Full Text (PDF)

Published OnlineFirst November 10, 2009; DOI: 10.1158/0008-5472.CAN-09-1778

Cell, Tumor, and Stem Cell Biology

Loss of Collapsin Response Mediator Protein1, as Detected by iTRAQ Analysis, Promotes Invasion of Human Gliomas Expressing Mutant EGFRvIII Joydeep Mukherjee,1 Leroi V. DeSouza,2 Johann Micallef,1 Zia Karim,1 Sid Croul,3 K.W. Michael Siu,2 and Abhijit Guha1,4

1Arthur and Sonia Labatts Brain Tumor Research Center, Hospital for Sick Children's Research Institute, University of Toronto, 2Department of Chemistry and Centre for Research in Mass Spectrometry, York University, 3Division of Neuropathology, Department of Pathology, Toronto Western Hospital, University of Toronto, and 4Division of Neurosurgery, Department of Surgery, Toronto Western Hospital, University of Toronto, Toronto, Canada

Abstract cellular domain of the 180-kDa wtEGFR. This mutant EGFR, Δ – Glioblastoma multiforme (GBM) is the most common and le- termed EGFR, de2-7 EGFR, or most commonly EGFRvIII (4 7), ∼ thal primary human brain tumor. GBMs are characterized by results in a truncated 140-kDa constitutively activated EGFRvIII, a variety of genetic alterations, among which oncogenic muta- with an identical intracellular domain to wtEGFR (3, 4, 8). Preclin- tions of epidermal growth factor receptor (EGFRvIII) is most ical studies have shown that GBMs that harbor EGFRvIII have an in vitro in vivo common. GBMs harboring EGFRvIII have increased prolifera- and growth advantage, compared with GBMs that tion and invasive characteristics versus those expressing wild- just overexpress wtEGFR (9). Clinical studies suggest that the ∼ type (wt) EGFR. To identify the molecular basis of this 25% of all GBM patients whose tumors express both EGFRvIII increased tumorgenic phenotype, we used iTRAQ-labeling dif- and wtEGFR have a shorter interval to relapse and decreased sur- ferential proteomic analysis. Among several differentially ex- vival rate, compared with GBMs with only wtEGFR (2, 10). pressed proteins, we selected CRMP1, a protein implicated in Much of the aggressive phenotype of GBMs expressing EGFRvIII cellular invasion that was markedly decreased in GBMs ex- is a result of increased invasion. A large number of molecules whose interactions and coregulations promote or inhibit GBM mi- pressing EGFRvIII, for further study. The differential expres- gration have been proposed, but it remains an ongoing major area sion of CRMP1 was confirmed in a panel of human GBM cell of research focus in neurooncology (11–13). The mechanism(s) for lines and operative specimens that express wtEGFR or mutant the increased invasive phenotype by GBM cells expressing EGFR- EGFRvIII by quantitative real-time PCR, Western blot, and im- vIII is not clear, and not entirely explained by the ligand-indepen- munohistochemical analysis. In human GBM samples, de- dent constitutive basal activation of EGFRvIII for the following creased expression of CRMP1 correlated with EGFRvIII reasons: First, the basal activation of EGFRvIII has been noted to positivity. Knockdown of CRMP1 by siRNA resulted in in- be <10% of EGF- or transforming growth factor-α–stimulated creased invasion of wtEGFR expressing human GBM cells wtEGFR found in GBMs growing in vivo (14). Second, the major (U87 and U373) to those found in isogenic GBM cells. Exoge- intracellular tyrosine autophosphorylation sites, and the major sig- nous expression of EGFRvIII in these wtEGFR-expressing GBM naling pathways they activate, are identical between EGRvIII and cells promoted their ability to invade and was accompanied ligand-stimulated wtEGFR (15). This would suggest that additional by decreased expression of CRMP1. Rescuing CRMP1 expres- mechanism(s), as reflected by differences in the proteome between sion decreased invasion of the EGFRvIII-expressing GBM cells GBMs, which do or do not express EGFRvIII, likely exists, and these by tilting the balance between Rac and Rho. Collectively, these differences lead to the difference in the invasion and malignancy results show that the loss of CRMP1 contribute to the in- potential of GBM. creased invasive phenotype of human GBMs expressing mu- Differential proteomic analysis between less invasive and highly tant EGFRvIII. [Cancer Res 2009;69(22):8545–54] invasive cancer cells have already led to identification of several proteins/genes implicated in invasion and metastasis in several Introduction human cancers, including NM23, KAI1, and KiSS-1 (16–18). The de- velopment of novel mass spectrometry (MS)–based technologies, Glioblastoma multiforme (GBM) is the most common, aggres- such as iTRAQ-labeling, yields great promise in our ability to inter- sive, and incurable central nervous system malignancy, largely rogate differences in the proteome between pathologic and normal due to its highly invasive phenotype. Episomal amplifications in tissues (19–21). In the present investigation, we used preclinical the epidermal growth factor receptor (EGFR) gene are prevalent in vitro and in vivo human GBM models that are well characterized in approximately half of GBMs, but not in lower grade gliomas for their expression profiles of wtEGFR and EGFRvIII. The differ- (1–3). Among these GBMs, approximately half have an intragenic ence in the proteome was analyzed by liquid chromatography- deletion of exons 2 to 7 of the wild-type (wt) EGFR gene, resulting tandem MS (LC-MS/MS) with iTRAQ -labeling, with our interest in an in-frame deletion of 267 amino acid residues from the extra- in proteins that are related to invasion. Our initial focus is on Col- lapsin Response Mediator Protein 1 (CRMP1), which was markedly decreased in GBM tumors expressing EGFRvIII as determined by Requests for reprints: Abhijit Guha, Hospital for Sick Children's University Health iTRAQ analysis, and has not been implicated previously in glioma Network, 4W-446 West Wing, 399 Bathurst Street, Toronto, Ontario, M5T 2S8, Canada. biology. CRMP1 was previously implicated as a negative regulator Phone: 416-603-5740; Fax: 416-603-5298; E-mail: [email protected]. ©2009 American Association for Cancer Research. of cellular invasion in lung cancer models (22, 23). Expression of doi:10.1158/0008-5472.CAN-09-1778 CRMP1 was related to tumor stage, lymph node metastasis, and www.aacrjournals.org 8545 Cancer Res 2009; 69: (22). November 15, 2009

