DOCSLIB.ORG

The Heparan and Heparin Metabolism Pathway Is Involved in Regulation of Fatty Acid Composition

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Heparan and Heparin Metabolism Pathway Is Involved in Regulation of Fatty Acid Composition Int. J. Biol. Sci. 2011, 7 659 Ivyspring International Publisher International Journal of Biological Sciences 2011; 7(5):659-663 Letter The Heparan and Heparin Metabolism Pathway is Involved in Regulation of Fatty Acid Composition Zhihua Jiang1,, Jennifer J. Michal1, Xiao-Lin Wu2, Zengxiang Pan1 and Michael D. MacNeil3 1. Department of Animal Sciences, Washington State University, Pullman, WA 99164-6351, USA; 2. Department of Dairy Science, University of Wisconsin-Madison, Madison, WI 53706-1284, USA; 3. USDA-ARS, Fort Keogh Livestock and Range Research Laboratory, Miles City, MT 59301, USA Corresponding author: Dr. Zhihua Jiang, Phone: 509-335-8761; Fax: 509-335-4246; Email: [email protected] © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2011.03.04; Accepted: 2011.05.16; Published: 2011.05.21 Abstract Six genes involved in the heparan sulfate and heparin metabolism pathway, DSEL (dermatan sulfate epimerase-like), EXTL1 (exostoses (multiple)-like 1), HS6ST1 (heparan sulfate 6-O-sulfotransferase 1), HS6ST3 (heparan sulfate 6-O-sulfotransferase 3), NDST3 (N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3), and SULT1A1 (sul- fotransferase family, cytosolic, 1A, phenol-preferring, member 1), were investigated for their associations with muscle lipid composition using cattle as a model organism. Nineteen single nucleotide polymorphisms (SNPs)/multiple nucleotide length poly- morphisms (MNLPs) were identified in five of these six genes. Six of these mutations were then genotyped on 246 Wagyu x Limousin F2 animals, which were measured for 5 carcass, 6 eating quality and 8 fatty acid composition traits. Association analysis revealed that DSEL, EXTL1 and HS6ST1 significantly affected two stearoyl-CoA desaturase activ- ity indices, the amount of conjugated linoleic acid (CLA), and the relative amount of saturated fatty acids (SFA) and monounsaturated fatty acids (MUFA) in skeletal muscle (P<0.05). In particular, HS6ST1 joined our previously reported SCD1 and UQCRC1 genes to form a three gene network for one of the stearoyl-CoA desaturase activity indices. These results provide evidence that genes involved in heparan sulfate and heparin me- tabolism are also involved in regulation of lipid metabolism in bovine muscle. Whether the SNPs affected heparan sulfate proteoglycan structure is unknown and warrants fur- ther investigation. Key words: Heparan sulfate and heparin metabolism pathway, muscle fatty acid composition, as- sociations, genetic networks. Research has shown that the enzymes and pro- lism [1]. Both heparan sulfate and heparin are mem- teins encoded by DSEL (dermatan sulfate epi- bers of the glycosaminoglycan family of carbohy- merase-like), EXTL1 (exostoses (multiple)-like 1), drates that are very closely related in structure. As HS6ST1 (heparan sulfate 6-O-sulfotransferase 1), reviewed by Kolset and Salmivirta [2], cell surface HS6ST3 (heparan sulfate 6-O-sulfotransferase 3), heparan sulfate proteoglycans play biological roles in NDST3 (N-deacetylase/N-sulfotransferase (heparan several aspects of lipoprotein metabolism. For exam- glucosaminyl) 3), and SULT1A1 (sulfotransferase ple, the binding of lipoproteins to heparan sulfate family, cytosolic, 1A, phenol-preferring, member 1), presents an important process for the cellular uptake are involved in heparan sulfate and heparin metabo- and turnover of lipoproteins. Heparan sulfate also http://www.biolsci.org Int. J. Biol. Sci. 2011, 7 660 serves as a primary interaction site for lipoprotein Table 1. Primers designed for mutation detection in six lipase and hepatic lipase on cell surfaces and trans- bovine genes ports lipoprotein lipase from extravascular cells to the Region