [42] S. B. Baylin, J. G. Herman, J. R. Graff,P.M.Vertino,andJ.-P. human disease and prospects for epigenetic therapy,” Nature, Issa, “Alterations in DNA methylation: a fundamental aspect vol. 429, no. 6990, pp. 457–463, 2004. of neoplasia,” Advances in Cancer Research, vol. 72, pp. 141– [24] P. A. Jones and D. Takai, “The role of DNA methylation in 196, 1997. mammalian epigenetics,” Science, vol. 293, no. 5532, pp. 1068– [43] L. Ye, X. Li, X. Kong et al., “Hypomethylation in the promoter 1070, 2001. region of POMC gene correlates with ectopic overexpression [25] E. Li, C. Beard, and R. Jaenisch, “Role for DNA methylation in in thymic carcinoids,” Journal of Endocrinology, vol. 185, no. 2, genomic imprinting,” Nature, vol. 366, no. 6453, pp. 362–365, pp. 337–343, 2005. 1993. [44] J. Newell-Price, P. King, and A. J. L. Clark, “The CpG ff [26] K. D. Robertson and A. P. Wol e, “DNA methylation in health island promoter of the human proopiomelanocortin gene is and disease,” Nature Reviews Genetics, vol. 1, no. 1, pp. 11–19, methylated in nonexpressing normal tissue and tumors and 2000. represses expression,” Molecular Endocrinology, vol. 15, no. 2, [27] C. Tufarelli, J. A. S. Stanley, D. Garrick et al., “Transcription pp. 338–348, 2001. of antisense RNA leading to gene silencing and methylation as [45] S. Kriaucionis and N. Heintz, “The nuclear DNA base 5- a novel cause of human genetic disease,” Nature Genetics, vol. hydroxymethylcytosine is present in purkinje neurons and the 34, no. 2, pp. 157–165, 2003. brain,” Science, vol. 324, no. 5929, pp. 929–930, 2009. [28] C. Maison, D. Bailly, A. H. F. M. Peters et al., “Higher-order [46] M. Tahiliani, K. P. Koh, Y. Shen et al., “Conversion of 5- structure in pericentric heterochromatin involves a distinct methylcytosine to 5-hydroxymethylcytosine in mammalian pattern of histone modification and an RNA component,” DNA by MLL partner TET1,” Science, vol. 324, no. 5929, pp. Nature Genetics, vol. 30, no. 3, pp. 329–334, 2002. 930–935, 2009. [29] A. Verdel, S. Jia, S. Gerber et al., “RNAi-mediated targeting of [47] D. E. Schones, K. Cui, S. Cuddapah et al., “Dynamic regulation heterochromatin by the RITS complex,” Science, vol. 303, no. of nucleosome positioning in the human genome,” Cell, vol. 5658, pp. 672–676, 2004. 132, no. 5, pp. 887–898, 2008. [30] M. Zofall, T. Fischer, K. Zhang et al., “Histone H2A.Z coop- [48] A. Barski, S. Cuddapah, K. Cui et al., “High-resolution erates with RNAi and heterochromatin factors to suppress profiling of histone methylations in the human genome,” Cell, antisense RNAs,” Nature, vol. 461, no. 7262, pp. 419–422, vol. 129, no. 4, pp. 823–837, 2007. 2009. [49] D. E. Schones and K. Zhao, “Genome-wide approaches to [31] S. M. Taylor, “p53 and deregulation of DNA methylation in studying chromatin modifications,” Nature Reviews Genetics, cancer,” Cellscience Reviews, vol. 2, no. 3, pp. 1742–8130, 2006. vol. 9, no. 3, pp. 179–191, 2008. 6 Obstetrics and Gynecology International

