DOCSLIB.ORG

Underexpression of HOXA11 Is Associated with Treatment Resistance and Poor Prognosis in Glioblastoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Underexpression of HOXA11 Is Associated with Treatment Resistance and Poor Prognosis in Glioblastoma pISSN 1598-2998, eISSN 2005-9256 Cancer Res Treat. 2017;49(2):387-398 https://doi.org/10.4143/crt.2016.106 Original Article Open Access Underexpression of HOXA11 Is Associated with Treatment Resistance and Poor Prognosis in Glioblastoma Young-Bem Se, MD1 Purpose Seung Hyun Kim, MD2 Homeobox (HOX) genes are essential developmental regulators that should normally be in the silenced state in an adult brain. The aberrant expression of HOX genes has been asso- Ji Young Kim, MS1 ciated with the prognosis of many cancer types, including glioblastoma (GBM). This study PhD1 Ja Eun Kim, examined the identity and role of HOX genes affecting GBM prognosis and treatment 1 Yun-Sik Dho, MD resistance. Jin Wook Kim, MD, PhD1 Yong Hwy Kim, MD1 Materials and Methods The full series of HOX genes of five pairs of initial and recurrent human GBM samples were Hyun Goo Woo, MD, PhD3 screened by microarray analysis to determine the most plausible candidate responsible for MD, PhD4 Se-Hyuk Kim, GBM prognosis. Another 20 newly diagnosed GBM samples were used for prognostic vali- 5 Shin-Hyuk Kang, MD, PhD dation. In vitro experiments were performed to confirm the role of HOX in treatment resist- 6 Hak Jae Kim, MD, PhD ance. Mediators involved in HOX gene regulation were searched using differentially Tae Min Kim, MD, PhD7 expressed gene analysis, gene set enrichment tests, and network analysis. Soon-Tae Lee, MD, PhD8 Results MD, PhD9 Seung Hong Choi, The underexpression of HOXA11 was identified as a consistent signature for a poor prog- 10 Sung-Hye Park, MD, PhD nosis among the HOX genes. The overall survival of the GBM patients indicated a signifi- 6 Il Han Kim, MD, PhD cantly favorable prognosis in patients with high HOXA11 expression (31±15.3 months) Dong Gyu Kim, MD, PhD1,2 compared to the prognoses in those with low HOXA11 expression (18±7.3 months, p=0.03). Chul-Kee Park, MD, PhD1,2 When HOXA11 was suppressed in the GBM cell lines, the anticancer effect of radiotherapy and/or temozolomide declined. In addition, five candidate mediators (TGFBR2, CRIM1, *A list author’s aliations appears at the end TXNIP, DPYSL2, and CRMP1) that may confer an oncologic effect after HOXA11 suppression of the paper. were identified. Conclusion + C +o r+re s+p o +n d +e n +c e :+ D +o n +g G +y u+ K +im +, M + D +, P +h D + + + + + + + + + + + + + + + + + + + + + + + The treatment resistance induced by the underexpression of HOXA11 can contribute to a + D +e p+a r +tm +en +t o +f N +e u +ro s+u r+g e +ry ,+ S e+o u +l N +a t+io n+a l+ + poor prognosis in GBM. Further investigation will be needed to confirm the value of HOXA11 University Hospital, Seoul National University + + + + + + + + + + + + + + + + + + + + as a potential target for overcoming the treatment resistance by developing chemo- or radio- College of Medicine, 101 Daehak-ro, + + + + + + + + + + + + + + + + + + + + sensitizers. + J o+n g+n o+- g +u , +S e +ou +l 0 3+0 8 +0 , +K o +re a+ + + + + + + + + T +e l :+ 8 2 +-2 -+2 0 +72 -+2 8 +74 + + + + + + + + + + + + + F +a x +: 8 2+- 2 +-7 4+1 - 8+9 5+4 + + + + + + + + + + + + + E +-m +a i l+: g +k n +if e +@ s +n u +.a c +.k r+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + Key words + C +o -+co r+r e +sp o+n d+e n+c e +: C +h u +l- K +e e+ P a+r k +, M +D +, P +h D + + Homeobox genes, HOXA11, Glioblastoma, Treatment resistance + D +e p +a r +tm +en +t o +f N +e u +ro s+u r+g e +ry ,+ S e+o u +l N +a t+io n+a l+ + + U +n i+v e +rs i t+y H+ o +sp +it a +l, S +e o +u l +N a +ti o +n a +l U +n i +ve r+s i t+y + + + + + + + + + + + + + + + + + + + + + + C +o l+le g +e o+f M + e +d i c+in e+, 1 +0 1 + D a+e h+a k +-r o+, + + + + + + J o+n g+n o+- g +u , +S e +ou l+ 0 3+0 8 +0 , +K o +re a+ + + + + + + + + T +e l :+ 8 2 +-2 -+2 0 +72 -+0 3 +47 + + + + + + + + + + + + + F +a x +: 8 2+- 2 +-7 4+1 - 8+5 9+4 + + + + + + + + + + + + + E +-m +a i l+: n +sc k+p a+r k +@ s+n u +.a c+.k r+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + R +e c +ei v +e d + M +a r+c h + 9 , +2 0 +16 + + + + + + + + + + + A +c c +ep +te d + J +un +e 3 +0, 2+0 1+6 + + + + + + + + + + + P +u b +li s +h e d+ O +n l+in e+ J+u l y+ 1 9+, 2+0 1 +6 + + + + + + + + + + + + + + + + + + + + + + + + + + + + * +Y o +u n +g - B+e m+ S+e a+n d+ S +eu n+g +H y+u n+ K +im + + + + + + + + + + + + + + + + + + + + + + + + + + c +on +tr i b+u t+e d + e q +u a+ll y + t o + t h +is w+ o +rk +. + + + + + + │ http://www.e-crt.org │ Copyright ⓒ 2017 by the Korean Cancer Association 387 This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Cancer Res Treat. 