[CANCER RESEARCH 52, 3353-3360, June 15, 1992] Expression of Cytokine Genes, Cytokine Receptor Genes, and Transcription Factors in Cultured Hodgkin and Reed-Sternberg Cells1

Hans-JürgenGruss, Marion A. Brach, Hans-GünterDrexler, Renate Bonifer, Roland H. Mertelsmann, and Friedhelm Herrmann2

Department of Internal Medicine I, University of Freiburg Medical Center, Freiburg [H-J. G.,M.A. B., R. B., R. H. M.,F. H.], and German Collection of Microorganisms and Cell Cultures [H-G. D.J, Braunschweig, Germany

ABSTRACT 2 for review). Various cell types have been proposed as the originators of HD including lymphoid cells (3-6), mononuclear In the present study, we show by Northern blot analysis and enzyme linked immunosorbent assay that the Hodgkin's disease (HD)-derived phagocytes (7-11 ), interdigitating reticulum cells (12), follicular cell lines HDLM-2 and KM-H2 express a variety of cytokine genes dentritic cells (13, 14), and granulopoietic cells (15). Unfortu either constitutively or upon induction with phorbol ester 12-O-tetrade- nately, the analysis of RS-H cells is hampered by the scarcity canoylphorbol-13-acetate. Cytokine genes expressed by HD-derived lines of this neoplastic component and contamination with bystander include granulocyte-macrophage colony-stimulating factor (( 'SI1'),mac- cells in HD-involved tissues. The advent of improved tissue rophage-CSF, interleukin (II,)-!-,». II -X IL-5, II -6, IL-8, leukemia culture methodology for the establishment of immortalized cell inhibitory factor, tumor necrosis factor-«,tumor necrosis factor-/?, and lines has enhanced the possibilities of studying neoplastic cells. transforming growth factor-/?, while transcripts and the corresponding Recently, a number of cell lines have been established from proteins for granulocyte-CSF, IL-1-/3, IL-2, IL-4, IL-7, IL-10, and the tissues or pleural effusions of patients with HD (16-21), mostly JE/macrophage chemoattractant and activating factor gene were not with the nodular sclerosis variant. These in vitro cultured cells detectable in cytoplasmic RNA and culture supernatants obtained from may represent the in vivo RS-H cells having identical or very both lines. In addition, IL-2 receptor (R) p55 and macrophage-CSF R (c- fmx) genes were expressed by both lines. HDLM-2, but not KM-H2 similar characteristic features. Therefore, they might be opera cells, exhibited the II -6 R p80 and the IL-2 R p75 chain. Analysis of tionally regarded as in vitro representatives of RS-H cells, nuclear proteins that bind to oligonucleotides containing the consensus although it has to be considered that cell lines cannot be derived sequences of the transcription factors activation protein 1, nuclear factor from the vast majority of cases of HD, and therefore, HD (NF) monocyte- genetic studies of rearrangements of the T-cell receptor and and B-cell-derived proteins. IV cross-linking experiments confirmed that immunoglobulin genes (23-26), have analyzed possible altera NF xB-binding proteins of M, 85,000, 75,000, and 50,000/55,000 were detectable in nuclear extracts obtained from T-cells and both HD lines, tions of the genomic structure and expression levels of certain while monocytes and B-cells displayed the M, 50,000/55,000 and 75,000 protooncogenes including those of the ras gene family (27, 28), NF *H complex only. Both HD lines also constitutively expressed tran of the c-myc gene (16, 29) and the c-fms gene (30, 31), and have scripts for i--fiisand c-jun, which are involved in heterodimeric formation also explored the presence of Ebstein-Barr virus DNA in RS- of the transcription factor activation protein 1, as well as for the NF «B/ H cells. In most of these studies, HD-derived cell lines were KBF1 gene. used. Despite these extensive efforts, there is still no consensus concerning either the etiology of HD or the identity of RS-H INTRODUCTION cells. Characterization of further features of HD-derived cell lines would thus be important in increasing our understanding HD3 is a malignant disorder morphologically characterized of HD. by the presence of multinucleated RS and the mononuclear H A number of features of HD are consistent with characteris cells in a stremai background consisting of lymphocytes, plasma tics of a tumor of cytokine-producing cells, including occurrence of "B" symptoms, of sclerosis, eosinophilia, and polycarion cells, histiocytic cells, and eosinophils (1). Both the etiology of HD and the precursor identity of its presumed malignant com formation. Several investigators have assessed the capacity of ponent, the RS and H cells, have remained uncertain (see Ref. RS-H cells to express cytokine genes. For instance, Paietta et al. (31) have shown that the L428 cell line, obtained from a Received 12/10/91; accepted 4/6/92. nodular sclerosis HD patient, disclosed transcripts for the M- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in CSF and its receptor, encoded by the c-fms protooncogene (32). accordance with 18 U.S.C. Section 1734 solely to indicate this fact. CSF secretion by cultured H-RS cells has also been shown by 1Supported by the Deutsche Krebshilfe. 2To whom requests for reprints should be addressed, at Department of Internal Burrichter et al. (33) and Byrne et al. (34). Naumovski et al. Medicine I. University of Freiburg Medical Center, Hugstetter Str. 55, D-7800 (35) have described secretion of IFN--y by the SUP-HD1 cell Freiburg i.Br., Germany. line. By means oíinsitu hybridization, transcripts for IL-5 were 3The abbreviations used are: HD, Hodgkin's disease; RS, Reed-Sternberg; H, Hodgkin; CSF, colony-stimulating factor; M-CSF, macrophage CSF; IFN. inter- detected in RS cells of primary HD tissues by Samoszuk and feron; TNF, tumor necrosis factor; GM-CSF, granulocyte-macrophage CSF; G- Nansen (36). Hsu et al. (37-39) have analyzed expression of CSF, granulocyte CSF; IL, interleukin; LIF, leukemia inhibitory factor; TGF, IL-1, TNF-a, and TNF-0 in the HDLM-1 and HDLM-ld transforming growth factor; JE/MCAF, JE/macrophage chemoattractant and Hodgkin lines (37-39). Similarly, Kretschmer et al. (40) have activating factor; cDNA complementary DNA; AP, activation protein; NF, nu clear factor; NFAT 1, nuclear factor of activated T-cells; EMSA, electrophoretic shown the ability of L428 and L540 Hodgkin cells to produce mobility shift assay; TPA, l2-O-tetradecanoylphorbol-13-acetate; moAb, mono TNF. TGF-/3 and IL-6 secretion by RS-H cells has also been clonal antibody; TCR, T-cell receptor; ATCC, American Type Culture Collection; SDS, sodium dodecyl sulfate; SSC, standard sodium citrate; IL-2R (IL-6R), IL- demonstrated in both cultured and primary Hodgkin tissues 2 (IL-6) receptor. (41-43). Also, expression of IL-9 by cultured and primary RS- 3353