[50] C. De Smet, C. Lurquin, B. Lethe,´ V. Martelange, and T. Boon, [68] A. T. Rovio, D. R. Marchington, S. Donat et al., “Mutations at “DNA methylation is the primary silencing mechanism for a the mitochondrial DNA polymerase (POLG) locus associated set of germ line- and tumor-specific genes with a CpG-rich with male infertility,” Nature Genetics, vol. 29, no. 3, pp. 261– promoter,” Molecular and Cellular Biology, vol. 19, no. 11, pp. 262, 2001. 7327–7335, 1999. [69] Y. K. Cloonan, V. L. Holt, and J. Goldberg, “Male factor [51] P. Fraser and W. Bickmore, “Nuclear organization of the infertility: a twin study,” Paediatric and Perinatal Epidemiology, genome and the potential for gene regulation,” Nature, vol. vol. 21, no. 3, pp. 229–234, 2007. 447, no. 7143, pp. 413–417, 2007. [70]H.-P.Kohler,J.L.Rodgers,andK.Christensen,“Isfertility [52] R. Straussman, D. Nejman, D. Roberts et al., “Developmental behavior in our genes? Findings from a Danish twin study,” programming of CpG island methylation profiles in the Population and Development Review, vol. 25, no. 2, pp. 253– human genome,” Nature Structural and Molecular Biology, vol. 288, 1999. 16, no. 5, pp. 564–571, 2009. [71] D. Kleine-Kohlbrecher, J. Christensen, J. Vandamme, et al., “A [53] M. R. Matarazzo, S. Boyle, M. D’Esposito, and W. A. Bickmore, functional link between the histone demethylase PHF8 and the “Chromosome territory reorganization in a human disease transcription factor ZNF711 in X-linked mental retardation,” with altered DNA methylation,” Proceedings of the National Molecular Cell, vol. 38, no. 2, pp. 165–178, 2010. Academy of Sciences of the United States of America, vol. 104, [72] Y. Okada, K. Tateishi, and Y. Zhang, “Histone demethylase no. 42, pp. 16546–16551, 2007. JHDM2A is involved in male infertility and obesity,” Journal [54] J. H. Frenster and P. R. Herstein, “Gene de-repression,” The of Andrology, vol. 31, no. 1, pp. 75–78, 2010. New England Journal of Medicine, vol. 288, no. 23, pp. 1224– [73] A. Groth, A. Corpet, A. J. L. Cook et al., “Regulation 1229, 1973. of replication fork progression through histone supply and [55] S. L. Nakatsu, M. A. Masek, S. Landrum, and J. H. Frenster, demand,” Science, vol. 318, no. 5858, pp. 1928–1931, 2007. “Activity of DNA templates during cell division and cell [74]M.L.Dechassa,A.Sabri,S.Pondugula,etal.,“SWI/SNFhas differentiation,” Nature, vol. 248, no. 5446, pp. 334–335, 1974. intrinsic nucleosome disassembly activity that is dependent on [56] H. Marks, J. C. Chow, S. Denissov et al., “High-resolution adjacent nucleosomes,” Molecular Cell, vol. 38, no. 4, pp. 590– analysis of epigenetic changes associated with X inactivation,” 602, 2010. Genome Research, vol. 19, no. 8, pp. 1361–1373, 2009. [75] J. A. Sharp, E. T. Fouts, D. C. Krawitz, and P. D. Kaufman, [57] B. K. Sun, A. M. Deaton, and J. T. Lee, “A transient “Yeast histone deposition protein Asf1p requires Hir proteins heterochromatic state in Xist preempts X inactivation choice and PCNA for heterochromatic silencing,” Current Biology, without RNA stabilization,” Molecular Cell,vol.21,no.5,pp. vol. 11, no. 7, pp. 463–473, 2001. 617–628, 2006. [76] R. Belotserkovskaya, A. Saunders, J. T. Lis, and D. Reinberg, [58] M. F. Lyon, “Gene action in the X-chromosome of the mouse “Transcription through chromatin: understanding a complex (mus musculus L.),” Nature, vol. 190, no. 4773, pp. 372–373, FACT,” Biochimica et Biophysica Acta—Gene Structure and 1961. Expression, vol. 1677, no. 1–3, pp. 87–99, 2004. [59] K. Plath, J. Fang, S. K. Mlynarczyk-Evans, et al., “Role of [77] Y. Okada, G. Scott, M. K. Ray, Y. Mishina, and Y. Zhang, histone H3 lysine 27 methylation in X inactivation,” Science, “Histone demethylase JHDM2A is critical for Tnp1 and Prm1 vol. 300, no. 5616, pp. 131–135, 2003. transcription and spermatogenesis,” Nature, vol. 450, no. [60] M. D. Meneghini, M. Wu, and H. D. Madhani, “Conserved 7166, pp. 119–123, 2007. histone variant H2A.Z protects euchromatin from the ectopic [78] R. E. Braun, “Packaging paternal chromosomes with pro- spread of silent heterochromatin,” Cell, vol. 112, no. 5, pp. tamine,” Nature Genetics, vol. 28, no. 1, pp. 10–12, 2001. 725–736, 2003. [79] C. Cho, W. D. Willis, E. H. Goulding et al., “Haploinsufficiency [61] L. M. Carruthers and J. C. Hansen, “The core histone N of protamine-1 or -2 causes infertility in mice,” Nature termini function independently of linker histones during Genetics, vol. 28, no. 1, pp. 82–86, 2001. chromatin condensation,” The Journal of Biological Chemistry, [80] D. Miller, M. Brinkworth, and D. Iles, “Paternal DNA vol. 275, no. 47, pp. 37285–37290, 2000. packaging in spermatozoa: more than the sum of its parts? [62] K. Luger and T. J. Richmond, “The histone tails of the DNA, histones, protamines and epigenetics,” Reproduction, nucleosome,” Current Opinion in Genetics and Development, vol. 139, no. 2, pp. 287–301, 2010. vol. 8, no. 2, pp. 140–146, 1998. [81] M. S. Bartolomei, “Genomic imprinting: employing and [63] S. Y. Roth, J. M. Denu, and C. D. Allis, “Histone acetyltrans- avoiding epigenetic processes,” Genes and Development, vol. ferases,” Annual Review of Biochemistry, vol. 70, pp. 81–120, 23, no. 18, pp. 2124–2133, 2009. 2001. [82] S. A. J. I. Jacob and K. H. Moley, “Gametes and embryo [64] C. Maison and G. Almouzni, “HP1 and the dynamics of epigenetic reprogramming affect developmental outcome: heterochromatin maintenance,” Nature Reviews Molecular Cell implication for assisted reproductive technologies,” Pediatric Biology, vol. 5, no. 4, pp. 296–304, 2004. Research, vol. 58, no. 3, pp. 437–446, 2005. [65] E. S. Chen, K. Zhang, E. Nicolas, H. P. Cam, M. Zofall, [83] F. I. Lopes, A. I. Fortier, N. Darricarrere, D. Chan, D. R. and S. I. S. Grewal, “Cell cycle control of centromeric repeat Arnold, and J. M. Trasler, “Reproductive and epigenetic transcription and heterochromatin assembly,” Nature, vol. outcomes associated with aging mouse oocytes,” Human 451, no. 7179, pp. 734–737, 2008. Molecular Genetics, vol. 18, no. 11, pp. 2032–2044, 2009. [66] L. Tiepolo and O. Zuffardi, “Localization of factors controlling [84] G. F. Cox, J. Burger,¨ V. Lip et al., “Intracytoplasmic sperm spermatogenesis in the nonfluorescent portion of the human injection may increase, the risk of imprinting defects,” The Y chromosome long arm,” Human Genetics,vol.34,no.2,pp. American Journal of Human Genetics, vol. 71, no. 1, pp. 162– 119–124, 1976. 164, 2002. [67] C. Tyler-Smith, “An evolutionary perspective on Y-chromo- [85] K. H. ∅rstavik, K. Eiklid, C. B. van der Hagen et al., “Another somal variation and male infertility,” International Journal of case of imprinting defect in a girl with Angelman syndrome Andrology, vol. 31, no. 4, pp. 376–382, 2008. who was conceived by intracytoplasmic sperm injection,” Obstetrics and Gynecology International 7

