Diversity and Management of Russian-Thistle (Salsola Tragus L.) in the Dryland Cropping Systems of the Inland Pacific Northwest

Home , Bromus, Kali (plant), Kali tragus, Salsoloideae, Tragus (plant)

DIVERSITY AND MANAGEMENT OF RUSSIAN-THISTLE (SALSOLA TRAGUS L.) IN THE DRYLAND CROPPING SYSTEMS OF THE INLAND PACIFIC NORTHWEST

JOHN FORREST SPRING

A dissertation submitted in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

WASHINGTON STATE UNIVERSITY Department of Crop and Soil Science

MAY 2017

JOHN FORREST SPRING find it satisfactory and recommend that it be accepted.

______Drew J. Lyon, Ph.D., Chair

______Ian C. Burke, Ph.D.

______Eric H. Roalson, Ph.D.

______Frank L. Young, Ph.D.

ACKNOWLEDGEMENTS Thank you to all that contributed to the conduct of this work, and to the education of a would-be scientist: my advisor, Drew Lyon, and committee members, program technicians, professors, and fellow graduate students.

iii

DIVERSITY AND MANAGEMENT OF RUSSIAN-THISTLE (SALSOLA TRAGUS L.) IN THE DRYLAND CROPPING SYSTEMS OF THE INLAND PACIFIC NORTHWEST

Abstract

by John Forrest Spring, Ph.D. Washington State University May 2017

Chair: Drew J. Lyon

Russian-thistle (Salsola tragus L.) is one of the most troublesome weed species in the low- and intermediate-precipitation dryland wheat-fallow cropping zones of the inland Pacific

Northwest (PNW). High levels of morphological diversity typify the species on global, continental and regional scales. Previous research in California found this variability to

encompass a largely cryptic complex of five distinct species in populations of Salsola in that

state. Russian-thistle also exhibits high levels of morphological diversity in the inland PNW,

suggesting that similar levels of genetic differentiation and population structure may be present

in the region. A double-digest RAD-seq approach was used to characterize the genetic diversity

and population structure of Russian-thistle in a sample of 94 individual plants collected across

the wheat-fallow production region of eastern Washington and northeastern Oregon. Only one

species (Salsola tragus sensu lato) was found. Multi-dimensional scaling, kernel-PCA-and- optimization population clustering, and Moran’s eigenvector mapping approaches all indicate the presence of a single, unstructured population across the region. High levels of standing genetic diversity were indicated in this population by expected multilocus heterozygosity of 0.35.

Separate trials related to field weed management led to the first reported case of glyphosate resistance in Russian-thistle from Washington state. Dose response experiments conducted in greenhouse and field settings indicated 2.5 to 8-fold resistance to glyphosate in this accession. Variability in the magnitude of expressed glyphosate resistance appeared closely correlated with temperature conditions after application, with higher temperatures resulting in higher levels of expressed resistance. Resistance to glyphosate poses a substantial threat to successful weed control in chemical fallow in the PNW, which relies heavily on glyphosate.

Field experiments were conducted to evaluate several pre-emergence herbicides for addition to glyphosate-only chemical fallow management programs in the wheat-fallow region. Initial results indicate that this approach has potential to improve efficacy of control and reduce selection pressure for glyphosate resistance in chemical fallow, but further experimentation is needed before robust field management recommendations can be developed.

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS...... iii

ABSTRACT...... iv

TABLE OF CONTENTS...... vi

LIST OF TABLES...... ix

LIST OF FIGURES...... x

CHAPTER 1: Review of the Literature

Dryland Cropping Zones of the Inland Pacific Northwest...... 1

Russian-thistle

Description...... 3

History in North America...... 5

Biology and Ecology...... 5

Impacts...... 8

Control and Management...... 11

Herbicide Resistance...... 14

Genetic Diversity...... 15

Research Objectives...... 19

Literature Cited...... 20

Tables and Figures...... 25

CHAPTER 2: Russian-thistle Population Structure in the Dryland Cropping Region of the Inland Pacific Northwest

Introduction...... 26

Materials and Methods

Plant Material...... 30

Species Identification...... 31

Library Preparation and Sequencing...... 33

Genotyping and SNP Calling...... 34

Population Structure and Genetic Diversity...... 35

Results and Discussion...... 36

Literature Cited...... 44

Tables and Figures...... 49

CHAPTER 3: Glyphosate Resistant Russian-thistle in Washington State

Introduction...... 54

Materials and Methods

Plant Material...... 55

Greenhouse Dose-response Assay...... 56

Field Dose-response Assays...... 57

Data Analysis...... 59

Results and Discussion...... 60

Literature Cited...... 64

Tables and Figures...... 66

vii

CHAPTER 4: Tank Mixes of Glyphosate and Soil Residual Herbicides for Extended Control of Russian-thistle in Chemical Fallow

Introduction...... 70

Materials and Methods...... 72

Results and Discussion...... 74

Literature Cited...... 79

Tables and Figures...... 81

viii

LIST OF TABLES

Table 2.1. Selected summary metrics for SNP datasets...... 49

Table 3.1 Parameter estimates ± standard errors for fitted dose-response lines for greenhouse

experiments...... 65

Table 3.2 Parameter estimates ± standard errors for fitted dose-response lines for field experiments...... 66

Table 3.3. Selected weather summary metrics for Lind and Pullman trial sites during the trial period...... 67

Table 4.1. Herbicide treatments and mean emergence data...... 80

Table 4.2. Mean monthly precipitation for the three trial sites...... 81

LIST OF FIGURES Figure 1.1. Morphologically divergent Russian-thistle phenotypes in the PNW...... 25

Figure 2.1. Approximate locations of sampling points...... 49

Figure 2.2. Multidimensional scaling plots...... 50

Figure 2.3. Per locus estimates of observed versus expected heterozygosity...... 51

Figure 2.4. Divergent and intermediate individual phenotypes observed in common garden cultivation of collection...... 52

Figure 3.1. Photos of field dose-response trials at 4 weeks after treatment...... 68

CHAPTER 1: Review of the Literature

Dryland Cropping Zones of the Inland Pacific Northwest

The dryland cropping region of the Inland Pacific Northwest is located in eastern

Washington, northeastern Oregon, and a small part of western north Idaho (Schillinger et al.

2006). Precipitation in the area follows a pronounced gradient moving eastward from the

Cascade mountains, with average annual precipitation in the driest western parts of the area of

around 225 mm year-1, increasing to over 600 mm year-1 at the wettest eastern edge. These

differences in precipitation have resulted in the development of 3 distinct cropping systems that

divide the region into low-, intermediate-, and high-precipitation zones (Williams and Wuest

2011). The high-precipitation areas receive adequate moisture for annual cropping (over 450 mm

of precipitation annually). While Russian-thistle is intermittently present in this zone it is not of

agronomic importance, and the high precipitation cropping zone is not considered in this work.

Across the low-precipitation (less than 300 mm average annual precipitation) and intermediate-

precipitation (300 to 450 mm average annual precipitation) zones, however, Russian-thistle is

one of the most widely distributed and problematic weed species in crop production (Schillinger

et al. 1999, Young and Thorne 2004, Young 1986). In these zones, precipitation is inadequate to

produce a crop every year. The deep silt loam soils of the region can store a substantial amount

of annual precipitation – up to 30% - into the next year (Schillinger and Young 2004), allowing

production of crop(s) alternating with year-long moisture-storing fallow.

The low-precipitation zone covers approximately 1.6 million ha of cropland (Schillinger et al. 2006), and is dominated by the tillage-intensive winter wheat-fallow system that has been in place since conversion from native sage-steppe vegetation in the 1880s (Young and

Schillinger 2012). The majority of tillage occurs during the fallow period, and has several

1 purposes. The most important is to ensure sufficient seedbed moisture during the late summer window for seeding winter wheat in the region (Thorne et al. 2007). Under typical hot, dry summer conditions, soil evaporation and capillary action will result in drying of undisturbed soil to depths well below the 12 to 15 cm maximum feasible depth for seeding wheat with the deep furrow drills used in the region (Hammel et al. 1981). A single pass made early in the fallow cycle at approximately 13 cm depth with a full width primary tillage implement (typically a double disc) breaks the capillary connection between the soil surface and lower layers, preventing evaporation of soil moisture from lower levels of the profile and “setting” the moisture line at a depth appropriate for seeding (Schillinger and Papendick 1997). After this primary tillage, secondary operations are common and often quite intensive. Serving primarily for weed control, between two and five rodweedings are typically performed over the course of the fallow summer (Schillinger et al. 2006). Intensive tillage has a range of well documented negative effects in the region, including dramatically increased wind erosion and soil quality losses, and public health and safety concerns (Rasmussen and Parton 1994, Schillinger and

Young 2000, Thorne et al. 2003, Williams and Wuest 2011, Young and Schillinger 2012).

Despite substantial challenges, a meaningful minority of growers have successfully transitioned to no-till production, and feel that it offers them substantial advantages over the traditional tillage-based alternative (author’s personal observation). Although adoption has not yet been widespread, several relatively recent alternative crops appear to offer good potential for diversification of the current wheat-fallow rotation. Winter canola may be a feasible alternative to winter wheat in the region (Young et al. 2014), although difficulty with satisfactory stand establishment continues to present a major challenge to adoption and production. The recent development of well adapted varieties of winter pea (McGee et al. 2013) offers another broadleaf

alternative to winter wheat that currently seems very promising, and has attracted a great deal of

interest from producers (Howard Nelson, personal communication). While these alternative

crops and production methods are currently limited in extent, there is hope that they represent a

real potential for positive changes to the traditional system.

Covering nearly 1 million ha of cropland (Schillinger et al. 2006), the intermediate- precipitation zone is somewhat more variable than the low-precipitation zone. Most of the area is very similar to the low-precipitation zone but with slightly higher precipitation and crop yields.

A distinctly different system is present along the far eastern edge, where average annual precipitation above approximately 400 mm provides sufficient moisture to support a more intensive winter wheat – spring wheat – summer fallow rotation (Schillinger et al. 2006). Spring barley is commonly substituted for spring wheat depending on market considerations, and spring canola, spring mustard, and occasional spring legumes (dry peas and chickpeas) are also grown by some producers. Winter wheat forms the basis of the system with the highest and most stable economic returns (Juergens et al. 2004), and risk-averse growers frequently maintain a winter

wheat-fallow system even in areas where more intensive rotations are otherwise feasible. Soil

conservation and quality concerns are similar across zones.

Russian-thistle, Description

Current taxonomic authority recognizes Salsola tragus L. (Chenopodiaceae) as the

correct name for Russian-thistle (Mosyakin 1996), although it has also been suggested that the

legitimate classification may be Kali tragus (L.) Scop. (Chenopodiaceae) (Akhani et al. 2007,

Akhani et al. 2014, but see also Mosyaksin et al. 2014). Common synonyms include S. iberica,

S. kali, and S. pestifer (Beckie and Francis 2009). The following description is closely based on

those of Beckie and Francis (2009), Crompton and Bassett (1985), Hitchcock and Cronquist

(1973), Mosyakin (1996), and Mosyakin (2003).

Russian-thistle is an herbaceous annual from an extensive taproot system. Stems are

multiple to numerous, spreading, arcuate, and often distinctly striped with vertical red to

purple lines. Plants are 5-100 cm in height, generally growing into a bushy, roughly

globose shape, becoming stiff and spiny at maturity. After senescence, plants often break

off at the base of the stem and become tumbleweeds, aided in dispersal by their shape

and stiff springy branches. Alternate leaves are reduced, narrow (< 1mm) and linear

with broad bases, narrowing abruptly to spines at ends, typically 2-5cm in length.

Cotyledons are long, narrow, and grass-like in appearance. Young leaves are relatively

larger and fleshier, becoming smaller, spinier and non-fleshy as plant matures. Solitary,

apetalous, sessile flowers are borne in hollowed leaf axils, subtended by 2 reflexed

bracts. Bracts are approx. 6mm long, slightly enlarged at the base and narrowing

abruptly at the tip to form a hard, sharp spine. Stamens 5, typically yellow (occ. red),

pistil solitary with 2 styles. Sepals are 5, papery, ridged, 4-8mm across and variable in

color from green to whitish to pink/reddish, often wrapping around seed. Reproduction is

exclusively by seed, which are roughly cone-shaped with flattened or cupped top,

generally 2mm across, with persistent sepals giving a winged appearance. Seeds lack

endosperm with coiled, fully differentiated embryo visible or nearly so through the

papery seed coat.

History in North America

Russian-thistle is thought to be native to the mountainous regions of southwest Asia, but is now widely distributed across Eurasia between 25° and 60° N latitudes (Smith 2005). The first known introduction to North America was near Scotland, South Dakota in 1873 or 1874, probably as a contaminant of flax seed imported by Russian immigrants (Crompton and Bassett

1985). By 1895, several Canadian provinces and 16 western states were infested (Young and

Evans 1972), with rapid spread often attributed to dispersion by wind and rail traffic. By 1910

Russian-thistle was widely distributed across the arid and semi-arid regions of the American west (Beckie and Francis 2009), and now occupies nearly all of its potential range in North

America (Mosyakin 1996). This encompasses an estimated 41 million ha in the US alone (Young

1991).

Biology and Ecology

Habitat-

Russian-thistle is a primary colonizer and early successional species on ruderal sites in arid and semi-arid regions (Beckie and Francis 2009). Common site types include drought- stressed or overgrazed range and pasture, railroad right of ways and roadsides, fencerows and irrigation ditches, cropland, and other highly disturbed sites.

Although it is highly drought, heat, and salt tolerant, and extremely competitive in early succession, Russian-thistle seldom invades undisturbed habitats and decreases relatively quickly as succession proceeds on most sites (Crompton and Bassett 1985). In cropland, it is particularly problematic in small grain systems (Young 1988).

Physiology -

Russian-thistle is a C4 plant with Salsoloid Kranz anatomy (Voznesenskaya et al. 2013) and very high water use efficiency (Fowler et al. 1992), contributing to its drought tolerance and competitive ability under moisture limited conditions. In the silt loam soils typical of dryland crop fields in the inland PNW, Russian-thistle is capable of extracting soil water to levels as low as 2% by volume (Schillinger 2007). In comparison, spring wheat typically could not effectively extract soil moisture below levels of 4% by volume under the same conditions (Schillinger

2007), giving Russian-thistle a substantial competitive advantage in moisture limited conditions.

Russian-thistle does not produce a true seed with endosperm, instead the calyx contains a coiled, fully differentiated seedling (Wallace et al. 1968). Germination consists simply of uncoiling and can be quite rapid – on the order of hours under favorable conditions (Wallace et al. 1968). Following a short, internally controlled after-ripening period, germination can occur under a wide range of moisture and temperature conditions (Young and Evans 1972). This afterripening requirement helps insure that seeds do not germinate under typical early autumn conditions but are ready for spring germination. Soil texture and atmospheric humidity affect moisture requirements for germination, but germination can occur with relatively low moisture availability (Evans and Young 1972, Wallace et al. 1968, Young et al. 1995). Rapid germination allows Russian-thistle to take advantage of short windows of favorable conditions that a slower germinating species might be unable to exploit (Evans and Young 1972). In the PNW, even a light shower on otherwise dry soil can be enough to bring a flush of germination in field conditions (Young et al. 1995). Germination can take place at sustained temperatures from 4 to

25 C, or nighttime temperatures of 0 C or below alternating with daytime temperatures from 5 to

10 C (Young and Evans 1972). The early stages of germination are reversible and should

conditions change rapidly, many germinating seedlings are able to re-coil and wait for the return

of suitable conditions (Young and Evans 1972).

Phenology and Lifecycle in the Pacific Northwest -

Under typical PNW growing conditions, Russian-thistle emergence begins in March and continues into late June, although the majority of activity is from April to mid-May (Young

1986). Initial aboveground growth is slow under typically cool spring conditions, but root growth is rapid and extensive (Pan et al. 2001), helping to explain Russian-thistle’s competitive ability.

Roots of mature plants have been observed spreading up to 1.5 m laterally and to depths of 1.8 m in the region (Pan et al. 2001). As temperatures increase, aboveground growth accelerates and eventually overtakes root growth (Pan et al. 2001).

Flowering begins in early to mid-summer with pollination primarily by wind, and seed produced both auto- and allogamously (Beckie and Francis 2009, Young 1986). It has been suggested that some insect pollination may also occur, based on the high diversity and number of insects observed on plants (Blackwell and Powell 1981). Seed production begins in August or

September (Young 1986, Schillinger 2007) and continues through the first killing frost of the year, with viable seed produced by September or October (Schillinger and Young 2000).

Estimates of seed production vary, with healthy plants producing between 40,000 and 100,000 seed per plant (Schillinger and Young 2000, Stallings et al. 1995, Young 1986). Growth, flowering, and seed production are indeterminate, and can be initiated whenever conditions are favorable (Crompton and Bassett 1985). This means that plants often produce very little seed while growing in a competitive crop such as winter wheat, but following crop harvest will resume growth and flowering and potentially produce large amounts of seed by the end of the growing season (Young 1986, Schillinger 2007).