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research. CYTOKINES IN HODGKIN'S DISEASE

H cells has been shown (44, 45). kilobase Taql/BanU fragment of pGEM4-hIL-6 (kindly provided by T. Given these first observations, the aim of the present study Hirano, University of Osaka, Osaka, Japan); IL-7, the 0.51-kilobase was to examine the spectrum of cytokines released by the two Pvull fragment of pGembl-hIL-7 (S. Gillis); IL-8, the 0,4-kilobase well-defined HD-derived permanent cell lines HDLM-2 (46) Bglll/EcoRl fragment of pBBG44 (British Bio-Technology, Oxford, and KM-H2 (47) in more detail. To this end, an extensive panel United Kingdom); IL-10, the 0.76-kilobase Bgm/Hindlll fragment of pcDSRa (kindly provided by P. Vieira, DNAX Research Institute of of cytokines was analyzed at the mRNA and protein levels, Molecular and Cellular Biology, Palo Alto, CA); JE/MCAF, the 0.74- including GM-CSF, G-CSF, M-CSF, IL-1-«and IL-1-/3, IL-2, kilobase Kpnl fragment of pGEM-hJE34 (kindly provided by B. Rollins, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, LIF, TNF-a, TNF-0, Dana-Farber Cancer Institute, Boston, MA); LIF, the 0.6-kilobase TGF-/3, IFN-7, the gene coding for the JE/MCAF protein, and ///nrfIII/£coRI fragment of pBBG 46 (British Bio-Technology); TNF- the early response genes c-jun and c-fos, known to be involved a, the 1.0-kilobase Psll fragment of pSP64-hTNF-a (kindly provided in cytokine signaling (48, 49). In addition, expression of the by G. Adolph, Boehringer International, Vienna, Austria); TNF-/3, the p55 IL-2R a and p75 ßchain,of the p80 IL-6R, and of the M- 0.6-kilobase Ndel/BgllI fragment of pBBGS (British Bio-Technology); CSF receptor (c-fms) was assessed by Northern blotting using IFN-7, the 0.7-kilobase AamHI fragment of pBR322-hIFN-7 (Genen- tech, San Francisco, CA); TGF-/J, the 1.04-kilobase £coRIfragment of specific cDNA probes. The presence of transcription factors known to bind to consensus sequences in regulatory 5'-flanking pSP 64 (Genentech); c-fms, the 1.23-kilobase £coRIfragment of pcfms 104 (ATCC); NF «B/KBF1,the 3.9-kilobase Noti insert of pBKS-«BFl regions of many cytokine genes (50), such as the AP 1, the NF (kindly provided by S. Gosh, Whitehead Institute, Cambridge, MA); c- *B, and the NFAT 1, previously shown to be a T-cell-specific jun, the 1.2-kilobase £coRI/fla/wHI fragment of pSK-hjun (ATCC); c- molecule (51), were analyzed in nuclear extracts of both cell fos, the 0.9-kilobase £o>RIfragment of pBR322-hfos (ATCC); IL-2R lines, of peripheral blood T-cells, T-cell leukemia lines, lym- a chain, the 0.9-kilobase EcoRl fragment of PSP65-hIL-2R (W. Si phoblastoid B-cell lines, and of monocytes by EMSA. kora); IL-2R ßchain,the 1.9-kilobase Sac\/BamH\ fragment of pUC 10-b30SB (kindly provided by A. Kawahara, Institute for Molecular and Cellular Biology, Osaka University, Osaka, Japan); IL-6R p80, the MATERIALS AND METHODS 1.7-kilobase Hindlll/Xba\ fragment of pIB176-hIL-6R (T. Hirano); Cell Lines and Culture Conditions. Mycoplasma-free HDLM-2 (46), and actin, the 0.8-kilobase BamHl/Pstl fragment of pBR322 chicken KM-H2 (47), embryonic lung fibroblast FH 109 (52), the T-cell leuke a-actin (kindly provided by J. Ramadori, University of Mainz, Mainz, mia lines Jurkat, Rex, and Molt-14 (kindly provided by S. Meuer, Germany). IL-1 a was probed with an oligonucleotide as previously German Cancer Research Center, Heidelberg, Germany), and the Ep- described (56). stein-Barr virus transformed B-lymphoblastoid cell lines LUNDAK Isolation of Total Cellular RNA and Northern Blot Analysis. Medium- or TPA-treated HDLM-2, KM-H2 cells, and FH109 lung fibroblasts, (53) and Laz 506 (kindly provided by S. Meuer) were grown in standard TPA (32 nM)/phytohemagglutinin (1 mg/mL)-activated T-lympho- culture medium [RPMI 1640 medium (GIBCO, Grand Island, NY) cytes, or TPA (32 nM)-activated blood monocytes were harvested by supplemented with 10% low endotoxin fetal calf serum (Hazelton, Vienna, UT), 2 miviL-glutamine, 1% penicillin/streptomycin (GIBCO)] centrifugation after the appropriate culture time. Cells were resus- at 37°Cina 5% CO2 atmosphere in air. Only cultures in the log phase pended in 0. l M sodium acetate, 1 mM EDTA, pH 5.2, then lysed with 0.5% SDS, and extracted with an equal volume of acetate/EDTA- of growth were