The American Journal of Human Genetics,vol.72,no.1,pp. 218–219, 2003. [86] L. E. Young, “Imprinting of genes and the Barker hypothesis,” Tw in Research, vol. 4, no. 5, pp. 307–317, 2001. [87] F.-L. Sun, W. L. Dean, G. Kelsey, N. D. Allen, and W. Reik, “Transactivation of Igf2 in a mouse model of Beckwith- Wiedemann syndrome,” Nature, vol. 389, no. 6653, pp. 809– 815, 1997. [88] J. Halliday, K. Oke, S. Breheny, E. Algar, and D. J. Amor, “Beckwith-Wiedemann syndrome and IVF: a case-control study,” The American Journal of Human Genetics, vol. 75, no. 3, pp. 526–528, 2004. [89] E. R. Maher, “Imprinting and assisted reproductive technology,” Human Molecular Genetics, vol. 14, no. 1, pp. R133– R138, 2005. [90] C. Rubio, C. Simon, F. Vidal et al., “Chromosomal abnormalities and embryo development in recurrent miscarriage couples,” Human Reproduction, vol. 18, no. 1, pp. 182–188, 2003. [91] G. Kaati, L. O. Bygren, and S. Edvinson, “Cardiovascular and diabetes mortality determined by nutrition during parents’ and grandparents’ slow growth period,” European Journal of Human Genetics, vol. 10, no. 11, pp. 682–688, 2002. [92] M. E. Pembrey, L. O. Bygren, G. Kaati et al., “Sex-speciﬁc, male-line transgenerational responses in humans,” The Euro- pean Journal of Human Genetics, vol. 14, no. 2, pp. 159–166, 2006. Hindawi Publishing Corporation Obstetrics and Gynecology International Volume 2010, Article ID 682504, 7 pages doi:10.1155/2010/682504

Research Article Hypermethylation of SOX2 Promoter in Endometrial Carcinogenesis

Oscar Gee-Wan Wong,1 Zhen Huo,1, 2 Michelle Kwan-Yee Siu,1 HuiJuan Zhang,1 LiLi Jiang,1 Ester Shuk-Ying Wong,1 and Annie Nga-Yin Cheung1

1 Department of Pathology, Queen Mary Hospital, The University of Hong Kong, Pokfulam Road, Hong Kong 2 Department of Pathology, Peking Union Medical College Hospital, CAMS and PUMC, Beijing100730, China

Correspondence should be addressed to Annie Nga-Yin Cheung, [email protected]

Received 20 November 2009; Revised 4 June 2010; Accepted 7 July 2010

Academic Editor: Fan Jin

Copyright © 2010 Oscar Gee-Wan Wong et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

This paper aimed at investigating the expression and methylation profiles of SOX2, a gene coding for the stem cell-related transcription factor SOX2, in endometrial carcinomas. By methylation-specific polymerase chain reaction (MS-PCR), the methylation status of SOX2 promoter region in 72 endometrial carcinomas and 12 normal endometrial samples was examined. Methylated allele was found in 37.5% (27/72) of endometrial carcinomas but only in 8.3% (1/12) of normal endometrial, significantly more frequent in cancers (P = .0472). SOX2 mRNA level was significantly reduced in endometrial carcinoma compared with nonneoplastic endometrium (P = .045). A significant correlation between SOX2 mRNA expression and hypermethylation of SOX2 was found (P = .024). Hypermethylation of SOX2 tended to be more frequently found in type II serous or clear cell adenocarcinoma. SOX2 methylation was also significantly correlated with shorter survival of patients (P = .046). In conclusion, epigenetic mechanisms may play a crucial role on the transcriptional regulation of SOX2 and loss of SOX2 expression may be related to endometrial carcinogenesis.

