Genetic Disruption of the Multifunctional CD98/LAT1 Complex Demonstrates the Key Role of Essential Amino Acid Transport in the Control of Mtorc1 and Tumor Growth

Published OnlineFirst June 14, 2016; DOI: 10.1158/0008-5472.CAN-15-3376 Cancer Therapeutics, Targets, and Chemical Biology Research

Genetic Disruption of the Multifunctional CD98/ LAT1 Complex Demonstrates the Key Role of Essential Amino Acid Transport in the Control of mTORC1 and Tumor Growth Yann Cormerais1, Sandy Giuliano2, Renaud LeFloch2, Beno^t Front1, Jerome Durivault1, Eric Tambutte3, Pierre-Andre Massard1, Laura Rodriguez de la Ballina4, Hitoshi Endou5, Michael F. Wempe6, Manuel Palacin4, Scott K. Parks1, and Jacques Pouyssegur1,2

Abstract

The CD98/LAT1 complex is overexpressed in aggressive human inhibition, and severe in vitro and in vivo tumor growth arrest. We cancers and is thereby described as a potential therapeutic target. show that this severe growth phenotype is independent of the This complex promotes tumorigenesis with CD98 (4F2hc) engag- level of expression of CD98 in the six tumor cell lines. Surpris- ing b-integrin signaling while LAT1 (SLC7A5) imports essential ingly, CD98KO cells with only 10% EAA transport activity dis- amino acids (EAA) and promotes mTORC1 activity. However, it is played a normal growth phenotype, with mTORC1 activity and unclear as to which member of the heterodimer carries the most tumor growth rate undistinguishable from wild-type cells. How- prevalent protumoral action. To answer this question, we ever, CD98KO cells became extremely sensitive to inhibition or explored the tumoral potential of each member by gene disrup- genetic disruption of LAT1 (CD98KO/LAT1KO). This ﬁnding tion of CD98, LAT1, or both and by inhibition of LAT1 with the demonstrates that the tumoral potential of CD98KO cells is due selective inhibitor (JPH203) in six human cancer cell lines from to residual LAT1 transport activity. Therefore, these ﬁndings colon, lung, and kidney. Each knockout respectively ablated 90% clearly establish that LAT1 transport activity is the key growth- þ (CD98KO) and 100% (LAT1KO)ofNa-independent leucine limiting step of the heterodimer and advocate the pharmacology transport activity. LAT1KO or JPH203-treated cells presented an development of LAT1 transporter inhibitors as a very promising amino acid stress response with ATF4, GCN2 activation, mTORC1 anticancer target. Cancer Res; 76(15); 1–12. 2016 AACR.

Introduction heterodimer, CD98/LAT1, that controls import of essential amino acids (EAA). Tumor cells face numerous stressors in their microenviron- CD98 is a single-transmembrane glycoprotein also known ment and therefore have developed adaptive strategies to as the 4F2 antigen heavy chain (4F2hc). This protein binds to survive and grow. The limitation of essential nutrients is par- the cytoplasmic tail of b-integrin (5, 6) and regulates migra- ticularly acute in rapidly growing and hypoxic tumors. Inter- tion, adhesion-induced intracellular signaling, and anchorage- estingly, under conditions of limited oxygen perfusion, tumors independent survival (7–9). It has been reported that CD98 cells induce, via hypoxia-induced transcription factors (HIF) overexpression induces malignant transformation of NIH3T3 and other adaptive mechanisms, increased expression of key and BALB3T3 cells (10, 11). Furthermore, CD98 knockout nutrient transporters (1–4). An example of an overexpressed mouse embryonic stem cells display restricted teratocarcino- membrane nutrient transporter complex is the multifunctional ma formation (8). Moreover, a recent study has shown that CD98 regulates microenvironmental adaptation by amplify- ing cancer cell capacity to respond to extracellular matrix 1Medical Biology Department, Centre Scientifique de Monaco (CSM), Monaco. 2Institute for Research on Cancer & Aging (IRCAN), CNRS, rigidity to facilitate their tumor growth in a mouse skin cancer INSERM, Centre A. Lacassagne, University of Nice-Sophia Antipolis, model (12). Nice, France. 3Marine Biology Department, Centre Scientifique de fi 4 CD98 also interacts with LAT1 through a disul de bond and Monaco (CSM), Monaco. Institute for Research in Biomedicine, Uni- fi versity of Barcelona and CIBERER, Barcelona, Spain. 5Research & acts as a chaperone by promoting LAT1 stabilization, traf cking, Development, Fuji Biomedix Co. Ltd, Tokyo, Japan. 6School of Phar- and functional insertion into the plasma membrane (6, 13). LAT1 þ macy, University of Colorado Denver, Anschutz Medical Campus, is a 12-transmembrane spanning protein responsible for Na Aurora, Colorado. -independent transport of large neutral EAA (Leu, Val, Ile, Phe, Note: Supplementary data for this article are available at Cancer Research Trp, His, Met, Tyr). LAT1 is an obligatory exchanger with the Online (http://cancerres.aacrjournals.org/). uptake of one amino acid (AA) being coupled to the efflux of Corresponding Author: Jacques Pouyssegur, IRCAN, University of Nice-Sophia another AA (14, 15). The elevated bioenergetic need of rapidly Antipolis, 33 Avenue Valombrose, Nice 06189, France. Phone: 336-8505-4881; dividing cells creates an increased demand for AAs to satisfy Fax: 334-9203-1225; E-mail: [email protected] biomass increase. This nutritional demand imposes a constant doi: 10.1158/0008-5472.CAN-15-3376 stress in tumors growing in hostile, acidic, and low nourished 2016 American Association for Cancer Research. microenvironments (16, 17). Thus, high expression and activity of

www.aacrjournals.org OF1

Cormerais et al.