investigated. In some experiments, cell lines were treated equilibrated phenol (60°C).This mixture was incubated at 60'C for 25 for 12-24 h with TPA (Sigma, Munich, Germany) at a concentration of 24 n\i. T-cells and monocytes were prepared as previously described min with frequent vortexing. The aqueous phase was recovered after in detail (54). centrifugation and extracted once with an equal volume of phenol/ chloroform and twice with chloroform. The resulting RNA was precip Cell Surface Immunophenotyping and Monoclonal Antibodies. Expres itated overnight at —¿20°Cwith2.5 vol'.'mes of ethanol. The total RNA sion of surface and nuclear markers was examined either by indirect from each sample was then electrophoresed in a 1% agarose gel con immunofluorescence using flow cytometry (FACS Star; Becton Dick taining 20 mM sodium borate, pH 8.3-0.5 mM EDTA-3% formalde inson, Sunnyvale, CA) or on fixed cytospin slides according to standard procedures (55). moAbs used in these studies included anti-CD2, -CD3, hyde. The RNA was then transferred to nitrocellulose paper (Schleicher -CD4, -CDS, -CD 10, -CD1 Ib, -CD 19 , -CD20, -CD21, -CD33, -CD71 and Schuell, Dassel, Germany) in lOx SSC (1.5 Msodium chloride and 150 mM sodium citrate) using capillary blotting overnight. The blots (from Coulter Electronics, Hialeah, FL), anti-CD 14, -CD 15, -CD34, were then backed and prehybridized at 65°Cin 7% SDS-1 Ox Den- HLA-DR (from Becton Dickinson), anti-CD30, KI-67 (kindly provided hardt's solution (Ix Denhardt's = 0.2% Ficoll-0.2% bovine serum by H. Stein, University of Berlin, Germany), polyclonal anti-human K albumin-0.02% polyvinylpyrolidine)-5x SSC-20 mM salmon sperm or Xlight-chain (from Tago, Burlingame, CA), anti-p55 IL-2R (CD25) DNA (Sigma). The blots were probed with specific cDNA probes moAb Tac (kindly provided by T. Waldman, National Institutes of radiolabeled by random priming with a [a-32P]CTP (>6000 Ci/mmol) Health, Bethesda, MD), anti-p75 IL-2R moAb (Oncogene Science, (Amersham, Arlington Heights, IL). Hybridization with oligonucleo- Inc., Manhasset, NY), and anti-p80 IL-6R moAb MT 18 (kindly tides were performed essentially as previously described (56). The blots provided by T. Hirano, Osaka University, Osaka, Japan). An moAb were washed at 55°Cin 1% SDS-lx SSC and were autoradiographed against the monomorphic portion of the TCR-/3 chain (BE-1) was kindly with Kodak XAR film (Eastman Kodak, Rochester, NY) at -70°Cwith provided by S. Meuer. an intensifying screen. cDNA Probes. For hybridization, the following specific cDNA probes Isolation of DNA and Southern Blot Analysis. Genomic high molec were used: GM-CSF, 1.0-kilobase Pstl fragment of pBR322-hGM-CSF ular weight DNA was isolated from HDLM-2 and KM-H2 cells, and (kindly provided by P. Habermann, Hoechst, Frankfurt, Germany); G- Southern analysis was performed according to standard procedures CSF, the 0.6-kilobase £coRI////m/III fragment of pUC8-hG-CSF (57). DNA probes were used to detect possible rearrangements of (kindly provided by L. Souza, Amgen, Thousand Oaks, CA); M-CSF, immunoglobulin heavy chain genes (Ag/II-restricted genomic DNA-JH the 1.0-kilobase Pstl/Bglll fragment of pUC18-hM-CSF (kindly pro probe), immunoglobulin light chain genes (£coRI-restricted genomic vided by P. Ralph, Cetus Corp., Emeryville, CA); IL-1-/3, the 0.6- DNA-Cx probe or fla/nHI-restricted genomic DNA-C. probe), and kilobase BamHl/Smal fragment of pYEpsecl-hIL-lb (ATCC, Rock- TCR-/3 genes (///m/III-restricted genomic DNA-Ttf probe). An M-CSF ville, MD); IL-2, the 0.7-kilobase £coRI fragment of PUC9-hIL-2 and c-fms probe (see above) were also used in Southern blot analysis of (kindly provided by W. Sikora, Medizinische Hochschule, Hannover, DNA digested with various restriction endonucleases (Bethesda Re Germany); IL-3, the 1.6-kilobase Hpal/Xhol fragment of pGembl-hlL- search Laboratory, Gaithersburg, MD). 3 (P. Habermann); IL-4, the 0.4-kilobase Pst\ fragment of pcD-hIL-4 Cytokine Determination in Culture Supernatants. Cell-free superna- (kindly provided by S. Gillis, Immunex Corp., Seattle, WA); IL-5, the tants of medium- or TPA (32 nM, 24 h)-treated cells were assessed for 0.9-kilobase BamHl fragment of phIL-5115.1 (ATCC); IL-6, the 0.55- GM-CSF, G-CSF, M-CSF, IL-l-a, IL-l-ß,IL-2, IL-3, IL-4, IL-6, IL- 3354