1. Introduction and often arise in a background of atrophic endometrium. Type II carcinomas also exhibit a more aggressive clinical Endometrial cancer is the most common cancer found in course and poorer prognosis than Type I carcinomas. the female genital tract worldwide [1]. Although endometrial Common genetic changes include mutations of TP53 and cancers generally show favorable prognosis, the incidence CDH1 (E-cadherin) genes [4]. Despite the recent advances is on the rising trend in North America, Europe, and Asia in molecular diagnostics, the most important factors in [2, 3]. There are two major types of endometrial carcinomas predicting patient prognosis remain to be tumor grade, stage, exhibiting different histopathology, cell biology, clinical and subtypes [5, 6]. course, and underling genetic alterations [4]. Approximately Sox proteins are transcription factors related by a 70–80% endometrial cancers show endometrioid differenti- 79-amino acid high-mobility-group (HMG) DNA-binding ation and were designated as Type I carcinomas. They are domain that was first identified in the mammalian Sry pro- often preceded by premalignant endometrial hyperplasia, tein [7]. They take up various roles in neural development, which is presumably caused by long-duration unopposed including neural stem cell maintenance, glial specification, oestrogenic stimulation. Type I carcinomas generally have and lineage-specific terminal differentiation [8]. More than favorable outcome. Common genetic changes of Type I 20 members of the SOX gene family have been identified in carcinomas include mutations of K-RAS and PTEN genes, mammals [9]. Among them, SOX2 was first found crucial microsatellite instability (MSI) and alteration of beta-catenin for maintaining the stemness of neural stem cells and [4]. Type II carcinomas are poorly differentiated. In contrast then of embryonic stem cells. In conjunction with OCT3/4 to Type I carcinomas, these tumors are not oestrogen driven and NANOG, SOX2 is considered a master regulator of 2 Obstetrics and Gynecology International mammalian embryogenesis and part of a complex network (QIAGEN) was used to purify the converted DNA according of transcription factors that affects both pluripotency and to the manufacturer’s instructions. differentiation in embryonic stem cells [10]. In fact, forced expression of OCT3/4, SOX2, c-MYC, and KLF4 was suffi- 2.3. Methylation-Specific Polymerase Chain Reaction (MS- cient to induce stem cell-like pluripotency in adult fibroblast PCR). The methylation and unmethylation-sensitive [11] and CD34+ blood cell [12]. primers used in this study have been described previously SOX2 is dysregulated in many human cancers but its [21] and were shown in Table 1. The primers amplify role may vary in different kinds of malignancy. SOX2 a CpG-island located at about 500 bp upstream to the was found to be frequently downregulated in intestinal transcription start site of SOX2 (nm 0003106) [21]. 1.5 μl metaplasia of stomach [13]andgastriccancers[14]. Ectopic of bisulfite-converted DNA was amplified in a 25 μlreaction overexpression of SOX2 could inhibit cell growth through mixture containing 200 μM dNTPs, 10X reaction buffer, cell-cycle arrest and apoptosis in gastric epithelial cells 2.5 mM MgCL2, 10 pM forward and reverse primers, and 1 U [14]. In contrast, SOX2 and OCT3/4 were overexpressed of FastTaq (Roche). Bisulfite-converted normal lymphocyte in esophageal squamous cancer and significantly associated DNA methylated in vitro with Sssl methyltransferase with higher histological grade and poorer clinical survival was used as positive control while water was used as [15]. SOX2 overexpression was also observed in small cell no-template controls. The MS-PCR was conducted as lung cancer [16], basal cell-like breast carcinomas [17], and following: predenatured for 4 min at 94◦C, then at 94◦Cfor glioma [18]. Overexpressed SOX2 may promote cell pro- 30 seconds, 55◦C for 30 seconds, 72◦C for 30 seconds for 40 liferation and tumorigenesis of breast cancer cells through cycles, and finally a 10-min extension at 72◦C. Polymerase enhancing the G1/S transition of cell cycle [19]. Similarly, chain reaction products were separated on 2% Tris-borate silencing SOX2 in glioblastoma tumor-initiating cells leads EDTA agarose gels, stained with ethidium bromide, and to stop of proliferation and loss of tumorigenicity [20]. visualized under a UA transilluminator. Cases detected with Recently, our team was the first to report loss of SOX2 the presence of methylated alleles were repeated once for and hypermethylation in the promoter region of SOX2 confirmation. in trophoblastic diseases including hydatidiform mole and choriocarcinoma [21]. 2.4. RNA Extraction and cDNA Synthesis. RNA was isolated CpG island hypermethylation is a common event in from paraffin-embedded tissue by TRIZOL (Invitrogen) the development of the gynecologic cancers [22]. Our team according to the manufacturer’s instructions. First-strand has previously demonstrated the hypermethylation of RAS- cDNA was synthesized from 2.5 μgtotalRNAwitholigo- related genes in endometrial carcinomas in association with dTprimer and SuperScript III reverse transcriptase (Invitro- distinct clinicopathological parameters [23]. To the best of gen) according to the manufacturer’s instructions. our knowledge, there is no report on the methylation status of SOX2 gene in endometrial cancers. Therefore, we decided 2.5. Quantitative Real-Time Reverse Transcriptase-Polymerase to study the methylation and expression status of SOX2 in Chain Reaction. The mRNA expression of SOX2 was inves- endometrial carcinomas. tigated using quantitative real-time reverse transcriptase- polymerase chain reaction (RT-PCR). Primers were designed 2. Meterials and Methods specific to the SOX2 gene. Prime sequences for SOX2 and GAPDH (as internal control) are listed in Table 2. 2.1. Clinical Samples. Formalin-fixed, paraffin-embedded Quantitative real-time RT-PCR was performed in a 10 μl tissues of 57 cases and frozen tissues of 15 cases of endome- reaction, which included 1 μl of cDNA template, 10 pM trial carcinomas were retrieved for methylation study and of each forward and reverse primer, and 5 μl iTaq SYBR mRNA expression analysis. 12 cases of normal endometrium Green Supermix with Rox (Bio-rad). Each PCR reaction were retrieved for methylation study. In 23 of the 57 carci- was optimized to ensure that a single PCR product was noma cases being studied, their corresponding nonneoplastic amplified and no product corresponding to prime-dimer endometrium was retrieved for mRNA expression analysis. pairs was present. PCR reactions of each template were All specimens of tissues were collected at the Department performed in duplicate in one 96-well plate. The thermal of Pathology, Queen Mary Hospital, The University of Hong cycling conditions comprised an initial denaturation step at Kong. Prior to DNA and RNA extraction, haematoxylin, and 95◦C for 10 min and 40 cycles at 95◦C for 15 sec, and 58◦Cfor eosin-stained section was reviewed to confirm histological 1 min. The expression of SOX2 wasnormalizedwithrespect diagnosis and purity of the sample. Only samples with more to that of GAPDH. than 75% cancer cells were used. 2.6. Immunohistochemistry. Immunohistochemistry was 2.2. DNA Extraction and Bisulphite Modification of Genomic performed as previously described in [25]. Paraffinsections DNA. Genomic DNA was isolated from paraffin-embedded 4 μm thick was deparaffinized followed by antigen retrieval tissue by phenol-chloroform extraction after protease K using microwave treatment. Immunohistochemistry was digestion. Conversion of unmethylated cytosine residues performed using the streptavidin-biotin complex immu- in the genomic DNA to uracil by sodium bisulphite was noperoxidase method (Dako, Glostrup, Denmark). Mono- performed as described previously in [24]. 5 μgofDNAwas clonal primary antibodies for estrogen receptor (ER) (Dako) used in the sodium bisulphate conversion. The QIAEX II kit and progestogen receptor (PR) (Zymed Laboratories, San Obstetrics and Gynecology International 3