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. Published OnlineFirst November 10, 2009; DOI: 10.1158/0008-5472.CAN-09-1778 Cancer Research patient survival. Recently, Wu and colleagues (24) showed the role the precolumn was switched out of line. Data were acquired under the in- of cyclooxygenase-2 in regulating the expression of CRMP1 via re- formation-dependent acquisition mode, with dynamic exclusion set to ex- m/z ciprocal regulation of Sp1 and CAAT/enhancer binding protein α. clude any values that had been picked for MS/MS scan in the previous Involvement of NF-κB was also reported recently (25) to negatively 30 s. This last condition was intended to minimize the number of repeated analyses of any particular peptide, thus maximizing the number of unique regulate CRMP1 gene in lung adenocarcinoma cells, thereby pro- peptides identified during the course of an LC separation. The information- moting invasion. dependent acquisition script was also set to pick peaks nearest to a thresh- The above data from lung carcinoma and the decreased expres- old setting of 12 counts in the MS scan on every fourth cycle, ensuring also sion found by our iTRAQ differential labeling expression on GBMs the identification of low-abundance peptides. expressing EGFRvIII are both suggestive of an “invasion suppres- MS data were searched using ProQUANT v1.1 against the human KBMS sor” role of CRMP1. To further characterize CRMP1 in malignant 20041109 database containing 178,239 protein sequences (Applied Biosys- glioma invasion, we found decreased CRMP1 expression at the tems). Proteins whose unique peptides contributed to an overall score of RNA and protein levels in isogenic human GBM cells that differ >1.3, which corresponds to a confidence cutoff of 95%, were considered as only in their EGFRvIII expression profile and a larger set of human positive hits. This led to identification of a total of 826 proteins. Proteins GBM operative specimens. Alteration of CRMP1 expression modu- were selected for additional, confirmatory analyses, including immuno- chemistry, if the relative ratios of the proteins in both samples expressing lated the ability of human GBM cells to invade in in vitro assays. EGFRvIII were >50% when compared with both samples expressing Mechanistically, decreased CRMP1 expression shifted the balance wtEGFR (Table 1). The ratios reported were automatically normalized us- between activation of Rho- and Rac-GTPases to promote the inva- ing an “applied bias” factor, derived from the median ratio of all proteins sive phenotype of human GBMs that express EGFRvIII. that had been quantified from all the SCX fractions that were run in each run. This applied bias was based on the assumption that the majority of the Materials and Methods proteins identified would not be differentially expressed between the samples being analyzed and is used to correct for any systematic errors intro- GBM specimens and cell lines. Flash-frozen human GBM operative duced as a result of minor variations the volumes of samples used for the samples and corresponding paraffin sections were obtained from the Uni- analysis, as well as variations in the amount of blood proteins in the initial versity of Toronto Nervous System Tumor bank, in accordance with Re- samples. search Ethics Board guidelines and consent. Human GBM s.c. explants, Immunohistochemical staining for paraffin sections. Immunohisto- verified by our neuropathology colleague (SC) before implantation into chemistry was performed on formalin-fixed, paraffin-embedded 5-μm-thick Nod-Scid mice and also between serial passages, were obtained as per in- tissue GBM sections. Sections were first deparaffinized, rehydrated, antigen stitutional consent and guidelines. retrieved in citrate buffer (pH 6), and blocked for endogenous peroxidase The established human glioma cell lines U87 and U373 (American Type activity in 0.3% H2O2 in methanol for 20 min. Sections were treated with Culture Collection) were maintained in DMEM containing 10% fetal bovine 100 μL of 10% normal human serum for 10 min to block nonspecific bind- serum (FBS) at 37°C, 5%CO2 in a humidified chamber. EGFRvIII was cloned ing of the primary antibody. Primary antibodies, anti-human CRMP1 (Ab- into the tet-inducible TET-OFF vector (pTRE, Clontech) and cotransfected cam; 1:500), diluted with TBS, were added to slides for 1 h at room with the regulatory plasmid (pTA) into human U87 and U373 astrocytoma temperature. Slides were washed twice in TBS for 5 min and incubated cells. Clones expressing the pTRE-EGFRvIII (U87vIII, U373vIII) or the empty with biotinylated IgG secondary antibody for 30 min at room temperature. pTRE vector (U87P, U373P) were grown in DMEM supplemented with 10% Detection of antibody was performed using Vectastain ABC reagent and tet-approved FBS (Clontech). 3,3′-diaminobenzidine chromogen (Vector Laboratories). Negative controls iTRAQ labeling and two-dimensional LC-MS/MS analysis. For were obtained by replacing the primary antibody with an equal concentra- iTRAQ analysis, four frozen GBM explants, with two each expressing tion of mouse IgG2b (Sigma). wtEGFR and EGFRvIII, were immersed in 0.5 mL PBS containing protease Quantification of gene expression by real-time PCR. Two hundred μ inhibitors [1 mmol/L 4-(2-aminoethyl)benzenesulfonyl fluoride, 10 mol/L nanograms of total RNA from each sample was treated with DNase I (0.4 μ μ leupeptin, 1 g/mL aprotinin, and 1 mol/L pepstatin] and mechanically units/μg RNA) according to instructions of the Message Clean kit (Gen- homogenized at 30,000 rpm using a Polytron PT 1300D handheld homog- Hunter Corp.). Fifty nanograms of DNase-I–treated total RNA was used − enizer (Brinkmann). The samples were stored in aliquots at 70°C until for cDNA synthesis in a 20-μL RT reaction with oligo (dT)12-18 (Integrated used for further processing. Two hundred micrograms of each of the four DNA Technology), and SuperScript II reverse transcriptase and RNaseOUT GBM lysates were digested and labeled with the following iTRAQ labels: enzyme (Invitrogen) deoxynucleotide triphosphates were maintained at wtEGFR, 114 and 116 labels; EGFRvIII, 115 and 117 labels. Samples were 0.5 mmol/L. CRMP1-, wtEGFR-, and EGFR-vIII–specific primers corres- processed by offline two-dimensional LC-MS/MS analysis as described pre- ponding to the PCR targets were obtained from Integrated DNA Technology viously (19, 20). After separation by strong cation exchange (SCX), each (Table 2). Unless otherwise mentioned, each reaction was done in triplicate, μ fraction was dried and resuspended in 10 L of 0.1% formic acid. SCX frac- in three independent experiments. The mean concentration of HPRT1 was tions 6 to 30 were then sequentially analyzed by LC-MS/MS. Each fraction used as the control for input RNA and the average fold difference between was analyzed in duplicate. One microliter of each of the resuspended SCX samples was calculated using the Applied Biosystem software. fractions was loaded onto the reverse phase precolumn. A binary gradient, siRNA-mediated knockdown of CRMP1. U87 and U373 glioma cells at comprising aqueous solutions of 5% acetonitrile plus 0.1% formic acid (sol- 70% confluency were transfected in OPTIMEM medium (Invitrogen) with vent A), and 95% acetonitrile plus 0.1% formic acid (solvent B), was used for the indicated siRNA duplexes using Lipofectamine 2000 (Invitrogen). After the reverse phase nanoflow separation as described below. 4 h, the transfection medium was removed. The cells were washed twice with PBS, and then maintained in complete medium for 48 to 72 h before further experimentation. The sequences were synthesized by Qiagen. Tar- Time (min) 0 10 15 125 145 150 160 162 188 get sequences were as follows: control, AAT TCTCCGAACGTGTCACGT; % Solvent B 5.0 5.0 15.0 35.0 60.0 80.0 80.0 5.0 5.0 CRMP1-siRNA #1, 5′-AAGGCGGTGGCTACTGGCAAA-3′; and CRMP1-siRNA #2, 5′-AAGGGCATGGG CCGCTTCATT-3′. Protein extraction and western blot analysis. Whole-cell protein ly- In the above timetable, the sample was first loaded onto the reverse sates from human GBM explants, cell lines, and frozen operative specimens phase precolumn at 0 min, where it was desalted by passage of solvent A were prepared in modified PLC lysis buffer supplemented with protease at a flow rate of 25 μL/min for 4 min. At the 4th minute, the precolumn was and phosphatase inhibitors (Calbiochem). Protein concentration was deter- switched inline with the analytic column until the 177th min, at which time mined using the BCA assay (Pierce Chemical Co.). Protein lysates were