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research. CYTOKINES IN HODGKIN'S DISEASE

8, TNF-a, TNF-ft and TGF-/3 synthesis. Enzyme-linked immunoab- light-chain genes probed with fcoRI-digested genomic DNA- sorbent assay kits were purchased from the following suppliers and Cx or ÄamHI-digested genomic DNA-C. (not shown). performed as indicated by the manufacturer: R&D Systems, Minneap Constitutive Expression of Cytokine mRNA in HD-derived olis, MN (IL-l-a, IL-1-/3, IL-3, IL-4, IL-6, IL-8, TNF-«,and TNF-/3); Cell Lines. Next, the cell lines were tested for constitutive Amgen, Thousand Oaks, ÇA(G-CSF); Medical Resource Limited, mRNA production of a series of cytokines, cytokine-associated Darlington, Australia (GM-CSF); and Advanced Magnetics, Cam bridge, MA (IL-2). M-CSF synthesis was quantified using a murine protooncogenes, and cytokine receptors. As shown in Table 2, macrophage colony-forming assay as previously described in detail (54). expression of cytokine mRNA in both lines was heterogenous. In these experiments, recombinant human M-CSF (kindly provided by The spectrum of constitutive mRNA accumulation of HDLM- P. Ralph) served as an internal standard. TGF-/3 synthesis was analyzed 2 cells resembled that of activated T-cells, i.e., synthesis of by Western blotting. The TGF-/ÃŽdetection kit was obtained through transcripts for IL-l-a, IL-5, IL-6, LIF, TNF-a, and TNF-/3. Collaborative Research Inc., Bedford, MA. All manufacturers guaran Transcripts for the IL-2R p55 and p75 chains, the IL-6R p80 teed no cross-reactivity of the respective cytokine to be analyzed with other cytokines. Some samples required dilution up to 1:10 prior assay. Table 1 Immunophenotypic profile of HD-derived cell lines Extraction of Nuclear Proteins and Electrophoretic Mobility Shift Assay. Nuclear extracts were prepared from IO7cells by the method of Cluster designation" HDLM-2 KM-H2 Ohlsson and Edlund (58) with modifications as described in Ref. 59. CD2CD3CD4CDIOCDllbCD14CD1SCD19CD20CD21CD30CD33CD34HLA-DRKi-67CD71CD25IL-2R _— Protein concentrations were measured according to a standard protocol ++_ (60), and 10 ^g protein was used for EMSA. EMSA was performed __ using 10,000 cpm of the end-labeled double-stranded oligonucleotide _— (NF «B,TCGACAGAGGGGACTTTCCGAGAGGC; API, —¿++ ++_ GGGAGTCCGGCTGACTCATCAAGCT; NFAT1, GGGTTAAA- _— GAAAGGGGAAAAACTGTTTCA; the consensus binding sites are —¿+++ underlined) and 20 ng specific or nonspecific competitor oligonucleo tide. The components were incubated for 30 min at room temperature +++'+'++ before separation on a 5% polyacrylamide gel. The gels were dried and then exposed to Kodak XAR 5 films using an intensifying screen. ++++ UV Cross-Linking. UV cross-linking was performed as previously ++++ described (61). Briefly, the NF /cB oligonucleotide was continuously ++++ ++ labeled with the Klenow large fragment polymerase (Boehringer-Mann- p75IL-6R -+ heim, Germany) in the presence of 5 m\i dGTP-5 mM dATP (Boehrin- p80++*_ ger)-5 mM 5'-bromodeoxyuridine triphosphate (Sigma)-[«-"P]dCTP