Primer sequences (5’-3’) Size Tm luminal surface of the endothelia. Furthermore, Wilsie DSEL and colleagues [3] found that heparan sulfate proteo- Promoter F-GGAAGCAAGACGCTCTTCATTTGT 551 bp 60°C glycans facilitate fatty acid transport across the plas- ma membrane of adipocytes, thus contributing to in- R-AAAGAGGAGCCCAGATGCAAAGAT tracellular lipid accumulation in the cell. On the other 3’UTR (I) F-CAGCACAGTTTTTGGTGATTTGGT 553 bp 60°C hand, heparin has been reported to decrease the deg- R-TTTTCTGCCAACATGAAGGGAAAT radation rate of lipoprotein lipase in adipocytes [4] 3’UTR (II) F-TTCCAAACCTTAGCCGGGTATCTT 572 bp 60°C and promote adipocyte differentiation [5]. In the pre- R-AGCTGAAATCATGGGACTGCATTT sent study, we tested the hypothesis that genes in- EXTL1 volved in heparan sulfate and heparin metabolism are Exon 1 F- CTCACAGACAGGAGCCAATCAGAG 584 bp 60°C also involved in regulation of lipid metabolism in R- CCTGACCTTAGCCTTGAGGGAGAG bovine muscle. Cattle were used as a model organism in the 3’UTR (I) F- CGTAAGAAGTATCGCAGCCTGGAG 571 bp 60°C present study. The bovine DSEL, EXTL1, HS6ST1, R- CCAGGCACGTAGCTGATGTCTATC HS6ST3, NDST3 and SULT1A1 genes were annotated 3’UTR (II) F- GCCTAATGAACTCCACGCCTACAC 589 bp 60°C using a protocol described previously [6]. In brief, a R- GCTACCACTCAGCCCACCTAGAAA cDNA sequence for each of these genes was retrieved HS6ST1 from the GenBank database and then extended to a 3’UTR F- AGTCCCTAGACTGAGGGGAGCTGT 588 bp 60°C full length cDNA sequence using electronic rapid R- AGCGTTTGCAATGGACTGAACAT amplification of cDNA ends (e-RACE) [7]. Next, the HS6ST3 full-length cDNA sequence was used to search for 3’UTR (I) F- GCTTGGATGTTCTGCTGAAACTGA 571 bp 60°C genomic DNA contigs against the 7.15X bovine ge- nome sequence database (see the Bovine Genome R- AAGAGGCCTGCTCCAAATAGGAAA Resources at NCBI). A total of 15 primer pairs were 3’UTR (II) F- AAGGAGCTGAAGGCAAAATGAGTG 537 bp 60°C designed to amplify various targets located in 6 genes R- TCTGGACAATAACGGGTGGTTTCT (Table 1). Approximately 50 ng of genomic DNA from 3’UTR F- TCTCCCTTCCTGATGATTTGTTCC 550 bp 60°C (III) each of six Wagyu x Limousin F1 bulls were amplified in a final volume of 10 μl that contained 12.5 ng of R- GGAGAGGACAAGTGTGTTGCTTCA NDST3 each primer, 150 μM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 20 mM Tris-HCl and 0.25 U of AmpliTaq Gold Exon 2 F- CATTCTCCATTGCTTCACATGACC 520 bp 60°C polymerase (Applied Biosystems, Branchburg, NJ). R- ATGGCAGACAACTCATCCCAGTTT PCR conditions were as follows: 95ºC for 10 minutes, Exon 14 F- CTTGTATCTCCTCCTCCCACCTCA 538 bp 60°C 35 cycles of 94ºC for 30 sec, 60ºC for 30 sec, and 72ºC R- CAGGCAAACAGCAGCCTAAAAGTC for 30 sec, and an extension step at 72ºC for 10 min. SULT1A1 PCR amplicons were sequenced on a capillary se- Promoter F- AGGCAAGAATACTGGAGTGGGTTG 601 bp 60°C quencer by High-Throughput Sequencing Solutions (Seattle, WA). A total of 19 mutations were identified R- AGATGCCAAGAGTTCAGGTGGAAG in five of these six genes, including 2 single nucleotide Exon 8 F- AGAGGACCACAGTCAAGGAACAGG 576 bp 60°C polymorphisms (SNP) in DSEL, 1 multiple nucleotide R- ATATGCCTCCAGAGGACCACTCAC length polymorphism (MNLP) in EXTL1, 8 SNPs in 3’UTR F- CTGTTGGGAGCAAAGAACAAACCT 507 bp 60°C HS6ST1, 3 SNPs and 1 MNLP in HS6ST3 and 4 SNPs R- GACTGCGTTCACACATCTCCACTT in NDST3, respectively (Figure S1). Based on the ini- tial linkage disequilibrium of these mutations ob- served among six Wagyu x Limousin F bulls and 1 As described previously [8-9], 19 phenotypes their compatibility in forming multiplexes for geno- were measured on these F animals, including 5 car- typing with the Sequenom iPLEX assay design, only 2 cass, 6 eating quality and 8 fatty acid composition six mutations (see Figure S1) were genotyped on 246 traits. Associations between genotypes and pheno- F animals by the Genomics Center at the University 2 types were evaluated using linear models described of Minnesota. previously by Daniels