Cancer Res 2009; 69: (22). November 15, 2009 8546 www.aacrjournals.org

Table 1. Differential iTRAQ-labeled proteins between two EGFRvIII and two wtEGFR human GBM explants,which differ by ∼1.5-fold

Protein name Accession EGFRvllI#1: 116:114 EGFRvllI#2: Function no. wtEGFR#1 (wt2:wt1) wtEGFR#I

Cpn10 P61604 0.27 0.83 0.27 Apoptosis SPARC-like 1 Q14515 0.19 0.63 0.42 Neuronal migration Transferrin 1SUV_E 0.43 0.73 0.47 Iron binding protein. Collapsin response mediator Q14194 0.34 0.88 0.59 Axonal guidance, invasion protein-1 CRMP1 Putative NF-κB activating protein trm|Q7Z435 0.08 0.20 0.10 Trigger signaling pathways 3′(2′),5′-bisphosphate nucleotidase 1 gb|AAH178 01.1 0.42 0.82 0.49 Adhesion between cytoskeleton and plasma membrane Glucosamine 6-sulfatase P15586 0.24 0.51 0.32 Modulation of cell surface molecule and ECM Cyclin-dependent kinase 4 inhibitor A P42771 0.29 0.93 0.29 Apoptosis/cell cycle (p16-INK4) Tetraspanin-14 Q8NG11 0.36 0.70 0.36 Metastasis suppressor Barrier-to-autointegration factor 075531 0.37 0.74 0.36 Cell cycle (BAF) Cullin homologue 1 Q13616 0.40 0.85 0.63 Ubiquitin ligases Microtubule-associated protein 1 B P46821 0.43 0.86 0.47 Plasticity related cytoskeletal protein (MAP 1 B) Class II bHLH protein PTF1A trm|Q7RTS3 0.48 0.83 0.23 Exocrine differentiation Nestin NP_006608.1 3.08 1.03 2.79 Astrocyte intermediate filament proteins Vimentin P08670 3.56 0.94 2.24 Astrocyte intermediate filament Protein Annexin I P04083 2.66 0.88 2.07 Apoptosis γ-Actin P02571 0.80 0.85 0.80 Structural protein Annexin V P08758 1.74 1.03 2.03 Apoptosis

NOTE: The ratios reported above are ProQUANT ratios of the levels of the individual proteins in the three other samples relative to that present in the sample designated wtEGFR#1. All accession numbers above without “trm,”“gb,” or “NP” prefixes are Swiss Prot accession numbers.

separated on SDS-PAGE gels (either 10% or 12.5%) and transferred onto Plasmids and transfection. Human CRMP1 was obtained from OR- polyvinylidene difluoride membrane (NEN Research Products/Du Pont) Feomes collection (26, 27) and cloned into a Gateway entry vector using a semidry transfer apparatus (Bio-Rad). Membranes were probed pDONR223 (Invitrogen). A recombination reaction was performed to trans- overnight with the following antibodies, unless otherwise stated, with fer the inserts from these entry vectors into destination vectors to generate CRMP1 (Abcam, 1:200), wtEGFR (1:500, 1 h at room temperature), Rho pcDNA(3.2)-Myc-DEST-CRMP1, which were used to transform Escherichia (Millipore, 1:350), Rac (Millipore, 1:1,000), FAK (Abcam, 1:1,000), p-Fak (Ab- coli DH10B-R cells. The empty vector plasmid used as a control was pre- cam, 1:1,000, Tyr 397), and β-actin (Sigma-Aldrich, 1:20,000), Membranes pared by removing the Gateway recombinational region between SacI and were washed the next day and incubated with appropriate horseradish ApaI fragment from pcDNA3.2-Myc-DEST-CRMP1. Transient transfections peroxidase–conjugated secondary antibodies (Bio-Rad). Protein bands were were done in U87-vIII glioma cell lines by FuGENE 6 transfection reagent visualized with Chemiluminescence Reagent Plus (PerkinElmer Las, Inc.). (Roche Diagnostics) following the protocol of the manufacturer. Cells

Table 2. List of primer sequences used in this study

SL # Gene Primer sequence TM Product size (bp)

1 CRMP1 GCAGTCCCAAAACCCTTACA 60 154 GGAGGATGCTTCTCTGCAAC 2 EGFR ATG CGA CCC TCC GGGACG 60 1153 (ForWt) GAG TAT GTG TGA AGG AGT 352 (For VIII) 3 EGFR-WT TGT CGA TGG ACT TCC AGA AC 60 62 ATT GGG AC A GCT TGG ATC A 4 EGFR-VIII GAG TCG GGC TCT GGA GGA AAA G 60 72 CCA CAG GCT CGG ACG CAC 5 HPRT1 ATGCTGAGGATTTGGAAAG 60 93 CTCCCATCTCCTTCATCACA 6 β-ACTIN GATGAGATTGGCATGGCTTT 60 100 CACCTTCACCGTTCCAGTTT

www.aacrjournals.org 8547 Cancer Res 2009; 69: (22). November 15, 2009

Figure 1. CRMP1 peptide: Tandem mass spectrum and corresponding 1TRAQ reporter ions. A, tandem mass spectrum identifying a peptide from CRMP 1. B, iTRAQ reporter ions for the CRMP1 peptide shown in A.