At senescence, plants often break off at the base at a layer of specialized cells and

become tumbleweeds, with the globose growth form and springy branches promoting travel and

seed dispersal with wind (Beckie and Francis 2009). Plants shed approximately 60% of seed

when tumbling and only 20% if remaining stationary (Stallings et al. 1995). Tumbling plants

were observed to travel average distances of approximately 1-3 km before becoming lodged in

stubble, fencerows, ditches or other obstacles, with maximum travel distances slightly over 4 km

over six weeks in early fall (Stallings et al. 1995). Longevity in the seedbank is one year in the

Great Plains, and thought to be the same elsewhere (Burnside et al. 1996).

Impacts

The largest impact of Russian-thistle in crops is direct yield loss resulting from competition for soil moisture (Beckie and Francis 2009). Healthy stands of winter wheat compete effectively with Russian-thistle, and severe infestations generally occur only where stands are poor or plants are stressed as a result of seeding skips, winterkill, disease, or drought

(Young 1986). In contrast, spring cereals are highly susceptible to infestation and often suffer severe reductions in yield – up to 50% in heavy infestations (Young 1988). Young (1986) compared Russian-thistle growth among winter wheat, spring wheat, and crop free sites and found that winter wheat significantly suppressed seedling emergence, seedling survival and seed production relative to spring wheat and crop free conditions (which were largely indistinguishable). The number of seedlings emerging in winter wheat was approximately half the number emerging in spring wheat and crop free conditions, and seedling mortality was 50% in winter wheat and less than 10% in the other conditions. Biomass accumulation was significantly suppressed by both types of crop relative to the crop free environment during the growing season. After grain harvest, Russian-thistle plants resumed growth, rapidly

accumulating new biomass in spring wheat stubble and at a slower rate in winter wheat stubble.

Seed production averaged approximately 150,000 seeds per plant in crop free conditions, 17,000

seeds per plant in spring wheat, and 5,000 seeds per plant in winter wheat.

In spring wheat, grain yield in densely infested plots was reduced by 10 to 50% relative

to weed-free controls, depending on the year (Young 1988). Years in which moisture was more

limiting showed greater yield reduction than years with higher precipitation – likely due to

Russian-thistle’s relatively greater competitive ability under dry, hot conditions (Nord et al.

1999, Young 1986).

Russian-thistle can cause economic losses in infested crops beyond simple yield reduction. The foliage is typically green at harvest time and can result in dockage due to contamination of grain or elevated grain moisture levels as well as reduced harvest efficiency

(Young and Whitesides 1987). Plants that regrow substantially after harvest or during fallow can likewise accumulate enough biomass to interfere with later tillage or seeding operations. Direct costs of Russian-thistle control measures, and yield and quality losses were estimated to exceed

$50 million annually in 2006 (Young 2006).

Although yield losses in spring wheat or poor winter wheat stands can be severe, Young

(1986) suggested that post-harvest and fallow-year growth of Russian-thistle may have a larger

cumulative impact on the overall cropping system than in-crop growth and competition.

Following harvest of the wheat crop, Russian-thistle quickly resumes active growth, continuing

through the first killing frost (Schillinger 2007, Young and Whitesides 1987). If not controlled,

this growth can result in substantial biomass accumulation, soil water use, and seed production.

Biomass accumulation and soil water use by Russian-thistle plants during this post-harvest

period has been observed to substantially exceed that during the crop growing season

(Schillinger and Young 2000). Individual plants used approximately 70 L of soil water while

growing in spring wheat, and an additional 100 L of soil water for post-harvest growth. The

majority of above-ground biomass was produced in the post-harvest period, and approximately

25,000 to 50,000 seeds were produced per uncontrolled plant by the end of the growing season.

For plants at a 3 m regular spacing – not a particularly dense infestation – this level of soil water

use was projected to reduce yields approximately 425 kg ha-1 in the following wheat crop

(Schillinger and Young 2000). This is a substantial loss where yields typically range from 1200

to 3500 kg ha-1 (Schillinger et al. 2006). Although water use of plants growing uncontrolled in

fallow was not tested, in the absence of crop competition it seems that water use would be at

least as much as that in crop, with similar potential for yield interference.

Greater use of spring crops in the winter wheat-fallow rotation could have several benefits, including: better control of the winter annual grasses (largely downy brome, Bromus tectorum L.) that are a major problem in the system; increased flexibility in replanting options to deal with stand loss resulting from winter kill or seeding difficulties; the ability to take advantage of selected favorable, high precipitation years with re-cropping; and the potential for minimum- or no-till production allowed by suitable seedbed moisture conditions in spring but not fall

(Schillinger et al. 2007, Young and Thorne 2004). Unfortunately, the competitiveness of

Russian-thistle with spring crops is an important factor limiting the viability of spring cropping in the region (Schillinger 2001). Further, limited herbicide control options currently available for

Russian-thistle in potential broadleaf rotational crops may pose a barrier to their incorporation into the current cereal only system (Schillinger and Young 2000, Young et al. 2008). The availability of glyphosate-resistant varieties of canola provide a partial solution to this problem.

Control and Management

Management and control of Russian-thistle can be divided into three distinct periods over

the course of the crop rotation: in-crop, the time between small grain harvest and killing frost

(post-harvest), and the growing season of the fallow year.

In crop, the most effective management practice is ensuring a competitive crop (Young et

al. 1995). Healthy winter wheat stands provide effective control through competitive suppression

(Young 1986). Although spring wheat is much less competitive with Russian-thistle (largely due

to the much earlier phenological stage of spring wheat at the time of Russian-thistle emergence

and later canopy closure in relation to winter wheat), early planting and agronomic practices that

promote a vigorous crop stand can improve competitive suppression to some degree (Young et

al. 1995). Although the first Russian-thistle plants to establish during the season are generally the

most competitive (Young et al. 1995), prolonged emergence over the season can complicate

control, or at least necessitate the use of multiple control actions over the critical period of crop

competition. Effective herbicide options are available for in-crop control (Lyon and Barroso

2016, Morishita and Lyon 2016). In low yielding, low input winter wheat-fallow systems,

however, effective chemical control through the critical period of crop competition may be

prohibitively expensive despite the availability of effective chemistries.

In the post-harvest period, best management practice calls for control of Russian-thistle

within two weeks of grain harvest, before substantial growth and moisture use occurs. Several

control options for this period have been addressed in the literature. The first is shallow, non-

inversion tillage with wide overlapping sweep blades (undercutter) that sever Russian-thistle roots while leaving surface crop residue largely intact and in place for soil conservation. This method has been shown to be very effective at halting weed growth, and prevents almost all seed

production (Schillinger 2007). Dislodged Russian-thistle are typically moved out of the field by wind, and although they do not contain viable seed at this time, the resulting loss of residue has been raised as a possible soil conservation concern in extremely low residue situations

(Schillinger et al. 1999). The second method is use of a contact herbicide, typically paraquat or paraquat + diuron (Young and Whitesides 1987). Under good conditions this method is comparable to tillage in terms of efficacy, but poor conditions for application (large, dust-

covered , and moisture-stressed plants) mean that realized control is typically more variable

(Schillinger 2007). Biomass accumulation and soil moisture consumption are limited with this

method, but in most cases at least some seed is produced (Young and Whitesides 1987). Use of

herbicide alone is superior to tillage in terms of crop residue retention, and herbicide killed

Russian-thistle plants generally remain rooted, limiting potential distribution of seed and

contributing to surface residue loads (Schillinger et al. 1999).

Current grower practice for post-harvest control is not particularly consistent with the

peer-reviewed literature in the author’s observation. Although a USDA-NRCS Conservation

Innovation Grant and substantial WSU extension efforts were implemented to promote use of the

undercutter implement in the region (Schillinger and Young 2012), success has been mixed. A

number of growers adopted and continue to use undercutters as a result of the project, but the

majority of growers that choose tillage for post-harvest control use a heavy double disk, or

achieve weed control as secondary outcome of fall fertilizing using an applicator with straight

shanks and cultivator points. When herbicides are selected, paraquat is still used, but the majority

of growers select glyphosate. Paraquat + diuron is no longer available in a premixed formulation

and is not in common use, although tank mixes of glyphosate + paraquat are used by some

growers. Finally, many growers simply do not make control efforts immediately post-harvest,

12 particularly those employing less intensive management and relying more heavily on tillage for weed control over the fallow year.

During the growing season of the fallow year, weed control (of which Russian-thistle is generally the largest broadleaf component) is typically by both tillage and herbicide. A conventional, tillage-based fallow system will have an early season primary tillage with a heavy double disk or sweep, and four or more secondary tillage operations with a rodweeder throughout the season (Schillinger et al. 2006). Many growers now use lighter primary tillage and most substitute a nonselective herbicide application (typically glyphosate) for at least some of the traditional secondary tillage, but a primary tillage operation followed by two or more rodweedings is still typical practice on most cropland in the region (Riar et al. 2010, Schillinger et al. 2006). A number of growers have adopted direct seed systems, and rely solely on chemical control, both in fallow and throughout the rotation (Garrett Moon, Melvin Hall, Steve Camp, and

Aaron Viebrock, personal communication).

An optically controlled ‘smart sprayer’ has demonstrated potential to greatly reduce herbicide use during the fallow and post-harvest periods by turning individual nozzles on and off based on the presence of green plant tissue in the spray path, while maintaining levels of control equivalent to broadcast application in controlled field trials (Young et al. 2008). Despite this potential, the technology has not been adopted. The high initial cost of the unit is often cited for this, but completely inadequate performance of the system in accurately sensing plants and properly actuating spray nozzles under actual field use conditions (Garrett Moon, Larry

McGrew, personal communication, J. Spring unpublished data) is more likely the major factor.

From a larger scale management perspective, the ubiquitous distribution of Russian- thistle in the region and its capacity for relatively long range dispersal means that eradication or

long term reduction in population pressure is not feasible (Stallings et al. 1995, Thill and

Mallory-Smith 1997). Russian-thistle is present in most disturbed sites in the region (roadsides,

waste ground, parking lots, fencerows, and similar areas) where control, or even suppression, is

logistically and economically impossible. These serve as safe site sources for continual re-

infestation of adjacent areas (Stallings et al. 1994, Thill and Mallory-Smith 1997). Thus, realistic

management goals can encompass only season-long or very short term control, and perpetual

management efforts will be required to address annual re-infestation on farm and larger scales.

Herbicide Resistance

The ALS inhibitor chlorsulfuron provided almost complete, season-long control of

Russian-thistle for the first few years after its introduction in the mid-1980s (Young and Gealy

1986), but resistance developed rapidly. By 1992, 80% of Russian-thistle populations collected from crop fields across Washington displayed resistance to ALS inhibitors, and 70% of all populations statewide (from both crop and non-crop sites) exhibited resistance (Stallings et al.

1994). The physiological basis of this resistance in tested accessions from Washington State was a Pro197Leu substitution in the ALS gene (Warwick et al. 2010), although given the small

number of individuals tested it is possible that other mutations conferring resistance are also

present. In a survey of chlorsulfuron-resistant populations in Canada, the predominant source of resistance was a Trp574Leu mutation in the ALS gene, although Pro197Leu was also found

(Warwick et al. 2010). Recently, resistance to glyphosate has been reported in isolated

populations from eastern Washington and north central Montana (Kumar et al. 2017), and

northeastern Oregon (Barosso et al. 2017). Resistance to other mechanisms of action has not

been previously reported in Russian-thistle in the PNW (Heap 2017).

Genetic Diversity

Russian-thistle is known to be highly variable morphologically. From the current treatment in the Flora of North America (Mosyakin 2003):

In the present circumscription, Salsola tragus is an extremely polymorphic species

consisting of several more or less distinct races (subspecies or segregate species).

Several varieties may be recognized within S. tragus, many of them are just

morphological variants of little or no taxonomic value.

High levels of morphological variability are present within Russian-thistle populations in the inland PNW. Stallings et al. (1994) noted a high degree of variability in field surveys of

Russian-thistle across Washington State, and similar levels in specimens they cultivated in a common garden environment. The presence of multiple, seemingly stable, morphologically divergent ‘types’ of Russian-thistle has been anecdotally noted in Washington by others as well

(Frank Young, William Schillinger, and Drew Lyon, personal communication). There appears to be a strong genetic basis to these morphological differences – the ‘types’ appear to be stable across years, and morphologically divergent specimens of similar age are commonly observed growing in close proximity to one another in field populations (Figure 1.).

In California, morphological variability within Russian-thistle was found to include several cryptic species. Ryan and Ayres (2000) were the first to report that in California populations of what had previously been considered the single species S. tragus was actually composed of two genetically distinct and widely distributed groups, which they initially designated type A and type B. Type A was confirmed to be S. tragus sensu stricto, but the identity of type B was not immediately evident (Ryan and Ayres 2000, Ryan et al. 2007).

Following further genetic studies, type B was found to be synonymous with

S. kali austroafricana Aellen (Gaskin et al. 2006). In the same study, comparison of populations

from California and the native Eurasian range confirmed that S. tragus populations in California

are of Eurasian origin. Salsola kali austroafricana was not found in Eurasian collections, but

populations collected in South Africa were genetically very similar to the California collections

(Gaskin et al. 2006). On the basis of the pepC gene fourth intron sequences used for analyses,

genetic diversity was found to be relatively high in S. tragus (both in California and Eurasia), but

low in S. kali austroafricana (Gaskin et al. 2006). Hrusa and Gaskin (2008) established the

correct identity of type B as S. australis R. Br., which is thought to be native to Australia and

also invasive in South Africa. In its native range, S. australis is thought to be comprised of four

to six morphologically and ecologically distinct biotypes, although this has yet to be rigorously

confirmed (Chinnock 2010).

Coincidental to this work, a third, previously undescribed species, Salsola ryanii sp. nov., was also identified (Hrusa and Gaskin 2008). It is a fertile allohexaploid derived from hybridization of S. tragus and S. australis, thought to have evolved in at least two unique events at separate locations within California (but unknown in Eurasia, where there is no range overlap between the parent species). Finally, a full range of morphologically intermediate forms resulting from hybridization between S. tragus and S. paulsenii Litv. (Barbwire Russian-thistle, a morphologically distinguishable species that is also present in California) was observed (Hrusa and Gaskin 2008). This type of hybridization is apparently also common in regions of overlap in the native Eurasian ranges of the parent species (Gaskin et al. 2006, Mosyakin 2003). Further characterization of the Salsola complex in California was conducted by Ayres et al. (2009).

Ploidy and chromosome numbers, were verified for S. tragus (tetraploid, 2n=36), S. australis

(diploid, 2n=18), S. ryanii (allohexaploid, 2n=54), and S. lax (allohexaploid, 2n=54) a species

first described by Arnold (1972). [For clarity of discussion, the nomenclature used here is

consistent with that of Hrusa and Gaskin (2008) despite different usage by Ayres et al. (2009).

The work of Ayres et al. was completed prior to that of Hrusa and Gaskin based on manuscript

submission dates, thus the nomenclature used here also reflects the most current understanding

available.] Patterns of inheritance of parental markers in S. ryanii are consistent with this species

being a simple F1 hybrid between the parents (Gaskin et al. 2008). Sequences in S. lax indicate that it is not a simple interspecific hybrid, and it is currently thought to represent a complex pattern of introgression between S. tragus, S. australis, S. paulsenii, and a fourth, currently

ambiguous Salsola entity (Hrusa and Gaskin 2008). A recent survey of the Salsola complex

indicates that S. ryanii is undergoing rapid range expansion within California (Welles and

Ellstrand 2016a). The range and abundance of these species outside of California is unknown

(Hrusa and Gaskin 2008).

In a similar case of genetic work revealing previously cryptic species-level diversity, a

new species (Kali basalticum C. Brullo) was distinguished from S. tragus in Italy (Brullo et al.

2015). This species is hexaploid (with 2n=54), but unlike S. ryanii it appears to be derived entirely from S. australis ancestry on the basis of pepC fourth intron sequences (Brullo et al.

2015). Although restricted in known range to a single population on Mount Etna in Sicily, it is another example of the cryptic variability that may be present within S. tragus.

There is mixed evidence for the existence of population structure within S. tragus sensu stricto. On a continental scale, current taxonomic consensus seems to assume that population structure is present, and explains at least some of the morphological diversity observed in the species (Mosyakin 2003). Ryan and Ayres (2000), observed what they speculated to represent meaningful population structure within S. tragus sensu stricto. Gaskin et al (2006) noted

17 substantial diversity within S. tragus (and not S. australis), but did not address possible implications of this. Similarly, Hrusa and Gaskin (2008), noted that S. tragus sensu stricto appeared to have two major morphotypes in California that occupy distinct habitat types (as well as a full range of intermediate morphological forms), but did not explicitly address the possibility of population structure within the species. Welles and Ellstrand (2016b) found evidence for significant geographic population structure in S. ryanii (reflecting three unique origin events for the species), minimal structure in S. australis, and no structure in S. tragus populations in

California. However, they used a small number of markers for analysis (n=5), and conclusions regarding population structure in S. australis and S. tragus were not the focus of the study. On the whole, the evidence regarding intraspecific population structure is ambiguous, and no rigorous investigations have been conducted. Outside of California, only anecdotal information is available, but would suggest that local population structure is possible.