et al. [6]. Systematic factors in the linear models included the effects of harvest year http://www.biolsci.org Int. J. Biol. Sci. 2011, 7 661 (i=1,2,3), sex (j=1,2), sire (k=1,2,3,4,5,6), and age in cantly affected MUFA in an additive QTM. The p days at harvest (as a covariate). The effects of markers values of genetic modes were obtained from Monte were estimated either individually in the model or Carlo simulation with 10,000 replicates. For example, jointly in a multiple regression. In single-marker over-dominance genetic mode was evaluated as Hα: { analyses, ANOVA was conducted by testing the ˆQq max ˆ qq , ˆ QQ or ˆQq min ˆ qq , ˆ QQ } vs. model with the presence of marker effects 3 H0: {Otherwise}, where ˆ X was the estimated effect ( y* x b e ) vs. the model assuming null i ij j i of genotype X. Note that, when two or more markers j1 (genes) significantly affected a trait, the effects esti- marker effects ( y *=µ+e ), where y * is the phenotypic i i i mated by single marker analyses were theoretically value of the i-th individual which has been adjusted biased. So, the three markers with their QTMs on dif- for the effects of harvest years, sexes, sires, and age in ferent phenotypes were then merged with other days at harvest using a full model. Equivalently, this markers previously reported by Jiang et al. [9] and yields the null hypothesis H : µ = µ = µ = µ vs. the 0 1 2 3 combined into a multiple regression analysis for each alternative H : {Otherwise), where µ = µ+b is the α i i trait in attempt to identify their roles in the genetic mean of the i-th genotypes. The resulting p values regulation of fatty acid composition. The AIC-based were adjusted using the Bonferroni correction [10]. model selection suggested that the addition of Briefly, let the significance level for the whole family HS6ST1 with SCD1 and UQCRC1 formed a three-gene of tests be (at most) α, then the Bonferroni correction network for R3 (Figure 1B), because it had a smaller evaluate each of the individual association tests at a AIC value (which was 1499.11) than the model fea- significance level of α/n, where n = 6 is the number of turing a two-gene (UQCRC1 and SCD1) network independent tests (i.e., association tests per trait under (which was 1521.87).
Load more

Recommended publications
  • Polymorphic Human Sulfotransferase 2A1 Mediates the Formation of 25-Hydroxyvitamin
    Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2018/01/17/dmd.117.078428.DC1 1521-009X/46/4/367–379$35.00 https://doi.org/10.1124/dmd.117.078428 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:367–379, April 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Polymorphic Human Sulfotransferase 2A1 Mediates the Formation of 25-Hydroxyvitamin D3-3-O-Sulfate, a Major Circulating Vitamin D Metabolite in Humans s Timothy Wong, Zhican Wang, Brian D. Chapron, Mizuki Suzuki, Katrina G. Claw, Chunying Gao, Robert S. Foti, Bhagwat Prasad, Alenka Chapron, Justina Calamia, Amarjit Chaudhry, Erin G. Schuetz, Ronald L. Horst, Qingcheng Mao, Ian H. de Boer, Timothy A. Thornton, and Kenneth E. Thummel Departments of Pharmaceutics (T.W., Z.W., B.D.C., M.S., K.G.C., C.G., B.P., Al.C., J.C., Q.M., K.E.T.), Medicine and Kidney Research Institute (I.H.d.B.), and Biostatistics (T.A.T.), University of Washington, Seattle, Washington; Department of Pharmacokinetics and Drug Metabolism, Amgen Inc., South San Francisco, California (Z.W.); Department of Pharmacokinetics and Drug Metabolism, Amgen Inc., Cambridge, Massachusetts (R.S.F.); St. Jude Children’s Research Hospital, Memphis, Tennessee Downloaded from (Am.C., E.G.S.); and Heartland Assays LLC, Ames, Iowa (R.L.H.) Received September 1, 2017; accepted January 10, 2018 ABSTRACT dmd.aspetjournals.org Metabolism of 25-hydroxyvitamin D3 (25OHD3) plays a central role in with the rates of dehydroepiandrosterone sulfonation. Further analysis regulating the biologic effects of vitamin D in the body.