Table 1: Sequences of primers used in SOX2 methylation-speciﬁc PCR.

Primer Primer sequence (5 to 3)Productsize(bp)Ref. SOX2 promoter MSP-M Forward TGTTTATTTATTTTTTTCGAAAAGGCG 206 [21] Reverse GAACCCAACCTCGCTACCGAA SOX2 promoter MSP-U Forward TGTTTATTTATTTTTTTTGAAAAGGTG 208 [21] Reverse CTCAAACCCAACCTCACTACCAA

Table 2: Sequences of primers used in quantitative Real-Time RT-PCR study.

Primer Primer sequence (5 to 3)Productsize(bp)Ref. SOX2 Forward CGAGATAAACATGGCAATCAAAAT 85 [21] Reverse AATTCAGCAAGAAGCCTCTCCTT GAPDH Forward TCCATGACAACTTTGGTATCGTG 72 [21] Reverse ACAGTCTTCTGGGTGGCAGTG

Francisco, CA) were applied, both at 1 : 150 dilution, and when the cancer samples were grouped according to their incubated overnight at 4◦C. A case of breast cancer was used histological subtypes, we observed a trend of more frequent as positive control in each batch of experiment. Negative SOX2 promoter hypermethylation in type II (serous and control was prepared by replacing the primary antibody clear cell subtypes) (8/14, 57.1%) than in type I cancers with Tris-buffered saline. Assessment of immunoreactivity (endometrial subtype) (16/48, 33.3%) though statistical was performed independently by two pathologists according significance was not reached (P = .108; Table 4). No to percentage of immunor active nuclei: 1: 1–25%; 2: correlation was observed, however, between methylation 26%–50%; 3: 51–75%; 4: 76–100%. status with histological grade/ stage/ myometrial invasion/ vascular invasion/ age (Table 4). 2.7. Statistical Analyses. Statistical analysis was performed SOX2 methylation status correlated with PR expression using the Statistical Package Service Solution software (SPSS (Pearson correlation 0.377, P = .033) but not with ER version 16. 0). The association between methylation status expression. Kaplan-Meier analysis also demonstrated a sig- and clinicopathological parameters was tested by chi-square nificant correlation between SOX2 methylation and shorter test. The association between methylation status and mRNA overall survival (Figure 1(b); P = .046, log-rank test). expression level was analyzed using Spearman correlation test. For mRNA quantitative analysis, the relative gene 3.2. SOX2 mRNA Expression Is Lower in Endometrial Carci- expression between groups was compared with unpaired t- nomas Than in Their Normal Counter Parts and Is Correlated test (Mann-Whitney test). The association between methy- with the Methylation Status in Carcinomas. Out of the lation status and ER/PR immuno-scores was analyzed using 72 cases of endometrial carcinomas tested with MS-PCR, Pearson correlation test. P values less than.05 were consid- 23 cases have corresponding nonneoplastic endometrium ered statistically significant with two-tailed test. available. As shown in Figure 2, SOX2 mRNA level was significantly reduced in endometrial carcinoma compared = 3. Results with normal tissues of the same patients (P .045 Mann-Whitney U test; Figure 2). Moreover, there was a 3.1. Promoter Region of SOX2 Is Hypermethylated in Endome- significant correlation between SOX2 mRNA expression trial Carcinoma. In a previous study of methylation status and hypermethylation of SOX2 in endometrial carcinomas of SOX2 in gestational trophoblastic diseases, we identified samples (Spearman correlation coefficient = 0.470, P = a CpG island upstream of the transcription start site of .024). SOX2 [21]. The methylation frequency of this CpG island in 72 cases of endometrial carcinoma and 12 cases of normal 4. Discussion endometrium was assessed by MS-PCR. Hypermethylation of the SOX2 promoter was observed in 37.5% (27/72) In this study we tried to answer the question whether the of endometrial carcinomas, and 8.3% (1/12) of normal stemness-related transcription factor gene SOX2 expression endometrial tissues (Table 3 and Figure 1(a)). Therefore, is affected by promoter methylation in endometrial cancer. more frequent hypermethylation in SOX2 promoter in Epigenetic gene silencing through DNA methylation has endometrial cancers than in normal endometrial tissues was been suggested to be one of the important steps dur- observed (P = .0472, chi-square test; Table 3). Moreover, ing endometrial carcinogenesis [23, 24, 26–28]. Promoter 4 Obstetrics and Gynecology International

Table 3: Correlation of methylation status of the SOX2 gene in endometrial carcinomas and normal endometrial tissues.