Gaskin et al. (2006) included three specimens collected in the vicinity of Spokane, WA in their survey, all of which were confirmed to be S. tragus. The possible presence and distribution of the other Salsola entities in the PNW is completely unknown. In light of the high levels of morphological diversity observed in the region, it also seems plausible that meaningful levels of intra-specific population structure could be present in the region.

Research Objectives

The primary objective of this dissertation was to describe the genetic diversity and

population structure present in Russian-thistle populations in the low- and intermediate- precipitation cropping zones of the inland Pacific Northwest. Secondary objectives included several applied research questions related to improved chemical management of Russian-thistle in wheat-chemical fallow rotations in the region. The findings of this work are presented in the following three chapters that address: i.) genetic diversity and population structure of Russian- thistle in the Pacific Northwest; ii.) confirmation and characterization of resistance to glyphosate in Russian-thistle from Washington State; and iii.) identification of preemergence herbicides that show potential to increase efficacy of control of Russian-thistle in chemical fallow while also lowering input costs relative to current management practices, and providing options for management of glyphosate resistance.

Literature Cited

Akhani H, Edwards G, Roalson EH (2007) Diversification of the Old World Salsoleae s.l. (Chenopodiaceae): molecular phylogenetic analysis of nuclear and chloroplast data sets and a revised classification. Int. J. Plant Sci. 168:931–956

Akhani H, Greuter W, Roalson EH (2014) Notes on the typification and nomenclature of Salsola and Kali (Chenopodiaceae). Taxon, 63:647-650.

Arnold HL (1972) An analysis of the taxonomic status of a new taxon in the genus Salsola. PhD Dissertation, Utah State University, Logan

Ayres D, Ryan FJ, Grotkopp E, Bailey J, Gaskin J (2008) Tumbleweed (Salsola, section Kali) species and speciation in California. Biol. Invasions 11:1175–1187

Barroso J, Gourlie JA, Lutcher LK, Liu M, Mallory-Smith CA (2017) Identification of glyphosate resistance in Salsola tragus in north-eastern Oregon. Pest Manag. Sci. 10.1002/ps.4525

Beckie HJ, Francis A (2009) The biology of Canadian weeds. 65. Salsola tragus L.(updated). Can. J. Plant Sci. 89:775–789

Blackwell WH, Powell MJ (1981) A Preliminary Note on Pollination in the Chenopodiaceae. Ann. Mo. Bot. Gard. 68:524

Brullo C, Brullo S, Gaskin JF, Galdo GGD, Hrusa GF, Salmeri C (2015) A new species of (Salsoloideae, Chenopodiaceae) from Sicily, supported by molecular analysis. Phytotaxa 201:256-277

Burnside OC, Wilson RG, Weisburg S, Hubbard KG (1996) Seed longevity of 41 weed species buried 17 years in eastern and western Nebraska. Weed Sci. 44:74–86

Chinnock RJ (2010) Some observations on Salsola L. (Chenopodiaceae) in Australia. J. Adelaide Bot. Gard. 24:75–79

Crompton CW, Bassett IJ (1985) The biology of Canadian weeds: 65. Salsola pestifer A. Nels. Can. J. Plant Sci. 65:379–388

Evans RA, Young JA (1972) Germination and establishment of Salsola in relation to seedbed environment. II. Seed distribution, germination, and seedling growth of Salsola and microenvironmental monitoring of the seedbed. Agron. J. 64:219–224

Fowler JL, Hageman JH, Moore KJ, Suzukida M, Assadian H, Valenzuela M (1992) Salinity effects on forage quality of Russian-thistle. J. Range Manag. 45:559

Gaskin JF, Ryan FJ, Hrusa GF, Londo GP (2006) Genotype diversity of Salsola tragus and potential origins of a previously unidentified invasive Salsola from California and Arizona. Madroño 53: 244–251

Hammel JE, Papendick RI, Campbell GS (1981) Fallow tillage effects on evaporation and seedzone water content in a dry summer climate. Soil Sci. Soc. Am. J. 45:1016–1022

Heap, I. The International Survey of Herbicide Resistant Weeds. Online. Friday, January 13, 2017. Available www.weedscience.org

Hrusa GF, Gaskin JF (2008) The Salsola tragus complex in California (Chenopodiaceae): characterization and status of Salsola australis and the autochthonous allopolyploid Salsola ryanii sp. nov. Madroño 55:113–131

Juergens LA, Young DL, Schillinger WF, Hinman HR (2004) Economics of alternative no-till spring crop rotations in Washington’s wheat–fallow region. Agron. J. 96:154–158

Kumar V, Spring JF, Lyon DJ, Burke IC, Jha P (2017) Glyphosate-Resistant Russian thistle (Salsola tragus L.) Identified in Montana and Washington. Weed Technol. 31: 10.1017/wet.2016.32

Lyon D, Barroso J (2016) Winter Wheat. In: Peachey E., ed. Pacific Northwest Weed Management Handbook. Corvallis, OR: Oregon State University. D-18 to D-28

McGee RJ, Nelson H, McPhee KE (2013) Registration of “Lynx” Winter Pea. J. Plant Reg. 7:261

Morishita D, Lyon D (2016) Spring Wheat. In: Peachey E, ed. Pacific Northwest Weed Management Handbook. Corvallis, OR: Oregon State University. D-52 to D-63

Mosyakin SL (1996) A taxonomic synopsis of the genus Salsola (Chenopodiaceae) in North America. Ann. Mo. Bot. Gard. 83:387

Mosyakin SL (2003) Salsola Linnaeus. In: Flora of North America Editorial Committee eds. Flora of North America north of Mexico, Magnoliphyta, Caryophillidae, vol 4, Part 1. Oxford University Press, New York, pp 398–403

Mosyakin SL, Rilke S, Freitag H (2014) Proposal to conserve the name Salsola (Chenopodiaceae s.str.; Amaranthaceae sensu APG) with a conserved type. Taxon, 63:1134-1135.

Nord CA, Messersmith CG, Nalewaja JD (1999) Growth of Kochia scoparia, Salsola iberica, and Triticum aestivum varies with temperature. Weed Sci. 47:435–439

Pan WL, Young FL, Bolton RP (2001) Monitoring Russian-thistle (Salsola iberica) root growth using a scanner-based, portable mesorhizotron. Weed Technol. 15:762–766

Rasmussen PE, Parton WJ (1994) Long-term effects of residue management in wheat-fallow: I. Inputs, yield, and soil organic matter. Soil Sci. Society Am. J. 58:523–530

Riar DS, Ball DA, Yenish JP, Wuest SB, Corp MK (2010) Comparison of fallow tillage methods in the intermediate rainfall inland Pacific Northwest. Agron. J. 102:1664

Ryan FJ, Ayres DR (2000) Molecular markers indicate two cryptic, genetically divergent populations of Russian-thistle (Salsola tragus) in California. Can. J. Bot. 78:59–67

Ryan FJ, Mosyakin SL, Pitcairn MJ (2007) Molecular comparisons of Salsola tragus from California and Ukraine. Can. J. Bot. 85:224–229

Schillinger WF (2001) Minimum and delayed conservation tillage for wheat–fallow farming. Soil Sci. Soc. Am. J. 65:1203–1209

Schillinger WF (2007) Ecology and control of Russian-thistle (Salsola iberica) after spring wheat harvest. Weed Sci. 55: 381-385.

Schillinger WF, Kennedy AC, Young DL (2007) Eight years of annual no-till cropping in Washington’s winter wheat-summer fallow region. Agr. Ecosyst. Environ. 120:345–358

Schillinger WF, Papendick RI (1997) Tillage mulch depth effects during fallow on wheat production and wind erosion control factors. Soil Sci. Soc. Am. J. 61:871–876

Schillinger WF, Papendick RI, Guy SO, Rasmussen PE, Van Kessel C (2006) Dryland cropping in the western United States in: Dryland Agriculture, 2nd ed. Agronomy Monograph no. 23. Crop Sci. Soc. Am., Soil Sci. Soc. Am., Madison, WI, USA

Schillinger WF, Papendick RI, Veseth RJ, Young FL (1999) Russian-thistle skeletons provide residue in wheat-fallow cropping systems. J. Soil Water Conserv. 54:506–509

Schillinger WF, Young DL (2004) Cropping systems research in the world’s driest rainfed wheat region. Agron. J. 96:1182–1187

Schillinger WF, Young FL (2000) Soil water use and growth of Russian-thistle after wheat harvest. Agron. J. 92:167–172

Singh P, Flury M, Schillinger WF (2011) Predicting seed-zone water content for summer fallow in the inland Pacific Northwest, USA. Soil Till. Res. 115-116:94–104

Smith L (2005) Host plant specificity and potential impact of Aceria salsolae (Acari: Eriophyidae), an agent proposed for biological control of Russian-thistle (Salsola tragus). Biol. Control 34:83–92

Stallings GP, Thill DC, Mallory-Smith C (1994) Sulfonylurea-resistant Russian-thistle (Salsola iberica) survey in Washington State. Weed Technol. 8:285–264

Stallings GP, Thill DC, Mallory-Smith CA, Lass LW (1995) Plant movement and seed dispersal of Russian-thistle (Salsola iberica). Weed Sci. 43:63–69

Thill DC, Mallory-Smith CA (1997) The nature and consequence of weed spread in cropping systems. Weed Sci. 45:337–342

Thorne ME, Young FL, Pan WL, Bafus R, Alldredge JR (2003) No-till spring cereal cropping systems reduce wind erosion susceptibility in the wheat/fallow region of the Pacific Northwest. J. Soil Water Conserv. 58:250–257

Thorne ME, Young FL, Yenish JP (2007) Cropping systems alter weed seed banks in Pacific Northwest semi-arid wheat region. Crop Prot. 26:1121–1134

Voznesenskaya EV, Koteyeva NK, Akhani H, Roalson EH, Edwards GE (2013) Structural and physiological analyses in Salsoleae (Chenopodiaceae) indicate multiple transitions among C3, intermediate, and C4 photosynthesis. J. Exp. Bot. 64:3583–3604

Wallace A, Rhods WA, Frolich EF (1968) Germination behavior of Salsola as influenced by temperature, moisture, depth of planting, and gamma irradiation. Agron. J. 60:76–78

Warwick SI, Sauder CA, Beckie HJ (2010) Acetolactate synthase (ALS) target-site mutations in ALS inhibitor-resistant Russian-thistle (Salsola tragus). Weed Sci. 58:244–251

Welles SR, Ellstrand NC (2016a) Rapid range expansion of a newly formed allopolyploid weed in the genus Salsola. Am. J. Bot. 103:663–667

Welles, SR, Ellstrand NC (2016b) Genetic structure reveals a history of multiple independent origins followed by admixture in the allopolyploid weed Salsola ryanii. Evol. Appl. 9:871–878

Williams JD, Wuest SB (2011) Tillage and no-tillage conservation effectiveness in the intermediate precipitation zone of the inland Pacific Northwest, United States. J. Soil Water Conserv. 66:242–249

Young DL, Schillinger WF (2012) Wheat farmers adopt the undercutter fallow method to reduce wind erosion and sustain profitability. Soil and Till. Res. 124:240–244

Young JA (1991) Tumbleweed. Sci. Amer. March: 264:82-87

Young JA, Evans RA (1972) Germination and establishment of Salsola in relation to seedbed environment. I. Temperature, afterripening, and moisture relations of Salsola seeds as determined by laboratory studies. Agron. J. 64:214–218

Young FL (1986) Russian-thistle (Salsola iberica) growth and development in wheat (Triticum aestivum). Weed Sci. 34:901–905

Young FL (1988) Effect of Russian-thistle (Salsola iberica) interference on spring wheat (Triticum aestivum). Weed Sci. 36:594–598

Young FL, Ball DA, Veseth RJ, Thill DC, Schillinger WF (1995) Managing Russian-thistle under conservation tillage in crop-fallow rotations. Pacific Northwest Extension Publication 492. 12p.

Young FL, Gealy DR (1986) Control of Russian-thistle (Salsola iberica) with chlorsulfuron in a wheat (Triticum aestivum) summer-fallow rotation. Weed Sci. 34:318–324

Young FL, Thorne ME (2004) Weed-species dynamics and management in no-till and reduced- till fallow cropping systems for the semi-arid agricultural region of the Pacific Northwest, USA. Crop Prot. 23:1097–1110

Young FL, Whitesides RE (1987) Efficacy of postharvest herbicides on Russian-thistle (Salsola iberica) control and seed germination. Weed Sci. 35:554–559

Young FL, Yenish JP, Launchbaugh GK, McGrew LL, Alldredge JR (2008) Postharvest control of Russian-thistle (Salsola tragus) with a reduced herbicide applicator in the Pacific Northwest. Weed Technol. 22:156–159

Young FL (2006) Russian-thistle (Salsola spp.) biology and management. P145–147 in: Managing Weeds in a Changing Climate: Papers and Proceedings of 15th Australian Weeds Conference. Adelaide, Australia: Weed Management Society of South Australia.

Young FL, Whaley DK, Pan WL, Roe RD, Alldredge JR (2014) Introducing Winter Canola to the Winter Wheat-Fallow Region of the Pacific Northwest. Crop Manag. 13: 10.2134/CM-2013-0023-RS

Tables and Figures

Figure 1.1. Photos of morphologically divergent Russian-thistle phenotypes. Specimens emerged in same cohort, and are clearly growing in close proximity. Presumably, specimens are experiencing nearly identical environmental conditions, and phenotypic differences apparent result primarily from genetic differences between individuals. For rough scale, a boot print is evident between plants in top photos, row spacing in bottom photo is approximately 20 cm. Photos taken at WSU Lind Research Station near Lind, WA ca. 1990, courtesy of Dr. Frank Young.

CHAPTER 2: Russian-thistle Population Structure in the Dryland Cropping Region

of the Inland Pacific Northwest

Russian-thistle is a common and agronomically important weed of semi-arid cropping regions across North America (Beckie and Francis 2009), and is especially problematic in small grain production systems. In the dryland winter wheat-fallow cropping systems of the inland

Pacific Northwest – an area of approximately 2.6 million hectares of cropland in eastern

Washington, northeastern Oregon, and western north Idaho – it is commonly cited as the

dominant broadleaf weed species, and poses persistent and often severe management concerns

(Lutcher 2015, Schillinger et al. 2006, Schillinger and Young 2000, Young 1986, Young 1988).

As a species, Russian-thistle is characterized by high levels of morphological variability.

This has been noted on a continental scale by taxonomic authorities (Mosyaksin 2003, Rilke

1999), and on regional scales as well (Beckie and Francis 2009, Lee and Brothers 1981,

Reynolds and Launchbaugh 1977, Stallings et al. 1995). Populations of Russian-thistle in

California were found to contain cryptic, species-level diversity by a series of research efforts

(Ryan and Ayres 2000, Gaskin et al. 2006, Ryan et al. 2007, Hrusa and Gaskin 2008, Ayres et al.

2009) that ultimately delineated a complex of four Salsola species in the state, consisting of: S.

tragus sensu stricto, S. australis R. Br., S. ryanii GF Hrusa and JF Gaskin, and S. lax HL Arnold.

A fifth species, barbed-wire Russian-thistle (S. paulsenii Litv.), is also present in California, but

is generally considered to be morphologically distinguishable from S. tragus (Beatley 1973). The

most widely distributed of these species in California are S. tragus and S. australis (Ryan and

Ayres 2000, Hrusa and Gaskin 2008). Salsola tragus sensu stricto is currently thought to be the

typical and most broadly distributed weedy Salsola species of arid regions across North America

(Francis and Beckie 2009, Mosyaksin 1996). Salsola australis (syn. S. kali austroafricana

Aellen.) is widely distributed in California and has also been documented in herbarium

collections from New Mexico, Texas, and Mexico, although North American distribution beyond

this is unknown (Ryan and Ayres 2000, Hrusa and Gaskin 2008, Ayres et al. 2009). This species

is thought to be native to Australia, where it has between four and six morphologically and

ecologically distinct biotypes (Chinnock 2010), only one of which is known from California.