LAT1, regulated by HIF2 as reported in lung tissues and kidney ZFN-mediated gene knockout of LAT1 and CD98 cancers, is implicated in the ability to sustain growth despite the LS174T cells were transfected with ZFNs designed by Sigma- challenges faced in the microenvironment (18). Numerous clin- Aldrich (Saint-Louis, MO). Transfection of the ZFN (CSTZFN- ical studies have shown that the CD98/LAT1 complex is over- 1KT, CompoZr Custom ZFN) targeting LAT1 (exon 5) or CD98 expressed and is a negative prognostic factor in different types of (exon 4) was performed with JetPRIME (Polyplus). Transfected cancers, including prostate (19), non–small cell lung cancer (20), cells were grown for 7 days to express the mutated forms and gliomas (21), and renal cell carcinomas (18, 22). then CD98 surface expression was analyzed using flow cyto- It is now well accepted that the CD98/LAT1 complex plays a key metry. Negative and low expressing cells were sorted and plated role in tumor growth and is therefore an attractive therapeutic in clonal conditions (250 individualized cells in 100 mm target. However, to improve effective anticancer treatments, it is dishes). Each clone was picked and analyzed for CD98 or LAT1 essential to clearly define which member plays the dominant expression by immunoblot and negative clones were re-cloned protumoral role in this complex. This notion is far from being and further analyzed by DNA sequencing (Supplementary clarified and remains controversial in the literature (2). Despite Table S2). Finally two independent clones for LAT1KO, CD98KO the fact that CD98 knockout cells have reduced AA transport, Feral and LAT1KO/CD98KO double knockout were selected for this and colleagues and Cantor and Ginsberg reported that the pro- study. tumoral action in a teratocarcinoma model or growth-promoting activities in T and B cells are mediated through integrins–CD98 shRNA-mediated knockdown of CD98 signaling rather than the activity of LAT1 (8, 9). Considering the We obtained prevalidated shRNA sequences targeting CD98 obligatory nutrient needs in tumors and, in particular, EAA, this is from Sigma (Sigma NM_002394, CCGGCTAGCTCATACCTGT- a surprising conclusion that we decided to challenge and inves- CTGATTCTCGAGAATCAGACAGGTATGAGCTAGTTTTTG). Len- tigate further. tiviral particles (pLKO.1, Sigma) containing the shRNA were Here, we report AA stress, mTORC1 activity, EAA transport produced in HEK cells. Lentiviral infection of A549 cells was then rates, proliferation, and tumorigenicity in a colorectal and performed, and puromycin selection was utilized to obtain a total lung human adenocarcinoma cell lines (LS174T, A549), in population of shRNA-targeted cells. shControl (shCTRL) cells which the corresponding genes for LAT1 and CD98 have been were created as a reference control (Addgene plasmid #1864, disrupted by zinc finger nucleases (ZFN) or knockdown by CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTA- shRNA. Homozygous knockouts of each gene, CD98KO and ACCTTAGG). shRNA efficacy was validated by comparison of LAT1KO,confirmed a clear interdependence of the two mem- shCD98 and shCTRL cells using qPCR and Western blotting. bers of this complex. As anticipated, LAT1KO cells display an in vitro and in vivo disruption of AA homeostasis leading to ATF4 Immunoblotting induction, inhibition of mTORC1, and abolition of tumor Cells were lysed in 1.5 Laemmli buffer, and protein concen- growth. Full restoration of plasma membrane expression of trations were determined using the Pierce BCA protein assay KO CD98 failed to rescue growth of LAT1 cells, demonstrating (23227 Thermo Scientific). Protein extracts (40 mg) were separat- the independence of CD98 in the growth phenotype. Finally, ed by electrophoresis on 10% SDS polyacrylamide gel and trans- we confirmed and extended these results by specific inhibition ferred onto polyvinylidene difluoride membranes (Millipore). of LAT1 with JPH203 (23, 24) in six cell lines from colon, Membranes were blocked in 5% nonfat milk in TN buffer (50 lung, and renal cell carcinoma. Together, these findings clearly mmol/L Tris-HCl pH7.4, 150 mmol/L NaCl) and incubated with establish that EAA transport, but not CD98, is a key limiting the following anti-human antibodies: rabbit LAT1 (1:1,000, step in tumor growth and therefore fully validate LAT1 as a KE026 TransGenic Inc.), rabbit CD98 (1:1,000, SC-9160 Santa major anticancer target. Undoubtedly, besides JPH203 (23, Cruz Biotechnology), rabbit xCT (1:1,000, ab37185 Abcam), 24), enthusiasm for developing novel LAT1 (SLC7A5) inhibi- mouse GCN2 (1:250, sc-374609 Santa Cruz Biotechnology), tors will emerge. mouse phospho-GCN2 (1:500, ab75836 Abcam), rabbit EIF2a (1:1,000, ab5369 Abcam), mouse phospho-EIF2a (1:1,000, Materials and Methods ab32157 Abcam), rabbit ATF4 (1:1,000, 11815S CST), rabbit p70-S6K (1:1,000, 9202S CST), rabbit phospho-p70-S6K Cell culture (1:1,000, 9202S CST), rabbit RPS6 (1:1,000, 2217S CST), and Human colon adenocarcinoma LS174T and HT29 cells rabbit phospho-RPS6 (1:1,000, 2215S CST). Detection of tubulin were kindly provided by Dr. Van de Wetering (Utrecht, the was used as a protein loading control (1:10,000 MA5-16308, Netherlands). The other cell lines from lung (A549, H1975) Thermo Scientific). Immunoreactive bands were detected with and renal cell carcinoma, (786-O, A498) were obtained from horseradish peroxidase anti-mouse or anti-rabbit antibodies ATCC. These cell lines have been authenticated by DNA (Promega) using the ECL system (Merck Millipore WBKLS0500). profiling using 8 different and highly polymorphic short Analysis and quantification of immunoblots were performed tandem repeat loci (DSMZ). The cells, regularly checked for using LI-COR Odyssey Imaging System. mycoplasma, were grown in DMEM (Gibco) supplemented with 7.5% FBS, penicillin (10 U/mL), and streptomycin (10 Flow cytometry mg/mL). DMEM (0.3) was obtained by mixing 2 volumes of Cells were trypsinized, washed, and incubated for 30 minutes DMEM lacking 5 EAA LEU, ILE, MET, PHE, TRP with 1 with mouse anti-human CD98 (1:100, KS129 TransGenic Inc.; volume of regular DMEM. It is important to note that the diluted in FACS buffer PBS/BSA 0.1%/EDTA 5 mmol/L) on ice. final concentration of the EAA (except tryptophan) in DMEM Cells were then washed and incubated for 30 minutes with anti- (0.3) still largely exceeds the physiologic EAA levels of mouse PE-conjugated secondary antibody on ice. Cells were human plasma (Supplementary Table S1). washed, resuspended in 500 mL of FACS buffer, filtered (40 mm),