    [Show full text]
  • Transcriptomic Characterization of Fibrolamellar Hepatocellular
    Transcriptomic characterization of fibrolamellar PNAS PLUS hepatocellular carcinoma Elana P. Simona, Catherine A. Freijeb, Benjamin A. Farbera,c, Gadi Lalazara, David G. Darcya,c, Joshua N. Honeymana,c, Rachel Chiaroni-Clarkea, Brian D. Dilld, Henrik Molinad, Umesh K. Bhanote, Michael P. La Quagliac, Brad R. Rosenbergb,f, and Sanford M. Simona,1 aLaboratory of Cellular Biophysics, The Rockefeller University, New York, NY 10065; bPresidential Fellows Laboratory, The Rockefeller University, New York, NY 10065; cDivision of Pediatric Surgery, Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; dProteomics Resource Center, The Rockefeller University, New York, NY 10065; ePathology Core Facility, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; and fJohn C. Whitehead Presidential Fellows Program, The Rockefeller University, New York, NY 10065 Edited by Susan S. Taylor, University of California, San Diego, La Jolla, CA, and approved September 22, 2015 (received for review December 29, 2014) Fibrolamellar hepatocellular carcinoma (FLHCC) tumors all carry a exon of DNAJB1 and all but the first exon of PRKACA. This deletion of ∼400 kb in chromosome 19, resulting in a fusion of the produced a chimeric RNA transcript and a translated chimeric genes for the heat shock protein, DNAJ (Hsp40) homolog, subfam- protein that retains the full catalytic activity of wild-type PKA. ily B, member 1, DNAJB1, and the catalytic subunit of protein ki- This chimeric protein was found in 15 of 15 FLHCC patients nase A, PRKACA. The resulting chimeric transcript produces a (21) in the absence of any other recurrent mutations in the DNA fusion protein that retains kinase activity.
    [Show full text]
  • Chronic Exposure to Bisphenol a Reduces SULT1A1 Activity in the Human Placental Cell Line Bewo
    Chronic exposure to bisphenol A reduces SULT1A1 activity in the human placental cell line BeWo Pallabi Mitra Department of Pharmaceutical Chemistry University of Kansas October 27, 2006 Outline ▪ Placental structure and models ▪ Placental permeation ▪ Placental metabolism and regulation (induction/inhibition) ▪ Sulfotransferase enzymes in trophoblast ▪ Bisphenol A ▪ Effects of bisphenol A on SULT1A1 ▪ Conclusions The placental barrier The placental barrier Mother’s blood •Trophoblasts and syncytiotrophoblasts line the maternal villar surface in a monolayer- like fashion. •Constitute the rate limiting barrier to exchange between the maternal and fetal blood. Syme et al., Drug transfer and metabolism by the human placenta, Clin Pharmacokinet 2004: 43(8): 487-514 Models of the human placenta ▪ In vivo models – Anatomical and functional differences between mammalian placentas makes it difficult to extrapolate animal studies to humans. ▪ In vitro models ▪ Perfused placental cotyledon ▪ Isolated trophoblast plasma membrane ▪ Isolated transporters and receptors ▪ Villous explants ▪ Primary cultures (cytotrophoblasts) ▪ Immortalized cell lines (BeWo, JAr, JEG, HRP-1, etc.) Refn. Bode et al. In Vitro models for studying trophoblast transcellular transport, Methods Mol Med. 2006;122:225-39 Sastry, B.V., Adv Drug Deliv Rev., 1999 Jun 14. 38(1): p. 17-39. Placental permeation - Factors Efflux Carrier-mediated Passive diffusion transport Metabolism A A X A A Maternal side A X-OH A Fetal side Placental metabolism ▪ Though enzyme expression is much more restricted than hepatic metabolism, those that are functional metabolize xenobiotics as well as hormones. ▪ Placental enzymes CYP1A1/1A2, CYP19 (aromatase), GST, UGT, SULT ▪ Maternal blood-borne chemicals (drugs/polychlorinated biphenyls/pesticides) alter expression and activity. • Altered steroid metabolism.