Normal endometrial tissue Endometrial carcinoma P value (chi square) Status Frequency (%) Frequency (%) Methylated 1 (8.3%) 27 (37.5%) Unmethylated 11 (91.7%) 45 (62.5%) .0472 Total 12 72

2.5 NE1 NE2 T1 T2 T3 T4 P = .045 MUMU MUMUMU MU 2

(a) 1.5 P = .046 1 1 n = 37

0.8 n = 22 0.5 Relative SOX2 mRNA expression

0.6 0 Non-tumor Tumor 0.4 Figure 2: Relative SOX2 expression in endometrial carcinomas and Cumulative survival in normal endometrial tissue. 0.2

0 gene hypermethylation and downregulation contributes to 0 20 40 60 80 100 120 endometrial carcinogenesis. Survival (month) Notably, the frequency of hypermethylation in cancer samples was not high (37.5%). This may suggests that other SOX2 methy −ve genetic or epigenetic events other than SOX2 downregulation SOX2 methy +ve contribute to endometrial carcinogenesis. Moreover, hyper- (b) methylation is a dynamic process. It may exist in early stages of endometrial carcinogenesis such as the precursor lesions Figure 1: (a) Representative examples of methylation-specific PCR and may have reverted to unmethylated state by the time on SOX2 in endometrial carcinomas (T), and in normal endome- carcinoma is developed. It is also possible that SOX2 was trial tissue (NE), demonstrating methylated (M) and unmethylated downregulated by hypermethylation of other CpG islands in (U) alleles. (b) Survival curves of patients classified according to the the promoter regions of SOX2 that were not tested in this presence or absence of methylated SOX2 allele. study. In fact, the CpG island investigated in this study lies at about 200 bp upstream of the transcription start site [21] and CpG islands further upstream may exist (CpG search hypermethylation of RASSF1A, metallothionein 1E, and analysis, data not shown). It is our next aim to study the related tumor-suppressor genes have been found to correlate methylation pattern in CpG islands further away from the with clinicopathological parameters in endometrial cancer transcription start site. [23, 26, 28]. On the other hand, hypomethylation is also It is interesting to note that, among all clinicopatho- found to be important in regulating the expression of the logical parameters examined, hypermethylation of SOX2 S100A4 gene in endometrial cancer [27]. Here, our results promoter was linked marginally to histologic subtypes, being suggest more frequent hypermethylation events, at least in relatively more common in type II serous and clear cell the investigated CpG islands of SOX2 gene, in endometrial adenocarcinomas. This finding further supports the notion cancer samples than in normal endometrium. Moreover, that type I and type II endometrial cancers represent two hypermethylation of SOX2 promoter was correspondingly different malignancies with different pathologically courses matched by a decrease of SOX2 mRNA level in the samples. [4]. Indeed, we have reported earlier the significantly more Moreover, analysis on patients’ survival also linked hyper- frequent RASSF1A hypermethylation in type I endometrioid methylation of SOX2 with worse clinical outcome. Taken carcinomas when compared with the type II carcinomas together, our findings support the possibility that SOX2 [23]. Obstetrics and Gynecology International 5

Table 4: Correlation of SOX2 methylation status with clinicopathological features in endometrial cancers.

Clinicopathological Features Presence of methylated alleles Absence of methylated alleles P-value Cases (%) Cases (%) Histological type Endometrioid 16 (66.7) 32 (84.2) .108 Serous/CCC 8 (33.3) 6 (15.8) Grade Low (1) 7 (29.2) 15 (39.5) .409 High (2-3) 17 (70.8) 22 (60.5) Stage I 19 (79.2) 32 (84.2) .613 II–IV 5 (20.8) 6 (15.8) Myometrial invasion <1/2 8 (72.7) 27 (81.8) .517 ≥1/2 3 (27.3) 6 (18.2) Vascular invasion Negative 12 (80.0) 27 (73.0) .596 Positive 3 (20.0) 10 (27.0) Involving cervix Negative 13 (86.7) 34 (91.9) .962 Positive 2 (13.3) 3 (8.1) Age <45 9 (36.0) 10 (26.3) .413 ≥45 16 (64.0) 28 (73.7)