Cancer Res 2009; 69: (22). November 15, 2009 8548 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. Published OnlineFirst November 10, 2009; DOI: 10.1158/0008-5472.CAN-09-1778 CRMP1 in Human GBMs transfected with empty plasmid vector were used as controls. Transfected Dickinson Discovery Labware). For the CRMP1 siRNA and transient over- cells were cultured for an additional 48 h before use. expression experiments, cells were transfected and were harvested 48 h after GTPase pull-down assays. Rac-GTP and Rho-GTP were pulled down by transfection. After harvesting, cells were washed and resuspended in the use of lysates containing 2 mg protein and GST-PBD (Rac-binding do- serum-free medium. Cell concentration was measured and adjusted to main of PAK1) and GST-Rhotekin BD–conjugated (Rho-binding domain of 2×105 cells/mL. Sixty thousand cells (0.3 mL) were added to the top Rhotekin) beads (28, 29). In short, cells were lysed with lysis buffer [25 of each hydrated chamber, with 1 mL medium plus 10% FBS used as mmol HEPES (pH 7.5), 150 mmol NaCl, 1% NP40, 10% glycerol, 10 mmol chemoattractant in the bottom well plate. After 22 h of incubation, cells MgCl2, 1 mmol/L EDTA, and protease inhibitors] and then incubated for were processed according to the manufacture's protocol. The number of 1 h at 4°C with glutathione-Sepharose beads bound to 20 μg of GST-PBD or invading cells was quantified by counting them in at least six random GST-Rhotekin BD. The beads were then washed thrice in lysis buffer, resus- fields (200×). pended, and boiled in sample buffer (1×), and the supernatants were sub- Statistical analysis. The unpaired Student's t test was applied for com- jected to SDS-PAGE followed by immunoblotting with the appropriate parison between two groups; one-way ANOVA test with post hoc Tukey- antibodies, as described above. Kramer multiple comparisons was used for comparison among multiple Migration assay. Migration assays were performed using gelatin-coated groups. polycarbonate filters (pore size, 8 μm) of transwells separating the upper and lower chamber of 24-well plates (Costar). Chemotaxis medium (DMEM with 0.5% bovine serum albumin and 10 mmol/L HEPES) was added to the bottom Results chamber. Parental and CRMP1-transfected U87 and U373 cells (0.5 × 106/ well) were placed in the upper chamber. The plates were incubated at 37°C Differential proteome between wtEGFR and EGFRvIII GBM overnight. Viable cells in the lower chamber were collected and counted. explants as detected by iTRAQ. iTRAQ-labeling LC-MS/MS anal- Invasion assay. Invasive potential was measured by using an 8-μm yses led to the identification of ∼800 proteins. Most of these pro- pore, 24-well format Matrigel-coated transwell chamber assay (Becton teins did not exhibit differential expression between the two pairs

Figure 2. Validation of CRMP1 expression in human GBM explant xenograft samples and established GBM cell lines. A, Western analyses for wtEGFR and the EGFRvIII explants,demonstrating a lower mass band of ∼140 kDa for the latter due to the truncation in the extracellular domain. The blots show higher levels of CRMP-1 in wtEGFR-expressing versus the EGFRvIII-expressing GBM explants. Numbers below each Western blot represent densitometry values. Note: same xenograft specimens were used in iTRAQ analysis. B, RT-PCR analysis for wtEGFR and the EGFRvIII explants demonstrating decreased CRMP1 expressions is due to decreased RNA expression. C, immunohistochemical analysis demonstrating abundant CRMP1 expression in the wtEGFR GBM explant (i), compared with EGFRvIII GBM explant (ii). D, Western blot analysis shows higher levels of CRMP1expression in the parental U87 (i) and U373 (ii) cells than the U87 and U373 cells stably transfected with EGFRvIII. RT-PCR analyses show the difference in expression is also present at the transcriptional level.

www.aacrjournals.org 8549 Cancer Res 2009; 69: (22). November 15, 2009

Figure 3. Expression of CRMP1 in primary human GBM samples. A, expression of CRMP1 in 10 human operative GBM samples was analyzed by semiquantitative reverse transcriptase PCR. B, quantitation of CRMP1 mRNA expression in the same 10 human GBM samples by qtRT-PCR. EGFR status was also monitored by qtRT-PCR analyses with wtEGFR and EGFRvIII mutant–specific primers. CRMP1 expression was lower in GBMs that express EGFRvIII versus those that express only wtEGFR. Measurements for each sample (n = 10) was done in triplicate and repeated in three independent experiments. Columns, mean; bars, SEM. C, immunohistochemical validation of CRMP1 expression (arrows) in primary human GBM samples. Normal brain and GBM with wtEGFR express CRMP1 in most cells,whereas only a few cells in GBMs with EGFRvIII express CRMP1, which may reflect the recognized heterogenous nature of EGFRvIII expression.