    [Show full text]
  • Regulation of Xenobiotic and Bile Acid Metabolism by the Anti-Aging Intervention Calorie Restriction in Mice
    REGULATION OF XENOBIOTIC AND BILE ACID METABOLISM BY THE ANTI-AGING INTERVENTION CALORIE RESTRICTION IN MICE By Zidong Fu Submitted to the Graduate Degree Program in Pharmacology, Toxicology, and Therapeutics and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. Dissertation Committee ________________________________ Chairperson: Curtis Klaassen, Ph.D. ________________________________ Udayan Apte, Ph.D. ________________________________ Wen-Xing Ding, Ph.D. ________________________________ Thomas Pazdernik, Ph.D. ________________________________ Hao Zhu, Ph.D. Date Defended: 04-11-2013 The Dissertation Committee for Zidong Fu certifies that this is the approved version of the following dissertation: REGULATION OF XENOBIOTIC AND BILE ACID METABOLISM BY THE ANTI-AGING INTERVENTION CALORIE RESTRICTION IN MICE ________________________________ Chairperson: Curtis Klaassen, Ph.D. Date approved: 04-11-2013 ii ABSTRACT Calorie restriction (CR), defined as reduced calorie intake without causing malnutrition, is the best-known intervention to increase life span and slow aging-related diseases in various species. However, current knowledge on the exact mechanisms of aging and how CR exerts its anti-aging effects is still inadequate. The detoxification theory of aging proposes that the up-regulation of xenobiotic processing genes (XPGs) involved in phase-I and phase-II xenobiotic metabolism as well as transport, which renders a wide spectrum of detoxification, is a longevity mechanism. Interestingly, bile acids (BAs), the metabolites of cholesterol, have recently been connected with longevity. Thus, this dissertation aimed to determine the regulation of xenobiotic and BA metabolism by the well-known anti-aging intervention CR. First, the mRNA expression of XPGs in liver during aging was investigated.
    [Show full text]
  • Identification of Human Sulfotransferases Involved in Lorcaserin N-Sulfamate Formation
    1521-009X/44/4/570–575$25.00 http://dx.doi.org/10.1124/dmd.115.067397 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 44:570–575, April 2016 Copyright ª 2016 by The American Society for Pharmacology and Experimental Therapeutics Identification of Human Sulfotransferases Involved in Lorcaserin N-Sulfamate Formation Abu J. M. Sadeque, Safet Palamar,1 Khawja A. Usmani, Chuan Chen, Matthew A. Cerny,2 and Weichao G. Chen3 Department of Drug Metabolism and Pharmacokinetics, Arena Pharmaceuticals, Inc., San Diego, California Received September 30, 2015; accepted January 7, 2016 ABSTRACT Lorcaserin [(R)-8-chloro-1-methyl-2,3,4,5-tetrahydro-1H-3-benza- and among the SULT isoforms SULT1A1 was the most efficient. The zepine] hydrochloride hemihydrate, a selective serotonin 5-hydroxy- order of intrinsic clearance for lorcaserin N-sulfamate is SULT1A1 > Downloaded from tryptamine (5-HT) 5-HT2C receptor agonist, is approved by the U.S. SULT2A1 > SULT1A2 > SULT1E1. Inhibitory effects of lorcaserin Food and Drug Administration for chronic weight management. N-sulfamate on major human cytochrome P450 (P450) enzymes Lorcaserin is primarily cleared by metabolism, which involves were not observed or minimal. Lorcaserin N-sulfamate binds to multiple enzyme systems with various metabolic pathways in human plasma protein with high affinity (i.e., >99%). Thus, despite humans. The major circulating metabolite is lorcaserin N-sulfamate. being the major circulating metabolite, the level of free lorcaserin Both human liver and renal cytosols catalyze the formation of N-sulfamate would be minimal at a lorcaserin therapeutic dose and lorcaserin N-sulfamate, where the liver cytosol showed a higher unlikely be sufficient to cause drug-drug interactions.