OF2 Cancer Res; 76(15) August 1, 2016 Cancer Research

Genetic Dissection of LAT1/CD98 Complex and Tumor Growth

and analyzed using a fluorescence-activated cell sorter (BD Clonogenicity assay Healthcare FACSCalibur Analyzer). LS174T-derived mutants (1,000 cells) were plated in 60-mm dishes and incubated at 37 C, 5% CO2. Twenty-four hours after Immunofluorescence and confocal analysis cell adherence, the media were replaced with regular 1 or 0.3 Cells were seeded (1 105 cells) on Cel-Line Diagnostic DMEM (Supplementary Table S1) supplemented with 7.5% Microscope Slides (30-256H-BLACK-CE24 Thermo Scientific). serum and containing JPH203 for LAT1 inhibition experiment. After 24 hours, cells were washed and fixed at room temperature Media were changed once every three days. Dishes were stained for 20 minutes with 3% paraformaldehyde. Cells were permea- with 5% Giemsa (Fluka) for 30 to 45 minutes to visualize bilized with PBS (Euromedex, ET330-A) containing 0.2% Triton colonies. X-100 (T8532 Sigma) for 2 minutes before being exposed to rabbit anti-human LAT1 (1:1000, KE026 TransGenic Inc.) and LAT1 inhibitor dose response assay mouse anti-human CD98 (1:1000, KS129 TransGenic Inc.) for 1 The different cell lines (5 104 cells) were seeded onto 6-well hour at room temperature. Cells were washed 3 times with PBS plates in triplicate for each cell line and JPH203 concentrations and then incubated for 1 hour at room temperature with 1:1,000 indicated. We measured proliferation as described above after 3 dilution anti-mouse FluoProbe 488-labeled (FP-SA4110-T Inter- days. Cell number fold increases were calculated as described chim) and anti-rabbit FluoProbe 594-labeled (FP-SD5110-T above. Interchim) and mounted using ProLong Gold Antifade Reagent (P36934 Life Technologies). Images were captured on an SP5 Tumor xenograft studies confocal microscope (Leica) and analyzed using Leica LS AF The different LS174T stable cell lines (1 106 cells) suspended software and ImageJ. in 300 mL of serum-free DMEM supplemented with insulin– transferrin–selenium (Life Technologies) were injected subcuta- 14 L-[ C]-Leucine uptake neously into the back of 8-week-old female athymic mice (Jan- Cells (2.5 105) were seeded onto 35-mm dishes, in triplicates vier). Tumor dimensions were measured twice a week using per cell line. Cells were used for uptake experiments 24 hours after calipers, and the tumor volume was determined by using the seeding. Culture media were removed and cells were carefully formula: (4p/3) L/2 W/2 H/2 (L, length; W, width; and H, þ 3 washed with prewarmed Na -free Hank's Balanced Salt Solution height). When the tumor volume reached 1,000 mm , mice were (HBSS: 125 mmol/L choline chloride, 4.8 mmol/L KCl, 1.2 euthanized, and the tumors were excised. For protein analysis, mmol/L MgSO4, 1.2 mmol/L KH2PO4, 1.3 mmol/L CaCl2, 5.6 tumors were lysed directly after harvesting. Tumors were incu- mmol/L glucose, and 25 mmol/L HEPES), preincubated in 1.0 mL bated in cell extraction buffer (FNN0011 Thermo Scientific) þ of prewarmed Na -free HBSS at 37C for 5 minutes before adding supplemented with Halt protease inhibitor cocktail (78429 substrates for the uptake experiment. Cells were then incubated at Thermo Scientific) and lysed using a Precellys homogenizer. þ 37C for 1 minute in 750 mLofNa -free HBSS containing 1.0 Animal housing was done in compliance to the EU directive 14 fl mmol/L of L-[ C]-leucine (0.03 mCie/mL; PerkinElmer). Subse- 2010/63/EU. Brie y, each cage contained 5 mice with an enriched þ quently, cells were washed three times with ice-cold Na -free environment. Food and water were given ad libitum, and the litter HBSS containing 1.0 mmol/L of nonradiolabeled leucine. Cells was changed on a weekly basis. Animal care met the EU directive were then lysed with 50 mL of 0.1 N NaOH and mixed with 3.5 mL 2010/63/EU ethical criteria. The animal experimentation proto- of Emulsifier-Safe cocktail (PerkinElmer). Radioactivity was mea- col was approved by the local animal care committee (Veterinary sured using a b-scintillation counter. For the inhibition experi- Service and Direction of Sanitary and Social Action of Monaco; Dr. 14 fi ments, the uptake of 1.0 mmol/L L-[ C]-leucine is examined in the H. Raps, Centre Scienti que de Monaco, Monaco). presence of BCH (1.0 mmol/L). Statistical analysis Proliferation assay Data are expressed as mean SD. Each experiment was per- The different cell lines (2.5 104 cells for 7 days, 5 104 cells formed at least three times. Statistical analysis was done with the t for 3 days) were seeded onto 6-well plates in triplicate per cell line unpaired Student test. Differences between groups were consid- fi P < and per condition. We measured proliferation by trypsinizing the ered statistically signi cant when 0.05. cells and counting them daily with a Coulter Z1 (Beckman) during 3 or 7 days. The cell proliferation index was calculated as "fold Results increase" by standardizing each measurement to the cell number CD98 and LAT1 expression, localization, and activity are obtained 24 hours after seeding (day 0). interdependent LAT1 or CD98 knockouts (KO) were created in the colon Three-dimensional growth assay adenocarcinoma cell line LS174T using ZFNs. To avoid clonal LS174T 3D cultures were prepared using the liquid overlay effects, we always tested two independent clones of each disrupted method. Briefly, 24-well culture plates were coated with 1.5% gene. Lack of corresponding protein expression (Fig. 1A), genome agarose prepared in sterile water. Cells (10,000) from a single-cell analysis, and sequencing around the ZFN-targeted site demon- suspension were added per well. The plates were gently swirled strated that the mutations introduced (see Supplementary Table KO and incubated at 37 Cin5%CO2 atmosphere until cells were S2) disrupted the different alleles. LAT1 cells exhibit an 80% organized into 3D. Media were changed once every 3 days. After 9 decrease in total CD98 protein expression (Fig. 1A and Supple- days, 3D culture images were taken using an EVOS Cell Imaging mentary Fig. S1A), resulting in a 60% reduction of the functional Systems (Life Technologies), and the 3D culture surface area was plasma membrane expression (Fig. 1B). Furthermore, qPCR anal- measured using ImageJ. ysis revealed that the CD98 protein reduction in LAT1KO cells is

www.aacrjournals.org Cancer Res; 76(15) August 1, 2016 OF3

Cormerais et al.

Figure 1. LAT1 and CD98 expression, localization, and activity are interdependent. A, LAT1 and CD98 protein expressions were analyzed by immunoblotting in LS174T WT, LAT1KO, and CD98KO cells, demonstrating an interdependence of protein expression for CD98. Two independent clonal cell lines of LAT1 and CD98 knockout are shown (#1, #2). Tubulin was used as a loading control (Ctrl). B, plasma membrane expression of CD98 was analyzed by flow cytometry in LS174T WT, LAT1KO, and CD98KO cells. Relative membrane expression of CD98 is noted on each panel as a percentage (%) compared with WT cells. C, immunofluorescence was performed on LS174T WT, LAT1,andCD98KO cells using LAT1 and CD98 antibodies to analyze protein localization using confocal microscopy. Note the cytoplasmic localization of LAT1 in CD98 knockout cells. Scale bars are indicated on each panel. D, LAT1 transport activity of LS174T WT, LAT1KO,andCD98KO cells was measured by [14C]-leucine (14C-LEU) uptake in Naþ-free HBSS media containing 1 mmol/L leucine with or without the LATs inhibitor BCH (10 mmol/L). These results represent the average of three independent experiments. , P < 0.05; , P < 0.001. n.s, not significant.

partially due to reduced mRNA expression (Supplementary Fig. transport. Ablation of LAT1 fully abolished the leucine uptake, S1B). Similar independent results were obtained in inducible confirming that LAT1 is the only functional large neutral AA LAT1 knockdown (KD) LS174T cells and LAT1KO in the lung transporter expressed in LS174T (Fig. 1D). CD98KO cells also þ carcinoma A549 cell line (Supplementary Fig. S1C and S1D). show a 90% reduction in Na -independent leucine transport Therefore, despite the fact that CD98 can heterodimerize with (Fig. 1D). However, the residual 10% transport activity detected þ þ other transporters (LAT2, y LAT1, y LAT2, and xCT), LAT1 repre- in CD98KO cells is significant and sensitive to the LATs inhibitor sents the major expressed light chain in the two tumor cell lines BCH (Fig. 1D) and JPH203 (see below). LS174T and A549. In contrast, LAT1 total protein expression is reduced in CD98KD and CD98KO cells (Supplementary Fig. S1A LAT1 ablation disrupts AA homeostasis and abolishes and S1C) and retained in the cytoplasm (Fig. 1C). This finding is proliferation, whereas CD98 knockout does not in agreement with the notion that CD98 is required to control As LAT1 transport activity is severely decreased in both CD98 LAT1 trafficking and functional insertion in the plasma and LAT1 knockouts, we analyzed their effects on the two AA- membrane. sensing pathways: GCN2 and mTORC1 (reviewed in ref. 25). In We next investigated the impact of these gene knockouts on nutrient-rich media (1 DMEM), LAT1KO cells display an induc- þ LAT1 activity by measuring the Na -independent rate of leucine tion of the AA stress response pathway GCN2/EIF2a/ATF4,