(Amersham, Arlington Heights, IL). Nuclear proteins from treated TCR-/J chain monocytes, T-cells, HDLM-2 KM-H2, and Lundak B-cells were incu °As proposed by the workshops on human leukocyte differentiation antigens bated with 100 fmol continuously labeled oligonucleotide as described (Paris, France, 1982; Boston, MA, 1984; Oxford, United Kingdom, 1986). above and then subjected to UV irradiation (254 nm) for 20 min at * -, negative; +, 20-50% were positive; ++, >50% were positive. 4°C.Proteins were separated under reducing conditions on a 12% SDS ' Expression upon treatment with TPA only. gel. A rainbow marker (Amersham) was used as a size marker. The gel was dried and autoradiographed at —¿70°Cusingan intensifying screen. Table 2 Constitutive and TPA-inducible mRNA expression of selected cytokines, protooncogenes, and cytokine receptors by HD-derived cell lines RESULTS HDLM-2 KM-H2 TPA TPA Phenotypic and Genotypic Features of HD-derived Cell Lines. mRNA expression of Table 1 shows the phenotypic profile of HDLM-2 and KM-H2 GM-CSF cells. Both lines express CD 15, CD30, Ki-67, CD71, CD25, G-CSF and HLA-DR. In comparison to HDLM-2 cells, CD25 expres M-CSF IL-I-« sion in KM-H2 was weak and detectable in a minority of cells IL-I-/J only. Similarly, HDLM-2 cells exhibited the IL-2R ßchainon IL-2 IL-3 their surface, while KM-H2 cells did not. HDLM-2 cells were IL-4 stained with anti-CD2 but not with anti-CD4 moAb, while KM- IL-5 IL-6 H2 cells expressed CD4 but not CD2. Upon exposure to TPA IL-7 for 24 h, KM-H2 cells displayed binding sites for anti-CD33 IL-8 and anti-CD34 moAbs, while HDLM-2 cells did not. HDLM- IL-10 LIF 2 cells failed to react with anti-B-cell antibodies (CD 10, CD 19, TNF-a CD20, CD21, K,X).In contrast, KM-H2 cells stained positively TNF-0 TGF-/3 for the CD21 monoclonal antibody but were unlabeled by other IFN-7 anti-B-cell moAbs. IL-6R p80 surface expression was seen in a JE/MCAF subpopulation of HDLM-2 cells but not in KM-H2 cells. There NF«B c-jun was no difference in the morphological appearance of CD25- c-fos positive and -negative KM-H2 cells or of IL-6R p80-positive IL-2R p55 and -negative HDLM-2 cells. Analysis of gene rearrangements IL-2R p75 IL-6R p80 in DNA obtained from HDLM-2 cells revealed germline con c-fms figuration of the immunoglobulin heavy- and light-chain genes, " mRNA expression was assessed by Northern hybridization of cytoplasmic but the TCR-0 chain showed a biallelic rearrangement. Geno RNA (15 ng/lane) using specific cDNA probes. IL-I-«transcripts were detected typic analysis of KM-H2 cells demonstrated rearrangement of with a specific oligonucleotide probe. Absence of RNA degradation and com parable RNA loading in single lanes was confirmed by staining of rRNA in the immunoglobulin heavy-chain gene but not of the K and X ethidium bromide gels. 3355