Salsola ryanii is an allohexaploid species recently formed from hybridization between S. tragus

and S. australis in North America (Ayres et al. 2009, Hrusa and Gaskin 2008). Although

currently limited in extent to a few known populations in California, the species appears to be

rapidly expanding, providing one of the few modern case studies of species formation via

polyploidy (Welles and Ellstrand 2016). A full range of morphologically intermediate hybrids

between S. tragus and S. paulsenii are also present in areas of range overlap between the parent

species in California (Ayres et al. 2009, Hrusa and Gaskin 2008), adjacent states (Beatley 1973),

and in their native Eurasian ranges (Rilke 1999). Finally, S. lax, first described by Arnold (1972),

is thought to be the outcome of a complex pattern of introgression among S. tragus, S. australis,

S. paulsenii, and a fourth, currently ambiguous Salsola entity, and is of very limited known

distribution (Hrusa and Gaskin 2008). Chromosome numbers and ploidy were verified by Ayres

et al. (2009) for S. tragus (autotetraploid, 2n=36), S. paulsenii (autotetraploid, 2n=36),

S. australis (diploid, 2n=18), S. ryanii (allohexaploid, 2n=54), and S. lax (allohexaploid, 2n=54).

The current ranges and distribution of these species in North America outside of California is

effectively unknown (Hrusa and Gaskin 2008).

In the inland Pacific Northwest, a high level of morphological diversity is present in

Russian-thistle populations, and specimens with notably divergent phenotypes are commonly observed growing in mixed populations in extremely close proximity to one another (F Young,

27 unpublished data). Additionally, a number of qualitatively recognizable gross phenotypes appear to be present, and seem stable from year to year (F Young, unpublished data). While far from conclusive, these observations are suggestive of substantial genetic diversity and possible differentiation within these populations. Variability in response to late-season applications of glyphosate, paraquat, and 2,4-D has also been anecdotally described within populations of

Russian-thistle in the region, and does not appear entirely explained by variation in environmental or herbicide application factors (F Young, unpublished data), suggesting that genetic variation may be involved. While population genetic structure has been speculated to have the potential to cause differential response to herbicides between population sub-groups, empirical studies on the topic are scarce. Marked differences in efficacy of clopyralid were observed between different biotypes of rush skeletonweed (Chondrilla juncea L.) in Australian field trials (Heap 1993), and variability in herbicide efficacy was speculatively attributed to genetic differentiation between populations of yellow toadflax (Linaria vulgaris Mill.) from across the western United States (Ward et al. 2008), but the authors were unable to find further studies addressing this hypothesis with empirical data. In contrast, differential response of population subgroups to classical biocontrol agents is well established (Gaskin et al. 2011,

Sobhian et al. 2003). Observation of differential response to biocontrol agents within populations of Russian-thistle in California was the initial motivation for the genetic work described previously (Ryan and Ayres 2000), and was confirmed in several subsequent studies (Bruckart et al. 2004, Sobhian et al. 2003).

The recent combination of next-generation nucleic acid sequencing technologies with reduced representation genomic sampling techniques – often referenced under the general term

‘genotyping-by-sequencing’ – has been revolutionary for studies in the broad fields of

28 ecological, evolutionary, and conservation genetics (Narum et al 2013). Rapid refinement of these techniques in the last several years has made generation of large numbers of genetic markers from many individuals relatively quick, easy, and financially feasible for even small research programs, and for non-model organisms with no existing genetic resources. Of these approaches, the family of techniques known as restriction site-associated DNA sequencing

(RAD-seq) have been most applicable to questions at the population and shallow evolutionary scales (Narum et al. 2013). Although a number of variations exist (thoroughly reviewed by

Andrews et al. 2016), the basic approach uses restriction enzymes to recover a repeatable set of discrete, short sequence fragments that occur at the same locations in the genome across all individuals in a sample, similar in principle to generation of AFLP markers (Davey et al. 2011).

These techniques have been successfully applied to research questions related to population structure in a wide range of organisms, including recent examples in the weed species cogongrass (Imperica cylindrica (L.) P. Beav.) (Burrell et al. 2015) and shepherd’s-purse

(Capsella bursa-pastoris L.) (Cornille et al. 2016).

In light of the cryptic diversity described in Russian-thistle populations in California and the suggestive, but essentially uncharacterized morphological diversity present in the inland

Pacific Northwest, the primary objective of this study was to use a RAD-seq approach to characterize the genetic diversity and structure of Russian-thistle populations across the wheat- fallow cropping zones of the region. Secondarily, it was hypothesized that if such population structure is present, differential response to herbicide treatments between population subunits might explain some of the variability in herbicide efficacy observed in the region.

Materials and Methods

Plant Material

Samples were collected from 72 locations across the range of Russian-thistle in the inland

Pacific Northwest (Figure 1). Sixty-one of these sampling locations were a subset taken from the systematic-random regional sampling design developed by Lawrence (2015). This subset included all points (51) with a land use category of dryland cropping and average annual precipitation of under 450 mm (roughly delineating the range of Russian-thistle in the region), and an additional, subjectively selected 10 points with a land use category of irrigated cropland and average annual precipitation under 450 mm. A further 11 points were subjectively placed to include geographic areas not included in the original set of sampling locations, and to capture additional apparent variability encountered during sampling excursions.

Samples were collected from November through December 2013, at which time plants were fully senesced and contained viable seed. At each sampling point, four individuals were selected, cut at the base of the stem, and individually bagged. If substantial morphological variability appeared to be present within the population at a site, individuals were selected to include as much of this variability as possible. From the initial collection of 288 individuals, a subset of 94 was selected for further analysis. This subset included the first plant collected at each site, plus 22 additional individuals from the initial collection. These additional individuals were subjectively selected to include the most apparent morphological diversity possible in the final subset, on the basis of phenotype apparent in the collected mother plants. A single seed from each selected individual was germinated and the aboveground portion of the seedling harvested for DNA extraction at 4 to 7 d after emergence, when plants had cotyledons plus two true leaves and were 2 to 4 cm tall. Collected tissue was frozen at -80 C, lyophilized for 48 h in a

MultiDry benchtop freeze dryer (FTS Systems, Stone Ridge, NY) and ground using a

TissueLyser (Qiagen, Valencia, CA). DNA was extracted from prepared tissue using a BioSprint

96 DNA Plant Kit (Qiagen) according to manufacturer instructions.

Species Identification

The species-specific haplotypes for nuclear DNA sequences of the intron between the fourth and fifth exons of the gene encoding phosphoenolpyruvate carboxylase (PEPC) identified by Gaskin et al. (2006) were used to design a Cleaved Amplified Polymorphic Sequence (CAPS) assay to discriminate between diploid, tetraploid, and combined genomes (and to infer species- level identity of specimens). A single nucleotide polymorphism at position 51 of the amplified

PEPC intron fragment distinguishes both known diploid (S. australis) haplotypes (with cytosine at position 51; GenBank accessions DQ257379 and DQ005543) from published tetraploid (S. tragus and S. paulsenii) haplotypes (with thymine at position 51; GenBank accessions

DQ257378, DQ005542, DQ005544, DQ257380, DQ257381, DQ257382, DQ257383,

DQ257384, DQ257385). All sequence analysis, and design of primers and CAPS site/enzyme was conducted in Geneious 8.1.7 (Kearse et al., 2012). The haplotype sequence(s) of four individual plants was confirmed using the method of Gaskin et al. (2006) with slight modification. The 420 bp target intron sequence was amplified from genomic sample DNA by

PCR in a 25 uL volume comprised of: 2 uL template DNA at 30ng/uL, 12.5 uL OneTaq 2x

Master Mix with Standard Buffer (New England Biolabs, Ipswich, MA), 1 uL of 10 uM forward primer ppcx4f (5’-ACTCCACAGGATGAGATGAG-3’), 1uL of 10 uM reverse primer ppcx5r

(5’-GCAGCCATCATTCTAGCCAA3’), made to final volume with nuclease-free water. A T100 thermocycler (Bio-RAD Laboratories Inc, Hercules, CA) was used with conditions of: initial denaturing for 1 minute at 94 C, 30 cycles of 30 s at 94 C, 30 s at 52 C, and 30 s at 68 C,

followed by 5 m of final extension at 68 C. The resulting product was run on a 2% TAE buffered

agarose gel at 125 V against a 100bp DNA size ladder (New England Biolabs), and visualized

with SYBR Safe DNA Gel Stain (Invitrogen, Carlsbad, CA) and UV light. The 420 bp product

was excised from the gel and purified using a QiaQuick Gel Extraction Kit (Qiagen,

Germantown, MD) according to manufacturer instructions. Purified product was prepared for

sequencing in triplicate reactions for each sample using the BigDye Terminator v3.1 Cycle

Sequencing Kit (Life Technologies Corporation, Carlsbad, CA) and cleaned using Performa

DTR Gel Filtration Cartridges (Edge Biosystems, Gaithersburg, MD) as recommended by

manufacturers prior to Sanger sequencing with an ABI 3730 DNA Analyzer (Life Technologies

Corporation) at the Molecular Biology and Genomics Core at Washington State University. All individuals sequenced had previously reported S. tragus (tetraploid) haplotypes (data not shown).

As no known diploid individuals were available, the diploid haplotype at position 51 of the

PEPC intron sequence was created from one of the previously sequenced tetraploid (S. tragus)

haplotypes using a mismatched forward primer to induce the desired SNP into a 135 bp product.

A 25 uL PCR was used with reaction components of: 1 uL of the gel purified 400bp PCR

product used for sequencing, 12.5 uL OneTaq 2x Master Mix with Standard Buffer (New

England Biolabs), 0.5 uL of 10 uM forward primer Fsnp(5’ACTCCACAGGATGAGATGA

GGGCAGG AATGAGCTACTTCCACGAGACAATCTG-3’), 0.5 uL of 10 uM reverse primer

Rsnp (5’-AGCATTGTAGGGAACACGTTCATTTATGCCTAAATTCTTCAAAGCTGTATC

AAC-3’), made to final volume with nuclease-free water. Reaction conditions were: initial denaturation for 1 m at 94 C, 35 cycles of 30 s at 94 C, 30 s at 60 C, and 30 s at 68 C, followed by 5 m of final extension at 68 C. The 135 bp CAPS fragment was then amplified in separate reactions from both genomic DNA of a known S. tragus individual and from the synthetic

diploid sequence in a 25 uL PCR containing: 2 uL template DNA, 12.5 uL OneTaq 2x Master

Mix with Standard Buffer (New England Biolabs), 1 uL of 10 uM forward primer ppcx4f , 1 uL

of 10 uM reverse primer 135Rg (5’-AGAGGAAAATTGGATAAGAGGAGC-3’), made to final volume with nuclease-free water. Following successful confirmation of sequences by gel purification and sequencing as before, CAPS fragments of both haplotype sequences were produced by PCR as previously described, and digested in a 30 uL reaction volume containing:

25 uL PCR product, 3 uL 10x CutSmart Buffer (New England Biolabs), 1 uL Hpy188III (New

England Biolabs), and 1 uL nuclease-free water. Digestion was 2.5 h at 37 C followed by

denaturation at 65 C for 20 m. Digested fragments were then run on a 2% agarose gel as

previously described. As designed, the diploid (S. australis) haplotype CAPS fragment was

digested (into 2 fragments, of 51 and 84 bp) while the tetraploid haplotype fragment remained

undigested at 135 bp. Following this confirmation of the assay’s validity, all individuals were

screened by amplification of the 135 bp CAPS fragment from genomic DNA of all samples

using primers Fsnp and Rsnp, digestion with Hpy188III, and visualization of fragment pattern

with gel electrophoresis as previously described.

Library Preparation and Sequencing

Library preparation and sequencing were performed by staff of the USDA-ARS Western

Regional Small Grains Genotyping Lab in Pullman, WA. Samples were divided into two

libraries, one of 48 individuals and one of 46. Library preparation followed the double digest

Genotyping-by-Sequencing (GBS) protocol developed for the Ion Torrent semi-conductor

sequencing platform by Mascher et al. (2013) with slight modifications. This general technique was first published under the name Genotyping-by-Sequencing by Elshire et al. (2011), but is also widely known as double-digest RAD-seq (ddRAD-seq) due to independent publication

under that name by Peterson et al. (2012). Digestion of genomic DNA was performed with the

PstI/MspI enzyme pair, and the protocol used was modified from the original protocol by

inclusion of several additional size selection steps after PCR amplification of prepared libraries

per the published protocol. Additional steps added prior to sequencing were: i. library size

distribution and concentration quantified using a 2100 BioAnalyzer (Agilent Technologies, Santa

Clara, CA) according to manufacturer instructions; ii. amplicons purified using the Agencourt

AMPure XP system (Beckman Coulter Inc., Brea, CA) according to manufacturer instructions; iii. size selection using the E-Gel SizeSelect system with 2% gels (Invitrogen, Carlsbad, CA) according to manufacturer instructions; iv. a second pcr amplification of the prepared library using 10 reaction cycles but with conditions otherwise identical to first amplification step as

Mascher et al. (2013); v. size selection using the E-Gel SizeSelect system as before; and vi. final quantitation of library size distribution and concentration using the 2100 BioAnalyser. Each library was individually sequenced using an Ion Proton sequencer (Life Technologies, Carlsbad,

CA) using Ion P1 chips. Individuals were automatically de-multiplexed and sequencing adapters and individual barcode sequences removed by Torrent Suite Software 4.6 (Life Technologies) with default settings for generation of output files in fastq format.

Genotyping and SNP Calling

All bioinformatics processes were run on a desktop computer with a 3.4 GHz Intel Core i7 processor and 16 GB RAM running Debian 8.6 Linux. Raw reads in fastq format were subjected to simple error correction using Pollux 1.0.2 (Marinier et al. 2015). Remaining common adapter sequences from library preparation were trimmed from corrected fastq files using Cutadapt 1.9.2 (Martin 2011). Reads were then quality trimmed using Trimmomatic 0.36

(Bolger et al. 2014) with the following parameters: HEADCROP:5, LEADING:5,

SLIDINGWINDOW:20, TRAILING:20, MINLEN:32. Prepared reads (demultiplexed and

quality trimmed) were then subjected to the reference free (‘Mock Reference’) assembly and

SNP calling process implemented in GBS-SNP-CROP 2.0.0 (Melo et al. 2016), beginning with

Step 4. User specified options and parameters used for each step of the pipeline follow. Step 4:

(using all genotypes in construction of the mock reference) -d SE, -rl 200, -pl 32, -p 0.01, -id

0.93. Step 5: -Q 0, -q 0, -f 0, -F 2308, -t 8, -Opt 0. Step 6: no user specified options. Step 7: - mnHoDepth0 11 -mnHoDepth1 48 -mnHetDepth 3 -altStrength 0.9 -mnAlleleRatio 0.1 -mnCall

0.75, -mnAvgDepth 4 -mxAvgDepth 200.

Population Structure and Genetic Diversity

Three approaches were used to investigate the possibility of population structure in the resulting SNP dataset. In the first approach, the SNP dataset was subjected to multi-dimensional scaling (MDS) in TASSEL 5.2.33 (Bradbury et al. 2007). Multi-dimensional scaling is extremely similar to principal components analysis (PCA) and identical in interpretation, but may be more robust to the missing data characteristic of GBS datasets (Wallace et al. 2015), and was chosen for this reason. For the second approach, the number of population clusters and individual population assignments were inferred using the non-model, linear-kernel PCA-based method implemented in PSIKO 1.0 (Popescu et al. 2014). This method produces results comparable to those generated by the model-based approach implemented by the de facto standard programs

STRUCTURE (Pritchard et al. 2000) and ADMIXTURE (Alexander et al. 2009), but with the advantages of minimal underlying assumptions (particularly in not assuming the presence of

Hardy-Weinberg equilibrium within population clusters) and superior computational speed

(Popescu et al. 2014). Finally, the potential for spatial structure was investigated using the package MEMGENE 1.0 (Galpern et al. 2014) for R 2.3.5 (R Core team, 2016) in R Studio

1.0.136 (RStudio team, 2015). Combining Moran eigenvector maps with multivariate regression, this approach is both more powerful and more appropriate for testing spatial patterns in genetic data than the more commonly used Mantel tests (Galpern et al. 2014, Legendre et al. 2015). The genetic distance matrix used was based on probability of identity by state on a pairwise basis between individuals, generated with default settings in TASSEL 5.2.33 (Bradbury et al. 2007).

Tests were run for 10,000 forward permutations, alpha = 0.05, and default settings for all other options.

Levels of observed and expected heterozygosity were calculated for each SNP locus across individuals using the polyfreqs function in the R package polyfreqs 1.0.2 (Blischak et al.

2016), which is designed to accurately impute heterozygosity rates for autopolyploid organisms from low coverage next-generation sequencing data. Raw read counts used as input for the package were manually extracted from the final SNP dataset output by Step 7 of the GBS-SNP-

CROP pipeline previously described. Analyses were run for 100,000 iterations, discarding the first 250,000 for burn-in, and sampling every 100 iterations. The mean value for each locus was calculated across retained sampling points, and the multilocus heterozygosity calculated as a simple mean of these values. Adequacy of model fit was assessed using the polyfreqs_pps function in polyfreqs, and did not indicate any violation of assumptions or lack of model fit.