2017;49(2):387-398 Introduction Materials and Methods Homeobox (HOX) genes are essential developmental reg- 1. Patient samples and cell lines ulators that control a wide range of processes, including apoptosis, differentiation, motility, and angiogenesis [1]. In Fresh frozen tumor tissue samples of five GBM patients, humans, there are four HOX clusters (A, B, C, and D), and in whom of pairs of initial and recurrent samples were avail- 39 HOX genes have been identified [1]. The HOX genes are able for screening, and another 20 newly diagnosed GBM normally active during embryogenesis, but most are not patients for validation were used in this study. All patients expressed or are expressed at very low levels in an adult were managed using a standard GBM treatment protocol of brain [2]. On the other hand, several studies have indicated concurrent radiotherapy and TMZ treatment, followed by aberrant expression of the HOX genes in brain tumors as well adjuvant TMZ as a primary treatment. The tumor tissues in as other cancers from various organs [3-6]. Moreover, there were obtained during surgery, snap-frozen in liquid nitro- is growing clinical evidence of a prognostic effect of HOX gen, and stored at 80°C prior to use. The study was gene expression in several cancers [7-10]. approved by an institutional review committee. Aberrantly expressed HOX genes in cancer cells have mul- The human glioma U251, U373, and LN18 cell lines were ticapacity functions, including metastasis, tumor growth, purchased from the American Type Culture Collection anti-apoptosis, and differentiation suppression [1]. The over- (Manassas, VA), and cultured in Dulbecco's modified Eagle's expression of multiple HOX genes have been observed in medium containing 10% fetal bovine serum and 5% antibi- glioblastoma (GBM) cell lines and primary astrocytoma [4]. otics (streptomycin) in a humidified atmosphere containing In addition, some studies have shown that the HOX genes 5% CO2 and 95% air at 37°C. are important in the treatment resistance of GBM [11-13]. On the other hand, the precise mechanism showing the role of 2. Reverse transcription polymerase chain reaction HOX genes and their functional relevance in glioma cells is unclear. GBMs, similar to other cancers, harbor a cell sub- The cell lines were lysed with TRIzol (Life Technologies, population with a stem cell-like capacity that is associated Carlsbad, CA), and RNA isolation was performed using an with the development of a tumor progeny and treatment RNeasy Mini Kit (#74104, Qiagen, Valencia, CA). The total resistance [9,14,15]. Given the roles of HOX genes in devel- RNA was treated with DNase and then quantified by spec- opment and organogenesis, it has been postulated that a por- trophotometry. In addition, cDNA was synthesized from tion of the relative expression of HOX genes is integral to 1 µg of the total RNA using a reverse transcription kit stem cell activity, specifically self-renewal, tissue specificity, (#205311, Qiagen) according to the manufacturer’s protocol. and quiescence [1]. Among the HOX genes, the HOXA clus- The primers used were designed using an online primer- ter is important in human embryonic stem cell differentiation BLAST tool (http://www.ncbi.nlm.nih.gov/tools/primer- [16]. Collectively, these results suggest that HOX genes are blast/). The primer sequences for HOXA11 were 5'-GATTT- plausible candidates as biomarkers for assessing the progno- CTCCAGCCTCCCTTC-3' (forward) and 5'-AGAAATTG- sis of GBM and a credible target for overcoming the treat- GACGAGACTGCG-3' (reverse). Using these primers, a ment resistance in GBM. reverse transcription polymerase chain reaction (RT-PCR) HOX genes were previously reported to be the genes of was performed for 35 cycles. Each cycle was comprised of interest related to GBM recurrence and treatment resistance 95°C for 30 seconds, 62°C for 30 seconds, and 72°C for 45 sec- [17]. Moreover, a mechanism through which the HOXA10 onds with each primer set. The RT-PCR products were gene affects temozolomide (TMZ) resistance in GBM cell resolved by 2% agarose gel electrophoresis. lines was reported [12]. HOXA10 induces the transcription of early growth response 1, which results in phosphatase and 3. Western blot tensin homolong (PTEN) and Rad51 paralogs.