of samples. Those that show expression changes in the EGFRvIII sion profile (Fig. 2D). Similar to the GBM explants, expression of samples larger than 1.5-fold relative to the wtEGFR-expressing EGFRvIII in U87 and U373 cells resulted in decreased CRMP1 both GBM samples are summarized in Table 1, along with cytoplasmic at the RNA and protein levels. actin, a housekeeping control protein that is not expected to Lastly, we examined a panel of human GBM operative speci- show differential expression. Out of this list of proteins, the CRMP1 mens (n = 10), by RT-PCR and quantitative RT PCR (Fig. 3). In (Fig. 1) showed decreased expression in both EGFRvIII-expressing the human GBM samples, 9 of 10 expressed CRMP1 to varying ex- GBMs, and was picked for further analysis and verification by tent by qRT-PCR analysis (Fig. 3A). Levels of CRMP1 expression Western analysis and reverse transcription-PCR (RT-PCR) analysis. was quantified by qRT-PCR analysis, with the same samples also We chose CRMP1 for our initial studies as this protein had been checked for the expression of wtEGFR and EGFRvIII. Levels of implicated in cellular invasion—our prime biological query as to CRMP1 correlated inversely to expression of EGFRvIII, with lower differences between GBMs, which express EGFRvIII versus those expression in those GBMs that expressed high levels of EGFRvIII, which only express wtEGFR. Figure 1 shows tandem MS spectra compared with those GBMs that express mainly wtEGFR (Fig. 3B). and iTRAQ reporter-ion windows, demonstrating differential ex- This inverse correlation was statistically significant (P <.05) as an- pression of CRMP1. As shown below, confirmatory biochemical alyzed by ANOVA. These RNA results were also reflected by immu- tests performed on the same samples corroborated the iTRAQ nohistochemical analysis (Fig. 3C). Of interest, CRMP1 expression findings of differential expression. was abundant in the normal region of the brain from a surgery for Verification of CRMP differential expression in human a GBM that expressed EGFRvIII (Fig. 3C). Negative controls (anti- GBMs. The four human GBM explants used for the iTRAQ analysis body omission or nonimmune similar antibody subclass) were uni- were used for verification of the iTRAQ results that CRMP1 was formly negative (data not shown). decreased in EGFRvIII GBMs (Fig. 2). Western blot analysis Functional significance of differential expression of CRMP1. (Fig. 2A) and RNA level as shown by RT-PCR analyses (Fig. 2B) con- To determine if CRMP1 contributes to the migration of glioma firmed decreased CRMP1 expressions in the two EGFRvIII-expres- cells, transwell migration assays were performed. CRMP1 expressing GBM explants. This decrease in CRMP1 expression was sion level in siRNA-transfected cells were determined by Western confirmed at the immunohistochemical level (Fig. 2C). blot analysis. siRNA #1 at 60 nm concentration showed significant For additional verification, we examined isogenic human U87 level of CRMP1 knockdown (∼70%) in both the cell lines and and U373 GBM cell lines that only differ in their EGFRvIII expres- were selected for further studies. Figure 4B shows that following

Cancer Res 2009; 69: (22). November 15, 2009 8550 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. Published OnlineFirst November 10, 2009; DOI: 10.1158/0008-5472.CAN-09-1778 CRMP1 in Human GBMs knockdown of CRMP1in U87 and U373 cells, migration from the to cell motility in a mechanism involving RhoA/Rac pathway upper chamber to the lower was increased ∼75% (P <0.01)and (30). Compared with parental U87s, in U87-vIII cells, Rac1-GTP le- ∼60% (P < 0.01), respectively. In fact, CRMP1 knockdown parental vels were elevated, whereas Rho-GTP was decreased in U87-vIII cells migrated at almost the same rate as U87-vIII and U373-vIII cells (Fig. 5C). CRMP1 overexpression in these U87-vIII cells de- cells. Differences in invasion was analyzed by modified Boyden creased Rac1-GTP and increased RhoA activity, compared with chamber assay and also showed statistically significant (P < 0.01) the U87-vIII empty vector transfected controls (Fig. 5C). increase in invasion of U87 and U373 cells with CRMP1 knock- We next examined the effects of CRMP1 on U87 cell morphology down, compared with parental cells (Fig. 4C). Similar to migration, and the status of focal adhesion kinase (FAK) turnover by monitor- the CRMP1 knockdown cells had a similar invasion rate to U87-vIII ing FAK activation. U87-vIII cells had statistically high levels of ac- and U373-vIII cells, respectively. Cells treated with scrambled con- tive phosphorylated FAK (P-FAKY397), compared with parental trol siRNA showed no significant difference from parental cells in U87 cells (Fig. 5D). CRMP1 overexpression in these U87-vIII cells either migration or invasion assays. resulted in decrease of P-FAK, to levels approaching parental U87 To further confirm the role of CRMP1, we rescued the expres- cells. Typical phase-contrast images of control and CRMP1 expression of CRMP1 in U87-vIII and U373-vIII cells, as both these cell sion–modulated cells illustrate marked changes in morphology line express lower amounts of CRMP1 compare to parentals (Figs. (Fig. 5E). Parental U87 cells showed small cell bodies with short pro- 2D and 5A). Overexpression of CRMP1 in U87-vIII and U373-vIII trusions, whereas U87-vIII cells also had small cell bodies but with cells resulted in a ∼35% and ∼38% reduction (P < 0.01) in invasion long extensions. In contrast, U87-vIII cells overexpressing CRMP1 compared with the empty vector controls (Fig. 5B). exhibited flat morphology and very little or no protrusions (Fig. Modulation of RhoA/Rac and FAK activation by CRMP1. It 5E). Interestingly knockdown of CRMP1 in parental U87 cells has been previously recognized that EGFR activation contributes showed elongated protrusion, similar morphology to U87-vIII cells.

Figure 4. Functional significance of CRMP1 expression. A, siRNA-mediated knockdown of CRMP1 resulted in ∼70% downregulation of CRMP1 protein expression in parental (i) U87 and (ii) U373 cells. Numbers below each Western blot represent densitometry values. B, change in migration after siRNA-mediated knockdown of CRMP1 in (i) U87 cells and (ii) U373 cells. Knockdown of CRMP1 resulted in increased migration of U87 and U373 cells,which approached values observed by U87-vIII and U373-vIII cells. Columns, mean from three independent experiments done in triplicate; bars, SEM; *, P < 0.01. C, invasion potential of the (i) parental U87,U87-vIII,and U87 with CRMP1 knockdown cells,and ( ii) parental U373,U373-vIII,and U373 with CRMP1 knockdown cells using modified Boyden chamber assay. Knockdown of CRMP1 resulted in increased invasion of U87 and U373 cells,which approached values observed by U87-vIII and U373-vIII cells. Columns, mean from three independent experiments done in triplicate; bars, SEM; *, P < 0.01.