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research. CYTOKINES IN HODGKIN'S DISEASE chain, c-jun, c-fos, and NF /cB were also synthesized. Unlike Table 3 Protein expression of selected cytokines by HD-derived cell lines activated T-cells, however, HDLM-2 cells failed to produce IL- All experiments were repeated three times and gave comparable results. The results show a representative experiment (mean values of triplicate cultures with 2, IL-4, IFN-7, IL-7, and IL-10 mRNA. Exposure to TPA also SD<10%). did not lead to expression of these genes. Detection of M-CSF 2TPA+<10° H2 and c-fms mRNA in both cell lines was surprising, because TPA-<10°170<25"macrophages and placenta tissue only. Recently, c-fms expres GM-CSF(pg/ml)M-CSF 757ISO sion was also identified in the HD-derived L428 line (31) and (units/ml)G-CSF 940<25° was interpreted as being indicative of the affiliation of RS-H (pg/ml)IL-l-a <25°<10° (pg/ml)IL-l-ff 39< cells with the phagocytic lineage. To determine whether c-fms (pg/ml)IL-2 0"<10°10° < 1 and M-CSF transcript synthesis by HDLM-2 and KM-H2 cells (pg/ml)IL-3 1000 units/mL of M- various genes that were not constitutively expressed by either CSF and >50 ng/mL of IL-6 in pilot experiments investigating line [GM-CSF, G-CSF, IL-l-ß,IL-2, IL-3, IL-4, IL-7, IL-8, IL the effect of M-CSF and IL-6 on growth of the myeloid leuke IO, and LIF (for KM-H2 cells only) and IFN-7, JE, IL-6R p80, mia WEHI 3BD* and the hybridoma B.9 cells. Cultures were and IL-2R p75] was investigated. To this end, HDLM-2 and performed for a period of 24, 48, and 72 h with [(H]thymidine KM-H2 were exposed to TPA (24 n\i) for 12 and 24 h. In all (37 mBq/well) being present for the last 6 h. The cells were experiments, cell viability in TPA treated cultures was >95% then collected onto glass fiber strips with a semiautomatic cell by trypan blue dye exclusion. As shown in Table 2, GM-CSF harvester (Cambridge Technology Inc., Cambridge, MA) and and IL-3 mRNA, albeit not constitutively expressed by either dried. The amount of ['H]thymidine incorporated into DNA cell line, was induced in HDLM-2 and KM-H2 cells by TPA. was determined by liquid scintillation counting. Since no dif LIF and IL-8, as well as IL-2R ßchain, mRNA not detectable ference in the cultures with or without anti-M-CSF or anti-IL- in unstimulated KM-H2 was inducible upon TPA treatment, as 6 moAbs could be detected (not shown), M-CSF and IL-6 may was IL-8 mRNA in HDLM-2 cells. TPA failed, however, to not have served as autocrine growth factors for either cell line, elicit synthesis of transcripts for G-CSF, IL-1-/3, IL-2, IL-4, IL- at least so far as the secreted form of these molecules is 7, IL-10, IFN-7, and JE/MCAF in both cell lines and also did concerned. However, internal association of the M-CSF and not induce IL-6R p80 mRNA expression in KM-H2 cells. IL-6R with their growth factors might be the mode of autocrine Identification of Proteins of Various Cytokines in Supernatants loop existent in the Hodgkin lines, but this was not investigated of Cultures of HD-derived Cell Lines. Given the finding of here. mRNA synthesis of various cytokines by HDLM-2 and KM- Assay of Nuclear Proteins Obtained from HD-derived Cell H2 cells, release of the corresponding proteins was assessed in Lines. Nuclear extracts from medium- or TPA (24 nM, 1 h)- cell-free culture supernatants of both lines. Cultures of HDLM- treated