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Integrative Analysis Identifies Candidate Tumor Microenvironment and Intracellular Signaling Pathways That Define Tumor Heterogeneity in NF1
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904771; this version posted January 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Integrative analysis identifies candidate tumor microenvironment and intracellular signaling pathways that define tumor heterogeneity in NF1 Jineta Banerjee1#, Robert J Allaway1#, Jaclyn N Taroni2, Aaron Baker1,4, Xiaochun Zhang5, Chang In Moon5, Jaishri O Blakeley6, Justin Guinney1, Angela Hirbe5, Casey S Greene2,3, Sara JC Gosline1* 1 Computational Oncology, Sage Bionetworks, Seattle, WA, 98121 2 Childhood Cancer Data LaB, Alex's Lemonade Stand Foundation, Philadelphia, PA, 19102 3 Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, 19104 4 University of Wisconsin-Madison, Madison, WI, 53715 5 Division of Oncology, Washington University Medical School, St. Louis, MO 63110 6 Neurology, Neurosurgery and Oncology, Johns Hopkins University, Baltimore, MD 21287 # Equal ContriBution * Correspondence: [email protected] Abstract: NeurofiBromatosis type 1 is a monogenic syndrome that gives rise to numerous symptoms including cognitive impairment, skeletal aBnormalities, and growth of Benign nerve sheath tumors. Nearly all NF1 patients develop cutaneous neurofiBromas (cNFs), which occur on the skin surface, while 40-60% of patients develop plexiform neurofibromas (pNFs) which are deeply embedded in the peripheral nerves. Patients with pNFs have a ~10% lifetime chance of these tumors Becoming malignant peripheral nerve sheath tumors (MPNSTs). These tumors have a severe prognosis and few treatment options other than surgery.
    [Show full text]
  • Supp Material.Pdf
    Supplemental Materials Genome-wide Mapping of SMAD Target genes Reveals the Role of BMP Signaling in Embryonic Stem Cell Fate Determination Teng Fei1#, Kai Xia2#, Zhongwei Li1^, Bing Zhou2^, Shanshan Zhu2^, Hua Chen1, Jianping Zhang1, Zhang Chen2, Huasheng Xiao3, Jing-Dong J. Han2*, Ye-Guang Chen1* Supplemental Methods Supplemental References Supplemental Figures S1–S17 Supplemental Tables S1-S9 1 Supplemental Methods Cell culture and antibodies Murine R1 ES cells were first plated on mitomycin-treated murine embryonic fibroblasts (MEFs) and grown under typical ES cell conditions (DMEM supplemented with 15% fetal calf serum, leukemia inhibitory factor (LIF), non-essential amino acids, GlutaMax-I (Invitrogen Gibco), beta-mercaptoethanol and penicillin/streptomycin. For ChIP assay, cells were cultured on gelatinized tissue culture plates for two passages to eliminate MEFs. KO-DMEM and Knockout serum replacement (Invitrogen Gibco) were used to substitute DMEM and fetal calf serum for feeder free culture. For ChIP experiments and immunoblotting, we used affinity-purified SMAD1/5 and SMAD4 antibodies that can recognize a specific band corresponding to endogenous SMAD proteins in R1 ES cells (Fig. S1A). Rabbit anti-SMAD1/5 antibody was generated with recombinant human SMAD1-linker (aa145-267)-His, and rabbit anti-SMAD4 antibody with recombinant human SMAD4-linker (aa144-316)-His. Anti-SMAD1/5 antibody can recognize both overexpressed SMAD1 and SMAD5 proteins but minimally SMAD8 (Fig. S1B). Phospho-SMAD1/5 antibody was purchased from Chemicon International (AB3848) and anti-nestin antibody from Chemicon International (MAB353). H3K27me3 antibody (ab6002) and histone H3 antibody (ab1791) were from Abcam. GFP (SC-8334), GST (SC-138), His (SC-803) antibody were from Santa Cruz Biotech.