OF4 Cancer Res; 76(15) August 1, 2016 Cancer Research

Genetic Dissection of LAT1/CD98 Complex and Tumor Growth

demonstrating AA deficiency (Fig. 2A). In contrast, minor changes Similar results were observed with the second cell line (A549) in the mTORC1 pathway were observed through the phosphor- disrupted for LAT1 (Supplementary Fig. S2A). In contrast, ylation of p70-S6K and RPS6, as only the phosphorylation of p70- although CD98KO cells have a strongly reduced LAT1 activity S6K decreased while its target S6RP remained unchanged (90%), no changes in the GCN2 and mTORC1 pathways are (Fig. 2A). We then challenged these cells with a media where the detectable in both 1 and 0.3 DMEM (Fig. 2A and B). Similar concentrations of LAT1 substrates are closer to physiological results were obtained for the GCN2 pathway with a 90% knock- levels (0.3 DMEM; Supplementary Table S1). In this condition, down of CD98 in A549 cells (Supplementary Fig. S3A and S3B). while the wild-type (WT) LS174T cells do not present any mod- mTORC1 (26, 27) and more recently GCN2 (28) have been ification in mTORC1 and GCN2 pathways, LAT1KO cells display demonstrated to control cell proliferation. We therefore investi- strong modifications in both pathways (Fig. 2A). Quantification gated the effect of either LAT1 or CD98 knockout on in vitro of GCN2 activity using the ATF4 expression shows that this LS174T proliferation (Fig. 3A). In 1 DMEM, LAT1 ablation pathway is increased by 10-fold compared with the wild-type decreased LS174T proliferation by 60% (Fig. 3A and B, left), and cells (Fig. 2B). In parallel, mTORC1 activity measured by the a decreased nutrient challenge with 0.3 EAA-derived DMEM phosphorylation level of RPS6 decreased by 50% (Fig. 2C). dramatically reduced their proliferation by more than 90%

Figure 2. LAT1 knockout induces an AA stress response and decreases mTORC1 activity. A, LS174T WT, LAT1KO,and CD98KO cells were cultivated for 24 hours in either 1 or 0.3 DMEM (see Materials and Methods for detailed composition). Changes in phosphorylation status and protein abundance of members of the two major AA-sensing pathways GCN2 (p-GCN2/p-EIF2a/ATF4) and mTORC1 (p-p70-S6K and p-RPS6) were analyzed by Western blot analysis. Tubulin was used as a loading control. Differential responses between cell lines are observed between culture media composition. B, quantification of AA-sensing pathways: GCN2 (ATF4/TUBULIN ratio, left) and mTORC1 (p-RPS6/RPS6 ratio, right) in LS174T WT, LAT1KO and CD98KO cells cultivated 24 hours in 0.3 DMEM. Quantifications represent the average of three independent experiments. , P < 0.05; , P < 0.01; n.s, not significant.

www.aacrjournals.org Cancer Res; 76(15) August 1, 2016 OF5

Cormerais et al.

Figure 3. LAT1 knockout dramatically reduces cell proliferation, whereas CD98 ablation has no effect. A, cell proliferation of LS174T WT, LAT1KO(two independent cell lines), and CD98KO (two independent cell lines) cells. Cells were cultivated for 7 days in either 1 or 0.3 DMEM, and media were replaced every 3 days. Proliferation rates are presented as fold increase (see Materials and Methods for detailed description). B, clonal growth of LS174T WT, LAT1KO,andCD98KO. Cells were cultivated 15 days either in 1 or 0.3 DMEM and colored for visualization using Giemsa. Media were replaced every 3 days. C, three-dimensional spheroid growth of LS174T WT, LAT1KO, and CD98KO cells was produced following 9 days in suspension in 0.3 DMEM. Representative images are shown (scale bars are indicated on each panel and represent 1 mm), and quantification of spheroid size was performed to illustrate differences between cell types. Quantification data are combined from 10 different spheroids per cell type. , P < 0.05; , P < 0.001. n.s, not significant.

(Fig. 3A and B, right). Consistent with our results for mTORC1 JPH203 (Supplementary Fig. S4A and S4B; refs. 23, 24) in six and GCN2 activity, LS174T-CD98KOand A549-CD98KD cells are different cell lines from colon (LS174T, HT29), lung (A549, able to maintain their proliferation at the same level as WT cells H1975), and renal cell carcinoma (786-O and A498). (Fig. 3A and B and Supplementary Fig. S3C). Furthermore, we confirmed that this LAT1KO-specific antiproliferative effect (70% Residual LAT1 activity in CD98KO cells ensures proliferation reduction) was observed in 3D culture assays (Fig. 3C). Interest- We then focused on the surprising growth phenotype of ingly, whereas CD98 has been described to be important for CD98KO cells. In particular, we wanted to understand how cells anchorage-independent survival and growth (7), 3D cultures that have lost 90% of the LAT1 EAA transport activity (Fig. 1D) show that only CD98KO cells are able to grow like WT cells (Fig. and should have also reduced activities from additional trans- 3C, bottom). porters like xCT (29) are able to proliferate in 0.3 media at the These findings demonstrate an essential role of LAT1 for main- same rate as WT cells. First, we tested the possibility that CD98 tenance of tumor cell AA homeostasis and proliferation. We disruption could have induced another transporter capable to confirmed these results by either invalidating (Supplementary compensate for the lack of EAA transport by LAT1. A good Fig. S2A–S2C) or inhibiting LAT1 with the specific inhibitor candidate was SLC6A14, which transports all neutral AA (30).

OF6 Cancer Res; 76(15) August 1, 2016 Cancer Research

Genetic Dissection of LAT1/CD98 Complex and Tumor Growth

However, this transporter was only detectable at very low levels by this finding by generating double knockout (dKO) LS174T qRT-PCR and Western blotting, while its expression was not cells: CD98KO/LAT1KO (Fig. 4C, lane dKO). dKO cells present increased in CD98KO cells. In addition we were not able to detect thesamestressresponseastheLAT1KO cells: the GCN2/EIF2a/ þ aNa -dependent leucine transport activity (data not shown). ATF4 pathway is induced while the mTORC1 activity is strongly We then investigated the impact on proliferation of the decreased (Fig. 4C) and in vitro proliferation is also strongly residual LAT1 activity present in CD98KO cells using JPH203. inhibited (Fig. 4D). Interestingly, downregulation of mTORC1 Growth dose response demonstrated an extreme sensitivity of is stronger in dKO cells than in LAT1KO cells (Fig. 4C). This KO CD98 cells to JPH203 with an IC50 of 1.0 mmol/L, whereas result can be easily explained by the fact that CD98 is able to the IC50 for WT cells was 35-fold higher (Fig. 4A). Furthermore, heterodimerize with others transporters. Therefore, double 5.0 mmol/L of JPH203 completely abolished the growth of CD98KO, LAT1KO likely abolish, besides EAA transport, addi- CD98KO cells (Fig. 4A and B), indicating that CD98KO cell tional AA transporter like xCT, explaining this deeper effect on growth is critically dependent on the LAT1 residual activity. the mTORC1 activity. Combined, these data demonstrate that These findings were confirmed in A549-CD98KD cells, where 30 maintenance of CD98KO and KD cell proliferation is not due to mmol/L of JPH203 abolishes growth while WT cells continue to an adaptation resulting from CD98 invalidation but to a grow (Supplementary Fig. S3D). We independently confirmed residual LAT1 transport activity.