    [Show full text]
  • The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z
    REVIEW pubs.acs.org/CR The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z. Long* and Benjamin F. Cravatt* The Skaggs Institute for Chemical Biology and Department of Chemical Physiology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, United States CONTENTS 2.4. Other Phospholipases 6034 1. Introduction 6023 2.4.1. LIPG (Endothelial Lipase) 6034 2. Small-Molecule Hydrolases 6023 2.4.2. PLA1A (Phosphatidylserine-Specific 2.1. Intracellular Neutral Lipases 6023 PLA1) 6035 2.1.1. LIPE (Hormone-Sensitive Lipase) 6024 2.4.3. LIPH and LIPI (Phosphatidic Acid-Specific 2.1.2. PNPLA2 (Adipose Triglyceride Lipase) 6024 PLA1R and β) 6035 2.1.3. MGLL (Monoacylglycerol Lipase) 6025 2.4.4. PLB1 (Phospholipase B) 6035 2.1.4. DAGLA and DAGLB (Diacylglycerol Lipase 2.4.5. DDHD1 and DDHD2 (DDHD Domain R and β) 6026 Containing 1 and 2) 6035 2.1.5. CES3 (Carboxylesterase 3) 6026 2.4.6. ABHD4 (Alpha/Beta Hydrolase Domain 2.1.6. AADACL1 (Arylacetamide Deacetylase-like 1) 6026 Containing 4) 6036 2.1.7. ABHD6 (Alpha/Beta Hydrolase Domain 2.5. Small-Molecule Amidases 6036 Containing 6) 6027 2.5.1. FAAH and FAAH2 (Fatty Acid Amide 2.1.8. ABHD12 (Alpha/Beta Hydrolase Domain Hydrolase and FAAH2) 6036 Containing 12) 6027 2.5.2. AFMID (Arylformamidase) 6037 2.2. Extracellular Neutral Lipases 6027 2.6. Acyl-CoA Hydrolases 6037 2.2.1. PNLIP (Pancreatic Lipase) 6028 2.6.1. FASN (Fatty Acid Synthase) 6037 2.2.2. PNLIPRP1 and PNLIPR2 (Pancreatic 2.6.2.
    [Show full text]
  • Genetic Variants of Lipoprotein Lipase and Regulatory Factors Associated with Alzheimer’S Disease Risk
    International Journal of Molecular Sciences Review Genetic Variants of Lipoprotein Lipase and Regulatory Factors Associated with Alzheimer’s Disease Risk Kimberley D. Bruce 1,*, Maoping Tang 1, Philip Reigan 2 and Robert H. Eckel 1 1 Division of Endocrinology, Metabolism, and Diabetes, Department of Medicine, University of Colorado Anschutz Medical Campus, Aurora, CO 80045, USA; [email protected] (M.T.); [email protected] (R.H.E.) 2 Department of Pharmaceutical Sciences, Skaggs School of Pharmacy and Pharmaceutical Sciences, University of Colorado Anschutz Medical Campus, Aurora, CO 80045, USA; [email protected] * Correspondence: [email protected] Received: 14 October 2020; Accepted: 4 November 2020; Published: 6 November 2020 Abstract: Lipoprotein lipase (LPL) is a key enzyme in lipid and lipoprotein metabolism. The canonical role of LPL involves the hydrolysis of triglyceride-rich lipoproteins for the provision of FFAs to metabolic tissues. However, LPL may also contribute to lipoprotein uptake by acting as a molecular bridge between lipoproteins and cell surface receptors. Recent studies have shown that LPL is abundantly expressed in the brain and predominantly expressed in the macrophages and microglia of the human and murine brain. Moreover, recent findings suggest that LPL plays a direct role in microglial function, metabolism, and phagocytosis of extracellular factors such as amyloid- beta (Aβ). Although the precise function of LPL in the brain remains to be determined, several studies have implicated LPL variants in Alzheimer’s disease (AD) risk. For example, while mutations shown to have a deleterious effect on LPL function and expression (e.g., N291S, HindIII, and PvuII) have been associated with increased AD risk, a mutation associated with increased bridging function (S447X) may be protective against AD.
    [Show full text]
  • Molecular Genetic Markers Associated with Boar Taint – Could Molecular Genetics Contribute to Its Reduction?