    [Show full text]
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
    [Show full text]
  • Selective Induction of Apoptosis in HIV-Infected Macrophages
    Selective Induction of Apoptosis in HIV-infected Macrophages by Simon Xin Min Dong A thesis submitted in partial fulfillment of the requirements for the Doctorate in Philosophy degree in Microbiology and Immunology Department of Biochemistry, Microbiology, and Immunology Faculty of Medicine University of Ottawa © Simon Xin Min Dong, Ottawa, Canada, 2020 Abstract The eradication of Human Immunodeficiency Virus (HIV) from infected patients is one of the major medical problems of our time, primarily due to HIV reservoir formation. Macrophages play important roles in HIV reservoir formation: once infected, they shield HIV against host anti-viral immune responses and anti-retroviral therapies, help viral spread and establish infection in anatomically protected sites. Thus, it is imperative to selectively induce the apoptosis of HIV-infected macrophages for a complete cure of this disease. I hypothesize that HIV infection dysregulates the expression of some specific genes, which is essential to the survival of infected host cells, and these genes can be targeted to selectively induce the apoptosis of HIV-infected macrophages. My objective is to identify the genes that can be targeted to eradicate HIV reservoir in macrophages, and to briefly elucidate the mechanism of cell death induced by targeting one of the identified genes. A four-step strategy was proposed to reach the goal. First, 90k shRNA lentivirus pool technology and microarray analysis were employed in a genome-wide screen of genes and 28 promising genes were found. Second, siRNA silencing was applied to validate these genes with 2 different HIV-1 viruses; as a result, 4 genes, Cox7a2, Znf484, Cdk2, and Cstf2t, were identified to be novel gene targets.
    [Show full text]
  • Variable Clinical Expression in Patients with a Germline MEN1 Disease Gene Mutation: Clues to a Genotype–Phenotype Correlation
    CLINICS 2012;67(S1):49-56 DOI:10.6061/clinics/2012(Sup01)10 REVIEW Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype–phenotype correlation Cornelis J. Lips,I Koen M. Dreijerink,I Jo W. Ho¨ ppenerII I University Medical Center Utrecht, Department of Internal Medicine & Endocrinology, Utrecht, The Netherlands. II University Medical Center Utrecht, Department of Metabolic & Endocrine Diseases, Utrecht, The Netherlands. Multiple endocrine neoplasia type 1 is an inherited endocrine tumor syndrome, predominantly characterized by tumors of the parathyroid glands, gastroenteropancreatic tumors, pituitary adenomas, adrenal adenomas, and neuroendocrine tumors of the thymus, lungs or stomach. Multiple endocrine neoplasia type 1 is caused by germline mutations of the multiple endocrine neoplasia type 1 tumor suppressor gene. The initial germline mutation, loss of the wild-type allele, and modifying genetic and possibly epigenetic and environmental events eventually result in multiple endocrine neoplasia type 1 tumors. Our understanding of the function of the multiple endocrine neoplasia type 1 gene product, menin, has increased significantly over the years. However, to date, no clear genotype– phenotype correlation has been established. In this review we discuss reports on exceptional clinical presentations of multiple endocrine neoplasia type 1, which may provide more insight into the pathogenesis of this disorder and offer clues for a possible genotype–phenotype correlation. KEYWORDS: Multiple Endocrine Neoplasia type 1; MEN1; Menin; Genotype–Phenotype Correlation; Clinical Expression. Lips CJ, Dreijerink KM, Ho¨ ppener JW. Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype– phenotype correlation. Clinics. 2012;67(S1):49-56.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Multi-Targeted Mechanisms Underlying the Endothelial Protective Effects of the Diabetic-Safe Sweetener Erythritol