Population-wide selfing rate was estimated using the multilocus identity disequilibrium based method implemented in RMES (David et al. 2007).

Results and Discussion

The CAPS assay used for species identification showed no known diploid haplotypes

(S. australis, S. ryanii, or S. lax) present in any of the individuals sampled (data not shown), strongly implying that all the individuals sampled are tetraploid. The assay does not allow

discrimination between S. tragus and S. paulsenii haplotypes, but given the prevalence and

completeness of hybridization observed between the two species in areas of range overlap (Hrusa

and Gaskin 2008, Beatley 1972, Rilke 1999), it is assumed that distinction between these species

is unlikely to be biologically important. The four individuals that were positively identified by

Sanger sequencing in development of the CAPS assay all had S. tragus haplotypes previously identified by Gaskin et al. (2006) (data not shown). Thus, all individuals sampled appear to be

S. tragus sensu lato (used here to indicate tetraploid individuals including genetic material from

S. tragus sensu stricto and potentially from S. paulsenii as well). Correspondingly, it appears that

S. australis, S. ryanii, and S. lax are rare or absent in the inland PNW. This is consistent with the expectations of Hrusa and Gaskin (2008), who noted that S. australis tends to be limited to lower elevation habitats in California with mild winters and only rare freezes, and speculated that its

North American distribution might be similarly restricted.

Libraries were initially combined for genotyping and SNP calling, however, when this was done both MDS and PSIKO analyses indicated spurious population structure clearly driven by library composition. Two sub-groups were identified with membership corresponding almost completely to library composition (data not shown). Resultantly, libraries could not be combined and parallel analyses were conducted on each. As library composition did not correspond to collection locations (Figure 2.1) or any other systematic division of the collection, the two libraries were considered as technical replicates. Results of all analyses were qualitatively identical between libraries. The genotyping and SNP calling pipeline identified 1,039 high confidence bi-allelic SNPs for Library 1, and 1,095 high confidence bi-allelic SNPs for Library 2

(Table 2.1).

No population structure was indicated by any of the analyses used. MDS plots do not

suggest any particular clustering or differentiation within the sample (Figure 2.1), and PSIKO

identified a single population cluster as the optimal model for both libraries (data not shown).

The spatial analysis conducted in MEMGENE clearly indicated a lack of spatial structure.

Adjusted r2 values generated by this method can be directly interpreted as the proportion of

genetic variability explained by spatial factors (Galpern et al. 2014) and were very low: -0.008

for Library 1 and -0.009 for Library 2. These values are consistent with expectations for a single

population under panmictic equilibrium (Galpern et al. 2014).

Expected multilocus heterozygosity across all individuals was 0.349 for Library 1

(95% highest posterior density (hpd) interval 0.347 to 0.351), and 0.360 for Library 2 (95% hpd

interval 0.359 to 0.362). Observed multilocus heterozygosity was slightly lower at 0.302 for

Library 1 and 0.320 for Library 2 (95% hpd intervals 0.302 to 0.303 and 0.319 to 0.321,

respectively). On a per locus basis, the general heterozygote deficiency is also apparent,

however, there are a sizeable number of loci exhibiting higher than expected heterozygosity

(Figure 2.3). Population wide selfing rates were estimated at 0.06 +- SE of 0.03 for Library 1, and 0.02 +- SE of 0.02 for Library 2. While these values indicate that Russian-thistle populations in the inland Pacific Northwest are predominantly outcrossing, selfing is not especially rare and is speculated to be the most likely explanation for loci with large heterozygote deficiencies. Loci with excess heterozygosity can result from several causes, and it is unknown which may be important here. Erroneous grouping of paralogous sites into single loci during SNP calling can increase estimates of heterozygosity by misidentifying fixed heterozygosity across invariant paralogues as true heterozygosity at a single variant site (Harvey et al. 2015). The GBS-SNP-

CROP pipeline is designed to be robust against such artifacts in polyploid genomes (Melo et al.

2106), and the relevant user specified variables were also chosen to be conservative in this regard. Given these precautions it is assumed that such artifacts are not the major cause of the observed pattern, but this cannot be determined with certainty. Biological causes of higher than expected levels of heterozygosity that seem plausible include: recent merging of two populations that were divergent at these loci (as might be expected between separate introductions from distinct source localities, or hybridization between weakly differentiated species such as S. tragus and S. paulsenii), balancing selection, or selection for excess heterozygosity by strong heterozygosity-fitness correlations in some regions of the genome.

Although there are not a large number of published studies using RAD-seq or similar techniques that address overall genetic diversity using estimates of multilocus SNP heterozygosity in plant species, comparison with the few that are available indicates that genetic diversity is relatively high in sampled Russian-thistle populations. Using a ddRAD-seq protocol,

Clark et al. (2016) found expected multilocus heterozygosity of 0.14 in wild populations of

Miscanthus sacchariflorus (Maxim.) Franch. collected across eastern Russia, which they interpreted as reflective of high genetic diversity. Expected multi-locus heterozygosity of approximately 0.38 was found across a diverse sample including both Mesoamerican and

Andean gene pools of common bean (Phaseolus vulgaris L.) using a 384 locus SNP chip with

RAD-seq developed markers (Valdisser et al. 2016). Within gene pools, levels of expected heterozygosity were substantially lower, at approximately 0.16 in each geographic group

(Valdisser et al. 2016). Syring et al. (2016), found observed multilocus heterozygosity for SNP markers developed by targeted capture sequencing of between 0.18 and 0.23 across North

American collections of whitebark pine (Pinus albicaulis Engelm.). Finally, Filippi et al. (2015), found expected multilocus heterozygosity of 0.29 across an association mapping panel of

domesticated sunflower inbred lines using a 384 locus SNP-chip. (As would be expected, actual heterozygosity was extremely low within inbred lines, but for calculation of expected multilocus heterozygosity on a population basis, the mapping panel collectively represents relatively high levels of genetic diversity).

The phenotypic diversity within the collection of Russian-thistle is also consistent with high levels of genetic diversity within the population, and with a lack of population structure.

During field collections and particularly in observation of the collection in a common garden setting, a wide range of divergent phenotypes was noted (J Spring, unpublished data). In addition to these highly divergent phenotypes, however, there also appeared to be a full range of intermediate forms between extremes for all traits examined (Figure 2.4). This apparent gradation in most variable morphological traits precluded attempts to separate the collection into groups on any phenotypic basis, and is likely indicative of a complex, polygenic basis for most of these traits.

Across methods, results indicate the presence of a single species of Russian-thistle

(Salsola tragus sensu lato) in the inland Pacific Northwest, existing as a genetically diverse, single population without structure or sub-division. While unexpected, this conclusion does not seem biologically infeasible. Russian-thistle is known for its long range tumbleweed dispersal, and studies conducted in the inland Pacific Northwest found that plants traveled and dispersed seed over maximum distances of approximately 3 to 4 km during a six week period in late fall

(Stallings et al. 1995). Pollen dispersal and movement of mature seed-bearing plants on vehicles and equipment should also contribute to increase dispersal ability, although this has not been explicitly investigated. Taken together, it is assumed that migration rates are high across the region, which could prevent development of population structure or quickly homogenize

40 populations that were differentiated at the time of introduction. Additionally, Russian-thistle is ubiquitous and highly abundant across the region and it is assumed that effective population size is quite high. Large effective population size coupled with migration can maintain genetic diversity and minimize the effects of drift, selection, and other forces that produce population differentiation and structure (Leinonen et al. 2013). Similar population dynamics and patterns of largely unstructured genetic diversity on regional scales were found in weedy waterhemp

(Amaranthus tuberculatus var. rudis (Moq.) Sauerlarge) populations in the Midwest (Waselkov and Olsen 2014), and for kochia (Kochia scoparia (L.) Schrad.) in North Dakota (Mengistu and

Messersmith 2002).

Without discernable population structure, it appears that the observed variability in herbicide efficacy within Russian-thistle populations cannot be explained by such structure as was initially hypothesized. While there is almost certainly at least some degree of genetic influence on individual plant response to herbicides, the current study did not provide any means to effectively investigate this response. Additionally, in the absence of population subunits that are both easily characterized by gross phenotypic characters or similar means, and strongly associated with the causal genetic factors underlying the variability in response to herbicides, it does not seem likely that such an effect (even if present and of biologically meaningful magnitude) can be practically exploited as the basis for improved herbicide use recommendations.

The conclusion that Russian-thistle exists as a single, genetically diverse, panmictic population across the inland PNW emphasizes the need to consider management of the species at a regional scale. While most, if not all, agronomic weed management in the area is planned and conducted at a single-field scale, the conceptual basis for landscape scale management explicitly

considering the evolutionary ecology of specific weed populations is compelling (Menalled et al.

2016), and especially pertinent to Russian-thistle. Particularly in the context of herbicide

resistance, the biological processes relevant to selection and spread of resistance in this

population appear to operate at a regional scale, which uncoordinated field scale management

efforts are fundamentally unable to address. The rapid spread of chlorsulfuron-resistance in

Russian-thistle in the region – five years from first detection to widespread occurrence (Stallings et al. 1994) – is strongly suggestive of the importance of regional-scale processes in the spread of

herbicide resistance. Glyphosate resistance has recently been discovered at several locations in

the region (Kumar et al. 2017, Barosso et al. 2017), and poses a major concern. If management of glyphosate resistance is to be successful, both previous evidence and the understanding of

Russian-thistle biology resulting from this work conclusively emphasize the need for regional coordination of management and control efforts.

From a theoretical standpoint, high levels of genetic diversity have been hypothesized to increase the adaptive potential of weed populations to selection pressures imposed by agricultural systems (Jordan and Jannink 1997, Clements et al. 2004), particularly in the evolution of herbicide resistance (Délye et al. 2013, Neve et al. 2014, Vigueira et al. 2013). The picture of the Russian-thistle population developed by this study – with relatively high levels of standing genetic diversity, lack of neutral population structure (which can confound attempts to characterize adaptive genetic divergence), and observed variability in response to easily manipulated, strong selection pressure via herbicides – suggest that this population might hold promise as a study system suited to empirical testing of this hypothesis in future research.

Despite the cryptic, species-level genetic diversity present in Russian-thistle populations

in California and the high degree of phenotypic diversity present in populations of Russian-

thistle in the dryland wheat-fallow cropping region of the Inland Pacific Northwest, only a single

species (Salsola tragus sensu lato) was found in the region. Although high levels of genetic

diversity are present, no evidence for population structure or subdivision was found. While this

does not appear promising for immediate development of improved herbicide use

recommendations, it points to a strong need for coordinated, regional-scale management of

Russian-thistle in the inland Pacific Northwest.

Literature Cited

Alexander DH, Novembre J, Lange K (2009) Fast model-based estimation of ancestry in unrelated individuals. Genome Res. 19:1655-1664

Andrews KR, Good JM, Miller MR, Luikart G, Hohenlohe PA (2016) Harnessing the power of RADseq for ecological and evolutionary genomics. Nat. Rev. Genet. 17:81–92

Valdisser PAMR, Pappas GJ, de Menezes IPP, Müller BSF, Pereira WJ, Narciso MG, Brondani C, Souza TLPO, Borba TCO, Vianello RP (2016) SNP discovery in common bean by restriction-associated DNA (RAD) sequencing for genetic diversity and population structure analysis. Mol. Genet. Genomics 291:1277–1291

Arnold HL (1972) An analysis of the taxonomic status of a new taxon in the genus Salsola. PhD Dissertation. Logan, UT: Utah State University.

Ayres D, Ryan FJ, Grotkopp E, Bailey J, Gaskin J (2009) Tumbleweed (Salsola, section Kali) species and speciation in California. Biol. Invasions 11:1175–1187

Barroso J, Gourlie JA, Lutcher LK, Liu M, Mallory-Smith CA (2017) Identification of glyphosate resistance in Salsola tragus in north-eastern Oregon. Pest. Manag. Sci. 10.1002/ps.4525

Beatley JC (1973) Russian thistle (Salsola) species in Western United States. J. Range Manag. 26:225–226.

Beckie HJ, Francis A (2009) The biology of Canadian weeds. 65. Salsola tragus L.(Updated). Can. J. Plant Sci. 89:775–789

Blischak PD, Kubatko LS, Wolfe AD (2016) Accounting for genotype uncertainty in the estimation of allele frequencies in autopolyploids. Mol. Ecol. Res. 16:742–754

Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114-2120

Bradbury PJ, Zhang Z, Kroon DE, Casstevens TM, Ramdoss Y, Buckler ES (2007) TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics 23:2633-2635.

Bruckart W, Cavin C, Vajna L, Schwarczinger I, Ryan FJ (2004) Differential susceptibility of Russian thistle accessions to Colletotrichum gloeosporioides. Biol. Control 30:306–311

Burrell AM, Pepper AE, Hodnett G, Goolsby JA, Overholt WA, Racelis AE, Diaz R, Klein PE (2015) Exploring origins, invasion history and genetic diversity of Imperata cylindrica (L.) P. Beauv. (Cogongrass) in the United States using genotyping by sequencing. Mol. Ecol. 24:2177-2193

Chinnock RJ (2010) Some observations on Salsola L. (Chenopodiaceae) in Australia. J. Adelaide Bot. Gard. 24:75–79

Clark LV, Dzyubenko E, Dzyubenko N, Bagmet L, Sabitov A, Chebukin P, Johnson DA, Kjeldsen JB, Petersen KK, Jørgensen U, Yoo JH, Heo K, Yu CY, Zhao H, Jin X, Peng J, Yamada T, Sacks EJ (2016) Ecological characteristics and in situ genetic associations for yield-component traits of wild Miscanthus from eastern Russia. Ann. Bot. 118:941–955

Clements DR, DiTommaso A, Jordan N, Booth BD, Cardina J, Doohan D, Mohler CL, Murphy SD, Swanton CJ (2004) Adaptability of plants invading North American cropland. Agr. Ecosys. Environ. 104:379–398

Cornille A, Salcedo A, Kryvokhyzha D, Glémin S, Holm K, Wright SI, Lascoux M (2016) Genomic signature of successful colonization of Eurasia by the allopolyploid shepherd’s purse (Capsella bursa-pastoris). Mol. Ecol. 25:616–629

Davey JW, Hohenlohe PA, Etter PD, Boone JQ, Catchen JM, Blaxter ML (2011) Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Nat. Rev. Genet. 12:499–510

David P, Pujol B, Viard F, Castella V, Goudet V (2007) Reliable selfing rate estimates from imperfect population genetic data. Mol. Ecol. 16: 2474-2487

Délye C, Jasieniuk M, Le Corre V (2013) Deciphering the evolution of herbicide resistance in weeds. Trends Genet. 29:649–658

Filippi CV, Aguirre N, Rivas JG, Zubrzycki J, Puebla A, Cordes D, Moreno MV, Fusari CM, Alvarez D, Heinz RA, Hopp HE, Paniego NB, Lia VV (2015) Population structure and genetic diversity characterization of a sunflower association mapping population using SSR and SNP markers. BMC Plant Biol. 15:52

Galpern P, Peres-Neto PR, Polfus J, Manseau M (2014) MEMGENE: Spatial pattern detection in genetic distance data. Methods Ecol. Evol. 5:1116–1120

Gaskin JF, Ryan FJ, Hrusa GF, Londo JP (2006) Genotype diversity of Salsola tragus and potential origins of a previously unidentified invasive Salsola from California and Arizona. Madroño 53:244-251

Gaskin JF, Bon M-C, Cock MJW, Cristofaro M, Biase AD, De Clerck-Floate R, Ellison CA, Hinz HL, Hufbauer RA, Julien MH, Sforza R (2011) Applying molecular-based approaches to classical biological control of weeds. Biol. Control 58:1–21

Harvey MG, Judy CD, Seeholzer GF, Maley JM, Graves GR, Brumfield RT (2015) Similarity thresholds used in DNA sequence assembly from short reads can reduce the comparability of population histories across species. PeerJ 3: 10.7717/peerj.895

Heap JW (1993) Control of rush skeletonweed (Chondrilla juncea) with herbicides. Weed Technol. 7:954–959.

Jordan NR, Jannink JL (1997) Assessing the practical importance of weed evolution: a research agenda. Weed Res. 37:237–246

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Mentjies P, Drummond A (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649

Kumar V, Spring JF, Lyon DJ, Burke IC, Jha P (2017) Glyphosate-Resistant Russian thistle (Salsola tragus L.) Identified in Montana and Washington. Weed Technol. 31: 10.1017/wet.2016.32

Lawrence NC (2015) Adaptation to Climate Change and Small Grain Production Systems by Bromus tectorum. Ph.D. Dissertation. Pullman, WA: Washington State University.