    RESEARCH IN PIG BREEDING, 13, 2019 (1) REVIEW: MOLECULAR GENETIC MARKERS ASSOCIATED WITH BOAR TAINT – COULD MOLECULAR GENETICS CONTRIBUTE TO ITS REDUCTION? Falková L. and Vrtková I. Laboratory of Agrogenomics, Department of Animal Morphology, Physiology and Genetics, Mendel University in Brno, Czech Republic Abstract Boar taint is an unpleasant meat odour or taste occurring in uncastrated male pigs usually. Naturally occurring compounds – androstenone, skatole and indole – and their accumulation in the adipose tissue of entire boars cause the perceptible boar taint. Individual levels or combination of these compounds lead to perception of boar taint observed during culinary process and pork consumption. The ban on surgical castration based on EU legislation makes it necessary to find a solution that enables our producers to adapt to these new conditions and ensure their competitiveness. Alternative options include the use of molecular genetic markers that affect the levels of androstenone and skatole in pig adipose tissue by Marker Assisted Selection (MAS). The aim of this review is to provide overview in recent facts in the field of molecular genetics and possibility in boar taint reduction solution. Key Words: Boar taint, genomic markers, selection Boar taint degree while in the skatole level besides genetic Boar taint is an unpleasant odour or taste of and age factor the nutrition and environmental meat from entire male pigs. The occurrence in factors play key role (Zamartskaia and Squires, adult pig males is connected with the hormone 2009). Skatole occurs in both male and female changes during maturation (Duijvesteijn et al., pigs but in male ones three times more (Wesoly 2010).
    [Show full text]
  • Lipoprotein Lipase: a General Review Moacir Couto De Andrade Júnior1,2*
    Review Article iMedPub Journals Insights in Enzyme Research 2018 www.imedpub.com Vol.2 No.1:3 ISSN 2573-4466 DOI: 10.21767/2573-4466.100013 Lipoprotein Lipase: A General Review Moacir Couto de Andrade Júnior1,2* 1Post-Graduation Department, Nilton Lins University, Manaus, Amazonas, Brazil 2Department of Food Technology, Instituto Nacional de Pesquisas da Amazônia (INPA), Manaus, Amazonas, Brazil *Corresponding author: MC Andrade Jr, Post-Graduation Department, Nilton Lins University, Manaus, Amazonas, Brazil, Tel: +55 (92) 3633-8028; E-mail: [email protected] Rec date: March 07, 2018; Acc date: April 10, 2018; Pub date: April 17, 2018 Copyright: © 2018 Andrade Jr MC. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Citation: Andrade Jr MC (2018) Lipoprotein Lipase: A General Review. Insights Enzyme Res Vol.2 No.1:3 Abstract Lipoprotein Lipase: Historical Hallmarks, Enzymatic Activity, Characterization, and Carbohydrates (e.g., glucose) and lipids (e.g., free fatty acids or FFAs) are the most important sources of energy Present Relevance in Human for most organisms, including humans. Lipoprotein lipase (LPL) is an extracellular enzyme (EC 3.1.1.34) that is Pathophysiology and Therapeutics essential in lipoprotein metabolism. LPL is a glycoprotein that is synthesized and secreted in several tissues (e.g., Macheboeuf, in 1929, first described chemical procedures adipose tissue, skeletal muscle, cardiac muscle, and for the isolation of a plasma protein fraction that was very rich macrophages). At the luminal surface of the vascular in lipids but readily soluble in water, such as a lipoprotein [1].
    [Show full text]
  • Overactive Endocannabinoid Signaling Impairs Apolipoprotein E-Mediated Clearance of Triglyceride-Rich Lipoproteins
    Overactive endocannabinoid signaling impairs apolipoprotein E-mediated clearance of triglyceride-rich lipoproteins Maxwell A. Ruby*, Daniel K. Nomura†, Carolyn S. S. Hudak†, Lara M. Mangravite*, Sally Chiu*, John E. Casida†‡, and Ronald M. Krauss*‡ *Children’s Hospital Oakland Research Institute, Oakland, CA 94609; and †Environmental Chemistry and Toxicology Laboratory, Department of Environmental Science, Policy and Management, University of California, Berkeley, CA 94720-3112 Contributed by John E. Casida, University of California, Berkeley, CA, July 25, 2008 (sent for review June 9, 2008) The endocannabinoid (EC) system regulates food intake and en- The EC system consists of the cannabinoid receptors, the ergy metabolism. Cannabinoid receptor type 1 (CB1) antagonists endocannabinoids (ECs), and the enzymes responsible for their show promise in the treatment of obesity and its metabolic synthesis and breakdown (14, 15). CB1 is a G protein-coupled consequences. Although the reduction in adiposity resulting from membrane receptor that transmits its response via Gi/o protein- therapy with CB1 antagonists may not account fully for the mediated reduction in adenylate cyclase activity (14). The ECs concomitant improvements in dyslipidemia, direct effects of over- anandamide and 2-arachidonoylglycerol (2-AG) are produced active EC signaling on plasma lipoprotein metabolism have not locally by N-acyl phosphatidylethanolamine phospholipase D been documented. The present study used a chemical approach to and by diacylglycerol lipase, respectively (14, 15). Signaling is evaluate the direct effects of increased EC signaling in mice by terminated primarily by enzymatic breakdown of anandamide by inducing acute elevations of endogenously produced cannabinoids fatty acid amide hydrolase (FAAH) and of 2-AG by monoacyl- through pharmacological inhibition of their enzymatic hydrolysis glycerol lipase (MAGL) (14–18).