Figure 4. Residual activity of LAT1 in CD98KO cells maintains cell proliferation. A, dose–response analysis of the LAT1- specific inhibitor JPH203 in LS174T WT and CD98KO cells. Cells were cultivated for 3 days in 0.3 DMEM containing different concentrations of inhibitor, and cell numbers were counted to determine proliferation rates. At 1 to 40 mmol/L of JPH203, the proliferation of the two CD98KO clones was significantly decreased compared with WT cells. B, clonal growth of WT, LAT1KO, and CD98KO LS174T cells cultivated for 15 days in 0.3 DMEM and treated with DMSO or different concentrations of JPH203 (1.0, 2.5, or 5.0 mmol/L), with visualization achieved via Giemsa staining. C, LS174T WT, LAT1KO, CD98KO, and LAT1/CD98 dKO cells were cultivated for 24 hours in 0.3 DMEM for analysis of the AA-sensing pathways GCN2 (p-GCN2/p-EIF2a/ATF4) and mTORC1 (p-p70-S6K and p-RPS6) via immunoblotting. Tubulin was used as a loading control. D, cell proliferation rates of LS174T WT, LAT1KO, CD98KO, and dKO cells. Cells were counted after 3 days of culture in 0.3 DMEM. For statistical analysis, these data represent the average three independent experiments. , P < 0.001. n.s, not significant.

www.aacrjournals.org Cancer Res; 76(15) August 1, 2016 OF7

Cormerais et al.

Reduced CD98 expression in LAT1KO cells has a minor impact ity was completely recovered, while no induction of the GCN2 on proliferation pathwaywasdetectable(Fig.5C).InLAT1KO cells transfected To investigate the impact of reduced CD98 expression in with xCT (LAT1KO xCT), the GCN2 pathway was still activated, LAT1KO cells, we designed an experiment that fully restored but surprisingly, the induction of ATF4 was reduced by the xCT endogenous CD98 expression at the cell surface in LAT1KO cells overexpression (Fig. 5C). The mTORC1 activity was also recov- while maintaining the lack of EAA transport. For this, we ered in LAT1KO xCT cells (Fig. 5C). With regards to the prolif- transfected xCT cDNA in LAT1KO cells. Like LAT1, xCT is a eration phenotype, as expected, LAT1 rescue completely light chain of CD98 but has a completely different function. restores the growth of LS174T cells, whereas xCT overexpres- Although LAT1 is important for EAA transport, xCT transports sion has only a minimal effect on proliferation that could cystine, an essential precursor of glutathione synthesis to coun- reflect the increased expression of xCT (Fig. 5C and D). We teract oxidative stress (31, 32). As expected, expression of xCT confirmed these findings in the lung carcinoma A549 cell line. or of LAT1 as a control restored the plasma membrane expres- TransienttransfectionofLAT1inA549LAT1KO cells rescued sion of CD98 in LAT1KO cells (Fig. 5A). However, only LAT1 cell proliferation, whereas xCT had no effect (Supplementary reexpression was able to restore leucine transport activity (Fig. Fig. S5). These results demonstrate that CD98 downregulation 5B). This restoration of AA transport activity in LAT1 rescue in LAT1KO is not implicated in the severe growth phenotype of cells reestablished AA homeostasis. Indeed, the mTORC1 activ- LAT1KO and again highlight the key role EAA transport in cell

Figure 5. Interactions between reduced CD98 expression and rescue in LAT1KO cell proliferation. A, plasma membrane expression of CD98 was analyzed by ﬂow cytometry in LS174T WT, LAT1KO, and LAT1KO cells stably expressing either the xCT or LAT1 cDNA to observe rescue of CD98 expression. Relative membrane expression (%) is indicated for each cell type. B, LAT1 transport activity of LS174T WT, LAT1KO,andLAT1KO cells stably expressing either the xCT or LAT1 was measured by [14C]-leucine (14C-LEU) uptake in Naþ-free HBSS media. C, LS174T WT, LAT1KO,andLAT1KO cells stably expressing either xCT or LAT1 were cultivated for 24 hours in 0.3 DMEM and the two AA-sensing pathways GCN2 (p-GCN2/p-EIF2a/ ATF4) and mTORC1 (p-p70-S6K and p-RPS6) were analyzed by immunoblotting. Tubulin was used as a loading control. D, cell proliferation analysis of LS174T WT, LAT1KO, and LAT1KO cells stably expressing either xCT or LAT1. Cells were counted after 3 days of culture in 0.3 DMEM. These results represent the average of three independent experiments. , P < 0.05; , P < 0.01; , P < 0.001. n.s, not signiﬁcant.