Lee MAB, Brothers T (1981) Seed dispersal in hybrid Salsola. Great Basin Nat. 41:370–376

Legendre P, Fortin M-J, Borcard D (2015) Should the Mantel test be used in spatial analysis? Methods Ecol. Evol. 6:1239–1247

Leinonen T, McCairns RJS, O’Hara RB, Merilä J (2013) QST–FST comparisons: evolutionary and ecological insights from genomic heterogeneity. Nat. Rev. Genet. 14:179–190

Lutcher LK (2015) Delayed Glyphosate Application for No-Till Fallow in the Driest Region of the Inland Pacific Northwest. Weed Technol. 29:707–715

Marinier E, Brown DG, McConkey BJ (2015) Pollux: platform independent error correction of single and mixed genomes. BMC Bioinformatics 15: 10.1186/s12859-014-0435-6

Martin M (2011) Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17: http://journal.embnet.org/index.php/embnetjournal/article/view/200

Mascher M, Wu S, Amand PS, Stein N, Poland J (2013) Application of Genotyping-by- Sequencing on Semiconductor Sequencing Platforms: A Comparison of Genetic and Reference-Based Marker Ordering in Barley. PLoS ONE8:10.1371/journal.pone.0076925

Menalled F, Peterson R, Smith R, Curran W, Páez D, Maxwell B (2016) The Eco-Evolutionary Imperative: Revisiting Weed Management in the Midst of an Herbicide Resistance Crisis. Sustainability 8:10.3390/su8121297

Mengistu LW, Messersmith CG (2002) Genetic diversity of kochia. Weed Sci. 50:498–503

Mosyaksin SL (2003) Salsola. In N. Morin, (ed.), Flora of North America V. 4:398–403. Oxford University Press, New York, NY.

Melo AT, Bartaula R, Hale I (2016) GBS-SNP-CROP: a reference-optional pipeline for SNP discovery and plant germplasm characterization using variable length, paired-end genotyping-by-sequencing data. BMC Bioinformatics 17: 10.1186/s12859-016-0879-y

Narum SR, Buerkle CA, Davey JW, Miller MR, Hohenlohe PA (2013) Genotyping-by- sequencing in ecological and conservation genomics. Mol. Ecol. 22:2841–2847

Neve P, Busi R, Renton M, Vila-Aiub MM (2014) Expanding the eco-evolutionary context of herbicide resistance research. Pest Manag. Sci. 70:1385–1393

Peterson BK, Weber JN, Kay EH, Fisher HS, Hoekstra HE (2012) Double Digest RADseq: An Inexpensive Method for De Novo SNP Discovery and Genotyping in Model and Non- Model Species. PLoS ONE 7:e37135

Popescu A-A, Harper AL, Trick M, Bancroft I, Huber KT (2014) A Novel and Fast Approach for Population Structure Inference Using Kernel-PCA and Optimization. Genetics 198:1421–1431

Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945-959.

R Core Team (2016) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https://www.R-project.org/.

Reynolds HC, Launchbaugh JL (1977) Russian Thistle in Northwest Kansas. Trans Kansas Acad Sci. 81:170.

Rilke S (1999) Revision der Sektion Salsola s.l. der Gattung Salsola (Chenopodiaceae). Bibliotheca Botanica 149:1–190

RStudio Team (2015) RStudio: Integrated Development for R. RStudio, Inc., Boston, MA URL http://www.rstudio.com/

Ryan FJ, Ayres DR (2000) Molecular markers indicate two cryptic, genetically divergent populations of Russian thistle (Salsola tragus) in California. Can. J. Bot. 78:59–67

Schillinger WF, Young FL (2000) Soil water use and growth of Russian thistle after wheat harvest. Agron. J. 92:167–172

Sobhian R, Ryan FJ, Khamraev A, Pitcairn MJ, Bell DE (2003) DNA phenotyping to find a natural enemy in Uzbekistan for California biotypes of Salsola tragus L. Biol. Control 28:222–228

Stallings GP, Thill DC, Mallory-Smith CA (1994) Sulfonylurea-resistant Russian Thistle (Salsola iberica) survey in Washington State. Weed Technol. 8:258-264

Stallings GP, Thill DC, Mallory-Smith CA, Lass LW (1995) Plant movement and seed dispersal of Russian thistle (Salsola iberica). Weed Sci. 43:63–69

Syring JV, Tennessen JA, Jennings TN, Wegrzyn J, Scelfo-Dalbey C, Cronn R (2016) Targeted Capture Sequencing in Whitebark Pine Reveals Range-Wide Demographic and Adaptive Patterns Despite Challenges of a Large, Repetitive Genome. Frontiers in Plant Sci. 7: 10.3389/fpls.2016.00484

Vigueira CC, Olsen KM, Caicedo AL (2013) The red queen in the corn: agricultural weeds as models of rapid adaptive evolution. Heredity 110:303–311

Wallace JG, Upadhyaya HD, Vetriventhan M, Buckler ES, Tom Hash C, Ramu P (2015) The Genetic Makeup of a Global Barnyard Millet Germplasm Collection. The Plant Genome 8: doi:10.3835/plantgenome2014.10.0067

Ward SM, Reid SD, Harrington J, Sutton J, Beck KG (2008) Genetic Variation in Invasive Populations of Yellow Toadflax (Linaria vulgaris) in the Western United States. Weed Sci. 56:394–399

Waselkov KE, Olsen KM (2014) Population genetics and origin of the native North American agricultural weed waterhemp (Amaranthus tuberculatus; Amaranthaceae). Am. J. Bot. 101:1726–1736

Welles SR, Ellstrand NC (2016) Rapid range expansion of a newly formed allopolyploid weed in the genus Salsola. Am. J. Bot. 103:663–667

Young FL (1986) Russian thistle (Salsola iberica) growth and development in wheat (Triticum aestivum). Weed Sci. 34:901–905

Young FL (1988) Effect of Russian thistle (Salsola iberica) interference on spring wheat (Triticum aestivum). Weed Sci. 36:594–598

Tables and Figures

Table 2.1. Selected summary metrics for SNP datasets.

Library 1 Library 2

Number of SNPS 1039 1095

Mean read depth per site 76 66

Mean proportion missing by site 0.06 0.08

Mean proportion missing by individual 0.06 0.08

Figure 2.1. Approximate locations of sampling points.

Figure 2.2. Multidimensional scaling plots. Each point represents an individual plant.

Figure 2.3. Per locus estimates of observed versus expected heterozygosity. Points below the line show loci exhibiting population-wide heterozygote deficiency, and points above show loci with population-wide heterozygote excess relative to expectations. Each point represents an individual locus.

Figure 2.4. Divergent and intermediate individual phenotypes observed in common garden cultivation of collection. A and B represent relative extremes in gross phenotype for overall plant ‘leafiness’, while C and D are representative of the relatively continuous range of variation between the extremes. Similar patterns were exhibited in all variable phenotypic traits observed across the collection.

CHAPTER 3: Glyphosate Resistant Russian-thistle in Washington State

The vast majority of growers using any reduced tillage or no-till cropping system in the inland Pacific Northwest (PNW) have relied primarily – and many exclusively – on glyphosate for non-selective post-emergence weed control over the past 10 or more years. The unique combination of comparatively low cost, control of nearly all agronomic weeds in the region, systemic action, complete lack of soil residual activity and rotational restrictions, and reliably high efficacy all contribute to both the heavy reliance on glyphosate, and the lack of truly viable alternative herbicides. Resultantly, glyphosate has been applied to most dryland crop hectares in the region at least once a season, every year for the last decade. It is used almost exclusively for control of weeds and volunteer crops prior to planting and is overwhelmingly the most common herbicide applied to chemical fallow. When applications are made for pre-harvest desiccation of crops or weeds or for post-harvest weed control, glyphosate is again the most commonly selected option. Typical use rates of glyphosate range from 0.80 to 1.2 kg ae ha-1 for young, actively growing weeds. When difficult conditions are anticipated ( such as unfavorable weather or large

weeds) rates as high as 2.4 kg ae ha-1 are not uncommon. Although most applicators include

appropriate surfactants recommended for the formulation of glyphosate used, very few choose to

tank-mix with a second mechanism of action. Some growers will combine a second herbicide

(primarily 2,4-D or another synthetic auxin, or less commonly paraquat) with glyphosate in

fallow, particularly later in the season when control of problematic broadleaf weeds becomes

more difficult. In this case, the intent of tank mixing is increased efficacy, not reduced selection

pressure for resistance through use of multiple mechanisms of action. Altered management to

proactively address herbicide resistance is not common in the region, probably due more to

economic disincentive to employ best practices such as tank mixing or herbicide rotation than to

lack of awareness on the part of crop managers.

Resistance to glyphosate is common worldwide (Heap 2016), but despite the history of

heavy use in the inland PNW, neither current scientific nor anecdotal evidence suggests that

glyphosate resistance is widespread in the region (Heap 2016, I. Burke, unpublished data).

Isolated cases of suspected glyphosate resistance have recently been reported, however, and

suggest that at least some glyphosate resistance is likely present. In 2015, glyphosate applied at a

typical field use rate of 1.2 kg ae ha -1 failed to effectively control a population of Russian-thistle in southeastern Washington state. Dose-response assays were conducted on offspring from this population under greenhouse and field conditions to confirm the presence of glyphosate resistance and to estimate the magnitude of resistance.

Materials and Methods

Plant Material

Plants from the resistant (R) population were collected from a chemical fallow field in

Columbia County, WA in June 2015. An application of glyphosate at 1.2 kg ae ha-1 plus appropriate surfactants made to the field 20 days prior to collection had failed to control a large number of Russian-thistle plants. Control of all other weed species in the field (primarily downy brome (Bromus tectorum L.), and pigweed species (Amaranthus spp.) was excellent – failure to

control Russian-thistle was clearly not a result of application error. At the time of collection,

plants were approximately 10 to 15 cm in height and 10 cm in diameter. No herbicide

symptomology was visually apparent on any of the surviving plants observed. Twelve individual

plants were dug up with approximately 5 L of surrounding soil and transplanted to the USDA-

ARS Palouse Conservation Field Station near Pullman, WA for the remainder of the growing

season. Prior to flowering, plants were reproductively isolated using mesh pollen bags

(manufacturer unknown, bags consisted of stamped translucent plastic mesh with opening

diameter of approximately 0.25 mm, outside dimensions of 20 x 30 cm, closed on three sides, the

fourth side was closed around plants by folding and stapling). Seeds were harvested from the

four surviving individuals at the end of the growing season in mid-October 2015, and maintained

as four separate accessions (designated ‘R1’ through ‘R4’) for dose-response assays.

Seeds from a population collected in the vicinity of Anatone, WA were used as a susceptible check (S) population. Mature seeds were collected from two individual plants at this location in December 2013. Offspring of these two plants (and others collected elsewhere in

WA) were cultivated in a common garden experiment on the WSU Spillman Agronomy Farm near Pullman, WA in 2014 (J. Spring, unpublished data). These plants were reproductively isolated as previously described, and the two seed lots descended from a single progeny of each of the initially collected individuals were used as the susceptible check accessions. The seed lot from one individual was used in greenhouse experiments. Due to limited seed availability, the seed lot from the second individual was used in the field experiments. Individuals from both seed lots exhibited a mid-range susceptible response to glyphosate in unrelated field trials conducted in 2015 (J. Spring, unpublished data).

Greenhouse Dose-response Assay

A dose-response assay was conducted in the WSU Plant Growth Facilities in Pullman,

WA from January through March 2016 in a greenhouse with supplementary daytime lighting of

400 μmols m-2 for a 16 h photoperiod and approximately 28/20 C day/night temperature cycle.

Seeds were overplanted into 66 mL (2.54 cm diameter x 16 cm depth) pots (Ray Leach Cone- tainer™, Steuwe and Sons, Inc., Tangent, OR), containing peat-based growing medium

(Sungro™ Professional Growing Mix, Sungro Horticulture Distribution Inc., Agawan, MA), and thinned to one plant per pot after emergence. Plants were watered over the top of the containers

as needed throughout experiment. Ten individual plants of each accession were used at each

herbicide rate. Plants were sprayed in an air-pressurized indoor spray cabinet (Generation III

Research Sprayer, DeVries Manufacturing Corp, Hollandale, MN) calibrated to deliver

140 L ha-1 total spray volume with a single 8002E flat fan nozzle (Teejet Spraying Systems Co.,

Wheaton, IL) at 172 kPa when they reached a height of 6 to 10 cm (4 weeks after planting).

Glyphosate was applied as Roundup Original (Monsanto, St. Louis, MO) in distilled water plus

0.5% v/v NIS (R11, Wilbur-Ellis Company, San Francisco, CA) at 13 rates (0.03, 0.06, 0.11,

0.22, 0.45, 0.79, 1.2, 1.8, 2.3, 2.8, 3.6, 4.5, and 5.6 kg ae ha-1) plus a nontreated check. Following

application, plants were randomized by rate (but not accession or replicate [individual plant])

into trays. Position and orientation of trays were rearranged bi-weekly in an attempt to avoid

introduction of artifacts from greenhouse location. Above-ground biomass was harvested at 4

weeks after treatment (WAT), dried for 48 hours at 60 C, and weighed.

Field Dose-response Assays

Dose-response assays were conducted under field conditions at two locations in June

through August 2016. One trial was conducted at the WSU Lind Dryland Research Station near

Lind, WA (47°00’12.5” N 118°34’18.1” W) and the second conducted at the ARS Palouse

Conservation Field Station near Pullman, WA (46°45’26.8” N, 117°11’47.5” W). The soil at the

Lind site is a Ritzville silt loam (coarse-silty, mixed, superactive, mesic Calcidic Haploxeroll).

The experiment was placed in a conventionally tilled summer fallow field (primary tillage with a sweep plow at a depth of approximately 15 to 20 cm, followed by secondary tillage with a rodweeder at a depth of approximately 10 cm). The soil at the Pullman site is a Thatuna silt loam

(fine-silty, mixed, superactive, mesic Oxyaquic Argixeroll). Site preparation in Pullman

consisted of thoroughly rototilling standing winter wheat stubble from the preceding year to a

depth of approximately 15 cm.

Seed of accession R1 used in the greenhouse dose-response assays were started in the

previously described greenhouse by overplanting into 42 x 42 mm Jiffy Peat Pellets (Jiffy

Products of America Inc., Lorain, OH) and thinning to 1 plant per pellet following emergence.

The observed response to glyphosate in greenhouse dose-response experiments was very similar across R accessions, so only a single accession was used in field trials. Established plants were transplanted by hand to field locations in mid-June at 16 (Lind) or 21 (Pullman) days after planting. Experiments were arranged as a 5 x 5 Latin square design for each accession, placed immediately adjacent to one another in the field. Individual plots within a study were arranged in a grid with 1.5 m center to center spacing. An individual plot consisted of four individual plants in a square array, each one approximately 8 cm from the center point of the plot. Immediately following transplant, approximately 0.2 L of water was applied to each plant. After this initial watering, existing soil moisture was adequate to sustain vigorous growth of plants at both locations and occasional hand weeding was the only maintenance performed. Plants were sprayed at 4 weeks after transplanting at both sites. Plants were approximately 12 to 18 cm in height and 10 to 15 cm in circumference at this time. Glyphosate (Glystar Original, Albaugh

LLC, Ankeny IA) was applied at 4 rates: 0.4, 0.8, 1.7, and 3.3 kg ae ha-1, plus a nontreated

check. All applications included 0.5% v/v NIS (M90, The McGregor Company, Colfax, WA)

-1 and 14 g L ammonium sulfate. Applications were made using a CO2-powered hand boom with

two 110015XRAI flat fan nozzles (Teejet Spraying Systems Co., Wheaton, IL) at 30 cm spacing,

calibrated to deliver 94 L ha-1 at 138 kPa. Aboveground biomass was harvested at 4 WAT,

placed in paper bags, and dried to constant final mass in a closed greenhouse in Pullman, WA

(approximately 10 d time to final mass, day/night temperatures of 67/21 C, ± 10/5 C). Mean dry

biomass was calculated for each plot (using individual plants within a plot as subsamples), and

this number was used for statistical analyses.

Data Analysis

Separate dose response curves were generated from dry biomass data for each accession

in each experiment using log logistic analysis implemented with the package drc 2.5-12 (Ritz and Streibig 2005) in R 3.2.5 (R Core Team 2016) using RStudio 0.99.896 (RStudio team,

2015). Dose response curves were fitted using the 4 parameter log logistic function:

( ) ( ) = + 1 + exp( (log ( ) ) 𝑑𝑑 − 𝑐𝑐 𝑓𝑓 𝑥𝑥 𝑐𝑐 Where e is the herbicide dose producing a response half𝑏𝑏 -way𝑥𝑥 between− 𝑒𝑒 the upper limit, d, and

lower limit, c. This dose is equivalent to the rate predicted to cause a 50% reduction in growth

relative to nontreated controls, or the GR50. The parameter b denotes the relative slope around e, and x is the dose. The lower limit c was bounded at zero to prevent negative estimates of dry weight. Lack-of-fit tests were conducted for each model using the cumulated residuals approach recommended by Ritz and Martinussen (2011) implemented with the function lin.test in drc. In cases where the initial model did not fit on the basis of this test, a Box-Cox transformation of the initial model was implemented in drc and successfully resolved lack-of-fit issues in all such cases. Robust standard error estimates were obtained using the R package sandwich 2.3-4

(Zeileis 2004, Zeileis 2006) following the example of Ritz et al. (2015). The Resistance Index

(RI) is calculated by dividing the GR50 value of the R accession(s) by the GR50 value of the S

accession within each site.