HDLM-2, KM-H2 cells, T-cells, LUNDAK B-cells, and 2 and KM-H2 cells were performed in the presence or absence monocytes were analyzed for the expression of the transcription of TPA (24 n\i) during a period of 24 h. Thereafter, cell-free factors AP 1, NFAT 1, and NF *B using EMSA (Table 4). culture supernatants were harvested and were subjected to HDLM-2 and KM-H2 cells constitutively produced a protein analysis of cytokine proteins by enzyme-linked immunoabsor- that bound an oligonucleotide containing the AP l consensus bent assay (GM-CSF, G-CSF, IL-1-«,IL-1-/3, IL-2, IL-3, IL-4, sequence from the collagenase enhancer. Both T-cells and IL-6, IL-8, TNF-a, and TNF-/3), biological assay (M-CSF), or HDLM-2 cells exhibited low AP 1-binding activity in an un Western blot analysis (TGF-/Õ).As shown in Table 3, HDLM- stimulated state that was enhanced upon exposure to TPA by 2 and KM-H2 cells secreted M-CSF, IL-6, TNF-«,and TNF-/Ö 7- to 8-fold and 3- to 4-fold, respectively. KM-H2 cells consti in the absence of TPA treatment. Upon exposure to TPA, tutively showed high AP 1-binding activity that was not further secretion of GM-CSF, IL-l-n, IL-3, and IL-8 protein became enhanced by TPA treatment. Normal peripheral blood T-cells, detectable. G-CSF, IL-1-/ÃŒ,IL-2,and IL-4 protein was, however, leukemic T-cell lines, and HDLM-2 and KM-H2 cells also not detectable in supernatants of HDLM-2 and KM-H2 cul displayed constitutive binding activity to an oligonucleotide tures irrespective of the presence or absence of TPA. containing the NFAT 1 consensus sequence, a nuclear factor Effect of Anti-M-CSF and Anti-IL-6 Antibody on Growth previously demonstrated to be T-cell specific. Binding was Characteristics of KM-H2 Cells. Since both cell lines coex- further enhanced in all T-cell types and HDLM-2 cells upon pressed M-CSF and its receptor and HDLM-2 cells exhibited exposure to TPA but was downregulated in KM-H2 cells after the IL-6R p80 chain and secreted IL-6, the possibility of auto- TPA treatment. Normal human monocytes and lymphoblastoid 3356

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research. CYTOKINES IN HODGKIN'S DISEASE

Table 4 Expression of transcription factors by HD-derived cell lines, T-cells, monocytes, and B-cells HDLM-2 KM-H2 T-cells Monocytes Epstein-Barr B-cells

Medium TPA Medium TPA Medium TPA Medium TPA Medium TPA AP-1 NF «B NFAT l 1-. no binding delectable; +. weak constitutive binding; ++. strong constitutive binding; +++, enhanced binding upon treatment with TPA (for 1 h. 24 nvi).

o O S SI* nnnn B

oi l g IIo 5 lu i Du l §5.» oc S.w oc o.We o 85 kD Fig. I. A, constitutive binding of NF »Bprotein isolated from untreated blood monocytes (Mo). HDLM-2, KM-H2. and T-cells (T). Nuclear proteins 75 kD (10 mg) obtained from these cells were incubated with an oligonucleotide containing the NF kB con sensus sequence in the absence (no competitor) or presence of 25-fold M excess of unlabeled NF «B oligonucleotide (specific competitor) or 25-fold M excess of an unlabeled unrelated oligonucleotide (not 55 kD shown). Arrowhead, unbound DNA. B, L'V cross- linking analysis of DNA-protein complexes formed with nuclear extracts obtained from T-cells (T), HDLM-2, KM-H2. and blood monocytes (Mo) with the NF «Boligonucleotide. Protein-DNA complexes were UV cross-linked in solution and then analyzed on a 12% SDS/poIyacrylamide gel under reducing conditions.