www.aacrjournals.org 8551 Cancer Res 2009; 69: (22). November 15, 2009

Figure 5. Overexpression of CRMP1 in U87-VIII cell line. A, overexpression of CRMP1 was achieved by transfecting CRMP1 transiently with pcDNA(3.2)-Myc-DEST- CRMP1 in (i) U87-vIII and (ii) U373-vIII cell lines. B, invasion potential of the (i) U87-vIII and CRMP1 overexpressing U87-vIII cells (U87-vIII-OE-CRMP1) and (ii) U373-vIII and CRMP1 overexpressing U373-vIII cells (U373-vIII-OE-CRMP1). Overexpression of CRMP1 resulted in decreased invasion of U87-vIII-OE-CRMP1 and U373-vIII-OE-CRMP1 cells compared with U87-vIII and U373-vIII cells. Columns, mean from three independent experiments done in triplicate; bars, SEM; *, P < 0.01. C, GST-CRIB pull-down assay. Lane 1, U87 control cells have relatively decreased Rac activation and increased Rho activation; lane 2, U87 cells overexpressing EGFR-vIII show increased Rac1-GTP and decreased RhoGTP activation; lane 3, overexpression of CRMP1 in U87-vIII cells decreased Rac activity and increased Rho activity. Total Rac and Rho protein,serving as a loading control,is shown in both panels. Overexpression of CRMP1 decreases the amount of active P -FAK in U87-vIII-OE-CRMP1 cells compare to U87-vIII cells. The cells were seeded at a density of 1 × 106 per 10-cm plate. Aliquots of cell lysates were immunoblotted with anti-FAK and anti-phospho-FAKY397 antibodies,as described in Materials and Methods. Numbers below each Western blot represent densitometry valu es. D, change in morphology of U87 Cells after modulation of CRMP1 expression of (i) parental U87 cells,( ii) U87-siCRMP1-siRNA–mediated knockdown of CRMP1 in parental U87 cells,( iii) U87-vIII cells stably transfected to overexpress EGFR-vIII,and ( iv) U87-vIII cells transiently transfected to overexpress CRMP1 U87-vIII-OE-CRMP1. Magnification,×10 and ×20.

Discussion drome (38, 39). Our focus was on CRMP1 because it was implicated – To understand the consequences of molecular variations of EGFR as a suppressor of invasion in lung cancer (23 25), the rate-limiting status on tumor invasion and growth, we used two well-character- biological property of human malignant gliomas. ized GBM subtypes differing in their expression profile for EGFRvIII We found expression of both CRMP1 mRNA, and protein was inversely associated with the migratory and invasive activity of and wtEGFR for identification of differentially expressed proteins by two human GBM cell lines, with knockdown of CRMP1 increasing iTRAQ analysis. The results of the EGFRvIII versus wtEGFR iTRAQ in vitro invasive activity (Fig. 4B and C). In addition, we found low- experiments, which yielded differential expression of CRMP1, a pro- er CRMP1 mRNA and protein expression in nearly 50% of GBM tein implicated in lung cancer invasion, were further validated at the specimens examined (Fig. 3A and B). This negative regulation of mRNA and protein levels. Five members of the CRMP gene family EGFRvIII on CRMP1 is at the transcript and subsequent protein – (CRMP1 5), encoding closely related 60- to 66-kDa proteins, have level and not genomic alterations in CRMP1 chromosomal locus been cloned and are transcriptionally differentially regulated (31– (chromosome location 4:5,822,492–5,894). Future experiments will 36). The best characterized function of these proteins remains the focus on establishing if an association exists between CRMP1 ex- repulsive guidance of nerve axons, but the molecular mechanism re- pression and advanced disease, early postoperative recurrence, and mains uncharacterized (34). CRMP2 is associated with neurofibril- survival of patients with GBM. lary tangles in patients with Alzheimer's disease (37). CRMP3 and The mechanism(s) of how CRMP1 acts to suppress invasion is of CRMP5 are recognized by autoantibodies from patients with importance. Recent studies showed that members of the CRMP fam- small-cell lung cancers who develop paraneoplastic neurologic syn- ily of proteins mediate semaphorin3A-PlexinA1 signal transduction

Cancer Res 2009; 69: (22). November 15, 2009 8552 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2009 American Association for Cancer Research. Published OnlineFirst November 10, 2009; DOI: 10.1158/0008-5472.CAN-09-1778 CRMP1 in Human GBMs cascade (31), as semaphorin/collapsin families might control the ble actin structures to progress by alternating between attachment movement of cells (40). The Rho GTPase family, which regulates to and detachment from the ECM (45). the actin cytoskeleton, has been shown to be involved in processes Overall, our observations are in support of the thesis that loss of of neurite outgrowth following semaphorin signaling (41). Some di- CRMP1 in GBMs, which express EGFRvIII, is involved in their more rect connections between CRMPs and Rho protein signaling have aggressive tumor phenotype. Mechanistically, this involves in- been implicated with CRMP-2 in combination with active Rho or creased relative activation of Rac-GTPase and inhibition of Rho- Rac GTPases effect, a cyclical switch in signaling promoting dynam- GTPase. Alteration of these GTPases results in increased activation ic shape change (42, 43). In the present study, parental U87 cells of FAK, thereby modifying the morphology of glioma cells and in- have higher levels of CRMP1 with associated increased levels of ac- creasing their migratory and invasive characteristics. Our study al- tivated Rho-A compared with activated Rac1 (Fig. 5C). In compar- so is also an early demonstration of how differential MS analysis of ison, highly invasive U87-EGFRvIII–transfected cells had lower well-defined tumor sets can shed light into relevant alterations in levels of CRMP1 expression, with resultant increase in activated their proteome. In addition to CRMP1, the iTRAQ analysis between Rac-1. We believe this shift causes actin reorganization governed GBMs that do and do not express EGFRvIII also yielded several by Rac-1 to become dominant, with resultant formation of mem- other differentially upregulated proteins, including the intermedi- brane ruffles and lamellipodia, and increased invasion (Fig. 5E). ate filaments nestin and vimentin (Table 1). These structural pro- Furthermore, reintroduction of CRMP1 in U87-EGFRvIII cells teins have been implicated as positive regulators of GBM cell caused a significant decrease in Rac-1 activity, while at the same motility and metastasis. They are in support of the recognized in- time, it increased the activity of RhoA (Fig. 5C), resulting in forma- creased invasiveness of EGFRvIII-expressing GBM cells, analogous tion of focal adhesions (44). Together, these two GTPases enable the to the focus of our work on loss of CRMP1 and increased invasion dynamic process of detachment of cells from the extracellular main EGFRvIII GBM cells. In addition, overexpression of these pro- trix (ECM) and their reattachment to it, which are essential for cell teins may also play a role in epithelial-mesenchymal transition re- migration (45). Studies have shown that activation of one of these sulting from expression of EGFRvIII. Epithelial-mesenchymal proteins can abolish the actin organization governed by the other, transition is defined as switching of polarized epithelial cells to a suggestive of a morphologic antagonism between Rac-1 and RhoA migratory fibroblastic phenotype and is implicated in the progres- (46–48). sion and metastasis of various cancers. Loss of epithelial proteins The turnover of focal adhesions, regulated by activation of FAK, and/or the acquisition of mesenchymal proteins are associated is important for cellular movement. FAK activation (Fig. 5D) was with poorly differentiated histology, advanced stage, and poor out- modulated by CRMP1 and correlated with morphologic changes of come, all attributes of EGFRvIII-expressing GBMs. Verification of the U87 cells (Fig. 5E) along with its changes in invasive and mi- the MS findings in human specimens followed by functional and gratory behavior (Fig. 4). Overexpression of CRMP1 in U87vIII cells, mechanistic studies can contribute much to the understanding which express high levels of activated phospho-FAKY397, resulted of the biological differences between the relevant tumor sets and in decreased P-FAK toward levels exhibited by parental U87 cells hopefully elucidate novel biological targets. (Fig. 5D). The modulation of CRMP1 expression was accompanied by alterations in cell morphology. Knockdown of CRMP1 by siRNA Disclosure of Potential Conflicts of Interest caused the U87 cells to become longer and slender compared No potential conflicts of interest were disclosed. with the parental U87 with small cell bodies and short protrusion (Fig. 5E, i and ii), similar to the morphologic features of U87-EGFR- vIII cells with decreased endogenous CRMP1 expression (Fig. 5E, Acknowledgments iii). However, U87-EGFRvIII cells overexpressing CRMP1 became Received 5/14/09; revised 7/29/09; accepted 8/3/09; published OnlineFirst 11/10/09. flatter with large cell bodies, devoid of any protrusion (Fig. 5E, iv). Grant support: The study was financed in part by grants from National Cancer Institute Canada and Neurofibromatosis Society of Ontario (A. Guha). The significance of these morphologic changes have implications The costs of publication of this article were defrayed in part by the payment of page for cell motility (45). Once the actin is organized into stress fibers, charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. and focal adhesions are assembled, the cells flatten and become at- J. Mukherjee is thankful to American Brain Tumor Association and Ministry of tached to the ECM. Cells in motion need to assemble and disassem- Research and Innovation, Govt. of Ontario for personnel funding.