OF8 Cancer Res; 76(15) August 1, 2016 Cancer Research

Genetic Dissection of LAT1/CD98 Complex and Tumor Growth

growth. In addition, the complete growth phenotype rescue by LAT1 transporter is critical for mTORC1 activity and tumor LAT1 reexpression in LS174T- and A549-LAT1KOillustrates that growth the phenotypes described were not due to ZFN-mediated off- In this report, investigating the multifunctional CD98/LAT1 target effects. transporter complex in the context of AA stress response, prolif- Furthermore, pharmacologic inhibition of LAT1 in six inde- eration, and tumor growth, we first showed that LAT1KO cells are pendent cancer cell lines [colon (LS174T, HT29), lung (A549, capable to grow (50% reduction compared with WT) in the "super H1975), and kidney carcinomas (786-O, A498)] did not decrease rich" nutrient culture media (DMEM). However, restoring an EAA CD98 expression (Supplementary Fig. S4A), while it mimicked concentration closer (but still above) to physiological values in the LAT1KO growth phenotype. Indeed, JPH203 treatment the culture media with the exception of tryptophan (Supplemen- increased the GCN2 pathway, reduced mTORC1 activity (Sup- tary Table S1) strongly induced an AA stress, restricted mTORC1 plementary Fig. S4A), and inhibited proliferation (Supplemen- activity, and arrested in vitro proliferation in the two human cancer tary Fig. S4B) in all of the cell lines tested. These findings further cell lines tested (LS174T, A549), as well as tumor growth for confirmed that the decreased expression of CD98 in LAT1KO cells LS174T. However, this major growth defect associated to the has no impact on their AA stress response and growth phenotype. single LAT1KO might not seem surprising considering the con- Combined, these results demonstrate that LAT1 carries the dom- comitant 80% decrease in total CD98 protein and 60% to 65% inant protumoral role in comparison with CD98 across multiple reduction at the cell surface (Fig. 1). We therefore could have cancer types. concluded that this drastic phenotype resulted from abrogation of the dual EAA transport activity of LAT1 and of b-integrin signaling. In fact, several arguments led us to fully reject this interpretation. LAT1 is essential for mTORC1 activity and tumor growth in vivo First, the single CD98KO in LS174T cells also led to a concom- Finally, we wanted to validate our results demonstrating a itant severe reduction of LAT1 transport activity (10% residual) strong impact of LAT1 removal on cancer cell proliferation with, surprisingly, no detectable growth phenotype. Inhibition of using an in vivo xenograft model. LS174T-derived cells were the residual LAT1 activity of CD98KO elicited AA stress and cell injected subcutaneously into nude mice and tumor growth was growth, illuminating LAT1 as the key protumoral element of the monitored (Fig. 6A). Consistent with our in vitro results, WT membrane heterodimer. However, this was a surprising result and CD98KO tumors grow at the same rate while LAT1 inval- considering that CD98 (4F2hc) acts as a chaperone for multiple idation decreased tumor growth by 91% at day 20 (Fig. 6A). AA transporters, including xCT. The hypothesis that these cells Following tumor growth experiments, protein analysis was might have acquired another AA transporter, such as SLC6A14 performed in three independent tumors of each LS174T- that is capable to transport several AAs, including EAA (37), could derived cell line (Fig. 6B). Interestingly, CD98 expression is not be validated in our cellular models (data not shown). In even more reduced in LAT1KO tumors (93%) compared with in contrast, pharmacologic inhibition of LAT1 (JPH203) or genetic vitro cultures and LAT1 expression, as well, is more dramatically invalidation of the residual 10% leucine transport activity decreased in CD98KO tumor (91%; Fig. 6B and C). Furthermore, (CD98KO/LAT1KO) was sufficient to induce an AA stress response as in vitro, AA-sensing pathways are altered specifically in and suppressed in vitro growth and tumorigenicity in CD98KO LAT1KO tumors: ATF4 is induced, whereas mTORC1 activity is cells. decreased by more than 70% (Fig. 6B and C). Finally, genetic Second, we fully restored CD98 expression in LAT1KO cells. disruption of residual LAT1 activity in CD98KO cells (dKO) As CD98 requires a light chain as a co-chaperone to be disrupts mTORC1 activity and fully ablates the tumorigenic expressed in the membrane, we ectopically expressed xCT in potential of LS174T cells (Supplementary Fig. S6A–S6C). These LS174T and A549 cells. Even under these conditions, which results demonstrate the key role of LAT1 for maintenance of allow full surface reexpression of CD98 in LAT1KO cells, we tumor growth by sustaining tumor AA homeostasis and could not rescue the growth defect phenotype of LAT1KO cells. mTORC1 activity. The LS174T LAT1KO CD98high (xCT) cells display only a slightly attenuated AA stress response that might result from the over- Discussion expression of the xCT transporter responsible for antioxidant Growth factor signals transduced through the ERK/PI3K/Akt/ production. mTORC1 pathway upregulate nutrient transporters (33). How- Third, the pharmacologic targeting of LAT1 with JPH203 ever, these transporters have kept the ability developed in allowed us to explore six human cancer cell lines expressing bacteria to be upregulated in response to nutrient depletion, different levels of LAT1 (Supplementary Fig. S4A). As expected, and in addition, some transporters are transcriptionally JPH203 did not reduce CD98 expression, with the expression induced by HIFs in the nutrient-deprived tumor microenviron- being even slightly increased in all cell lines following the con- ment (2, 3). Among the many AA transporters identified in comitant increased expression of LAT1. Interestingly however, human physiology (34, 35), at least three AA transporter targeting LAT1 alone with JPH203 drastically reduced cell prolif- systems have emerged as playing a major role in the control eration associated with all detected markers of AA stress, including of growth and cancer aggressiveness if we consider their members of the GCN2 and mTORC1 pathways in all six cell lines increased level of expression and correlation with poor disease (Supplementary Fig. S4A and S4B). This finding fully confirmed prognosis. These are the bidirectional EAA transporter complex and extended the genetic disruption of LAT1. CD98/LAT1 (SLC5A7) induced by HIF2 (18) and apparently functionally "coupled" to the high-affinity glutamine transport- LAT1: a dual cytosolic/lysosomal leucine transporter? er ASCT2 (SLC1A5; ref. 36) and the cystine transporter complex Although not yet fully resolved, the field of mTORC1 activation CD98/xCT (SLC7A11) essential for glutathione synthesis and by AA has rapidly progressed. Three variations of leucine-sensing resistance to chemotherapeutic agents (32). mechanisms regulating mTORC1 activity have been uncovered.

www.aacrjournals.org Cancer Res; 76(15) August 1, 2016 OF9

Cormerais et al.

Figure 6. LAT1 is essential for tumor growth in vivo. A, tumor volumes of nude mice injected subcutaneously with LS174T WT, LAT1KO,andCD98KO cells revealed dramatic inhibition of tumor growth with LAT1 knockout. B, protein levels of LAT1, CD98, and the two AA-sensing pathways GCN2 (ATF4) and mTORC1 (S6K and RPS6) were analyzed by immunoblotting in three independent tumors from each LS174T-derived cell line (WT, LAT1KO,andCD98KO). Tubulin acted as a protein-loading control. SE, short exposition; LE, long exposition. C, quantiﬁcation of LAT1, CD98 expression, and mTORC1 activity (p-RPS6/RPS6 ratio, right) in tumors from each LS174T-derived cell line (WT, LAT1KO,andCD98KO). , P < 0.01; , P < 0.001. n.s, not signiﬁcant.

Han and colleagues demonstrated that a cytoplasmic detection of transporter to have two distinct chaperones, CD98 for plasma leucine occurs by the tRNA-charging enzyme leucyl-tRNA synthe- membrane and LAPTM4b for LAT1 lysosomal membrane expres- tase, which translocates to the lysosome and promotes mTORC1 sion (40). This finding of dual LAT1 expression could explain the activity (38). Wolfson and colleagues provided evidence that extreme mTORC1 inhibition and growth defects of LAT1KO cells, sestrin2 is responsible for cytoplasmic leucine sensing and contrasting with the nonaffected CD98KO cells. Intriguingly, we mTORC1 activation (39). Finally, recent work by Milkereit and observed increased mTORC1 activity in A549 CD98KD cells (Sup- colleagues suggested a novel mechanism based on leucine lyso- plementary Fig. S3B), which agrees with a recent study on ES- somal sensing (40). This last mechanism is particularly appealing derived fibroblasts CD98KO cells (41). We propose that by sup- in the context of this study, as LAT1 might be the first AA pression of CD98 the LAT1 expression ratio between lysosomal/