    [Show full text]
  • Estrogen-Metabolizing Gene Polymorphisms in the Assessment of Female Hormone-Dependent Cancer Risk
    The Pharmacogenomics Journal (2006) 6, 189–193 & 2006 Nature Publishing Group All rights reserved 1470-269X/06 $30.00 www.nature.com/tpj ORIGINAL ARTICLE Estrogen-metabolizing gene polymorphisms in the assessment of female hormone-dependent cancer risk ON Mikhailova1, LF Gulyaeva1, Allelic variants of cytochrome P450: CYP1A1, CYP1A2, CYP19 (Aromatase) 1 2 and II-phase enzyme Sulfotransferase (SULT1A1) genes are associated with a AV Prudnikov , AV Gerasimov high risk of hormone-dependent cancers. We estimated a frequency of these 2 and SE Krasilnikov allelic variants in the female Caucasian population of the Novosibirsk region of Russia and their association with the elevated risk of ovarian and 1Institute of Molecular Biology and Biophysics, Novosibirsk, Russia and 2Regional Clinical endometrial cancer. A DNA bank of gynecologic oncology patients, patients Oncological Hospital, Novosibirsk, Russia with benign gynecologic diseases and healthy women was created, and the following single nucleotide polymorphisms (SNPs) were examined: CYP1A1 Correspondence: M1 polymorphism, that is, T264-C transition in the 30-noncoding region; Dr ON Mikhailova, Department of Molecular CYP1A2*1F polymorphism, that is, C734-A transversion in CYP1A2 gene; Mechanisms of Carcinogenesis, Institute of - Molecular Biology and Biophysics, Siberian C T transition (Arg264Cys) in exon 7 of CYP19; SULT1A1*2 polymorphism, Branch of the Russian Academy of Medical that is, G638-A transition (Arg213His) in SULT1A1 gene. A positive Sciences, Timakov Str. 2, Novosibirsk, correlation of C allele of CYP1A2*1F and G allele of SULT1A1*2 with 630117, Russia. hormone-dependent cancers in women was found. Thus, these genes are E-mail: [email protected] appropriate candidates for studying the contribution of genetic factors to endocrine disorder and environmentally determined diseases susceptibility.
    [Show full text]
  • Insights Into Steroid Sulfation and Desulfation Pathways
    61 2 Journal of Molecular P A Foster and J W Mueller Steroid sulfation 61:2 T271–T283 Endocrinology THEMATIC REVIEW SULFATION PATHWAYS Insights into steroid sulfation and desulfation pathways Paul A Foster1,2 and Jonathan Wolf Mueller1,2 1Institute of Metabolism and Systems Research (IMSR), University of Birmingham, Birmingham, UK 2Centre for Endocrinology, Diabetes and Metabolism (CEDAM), Birmingham Health Partners, Birmingham, UK Correspondence should be addressed to J W Mueller: [email protected] or to P A Foster: [email protected] This paper is part of a thematic section on Sulfation Pathways. The guest editors for this section were Jonathan Wolf Mueller and Paul Foster. They were not involved in the peer review of this paper on which they are listed as authors and it was handled by another member of the journal’s Editorial board. Abstract Sulfation and desulfation pathways represent highly dynamic ways of shuttling, Key Words repressing and re-activating steroid hormones, thus controlling their immense biological f adrenal hormones potency at the very heart of endocrinology. This theme currently experiences growing f androgens research interest from various sides, including, but not limited to, novel insights about f DHEA phospho-adenosine-5′-phosphosulfate synthase and sulfotransferase function and f hormone action regulation, novel analytics for steroid conjugate detection and quantification. Within f steroid homones this review, we will also define how sulfation pathways are ripe for drug development strategies, which have translational potential to treat a number of conditions, including Journal of Molecular chronic inflammatory diseases and steroid-dependent cancers.
    [Show full text]