There was another interesting observation that SOX2 is downregulated in endometrial cancers. In fact, a meta- methylation was weakly correlated with PR expression. analysis of publicly available gene expression data suggested Progesterone deficiency relative to estrogen level has been that at least one of the four pluripotency factors Oct3/4, considered as a risk factor for endometrial cancer [29]. High SOX2, Klf4, and c-myc is overexpressed in 18 out of 40 PR expression is usually considered as a good prognostic cancer types [34]. It was argued that overexpression of the marker for endometrial cancer [30]. It is hence intriguing four factors may contribute to the pathological self-renewal that SOX2 methylation was found to correlate with shorter characteristics of cancer stem cells. However, overexpression survival (Figure 1(b)) but also with higher PR level. It is of SOX2 was not observed in endometrial cancer in the possible that other mechanisms related to hypermethylation analysis [34]. Our observation that SOX2 was downregulated of SOX2 may contribute to poor survival independent of in endometrial cancer actually concurs with the mentioned hormonal effects by surmounting the beneficial effect of analysis. Moreover, SOX2 downregulation has been found to PR. For instance, suppression of SOX2 has been reported be frequent in clinical samples, cancer cell lines and primary to facilitate overcoming cell-cycle arrest and apoptosis [14]. cultures of human cancers such as choriocarcinomas [21] Moreover, there are at least two distinct functional isoforms and gastric cancer [14]. In choriocarcinoma cell lines, of PR, PR-A, and PR-B, which are derived from the same SOX2 expression is restored following treatment to 5-Aza- gene through alternative transcription start sites [31]. It 2-deoxycytidine and/or Trichostatin A, demethylation and has been shown in mice that PR-B, in the absence of PR- histone deacetylase inhibitors respectively, and the effect was A, actually promotes cell proliferation in the presence of synergistic [21]. On the other hand, when forced to express estrogen alone or estrogen and progesterone simultaneously SOX2, gastric cancer lines were arrested in G1/S transition [32]. It is therefore imperative to distinguish PR-A and PR- and undergone apoptosis [14]. Two additional lines of B in human immunohistochemical studies. In fact, in a evidence further support that downregulation of SOX2 recent immunohistochemical investigation conducted in 315 may be involved in early stages of gastric carcinogenesis. endometrioid endometrial cancer patients, a ratio of PR- Downregulation of SOX2 could be detected in precursor A/PR-B < 1 was associated with shorter survival, suggesting lesions of gastric cancer such as intestinal metaplasia [13] PR-B may correlate with poor prognosis [33]. It is important and Helicobacter pylori infection, a strong risk factor of to further our investigation on the relationship between gastric cancer, could induce intestinal metaplasia through SOX2 methylation and the statuses of both PR isoforms. inhibition of SOX2 expression [35]. It is possible that SOX2 It is currently unclear why SOX2, a transcription factor also participate in the early carcinogenesis of endometrial important for self-renewal and pluripotency of stem cells, cancer via interaction with other risk factors. 6 Obstetrics and Gynecology International

5. Conclusion [14] T. Otsubo, Y. Akiyama, K. Yanagihara, and Y. Yuasa, “SOX2 is frequently downregulated in gastric cancers and inhibits cell In summary, hypermethylation in association with reduced growth through cell-cycle arrest and apoptosis,” British Journal expression of SOX2 was demonstrated in endometrial carci- of Cancer, vol. 98, no. 4, pp. 824–831, 2008. noma. Stem cell transcription factors are likely to play a role [15] Q. I. Wang, W. He, C. Lu et al., “Oct3/4 and sox2 are in endometrial carcinogenesis. significantly associated with an unfavorable clinical outcome in human esophageal squamous cell carcinoma,” Anticancer Acknowledgment Research, vol. 29, no. 4, pp. 1233–1241, 2009. [16] A. O. Gure,¨ E. Stockert, M. J. Scanlan et al., “Serological identi- The first two authors contributed equally to this work. fication of embryonic neural proteins as highly immunogenic tumor antigens in small cell lung cancer,” Proceedings of the References National Academy of Sciences of the United States of America, vol. 97, no. 8, pp. 4198–4203, 2000. [1] A. Jemal, R. Siegel, E. Ward, T. Murray, J. Xu, and M. J. Thun, [17] S. M. Rodriguez-Pinilla, D. Sarrio, G. Moreno-Bueno et al., “Cancer statistics, 2007,” Ca: A Cancer Journal for Clinicians, “Sox2: a possible driver of the basal-like phenotype in sporadic vol. 57, no. 1, pp. 43–66, 2007. breast cancer,” Modern Pathology, vol. 20, no. 4, pp. 474–481, [2]F.Amant,P.Moerman,P.Neven,D.Timmerman,E.Van 2007. Limbergen, and I. Vergote, “Endometrial cancer,” Lancet, vol. [18] M. Schmitz, A. Temme, V. Senner et al., “Identification of 366, no. 9484, pp. 491–505, 2005. SOX2 as a novel glioma-associated antigen and potential target [3] Y. Shang, “Molecular mechanisms of oestrogen and SERMs for T cell-based immunotherapy,” British Journal of Cancer, in endometrial carcinogenesis,” Nature Reviews Cancer, vol. 6, vol. 96, no. 8, pp. 1293–1301, 2007. no. 5, pp. 360–368, 2006. [19] Y. Chen, L. Shi, L. Zhang et al., “The molecular mechanism [4] S. F. Lax, “Molecular genetic pathways in various types of governing the oncogenic potential of SOX2 in breast cancer,” endometrial carcinoma: from a phenotypical to a molecular- Journal of Biological Chemistry, vol. 283, no. 26, pp. 17969– based classification,” Virchows Archiv, vol. 444, no. 3, pp. 213– 17978, 2008. 223, 2004. [20] R. M. R. Gangemi, F. Griffero, D. Marubbi et al., “SOX2 [5]P.Mhawech-Fauceglia,D.J.Smiraglia,W.Bsharaetal., silencing in glioblastoma tumor-initiating cells causes stop of “Prostate-specific membrane antigen expression is a potential proliferation and loss of tumorigenicity,” Stem Cells, vol. 27, prognostic marker in endometrial adenocarcinoma,” Cancer no. 1, pp. 40–48, 2009. Epidemiology Biomarkers and Prevention,vol.17,no.3,pp. [21] A. S. M. Li, M. K. Y. Siu, H. Zhang et al., “Hypermethylation 571–577, 2008. of SOX2 gene in hydatidiform mole and choriocarcinoma,” [6]F.D.CirisanoJr.,S.J.Robboy,R.K.Dodgeetal.,“The Reproductive Sciences, vol. 15, no. 7, pp. 735–744, 2008. outcome of stage I-II clinically and surgically staged papillary [22]H.-J.Yang,V.W.S.Liu,Y.Wang,P.C.K.Tsang,andH.Y.S. serous and clear cell endometrial cancers when compared with Ngan, “Differential DNA methylation profiles in gynecological endometrioid carcinoma,” Gynecologic Oncology, vol. 77, no. 1, cancers and correlation with clinico-pathological data,” BMC pp. 55–65, 2000. Cancer, vol. 6, article 212, 2006. [7] J. Bowles, G. Schepers, and P. Koopman, “Phylogeny of the [23] X. Liao, M. K.-Y. Siu, K. Y.-K. Chan et al., “Hypermethylation SOX family of developmental transcription factors based on ff sequence and structural indicators,” Developmental Biology, of RAS e ector related genes and DNA methyltransferase vol. 227, no. 2, pp. 239–255, 2000. 1 expression in endometrial carcinogenesis,” International Journal of Cancer, vol. 123, no. 2, pp. 296–302, 2008. [8] M. Wegner and C. C. Stolt, “From stem cells to neurons and glia: a Soxist’s view of neural development,” Trends in [24] W.-C. Xue, K. Y. K. Chan, H.-C. Feng et al., “Promoter Neurosciences, vol. 28, no. 11, pp. 583–588, 2005. hypermethylation of multiple genes in hydatidiform mole and choriocarcinoma,” Journal of Molecular Diagnostics, vol. 6, no. [9] G. E. Schepers, R. D. Teasdale, and P. Koopman, “Twenty pairs 4, pp. 326–334, 2004. of sox: extent, homology, and nomenclature of the mouse and human sox transcription factor gene families,” Developmental [25] D. H. Shen, U. S. Khoo, W. C. Xue, et al., “Primary peritoneal Cell, vol. 3, no. 2, pp. 167–170, 2002. malignant mixed Mullerian¨ tumors: a clinicopathologic, [10]H.Fong,K.A.Hohenstein,andP.J.Donovan,“Regulationof immunohistochemical, and genetic study,” Cancer, vol. 91, no. self-renewal and pluripotency by Sox2 in human embryonic 5, pp. 1052–1060, 2001. stem cells,” Stem Cells, vol. 26, no. 8, pp. 1931–1938, 2008. [26]H.Jo,J.W.Kim,G.H.Kangetal.,“Associationofpromoter [11] K. Takahashi and S. Yamanaka, “Induction of pluripotent stem hypermethylation of the RASSF1A gene with prognostic cells from mouse embryonic and adult fibroblast cultures by parameters in endometrial cancer,” Oncology Research, vol. 16, defined factors,” Cell, vol. 126, no. 4, pp. 663–676, 2006. no. 4, pp. 205–209, 2006. [12] Y.-H. Loh, S. Agarwal, I.-H. Park et al., “Generation of induced [27] R. Xie, D. S. Loose, G. L. Shipley, S. Xie, R. L. Bassett Jr., pluripotent stem cells from human blood,” Blood, vol. 113, no. and R. R. Broaddus, “Hypomethylation-induced expression of 22, pp. 5476–5479, 2009. S100A4 in endometrial carcinoma,” Modern Pathology, vol. 20, [13] T. Tsukamoto, K. Inada, H. Tanaka et al., “Down-regulation no. 10, pp. 1045–1054, 2007. of a gastric transcription factor, Sox2, and ectopic expression [28] K. Y. Tse, V. W. S. Liu, D. W. Chan et al., “Epigenetic alteration of intestinal homeobox genes, Cdx1 and Cdx2: inverse of the metallothionein 1e gene in human endometrial carci- correlation during progression from gastric/intestinal-mixed nomas,” Tumor Biology, vol. 30, no. 2, pp. 93–99, 2009. to complete intestinal metaplasia,” Journal of Cancer Research [29] A. E. Schindler, “Progestogen deficiency and endometrial and Clinical Oncology, vol. 130, no. 3, pp. 135–145, 2004. cancer risk,” Maturitas, vol. 62, no. 4, pp. 334–337, 2009. Obstetrics and Gynecology International 7