Results and Discussion

Results from both greenhouse and field experiments confirm the presence of meaningful levels of glyphosate resistance in the R accessions. In the initial greenhouse experiment, R

accessions ranged from 3.5- to 4.2-fold resistant compared to the S accession on the basis of the

calculated RI (data not shown). Field experiments demonstrated the presence of appreciable

resistance in the R accession at both locations, although the magnitude of expressed resistance appeared to be heavily influenced by environment.

At the Lind site, the R accession was 8.3-fold resistant to glyphosate relative to the S accession; with a GR50 value slightly exceeding twice a reference 1x field use rate (1.2 kg ae ha-1) of glyphosate (Table 2.). All treated R individuals survived the highest tested rate of

glyphosate (3.3kg ae ha-1) at the Lind location (Figure 1) and would have continued growth for the remainder of the season if not harvested. This level of resistance would clearly be of major

management importance in a field weed management context.

At the Pullman site, both the R and S accessions were much more susceptible to

glyphosate than they were at Lind. The S accession was so susceptible that all tested rates

resulted in complete plant death by less than 1 WAT (data not shown). Without intermediate

responses (i.e. between the nontreated control rate and rates resulting in complete plant death) a

suitably fitting response curve could not be modelled for the S accession. Making the assumption

that the GR50 value for the accession lies midway between 0 and the lowest tested rate (0.4 kg ae

-1 -1 ha ) gives a crudely estimated GR50 value of 0.2 kg ae ha for the S accession. (As this assumes

a linear, rather than the more likely log-logistic relationship between the rates it likely over-

estimates the GR50 value, but in the absence of any data from this rate range such a conservative estimate seems preferable.) Using this value, the R accession would be 2.5-fold resistant to

glyphosate. More importantly, the R accession survived the reference 1x field use rate of

glyphosate at Pullman while the S accession was easily controlled by a 1/2x rate (Figure 1.).

Although substantially lower than the magnitude of resistance expressed at the Lind site, this

level of resistance would still be highly problematic in a field crop production setting.

The large difference observed in the magnitude of expressed resistance to glyphosate

between the two locations is attributed to differences in temperature (and possibly moisture)

conditions, with Lind being substantially warmer and drier than Pullman for the duration of the

trial (Table 3.). Expression of glyphosate resistance has been found to be sensitive to temperature

in several species. Kleinman et al. (2015) found that a shift from low- to high-temperature growing conditions resulted in a 6- to 8-fold increase in the estimated GR50 for accessions of

several Conyza spp. (in both glyphosate resistant and susceptible biotypes). Additional research

in Conyza canadensis (L.) Cronquist found a marked decline of glyphosate resistance at lower

temperatures, to such a degree that a population that was resistant to agronomic use rates of

glyphosate in field experiments during hot weather became susceptible during cool weather (Ge

et al. 2010). Similarly, substantially higher GR50 values were observed in glyphosate resistant

populations of Echinochloa colona (L.) Link. at higher relative to lower temperature regimes

(Nguyen et al. 2015). It is important for crop managers to be aware of this strong effect of

temperature on the magnitude of expressed glyphosate resistance to avoid potential confusion or

misunderstanding regarding the presence or magnitude of resistance expressed across variable

weather conditions.

While the resistant accessions were collected from a single site and do not provide any

information on the geographic extent of resistance, several historical examples indicate that

glyphosate-resistant Russian-thistle could spread rapidly and should be taken seriously by crop

managers across the PNW. The first is the rapid spread of chlorsulfuron-resistant Russian-thistle in Washington. Chlorsulfuron was introduced for broadleaf weed control in winter wheat in the mid 1980s, and initially provided excellent control of Russian-thistle (Young and Gealy 1986). A resistant population was first identified in a production field in 1987 and experimentally confirmed to be resistant by 1989 (Stallings et al. 1994). By 1992, a survey of Russian-thistle in

Washington found that 70% of sampled Russian-thistle populations were resistant to chlorsulfuron (Stallings et al. 1994). While the relative importance of independent evolution of resistant populations at separate locations versus the spread of resistant alleles from location(s) of origin is unknown, it is likely that both were important, particularly given the long-range dispersal mechanisms and outcrossing breeding system of Russian-thistle. The second example is the origin and spread of glyphosate resistant kochia (Kochia scoparia L.) in the western Great

Plains. A glyphosate-resistant accession of kochia was confirmed in a single chemical-fallow field in western Kansas in 2007 (Waite et al. 2013) and spread rapidly. Glyphosate-resistant kochia was widespread across western Kansas by 2012, and problematic across nine US Great

Plains states and three Canadian provinces by 2014 (Godar and Stahlmann 2015). Again, the importance of independent evolution of resistance is unknown, but dispersal of resistant plants across the landscape by the tumbleweed habit of kochia was certainly a major factor in this expansion. Kochia and Russian-thistle share similar ecological niches, outcrossing breeding

systems, and long-range dispersal as tumbleweeds (Friesen et al. 2009, Beckie and Francis

2009), making it likely that the rate of spread of glyphosate resistance in PNW Russian-thistle could closely match that of kochia in the Great Plains.

In 2015, the source population for the resistant accession of Russian-thistle was satisfactorily controlled in the field with a labelled rate of 2,4-D, and further issues with

glyphosate resistance were not observed in 2016. In a greenhouse discriminating dose screening,

the glyphosate resistant accession did not display resistance to representative herbicides

belonging to WSSA Mechanism of Action Groups 4, 6, 10, 14, 22, or 27 (Kumar et al. 2017), but

was resistant to Group 2 (ALS inhibitor) herbicides. Viable alternative herbicide choices for

control of glyphosate resistant populations are available within these groups for spring and

winter wheat (Lyon and Barroso 2016, Morishita and Lyon 2016), and chemical fallow (Macnab

2016). Tillage offers another option for integrated control in fallow.

Resistance to glyphosate in Russian-thistle populations is clearly present in the inland

PNW. While the current geographical extent of the problem is unknown, relevant historical evidence suggests that spread of resistance across the region may be very rapid (on the order of 5 to 8 years from initial detection to widespread occurrence). Crop managers and other stakeholders should be aware of the problem, and also that the magnitude of resistance expressed is likely modulated by temperature, with lower levels of apparent resistance at lower temperatures or during years with cooler weather. This interaction should not be confused with the absence or elimination of resistant populations. Field managers should be vigilant for the possibility of glyphosate resistance in Russian-thistle and should respond pro-actively and aggressively to cases of suspected resistance as they are detected. Adoption of herbicide stewardship measures such as herbicide rotation (i.e. away from glyphosate when possible), tank mixing additional mechanisms of action with glyphosate, and use of integrated control systems should also be considered. If proactive resistance management is uniformly implemented across the region, it is still possible that the efficacy of glyphosate may be preserved – or at least prolonged – for control of Russian-thistle in the PNW.

Literature Cited

Beckie HJ, Francis A (2009) The biology of Canadian weeds. 65. Salsola tragus L.(updated). Can. J. Plant Sci. 89:775–789

Friesen LF, Beckie HJ, Warwick SI, Van Acker RC (2009) The biology of Canadian weeds. 138. Kochia scoparia (L.) Schrad. Can. J. Plant Sci. 89:141–167

Ge X, d’Avignon DA, Ackerman JJ, Duncan B, Spaur MB, Sammons RD (2011) Glyphosate- resistant horseweed made sensitive to glyphosate: low-temperature suppression of glyphosate vacuolar sequestration revealed by 31P NMR. Pest Manag. Sci. 67:1215–1221

Godar AS, Stahlman PW (2015) Consultant’s perspective on the evolution and management of glyphosate-resistant Kochia (Kochia scoparia) in western Kansas. Weed Technol. 29:318–328

Heap, I. The International Survey of Herbicide Resistant Weeds. Online. Internet. Thursday, October 27, 2016 . Available www.weedscience.org

Kleinman, Z, Ben-Ami G, Rubin B (2016) From sensitivity to resistance - factors affecting the response of Conyza spp. to glyphosate. Pest Manag. Sci. 72:1681–1688

Kumar V, Spring JF, Lyon DJ, Burke IC, Jha P (2017) Glyphosate-Resistant Russian thistle (Salsola tragus L.) Identified in Montana and Washington. Weed Technol. 31: 10.1017/wet.2016.32

Lyon D, Barroso J (2016) Winter Wheat. In: Peachey E., ed. Pacific Northwest Weed Management Handbook. Corvallis, OR: Oregon State University. D-18 to D-28

Macnab, S (2016) Chemical Fallow. In: Peachey E., ed. Pacific Northwest Weed Management Handbook. Corvallis, OR: Oregon State University. D-64 to D-66

Morishita D, Lyon D (2016) Spring Wheat. In: Peachey E, ed. Pacific Northwest Weed Management Handbook. Corvallis, OR: Oregon State University. D-52 to D-63

Nguyen TH, Malone JM, Boutsalis P, Shirley N, Preston C (2016) Temperature influences the level of glyphosate resistance in barnyardgrass (Echinochloa colona). Pest Manag. Sci.72:1031–1039

R Core Team (2016). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https://www.R-project.org/.

RStudio Team (2015) RStudio: Integrated Development for R. RStudio, Inc., Boston, MA URL http://www.rstudio.com/

Ritz C, Martinussen T (2011) Lack-of-fit tests for assessing mean structures for continuous dose- response data. Environ. Ecol. Stat. 18:349–366

Ritz C, Baty F, Streibig JC, Gerhard D (2015) Dose-Response Analysis Using R. PLoS ONE 10: 10.1371/journal.pone.0146021

Stallings GP, Thill DC, Mallory-Smith C (1994) Sulfonylurea-Resistant Russian thistle (Salsola iberica) survey in Washington State. Weed Technol. 8:285–264

Waite J, Thompson CR, Peterson DE, Currie RS, Olson BLS, Stahlman PW, Al-Khatib K (2013) Differential kochia (Kochia scoparia) populations response to glyphosate. Weed Sci. 61:193–200

Young FL, Gealy DR (1986) Control of Russian thistle (Salsola iberica) with chlorsulfuron in a wheat (Triticum aestivum) summer-fallow rotation. Weed Sci. 318–324

Zeileis A (2004) Econometric Computing with HC and HAC Covariance Matrix Estimators. J. Stat. Software 11:1-17

Zeileis A (2006) Object-Oriented Computation of Sandwich Estimators. J. Stat. Software 16:1-16

Tables and Figures

Table 3.1. Parameter estimates ± standard errors for b, the relative slope at the inflection point, d, the upper limit, and e, the inflection point (equivalent to the dose required to reduce dry weight 50%, or the GR50) of the fitted lines for the greenhouse dose-response experiments.

Slope (b) Upper Limit (d) GR50(e) R1 2.3 ± 0.4 0.23 ± 0.01 3.3 ± 0.7 R2 1.8 ± 0.3 0.23 ± 0.01 3.8 ± 1.0 R3 3.2 ± 1.2 0.22 ± 0.01 3.2 ± 0.5 R4 2.2 ± 0.6 0.21 ± 0.01 3.6 ± 1.4 S 3.2 ± 0.2 0.28 ± 0.01 0.9 ± 0.1

Table 3.2. Parameter estimates ± standard errors for b, the relative slope at the inflection point, d, the upper limit, and e, the inflection point (equivalent to the dose required to reduce dry weight 50%, or the GR50) of the fitted lines for field dose-response experiments.

Slope (b) Upper Limit (d) GR50(e) R 1.3 ± 0.7 118 ± 12 2.5 ± 1.1 Lind S 2.4 ± 1.8 149 ± 14 0.3 ± 0.1

R 3.0 ± 0.7 152 ± 16 0.5 ± 0.1 PCFS S *------* An adequate line could not be fit to the observed data.

Table 3.3. Selected weather summary metrics for trial sites from planting through harvest (June 16 to August 11 at Lind, and June 21 to August 16 at Pullman). Lind Pullman Mean daily air temperature (C) 20.5 18.3 Mean daily soil temperature at 20 cm (C) 23.4 19.5 GDD accumulation (10 C base) 561 439 Total precipitation (mm) 19.3 30.5 Mean daily relative humidity (%) 46 56 Mean daily reference evapotranspiration (mm) 6.3 4.9 Total reference evapotranspiration (mm) 361 285

Figure 3.1. Photos of field dose-response trials 4 WAT, showing only first row of trial. Within a site the susceptible accession (S) is shown above, and the resistant (R), below. Rates from left to right within each photo are: 0.4, 0.8, 0 (non-treated check), 3.3, and 1.7 kg ae ha-1.

CHAPTER 4: Tank Mixes of Glyphosate and Soil Residual Herbicides for

Extended Control of Russian-thistle in Chemical-Fallow

Weed control in chemical fallow in the dryland cropping systems of the inland Pacific

Northwest (PNW) relies heavily, and often exclusively, on glyphosate. Growers generally make three applications spread over the course of the fallow season, although four applications are not uncommon in years with prolonged periods of weed germination. Typical use rates for glyphosate in fallow range from 0.80 to 1.2 kg ae ha-1. Other herbicides (primarily 2,4-D or paraquat) are occasionally tank-mixed with glyphosate or applied alone, but the vast majority of herbicide applications made to fallow consist only of glyphosate plus appropriate surfactants.

Addition of an herbicide with soil residual activity to this very limited fallow herbicide program has the potential to provide several benefits. Glyphosate applications are generally made at 4 to 6 week intervals over the growing season, timed to provide a balance between preventing extensive growth of weeds that have emerged since the last application and allowing density of emerged weeds to reach levels that justify the investment made in a broadcast application. If an herbicide with pre-emergence (PRE) soil residual activity could be tank-mixed with the first glyphosate application of the year and provide adequate residual control for 8 to 12 weeks, it is likely that the total number of broadcast applications made over the season could be reduced by one, providing substantial savings in both glyphosate and application costs.

The first application of the fallow year is intended primarily for control of winter annual grass weeds (e.g. Bromus tectorum L.), most of which will have emerged by early spring.

Many growers, however, will delay this application until mid-spring when there is at least some emergence of spring and summer annual broadleaf species in an attempt to maximize the amount of control realized from a single glyphosate application. However, if later-emerging broadleaf

70 weeds could be reliably controlled by a PRE herbicide included with this first glyphosate application, application timing could be based solely on the growth stage of early emerging and winter annual weeds, potentially increasing efficacy.

Although there have not been a large number of studies investigating use of PRE herbicides in wheat-chemical fallow rotations, those that are available indicate that the approach holds promise for control of Russian-thistle and other broadleaf weeds. Prior to the evolution and spread of resistance, PRE applications of chlorsulfuron gave excellent control of Russian-thistle in the inland PNW (Young and Gealy 1986). Also in the inland PNW, sulfentrazone applied to chemical fallow early in the season provided excellent control of Russian-thistle and other broadleaf weeds (Sullivan et al. 2013). In the western Great Plains, where glyphosate-resistant kochia (Kochia scoparia L.) has forced the inclusion of non-glyphosate chemistries in chemical fallow herbicide programs, PRE herbicides have also satisfactorily controlled broadleaf weeds.

Sulfentrazone applied in early spring was found to control kochia for at least 12 weeks after treatment (WAT) in Montana chemical fallow fields (Kumar and Jha 2014). In western Kansas, sulfentrazone + pendimethalin (Currie and Geier 2016a) and sulfentrazone + metribuzin (Currie and Geier 2016b) controlled Russian-thistle for up to 20 WAT when applied to chemical fallow in early spring.

As Russian-thistle is commonly regarded as the most problematic broadleaf weed across the wheat-fallow zone of the PNW (Young and Thorne 2004, Schillinger et al. 1999) and is the primary weed emerging during the mid to late portions of the fallow season in most years

(Lutcher 2015) it was chosen as the target species for control. The recent discovery of Russian- thistle accessions resistant to glyphosate in the region (Barroso et al. 2017, Kumar et al. 2017) presents a specific challenge for control of this species, and highlights the general need for

effective options to manage glyphosate resistant weed populations as they occur. Additionally, it

emphasizes the need to pro-actively address the threat of future resistance by reducing the

intensity of selection for resistance that the current reliance on glyphosate imposes.

Field trials were conducted in 2016 at three sites across the wheat-fallow cropping zone of the inland PNW to evaluate several PRE herbicide formulations for efficacy as tank-mix

components included with the first annual application of glyphosate made to chemical fallow,

with the primary intent of extending the period of control of Russian-thistle obtained from this

application.