References genes in human glioblastomas reveal deletions of se- cation, enhanced expression and possible rearrange- quences encoding portions of the N- and/or C-terminal ment of EGF receptor gene in primary human brain 1. EkstrandAJ,JamesCD,CaveneeWK,SeligerB, tails. Proc Natl Acad Sci U S A 1992;89:4309–13. tumours of glial origin. Nature 1985;313:144–7. Pettersson RF, Collins VP. Genes for epidermal growth α 5. Malden LT, Novak U, Kaye AH, Burgess AW. Selective 9. Nishikawa R, Ji XD, Harmon RC, et al. A mutant epi- factor receptor, transforming growth factor , and epi- amplification of the cytoplasmic domain of the epider- dermal growth factor and their expression in human gli- dermal growth factor receptor common in human glio- mal growth factor receptor gene in glioblastoma multi- omas in vivo. Cancer Res 1991;51:2164–72. ma confers enhanced tumorigenicity. Proc Natl Acad forme. Cancer Res 1988;48:2711–4. Sci U S A 1994;91:7727–31. 2. Schlegel J, Merdes A, Stumm G, et al. Amplification of the epidermal-growth-factor-receptor gene correlates 6. Sugawa N, Ekstrand AJ, James CD, Collins VP. Identi- 10. Hurtt MR, Moossy J, Donovan-Peluso M, Locker J. with different growth behaviour in human glioblastoma. cal splicing of aberrant epidermal growth factor recep- Amplification of epidermal growth factor receptor gene Int J Cancer 1994;56:72–7. tor transcripts from amplified rearranged genes in in gliomas: histopathology and prognosis. J Neuropathol human glioblastomas. Proc Natl Acad Sci U S A 1990; Exp Neurol 1992;51:84–90. 3. Wong AJ, Bigner SH, Bigner DD, Kinzler KW, Hamilton – SR, Vogelstein B. Increased expression of the epidermal 87:8602 6. 11. Cho WC, Cheng CH. Oncoproteomics: current trends growth factor receptor gene in malignant gliomas is in- 7. Wong AJ, Ruppert JM, Bigner SH, et al. Structural al- and future perspectives. Expert Rev Proteomics 2007;4: variably associated with gene amplification. Proc Natl terations of the epidermal growth factor receptor gene 401–10. Acad Sci U S A 1987;84:6899–903. in human gliomas. Proc Natl Acad Sci U S A 1992;89: 12. Giese A, Bjerkvig R, Berens ME, Westphal M. Cost of – 4. Ekstrand AJ, Sugawa N, James CD, Collins VP. Ampli- 2965 9. migration: invasion of malignant gliomas and implica- fied and rearranged epidermal growth factor receptor 8. Libermann TA, Nusbaum HR, Razon N, et al. Amplifi- tions for treatment. J Clin Oncol 2003;21:1624–36. www.aacrjournals.org 8553 Cancer Res 2009; 69: (22). November 15, 2009