OF10 Cancer Res; 76(15) August 1, 2016 Cancer Research

Genetic Dissection of LAT1/CD98 Complex and Tumor Growth

plasma membranes may have increased and induced a stronger Authors' Contributions mTORC1 signal. However, even if mTORC1 is increased in certain Conception and design: Y. Cormerais, R. LeFloch, H. Endou, S.K. Parks, cell lines when CD98 is knocked out or knocked down, these J. Pouyssegur results demonstrate that AA homeostasis is drastically disrupted Development of methodology: Y. Cormerais, R. LeFloch, E. Tambutte, M.F. Wempe, J. Pouyssegur in LAT1KO cells, whereas it is still maintained in CD98KOor Acquisition of data (provided animals, acquired and managed patients, CD98KD cells. provided facilities, etc.): Y. Cormerais, S. Giuliano, B. Front, E. Tambutte, H. Endou, J. Pouyssegur Conclusion Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): Y. Cormerais, S. Giuliano, J. Durivault, L.R. de la Our study highlights the dominant protumoral role of LAT1 in Ballina, S.K. Parks, J. Pouyssegur comparison with CD98. Indeed, although the tumoral impacts of Writing, review, and/or revision of the manuscript: Y. Cormerais, B. Front, integrin signaling are well described (42, 43), a loss of CD98 does P.-A. Massard, M.F. Wempe, S.K. Parks, J. Pouyssegur not affect the integrin levels in the cell (Supplementary Fig. S1F Administrative, technical, or material support (i.e., reporting or organizing and S1G), whereas a loss of LAT1 affects the foundation of cell data, constructing databases): J. Durivault, P.-A. Massard, L.R. de la Ballina, M.F. Wempe, M. Palacin, J. Pouyssegur proliferation by preventing essential nutrient import and Study supervision: S.K. Parks, J. Pouyssegur mTORC1 activation. This dependency leads to cancer cell reliance Other (suggested LAT1 mutations to eliminate transport activity without on LAT1 activity to sustain tumoral AA homeostasis, mTORC1 affecting CD98hc interaction and his laboratory generated the tagged ver- activation, and tumor growth. Previous studies from our labora- sions of human light subunits of LAT1 used in this study): M. Palacin tory investigated the potential of disrupting different metabolism- related proteins as therapeutic targets (44–47). Use of the aggres- Acknowledgments sive LS174 xenograft model in these previous studies underlined The authors thank Ludovic Cervera and CytoMed, the IRCANs' Flow Cyto- the problem of the functional protein redundancy in terms of metry Facility. cancer treatment. Indeed, dramatic reductions in tumor growth were obtained only by combined targeting of two carbonic anhydrases (44) or two lactate transporter isoforms (47). Intrigu- Grant Support ingly, here we show that in the same aggressive LS174 xenograft This work was entirely supported by the government of Monaco, includ- model, ablation of LAT1 alone is sufficient to abolish tumor ing thesis (Y. Cormerais), master (P.A. Massard), and post-doctoral (S.K. growth, demonstrating an absence of redundancy for essential Parks) fellowships. This project has also been, in part, supported by the AA transport in certain tumors. Together, these results highlight GEMLUC, Ligue Nationale Contre le Cancer (JP, Equipe labellisee), IRCAN, the essential protumoral role of LAT1 and demonstrate that LAT1 University of Nice, and Centre A. Lacassagne. The materials of CytoMed were supported by the Conseil General 06, the FEDER, the Ministere de is a promising individual target for future efforts in anticancer l'Enseignement Superieur, the Region Provence Alpes-Cote^ d'Azur and the drug development. INSERM, France. The costs of publication of this article were defrayed in part by the payment of Disclosure of Potential Conflicts of Interest page charges. This article must therefore be hereby marked advertisement in Hitoshi Endou is the CEO at and has ownership interest (including patents) accordance with 18 U.S.C. Section 1734 solely to indicate this fact. in J-Pharma. M.F. Wempe has ownership interest (including patents) in and is a consultant/advisory board member for J-Pharma. No potential conflicts of Received December 16, 2015; revised May 20, 2016; accepted May 23, 2016; interest were disclosed by the other authors. published OnlineFirst June 14, 2016.

References 1. Pouyssegur J, Dayan F, Mazure NM. Hypoxia signalling in cancer and 10. Hara K, Kudoh H, Enomoto T, Hashimoto Y, Masuko T. Malignant approaches to enforce tumour regression. Nature 2006;441:437–43. transformation of NIH3T3 cells by overexpression of early lymphocyte 2. McCracken AN, Edinger AL. Nutrient transporters: the Achilles' heel of activation antigen CD98. Biochem Biophys Res Commun 1999;262: anabolism. Trends Endocrinol Metab 2013;24:200–8. 720–5. 3. Parks SK, Cormerais Y, Marchiq I, Pouyssegur J. Hypoxia optimizes tumour 11. Shishido T, Uno S, Kamohara M, Tsuneoka-Suzuki T, Hashimoto Y, growth by controlling nutrient import and acidic metabolite export. Mol Enomoto T, et al. Transformation of BALB3T3 cells caused by over- Aspects Med 2016;47–48:3–14. expression of rat CD98 heavy chain (HC) requires its association with 4. Bhutia YD, Babu E, Ramachandran S, Ganapathy V. Amino Acid transpor- light chain: mis-sense mutation in a cysteine residue of CD98HC elim- ters in cancer and their relevance to "glutamine addiction": novel targets for inates its transforming activity. Int J Cancer 2000;87:311–6. the design of a new class of anticancer drugs. Cancer Res 2015;75:1782–8. 12. Estrach S, Lee SA, Boulter E, Pisano S, Errante A, Tissot FS, et al. CD98hc 5. Zent R, Fenczik CA, Calderwood DA, Liu S, Dellos M, Ginsberg MH. Class- (SLC3A2) loss protects against ras-driven tumorigenesis by modulating and splice variant-speciﬁc association of CD98 with integrin beta cyto- integrin-mediated mechanotransduction. Cancer Res 2014;74:6878–89. plasmic domains. J Biol Chem 2000;275:5059–64. 13. Nakamura E, Sato M, Yang H, Miyagawa F, Harasaki M, Tomita K, et al. 4F2 6. Fenczik CA, Zent R, Dellos M, Calderwood DA, Satriano J, Kelly C, et al. (CD98) heavy chain is associated covalently with an amino acid trans- Distinct domains of CD98hc regulate integrins and amino acid transport. J porter and controls intracellular trafﬁcking and membrane topology of 4F2 Biol Chem 2001;276:8746–52. heterodimer. J Biol Chem 1999;274:3009–16. 7. Rintoul RC, Buttery RC, Mackinnon AC, Wong WS, Mosher D, Haslett C, 14. Yanagida O, Kanai Y, Chairoungdua A, Kim DK, Segawa H, Nii T, et al. et al. Cross-linking CD98 promotes integrin-like signaling and anchorage- Human L-type amino acid transporter 1 (LAT1): characterization of func- independent growth. Mol Biol Cell 2002;13:2841–52. tion and expression in tumor cell lines. Biochim Biophys Acta 8. Feral CC, Nishiya N, Fenczik CA, Stuhlmann H, Slepak M, Ginsberg MH. 2001;1514:291–302. CD98hc (SLC3A2) mediates integrin signaling. Proc Natl Acad Sci U S A 15. Kanai Y, Segawa H, Miyamoto K, Uchino H, Takeda E, Endou H. Expression 2005;102:355–60. cloning and characterization of a transporter for large neutral amino acids 9. Cantor JM, Ginsberg MH. CD98 at the crossroads of adaptive immunity activated by the heavy chain of 4F2 antigen (CD98). J Biol Chem and cancer. J Cell Sci 2012;125:1373–82. 1998;273:23629–32.

www.aacrjournals.org Cancer Res; 76(15) August 1, 2016 OF11

Cormerais et al.