Materials and Methods

Field trials were conducted at three sites across eastern Washington in 2016: Lind,

Waterville, and Horse Heaven Hills. The Lind site was located on the Washington State

University Lind Dryland Research Station near Lind, WA (site location: 47°00’07” N

118°34’30” W). The soil at this site is a Ritzville silt loam (coarse-silty, mixed, superactive, mesic Calcidic Haploxeroll), with organic matter 1.3% and pH 6.3. The Waterville site was located approximately 14 km southeast of Waterville, WA (site location: 47°35’51” N

119°55’03” W). The soil at this site is a Sprauer ashy fine sandy loam (ashy, glassy, mesic

Vitritorrandic Durixeroll) with organic matter 2.4% and pH 5.6. The Horse Heaven Hills site was located approximately 6 km south-southwest of Benton City, WA (site location: 46°07’48” N

119°34’34” W). Soil at the site is a Shano silt loam (coarse-silty, mixed, superactive, mesic

Xeric Haplocambid) with organic matter 1.5% and pH 6.2. All sites are in long term no-till winter-wheat fallow production, and all were chemical fallow in 2016.

Trials were conducted using a randomized complete block design with 4 replications and individual plot size of 3 x 9 m. Ten herbicide treatments (Table 1) were applied using a

CO2-powered hand boom with four TT11002 Turbo Teejet nozzles (Teejet Spraying Systems

Co., Wheaton, IL) at 76 cm spacing, calibrated to deliver 94 L ha-1 at 172 kPa. Treatments were applied within 2 days of the first glyphosate application of the season made to the surrounding bulk field.

Counts of emerged Russian-thistle plants were recorded for whole plots at 3 week intervals, beginning at 6 weeks after treatment (WAT). At the Waterville site, prickly lettuce

(Lactuca serriola L.) was the major broadleaf weed species present and counts of prickly lettuce were also recorded. Counts were recorded until the third glyphosate application of the season was made to the bulk field surrounding the trial, at which point the trial was terminated.

Termination was at 15 WAT (Lind), 12 WAT (Horse Heaven Hills) or 11 WAT (Waterville).

A separate Analysis of Deviance was performed for each site on counts of emerged weeds made on the date of termination. Analyses were conducted with R 3.2.5 (R Core Team

2016) in R Studio 0.99.896 (RStudio team, 2015) with the glm.nb function in the package MASS

7.3-45 (Venables and Ripley 2002) using a generalized linear model with a negative binomial error distribution and a log link function. Herbicide treatment was modelled as a fixed factor.

Due to inadequate replication per site to support accurate modelling of block as a random factor

(Bolker et al. 2009), block was also treated as a fixed factor. A chi-square goodness of fit test based on residual deviance and degrees of freedom indicated that the negative binomial distribution adequately fit the data for all models. The optimal model was selected for each site using Likelihood Ratio tests between full (treatment + block as explanatory factors) and reduced models (treatment as only explanatory factor) with R’s anova function. Treatments were separated within sites using Tukey’s Multiple Comparison Procedure implemented in the package multcomp 1.4-6 (Hothorn et al. 2008).

Results and Discussion

Inclusion of PRE herbicides significantly reduced Russian-thistle emergence by the

time of trial termination relative to the glyphosate only control at Lind and Horse Heaven Hills

(Lind: Χ2 = 328 on 10 df, P < 0.01; Horse Heaven Hills: Χ2 = 33 on 10 df, P <0.01) and prickly lettuce emergence at the Waterville site (Χ2 =118 on 10 df, P < 0.01). Examination of the mean counts of emergence (Table 4.1), however, indicate that the importance of these reductions would be mixed in a management context.

At Lind, five treatments provided potentially meaningful reduction of Russian-thistle

emergence. Picloram at 134 g ae ha-1 allowed mean emergence of less than one plant per plot

(Table 4.1). In 3 of the 4 blocks, there was no Russian-thistle emergence in plots with this

treatment (data not shown), and in the remaining block it was noted that emerged plants were

spaced evenly down the center of the plot at intervals that appeared equal to the stride length of

the applicator. Soil disturbance caused by boot-heels during application may have disrupted the

herbicide treated layer of soil, allowing plants to germinate in these locations. If this speculation

is correct, the true efficacy of the treatment is likely higher than mean values indicate. Picloram

at 67 g ae ha-1, both rates of sulfentrazone, and both rates of sulfentrazone + metribuzin provided similar reduction of emergence, although mean values were more than 1 plant per plot

(Table 4.1). Given the low degree of replication and the relatively conservative nature of Tukey’s

Multiple Comparison Procedure, it is unclear whether this lack of significance represents a true

absence of treatment differences, or simply reflects low power (although the latter is suspected to

be at least partially involved). At the Horse Heaven Hills site, the magnitude of reduction in

emergence was inadequate to be of management importance. Treatments were similar at this site

(Table 4.1), with the best performing treatment allowing mean emergence of 7.6 Russian-thistle

plants per 3 x 9 m plot (1 plant per 3.6 m2), well in excess of any tolerable density of emerged

plants in fallow.

The marked difference between herbicide efficacy at these two sites is attributed to precipitation received after application, with Lind receiving substantially more than the Horse

Heaven Hills. Total precipitation during the trial period was 63 mm at Lind, compared to 26 mm in the Horse Heaven Hills. Additionally, a substantial regional rainfall event deposited 7 mm at

Lind 4 days after treatment (DAT), but only 3 mm at Horse Heaven Hills (then 2 DAT). This amount of precipitation was apparently adequate to activate the herbicides at Lind, but not at

Horse Heaven Hills. The Waterville site is also assumed to have received adequate precipitation to activate herbicides; a total of 47 mm fell during the trial period, including 20 mm in a single event 19 DAT.

Emergence of Russian-thistle at the Waterville site was much lower than anticipated when the trial was located. The trial site and the surrounding production field both had low and sporadic germination of Russian-thistle, precluding meaningful analysis for this species. A dense prickly lettuce (Lactuca serriola L.) population was present at the site, however, and treatment differences were evident for this species (Table 1.). Picloram at 134 g ae ha-1, and atrazine at 840

g ai ha-1 both reduced mean emergence to < 1 plant per plot. Metribuzin at 392 g ai ha-1 and

atrazine at 420 g ai ha-1 also substantially reduced emergence relative to the glyphosate only

control and other treatments. These four treatments were similar (Table 4.1), but as at Lind, this

may reflect low power rather than a lack of true treatment differences. Sulfentrazone did not

improve control of prickly lettuce relative to glyphosate alone (Table 4.1.). At the first rating

date, efficacy of glyphosate on emerged prickly lettuce plants was notably reduced in

sulfentrazone treatments relative to all others (data not shown), presumably due to antagonism of

75 glyphosate activity by sulfentrazone. It is not known if the relatively high counts in these treatments may have resulted at least partially from plants surviving the initial glyphosate application rather than inadequate preemergence efficacy of sulfentrazone on prickly lettuce.

Yenish and Eaton (2002) found that sulfentrazone at slightly higher rates controlled prickly lettuce in higher precipitation zones of the region in spring pea crops, further complicating interpretation.

At both sites that received adequate moisture, picloram at 167 g ae ha-1 provided control of Russian-thistle and prickly lettuce for 8 to 12 weeks, long enough that the overall number of glyphosate applications for the season could likely have been reduced (from three to two) in a whole field setting. Further testing is certainly warranted, and increased power through higher levels of replication in future trials should increase confidence in results. Sulfentrazone and sulfentrazone + metribuzin at the rates tested also seem to warrant further investigation for control of Russian-thistle, and atrazine and metribuzin for control of prickly lettuce.

The potential for carryover injury to subsequent crops is unknown for all but one of these herbicides at present, but of concern. In the Great Plains, picloram is labelled for use in fallow preceding winter wheat (Anonymous 2009a), however, no data is available for the PNW, and crop safety needs to be investigated. Additionally, a minimum of 36 months is necessary between application of picloram and cultivation of any broadleaf crop in areas where it is labeled

(Anonymous 2009a), posing substantial limitation to the use of picloram where flexibility to include broadleaf crops in the rotation is desired. Similarly, atrazine has a fallow use label preceding winter wheat in the western plains region (Anonymous 2009b), but has been observed to cause severe crop injury and stand loss in the PNW when used in this manner at rates

76 over 840 g ai ha-1 (Frank Young, unpublished data). Sulfentrazone is labeled for a 4 month rotational restriction to cereals (Anonymous 2011), but this interval may be longer in the drier areas of the PNW, and sporadic carryover injury was noted in the PNW by Sullivan et al. (2013).

A commercial premix of sulfentrazone + metribuzin is labelled for fallow use in Idaho and

Montana (Anonymous 2014a,b), also with a 4 month rotational restriction to wheat. Finally, metribuzin is labelled for fallow use in PNW wheat-fallow rotations at the tested rates, as well as post-emergence applications to wheat and barley (Anonymous 2014c) and likely poses negligible injury risk. Trial sites will be monitored into the crop grown in 2017 for potential crop injury.

Qualitatively inadequate efficacy of all treatments at the Horse Heaven Hills site raises an important consideration. If adequate precipitation is not received after applications are made

(as was the case at this site), efficacy of PRE herbicides will be severely compromised. While the timing of precipitation accumulation varies substantially from year to year, in general, the earlier in the year an application can be made, the better the chance of obtaining adequate precipitation to activate PRE herbicides will be (Table 4.2). Particularly in the drier portions of the crop fallow zone (such as the Horse Heaven Hills) where spring precipitation is often low and erratic, windows with acceptable conditions for glyphosate applications targeting winter annuals are not uncommon in late winter or early spring, and are frequently exploited by at least some growers

(Garrett Moon, personal communication). Applying PRE herbicides at this time could be an effective measure to reduce the risk of herbicide failure associated with inadequate precipitation following mid-spring applications. Herbicides applied at the typical timing for the first application to chemical fallow (early to mid-April) can be expected to receive, on average, only

25% of annual precipitation following application (Table 4.2). In contrast, herbicides applied in

November or December could be expected to receive 60 to 75% of annual totals after

77 application (Table 4.2). Additionally, the quantity of winter precipitation is generally less variable than that of spring precipitation, and this trend is expected to intensify under future climate scenarios (Mote and Salathé 2010). Earlier-than-customary spring applications (late

February to early March) might also increase the quantity of precipitation received, but with less disruption to typical field work patterns. Future trials will include a timing component to investigate the feasibility of this approach at drier sites.

Overall, the preliminary data provided by these trials indicate that several of the herbicides tested may represent viable options to add soil residual activity and an alternative mode of action to the glyphosate-only herbicide program currently used in most chemical fallow in the inland PNW. Further testing is warranted and trials have been initiated for the 2017 growing season.

Acknowledgements

The assistance of Bruce Sauer at the Lind Dryland Research Station is gratefully acknowledged, as is the generous donation of ground use for trial sites by Aaron and Owen

Viebrock (Waterville) and Garrett Moon (Horse Heaven Hills). Research support by a financial gift from the Benton County Crop Improvement Association and by the Camp Endowment Fund at Washington State University is also gratefully acknowledged.

Literature Cited

Anonymous (2009a) Tordon 22K herbicide product label. Label code D02-111-014. Dow AgroScience LLC, Indianapolis, IN. 13p.

Anonymous (2009b) AAtrex 4L herbicide product label. Label code SCP 497A-L38SS 0509. Syngenta Crop Protection, Greensborough NC. 24p.

Anonymous (2011). Spartan 4F herbicide product label. Label code Spartan 4F 04-01-11 Commercial. FMC Corporation, Philadelphia, PA. 14p.

Anonymous (2014a). Authority MTZ 24(C) SLN herbicide product label. Label code 030614. FMC Corporation, Philadelphia, PA. 1p.

Anonymous (2014b). Authority MTZ 24(C) SLN herbicide product label. Label code Fallow- KS-02-04-2014. FMC Corporation, Philadelphia, PA. 1p.

Anonymous (2014c) Tricor 4F herbicide product label. Label code 70506-68(081414-5106). United Phosphorous Inc., King of Prussia, PA. 40p.

Arguez A, Durre I, Applequist S, Squires M, Vose R, Yin X, Bilotta R (2010) NOAA's U.S. Climate Normals (1981-2010) [precipitation data for Lind 3 NE, WA, Prosser, WA, and Waterville, WA]. NOAA National Centers for Environmental Information. DOI:10.7289/V5PN93JP. Accessed 10/17/2016.

Barroso J, Gourlie JA, Lutcher LK, Liu M, Mallory-Smith CA (2017) Identification of glyphosate resistance in Salsola tragus in north-eastern Oregon. Pest Manag. Sci. 10.1002/ps.4525

Bolker BM, Brooks ME, Clark CJ, Geange SW, Poulsen JR, Stevens MHH, White J-SS (2009) Generalized linear mixed models: a practical guide for ecology and evolution. Trends Ecol. Evol. 24:127–135

Currie R, Geier P (2016a) Fallow weed control with preemergence applications of Clarity, atrazine, Spartan Guard, Sharpen, Zidua, and Corvus. Kansas Agricultural Experiment Station Research Reports 2:19

Currie R, Geier P (2016) Fallow weed control with preemergence applications of Balance Pro, Corvus, Banvel, atrazine, and Authority MTZ. Kansas Agricultural Experiment Station Research Reports 2:19

Hothorn T, Bretz F, Westfall P (2008) Simultaneous inference in general parametric models. Biometrical J. 50(3), 346--363.

Kumar V, Jha P (2015) Effective preemergence and postemergence herbicide programs for kochia control. Weed Technol. 29:24–34

Kumar V, Spring JF, Lyon DJ, Burke IC, Jha P (2017) Glyphosate-Resistant Russian thistle (Salsola tragus L.) Identified in Montana and Washington. Weed Technol. 31: 10.1017/wet.2016.32

Lutcher, LK (2015) Delayed glyphosate application for no-till fallow in the driest region of the inland Pacific Northwest. Weed Technol. 29:707–715

Mote, PW, EP Salathé (2010) Future climate in the Pacific Northwest. Climatic Change 102:29–50

R Core Team (2016) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https://www.R-project.org/.

RStudio Team (2015) RStudio: Integrated Development for R. RStudio, Inc., Boston, MA URL http://www.rstudio.com/

Schillinger, WF, RI Papendick, RJ Veseth, FL Young (1999) Russian thistle skeletons provide residue in wheat-fallow cropping systems. J. Soil Water Cons. 54:506–509

Sullivan LS, Young FL, Smiley RW, Alldredge JR (2013) Weed and disease incidence in no-till facultative wheat in the Pacific Northwest, USA. Crop Prot. 53:132–138

Venables WN, Ripley B D (2002) Modern applied statistics with S. Fourth Edition. Springer, New York. ISBN 0-387-95457-0

Yenish JP, Eaton NA (2002) Weed control in dry pea (Pisum sativum) under conventional and no-tillage systems. Weed Technol. 16:88–95

Young FL, Gealy DR (1986) Control of Russian thistle (Salsola iberica) with chlorsulfuron in a wheat (Triticum aestivum) summer-fallow rotation. Weed Sci. 318–324

Tables and Figures

Table 4.1. Herbicide treatments, and mean counts ± standard errors of emerged Russian-thistle and prickly lettuce plants per 3 x 9 m plot at the time of trial termination.

a All treatments included glyphosate at 1260 g ae ha-1 plus dry ammonium sulfate at 15g L-1. b Within the same column, means followed by the same letter are not significantly different according to Tukey’s Multiple Comparison Procedure (experiment-wise α=0.05). c Herbicide formulations were: glyphosate as RT 3 (Monsanto Corporation, St. Louis, MO), metribuzin as Tricor 4F (United Phosphorous Inc., King of Prussia, PA), sulfentrazone as Spartan 4F (FMC Corporation, Philadelphia, PA), sulfentrazone + metribuzin as Authority MTZ (FMC Corporation), picloram as Tordon 22K (Dow AgroSciences, Indianapolis, IN), and atrazine as AAtrex 4L (Syngenta Crop Protection, Greensborough, NC).

Table 4.2. Mean monthly precipitation (mm) for the three trial sites (1981 to 2010 30-year normal values for the closest available station, data from Arguez et al. 2010). The cumulative proportion presented is a mean across sites, however, sites varied by a maximum of 0.05 over the year. Year ends in August, corresponding with seeding of crop or beginning of fallow cycle after harvest. Horse Heaven Lind Waterville Cumulative Proportion Hills

Sep 10 12 10 0.04

Oct 21 19 17 0.12

Nov 35 26 39 0.25

Dec 32 35 50 0.40

Jan 30 29 38 0.52

Feb 21 21 24 0.61

Mar 26 20 21 0.70

Apr 21 (22)* 18 (7) 16 0.77

May 21 (27) 18 (15) 27 (25) 0.86

Jun 15 (14) 19 (5) 26 (19) 0.93

Jul 9 5 13(3) 0.97 Aug 8 7 9 1.00 Total 248 227 290 - *Observed values for 2016 during the trial period (from application through termination) shown parenthetically.