[30] K. Fukuda, M. Mori, M. Uchiyama, K. Iwai, T. Iwasaka, and H. Sugimori, “Prognostic signiﬁcance of progesterone receptor immunohistochemistry in endometrial carcinoma,” Gynecologic Oncology, vol. 69, no. 3, pp. 220–225, 1998. [31] P. Kastner, A. Krust, B. Turcotte et al., “Two distinct estrogen- regulated promoters generate transcripts encoding the two functionally diﬀerent human progesterone receptor forms A and B,” EMBO Journal, vol. 9, no. 5, pp. 1603–1614, 1990. [32] B. Mulac-Jericevic, R. A. Mullinax, F. J. DeMayo, J. P. Lydon, and O. M. Conneely, “Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform,” Science, vol. 289, no. 5485, pp. 1751–1754, 2000. [33]V.Jongen,J.Briet,¨ R. de Jong et al., “Expression of estrogen receptor-alpha and -beta and progesterone receptor-A and -B in a large cohort of patients with endometrioid endometrial cancer,” Gynecologic Oncology, vol. 112, no. 3, pp. 537–542, 2009. [34] M. Schoenhals, A. Kassambara, J. De Vos, D. Hose, J. Moreaux, and B. Klein, “Embryonic stem cell markers expression in cancers,” Biochemical and Biophysical Research Communications, vol. 383, no. 2, pp. 157–162, 2009. [35] S. Asonuma, A. Imatani, N. Asano et al., “Helicobacter pylori induces gastric mucosal intestinal metaplasia through the inhibition of interleukin-4-mediated HMG box protein Sox2 expression,” American Journal of Physiology, vol. 297, no. 2, pp. G312–G322, 2009.