16. Marchiq I, Pouyssegur J. Hypoxia, cancer metabolism and the therapeutic 32. Lo M, Wang YZ, Gout PW. The x(c)- cystine/glutamate antiporter: a benefit of targeting lactate/H symporters. J Mol Med 2016;94:155–71. potential target for therapy of cancer and other diseases. J Cell Physiol 17. Vaupel P, Kallinowski F, Okunieff P. Blood flow, oxygen and nutrient 2008;215:593–602. supply, and metabolic microenvironment of human tumors: a review. 33. Edinger AL. Controlling cell growth and survival through regulated nutri- Cancer Res 1989;49:6449–65. ent transporter expression. Biochem J 2007;406:1–12. 18. Elorza A, Soro-Arnaiz I, Melendez-Rodriguez F, Rodriguez-Vaello V, Mars- 34. Broer S, Palacin M. The role of amino acid transporters in inherited and boom G, de Carcer G, et al. HIF2alpha acts as an mTORC1 activator acquired diseases. Biochem J 2011;436:193–211. through the amino acid carrier SLC7A5. Mol Cell 2012;48:681–91. 35. Makrides V, Camargo SM, Verrey F. Transport of amino acids in the kidney. 19. Sakata T, Ferdous G, Tsuruta T, Satoh T, Baba S, Muto T, et al. L-type amino- Compr Physiol 2014;4:367–403. acid transporter 1 as a novel biomarker for high-grade malignancy in 36. Nicklin P, Bergman P, Zhang B, Triantafellow E, Wang H, Nyfeler B, et al. prostate cancer. Pathol Int 2009;59:7–18. Bidirectional transport of amino acids regulates mTOR and autophagy. 20. Kaira K, Oriuchi N, Imai H, Shimizu K, Yanagitani N, Sunaga N, et al. Cell 2009;136:521–34. Prognostic significance of L-type amino acid transporter 1 expression in 37. Babu E, Bhutia YD, Ramachandran S, Gnanaprakasam JP, Prasad PD, resectable stage I–III nonsmall cell lung cancer. Br J Cancer 2008; Thangaraju M, et al. Deletion of the amino acid transporter Slc6a14 98:742–8. suppresses tumour growth in spontaneous mouse models of breast cancer. 21. Haining Z, Kawai N, Miyake K, Okada M, Okubo S, Zhang X, et al. Relation Biochem J 2015;469:17–23. of LAT1/4F2hc expression with pathological grade, proliferation and 38. Han JM, Jeong SJ, Park MC, Kim G, Kwon NH, Kim HK, et al. Leucyl-tRNA angiogenesis in human gliomas. BMC Clin Pathol 2012;12:4. synthetase is an intracellular leucine sensor for the mTORC1-signaling 22. Betsunoh H, Fukuda T, Anzai N, Nishihara D, Mizuno T, Yuki H, et al. pathway. Cell 2012;149:410–24. Increased expression of system large amino acid transporter (LAT)-1 mRNA 39. Wolfson RL, Chantranupong L, Saxton RA, Shen K, Scaria SM, Cantor JR, is associated with invasive potential and unfavorable prognosis of human et al. Sestrin2 is a leucine sensor for the mTORC1 pathway. Science clear cell renal cell carcinoma. BMC Cancer 2013;13:509. 2016;351:43–8. 23. Wempe MF, Rice PJ, Lightner JW, Jutabha P, Hayashi M, Anzai N, et al. 40. Milkereit R, Persaud A, Vanoaica L, Guetg A, Verrey F, Rotin D. LAPTM4b Metabolism and pharmacokinetic studies of JPH203, an L-amino acid recruits the LAT1–4F2hc Leu transporter to lysosomes and promotes transporter 1 (LAT1) selective compound. Drug Metab Pharmacokinet mTORC1 activation. Nat Commun 2015;6:7250. 2012;27:155–61. 41. de la Ballina LR, Cano-Crespo S, Gonzalez-Munoz E, Bial S, Estrach S, 24. Oda K, Hosoda N, Endo H, Saito K, Tsujihara K, Yamamura M, et al. L-type Cailleteau L, et al. Amino acid transport associated to cluster of differen- amino acid transporter 1 inhibitors inhibit tumor cell growth. Cancer Sci tiation 98 heavy chain (CD98hc) is at the crossroad of oxidative stress and 2010;101:173–9. amino acid availability. J Biol Chem 2016;291:9700–11. 25. Efeyan A, Comb WC, Sabatini DM. Nutrient-sensing mechanisms and 42. Sun CC, Qu XJ, Gao ZH. Integrins: players in cancer progression and targets pathways. Nature 2015;517:302–10. in cancer therapy. Anticancer drugs 2014;25:1107–21. 26. Brown EJ, Albers MW, Shin TB, Ichikawa K, Keith CT, Lane WS, et al. A 43. Seguin L, Desgrosellier JS, Weis SM, Cheresh DA. Integrins and cancer: mammalian protein targeted by G1-arresting rapamycin-receptor complex. regulators of cancer stemness, metastasis, and drug resistance. Trends Cell Nature 1994;369:756–8. Biol 2015;25:234–40. 27. Guertin DA, Sabatini DM. Defining the role of mTOR in cancer. Cancer Cell 44. Chiche J, Ilc K, Laferriere J, Trottier E, Dayan F, Mazure NM, et al. Hypoxia- 2007;12:9–22. inducible carbonic anhydrase IX and XII promote tumor cell growth by 28. Ye J, Kumanova M, Hart LS, Sloane K, Zhang H, De Panis DN, et al. The counteracting acidosis through the regulation of the intracellular pH. GCN2-ATF4 pathway is critical for tumour cell survival and proliferation in Cancer Res 2009;69:358–68. response to nutrient deprivation. EMBO J 2010;29:2082–96. 45. Doyen J, Parks SK, Marcie S, Pouyssegur J, Chiche J. Knock-down of 29. Fotiadis D, Kanai Y, Palacin M. The SLC3 and SLC7 families of amino acid hypoxia-induced carbonic anhydrases IX and XII radiosensitizes tumor transporters. Mol Aspects Med 2013;34:139–58. cells by increasing intracellular acidosis. Front Oncol 2012;2:199. 30. Karunakaran S, Ramachandran S, Coothankandaswamy V, Elangovan S, 46. Le Floch R, Chiche J, Marchiq I, Naiken T, Ilc K, Murray CM, et al. CD147 Babu E, Periyasamy-Thandavan S, et al. SLC6A14 (ATB0,þ) protein, a subunit of lactate/Hþ symporters MCT1 and hypoxia-inducible MCT4 is highly concentrative and broad specific amino acid transporter, is a novel critical for energetics and growth of glycolytic tumors. Proc Natl Acad Sci U and effective drug target for treatment of estrogen receptor-positive breast S A 2011;108:16663–8. cancer. J Biol Chem 2011;286:31830–8. 47. Marchiq I, Le Floch R, Roux D, Simon MP, Pouyssegur J. Genetic disruption 31. Ganapathy V, Thangaraju M, Prasad PD. Nutrient transporters in cancer: of lactate/Hþ symporters (MCTs) and their subunit CD147/BASIGIN relevance to Warburg hypothesis and beyond. Pharmacol Ther 2009;121: sensitizes glycolytic tumor cells to phenformin. Cancer Res 2015;75: 29–40. 171–80.

OF12 Cancer Res; 76(15) August 1, 2016 Cancer Research

Genetic Disruption of the Multifunctional CD98/LAT1 Complex Demonstrates the Key Role of Essential Amino Acid Transport in the Control of mTORC1 and Tumor Growth

Yann Cormerais, Sandy Giuliano, Renaud LeFloch, et al.

Cancer Res Published OnlineFirst June 14, 2016.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-15-3376

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2016/06/11/0008-5472.CAN-15-3376.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2016/07/18/0008-5472.CAN-15-3376. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.