    Multi-Targeted Mechanisms Underlying the Endothelial Protective Effects of the Diabetic-Safe Sweetener Erythritol Danie¨lle M. P. H. J. Boesten1*., Alvin Berger2.¤, Peter de Cock3, Hua Dong4, Bruce D. Hammock4, Gertjan J. M. den Hartog1, Aalt Bast1 1 Department of Toxicology, Maastricht University, Maastricht, The Netherlands, 2 Global Food Research, Cargill, Wayzata, Minnesota, United States of America, 3 Cargill RandD Center Europe, Vilvoorde, Belgium, 4 Department of Entomology and UCD Comprehensive Cancer Center, University of California Davis, Davis, California, United States of America Abstract Diabetes is characterized by hyperglycemia and development of vascular pathology. Endothelial cell dysfunction is a starting point for pathogenesis of vascular complications in diabetes. We previously showed the polyol erythritol to be a hydroxyl radical scavenger preventing endothelial cell dysfunction onset in diabetic rats. To unravel mechanisms, other than scavenging of radicals, by which erythritol mediates this protective effect, we evaluated effects of erythritol in endothelial cells exposed to normal (7 mM) and high glucose (30 mM) or diabetic stressors (e.g. SIN-1) using targeted and transcriptomic approaches. This study demonstrates that erythritol (i.e. under non-diabetic conditions) has minimal effects on endothelial cells. However, under hyperglycemic conditions erythritol protected endothelial cells against cell death induced by diabetic stressors (i.e. high glucose and peroxynitrite). Also a number of harmful effects caused by high glucose, e.g. increased nitric oxide release, are reversed. Additionally, total transcriptome analysis indicated that biological processes which are differentially regulated due to high glucose are corrected by erythritol. We conclude that erythritol protects endothelial cells during high glucose conditions via effects on multiple targets.
    [Show full text]
  • An Evolutionary Conserved Region (ECR) in the Human Dopamine Receptor D4 Gene Supports Reporter Gene Expression in Primary Cultu
    Paredes et al. BMC Neuroscience 2011, 12:46 http://www.biomedcentral.com/1471-2202/12/46 RESEARCHARTICLE Open Access An evolutionary conserved region (ECR) in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex Ursula M Paredes1,2, Vivien J Bubb1, Kate Haddley1, Gabriele A Macho1,3 and John P Quinn1* Abstract Background: Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs), in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results: We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1) supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion: Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a) a strong enhancer that functions in neurons and b) a transcription factor that may modulate the function of that enhancer.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Transient Activation of Meox1 Is an Early Component of the Gene
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Access to Research and Communications Annals 1 Transient activation of Meox1 is an early component of the gene 2 regulatory network downstream of Hoxa2. 3 4 Pavel Kirilenko1, Guiyuan He1, Baljinder Mankoo2, Moises Mallo3, Richard Jones4, 5 5 and Nicoletta Bobola1,* 6 7 (1) School of Dentistry, Faculty of Medical and Human Sciences, University of 8 Manchester, Manchester, UK. 9 (2) Randall Division of Cell and Molecular Biophysics, King's College London, UK. 10 (3) Instituto Gulbenkian de Ciência, Oeiras, Portugal. 11 (4) Genetic Medicine, Manchester Academic Health Science Centre, Central 12 Manchester University Hospitals NHS Foundation Trust, Manchester, UK. 13 (5) Present address: Department of Biology, University of York, York, UK. 14 15 Running title: Hoxa2 activates Meox1 expression. 16 Keywords: Meox1, Hoxa2, homeodomain, development, mouse 17 *Words Count: Material and Methods: 344; Introduction, Results and Discussion: 18 3679 19 19 * Author for correspondence at: AV Hill Building The University of Manchester Manchester M13 9PT United Kingdom Phone: (+44) 161 3060642 E-mail: [email protected] 1 Abstract 2 Hox genes encode transcription factors that regulate morphogenesis in all animals 3 with bilateral symmetry. Although Hox genes have been extensively studied, their 4 molecular function is not clear in vertebrates, and only a limited number of genes 5 regulated by Hox transcription factors have been identified. Hoxa2 is required for 6 correct development of the second branchial arch, its major domain of expression. 7 We now show that Meox1 is genetically downstream from Hoxa2 and is a direct 8 target.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]