13. Nakada M, Nakada S, Demuth T, Tran NL, Hoelzinger 24. Wu CC, Lin JC, Yang SC, et al. Modulation of the ex- CJ. Structure and promoter analysis of the human unc- DB, Berens ME. Molecular targets of glioma invasion. pression of the invasion-suppressor CRMP-1 by cycloox- 33-like phosphoprotein gene. E-box required for maxi- Cell Mol Life Sci 2007;64:458–78. ygenase-2 inhibition via reciprocal regulation of Sp1 and mal expression in neuroblastoma and myoblasts. J Biol 14. Chu CT, Everiss KD, Wikstrand CJ, Batra SK, Kung C/EBPα. Mol Cancer Ther 2008;7:1365–75. Chem 2000;275:16560–8. HJ, Bigner DD. Receptor dimerization is not a factor 25. Gao M, Yeh PY, Lu YS, Chang WC, Kuo ML, Cheng 37. Gu Y, Hamajima N, Ihara Y. Neurofibrillary tangle- in the signalling activity of a transforming variant epi- AL. NF-κB p50 promotes tumor cell invasion through associated collapsin response mediator protein-2 dermal growth factor receptor (EGFRvIII). Biochem J negative regulation of invasion suppressor gene (CRMP-2) is highly phosphorylated on Thr-509, Ser-518, 1997;324:855–61. CRMP-1 in human lung adenocarcinoma cells. Biochem and Ser-522. Biochemistry 2000;39:4267–75. – 15. Huang HS, Nagane M, Klingbeil CK, et al. The en- Biophys Res Commun 2008;376:283 7. 38. Honnorat J, Byk T, Kusters I, et al. Ulip/CRMP pro- hanced tumorigenic activity of a mutant epidermal 26. Rual JF, Hirozane-Kishikawa T, Hao T, et al. Human teins are recognized by autoantibodies in paraneoplas- growth factor receptor common in human cancers is ORFeome version 1.1: a platform for reverse proteomics. tic neurological syndromes. Eur J Neurosci 1999;11: mediated by threshold levels of constitutive tyrosine Genome Res 2004;14:2128–35. 4226–32. phosphorylation and unattenuated signaling. J Biol 27. Rual JF, Venkatesan K, Hao T, et al. Towards a pro- 39. Yu Z, Kryzer TJ, Griesmann GE, Kim K, Benarroch Chem 1997;272:2927–35. teome-scale map of the human protein-protein interac- EE, Lennon VA. CRMP-5 neuronal autoantibody: marker 16. Dong JT, Lamb PW, Rinker-Schaeffer CW, et al. KAI1, tion network. Nature 2005;437:1173–8. of lung cancer and thymoma-related autoimmunity. a metastasis suppressor gene for prostate cancer on hu- 28. Benard V, Bohl BP, Bokoch GM. Characterization of Ann Neurol 2001;49:146–54. man chromosome 11p11.2. Science (New York, NY) rac and cdc42 activation in chemoattractant-stimulated 40. Kruger RP, Aurandt J, Guan KL. Semaphorins com- 1995;268:884–6. human neutrophils using a novel assay for active mand cells to move. Nat Rev 2005;6:789–800. – 17. Lee JH, Miele ME, Hicks DJ, et al. KiSS-1, a novel hu- GTPases. J Biol Chem 1999;274:13198 204. 41. ShihJY,LeeYC,YangSC,HongTM,HuangCY, man malignant melanoma metastasis-suppressor gene. 29. Fiordalisi JJ, Keller PJ, Cox AD. PRL tyrosine phos- Yang PC. Collapsin response mediator protein-1: a J Natl Cancer Inst 1996;88:1731–7. phatases regulate ρ family GTPases to promote inva- novel invasion-suppressor gene. Clin Exp Metastasis – 18. Steeg PS, Bevilacqua G, Kopper L, et al. Evidence for sion and motility. Cancer Res 2006;66:3153 61. 2003;20:69–76. a novel gene associated with low tumor metastatic po- 30. Mateus AR, Seruca R, Machado JC, et al. EGFR regu- 42. Arimura N, Inagaki N, Chihara K, et al. Phosphoryla- tential. J Natl Cancer Inst 1988;80:200–4. lates ρA-GTP dependent cell motility in E-cadherin mu- tion of collapsin response mediator protein-2 by ρ- – 19. DeSouza L, Diehl G, Rodrigues MJ, et al. Search for tant cells. Hum Mol Genet 2007;16:1639 47. kinase. Evidence for two separate signaling pathways cancer markers from endometrial tissues using differen- 31. Goshima Y, Nakamura F, Strittmatter P, Strittmatter for growth cone collapse. J Biol Chem 2000;275:23973–80. tially labeled tags iTRAQ and cICAT with multidimen- SM. Collapsin-induced growth cone collapse mediated 43. Hall C, Brown M, Jacobs T, et al. Collapsin response sional liquid chromatography and tandem mass by an intracellular protein related to UNC-33. Nature mediator protein switches ρA and Rac1 morphology in spectrometry. J Proteome Res 2005;4:377–86. 1995;376:509–14. N1E-115 neuroblastoma cells and is regulated by ρ ki- 20. DeSouza L, Diehl G, Yang EC, et al. Proteomic analysis 32. Fukada M, Watakabe I, Yuasa-Kawada J, et al. Molec- nase. J Biol Chem 2001;276:43482–6. of the proliferative and secretory phases of the human ular characterization of CRMP5, a novel member of the 44. Hall A. ρ GTPases and the control of cell behaviour. endometrium: protein identification and differential collapsin response mediator protein family. J Biol Chem Biochem Soc Trans 2005;33:891–5. – protein expression. Proteomics 2005;5:270–81. 2000;275:37957 65. 45. Raftopoulou M, Hall A. Cell migration: ρ GTPases 21. DeSouza LV, Grigull J, Ghanny S, et al. Endometrial 33. Gaetano C, Matsuo T, Thiele CJ. Identification and lead the way. DevBiol 2004;265:23 –32. carcinoma biomarker discovery and verification using characterization of a retinoic acid-regulated human 46. Moorman JP, Luu D, Wickham J, Bobak DA, Hahn CS. differentially tagged clinical samples with multidimen- homologue of the unc-33-like phosphoprotein gene A balance of signaling by ρ family small GTPases ρA, sional liquid chromatography and tandem mass spec- (hUlip) from neuroblastoma cells. J Biol Chem 1997; Rac1 and Cdc42 coordinates cytoskeletal morphology – trometry. Mol Cell Proteomics 2007;6:1170–82. 272:12195 201. but not cell survival. Oncogene 1999;18:47–57. 22. Banerjee AK, Read CA, Griffiths MH, George PJ, 34. Quinn CC, Gray GE, Hockfield S. A family of proteins 47. Rottner K, Hall A, Small JV. Interplay between Rac Rabbitts PH. Clonal divergence in lung cancer develop- implicated in axon guidance and outgrowth. J Neurobiol and ρ in the control of substrate contact dynamics. – ment is associated with allelic loss on chromosome 4. 1999;41:158 64. Curr Biol 1999;9:640–8. Genes Chromosomes Cancer 2007;46:852–60. 35. Wang LH, Strittmatter SM. Brain CRMP forms het- 48. Salhia B, Rutten F, Nakada M, et al. Inhibition of ρ- 23. Shih JY, Yang SC, Hong TM, et al. Collapsin response erotetramers similar to liver dihydropyrimidinase. J kinase affects astrocytoma morphology, motility, and mediator protein-1 and the invasion and metastasis of Neurochem 1997;69:2261–9. invasion through activation of Rac1. Cancer Res 2005; cancer cells. J Natl Cancer Inst 2001;93:1392–400. 36. Matsuo T, Stauffer JK, Walker RL, Meltzer P, Thiele 65:8792–800.

Cancer Res 2009; 69: (22). November 15, 2009 8554 www.aacrjournals.org

Loss of Collapsin Response Mediator Protein1, as Detected by iTRAQ Analysis, Promotes Invasion of Human Gliomas Expressing Mutant EGFRvIII

Joydeep Mukherjee, Leroi V. DeSouza, Johann Micallef, et al.

Cancer Res 2009;69:8545-8554. Published OnlineFirst November 10, 2009.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-09-1778

Cited articles This article cites 48 articles, 21 of which you can access for free at: http://cancerres.aacrjournals.org/content/69/22/8545.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/69/22/8545.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/69/22/8545. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.