B-cell lines, however, failed to express a NFAT 1-binding three different nuclear proteins of M, 85,000, 75,000, and protein constitutively or in response to TPA or other stimuli 50,000. The same protein pattern was observed in T-cells, while including IL-1, TNF-a, and endotoxin (not shown). We also monocyte-derived nuclear proteins and nuclear proteins col analyzed for constitutive and inducible binding activity of the lected from the LUNDAK B-cell line (not shown) displayed the NF KB transcription factor. All cells investigated showed con M, 50,000/55,000 and 75,000 protein complex only and lacked stitutive NF *B-binding activity that could be further augmented the M, 85,000 moiety. by TPA (Table 4). Interestingly, however, retarded bands from monocytes, T-cells, K.M-H2, and HDLM-2-derived proteins DISCUSSION displayed differential migration pattern, suggesting size heter ogeneity of nuclear factors binding to the NF «Bconsensus We have shown the expression of a variety of cytokines (i.e., sequence (Fig. 1/4). For all cell types, binding was competed for GM-CSF, M-CSF, IL-1-a, IL-3, IL-5, IL-6, IL-8, LIF, TNF- by an unlabeled oligonucleotide carrying the NF *B-binding a, TNF-/3, TGF-/3, cytokine receptors (IL-2R p55 and p75, IL- site but not with an unrelated oligonucleotide (Fig. ÌA,anddata 6R p80, M-CSF receptor), cytokine-associated protooncogenes, not shown). We, therefore, sought to determine the molecular and transcription factors (NF xB, NFAT1, c-fos, and c-jun size of nuclear proteins binding to the NF «Boligonucleotide. which form the heterodimeric transcription factor AP 1) in To this end, UV cross-linking experiments were performed. As HD-derived cell lines. The lines we have investigated (HDLM- shown in Fig. \B, both HDLM-2 and KM-H2 cells exhibited 2 and KM-H2) can be regarded as representatives of the neo- 3357

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research. CYTOKINES IN HODGKIN'S DISEASE plastic component of HD based on many characteristics of scripts and express the p55 and p75 IL-2R chain on the cell "true" RS-H cells (46, 47, 64), although it has to be considered surface. The HDLM-2 cells produce mRNA of cytokines which that cell lines cannot be derived from the vast majority of cases are normally products of activated T-cells, including GM-CSF, of HD, and therefore, HD tumors that allow establishement of IL-3, IL-5, IL-6, LIF, and TNF-/3 (which has been found in cell lines may bear atypical features. To establish concordance lymphocytes only). High levels of IL-1-a were also recently between primary RS-H cells and those in the HD-derived cells found in activated T-cells (72). Similarly, also M-CSF expres lines and to establish a relationship between cytokine expression sion by activated T-cells has been reported (73). Clinical het by these cells and the pathophysiology of HD, future studies of erogeneity is apparent in HD, and thus, HD-derived cell lines the expression of the respective genes in primary HD-involved show heterogeneity. Extrapolation of the information gained tissues will be clearly needed. A direct comparison between the from KM-H2 cells would also support a T-cell origin rather primary tumor cells from which the cell lines were originally than an affiliation with the macrophage or B-cell lineage, al derived and both lines revealed, however, an almost identical though KM-H2 cells nonproductively rearrange the immuno- morphology, cytochemical staining profile, immunophenotype, globulin heavy-chain gene and display the B lineage-associated and genotype (46, 65, 66). CD21 antigen. Interestingly, both cell lines expressed the IL-8 Constitutional B symptoms, elevations of acute phase reac- gene, previously observed in monocytes and fibroblasts only. tants in the serum, the presence of mild thromobocytosis, or Other typical monocyte products such as IL-1-0, JE/MCAF, certain histopathological manifestations such as sclerosis, po- and G-CSF were, however, not detectable in cytoplasmic RNA lycarion formation, plasmacytosis, and eosinophilia are com of HDLM-2 and KM-H2 cells. Expression of c-fms by both cell mon features in active HD (l) and may relate to an abnormal lines must be ranked as abnormal. Aberrant expression of c- or unbalanced secretion of cytokines. Indeed, several of the fms has been reported in some solid tumor cells (32, 74, 75) cytokines identified here as products of RS-H cells exert bio and also in the HD-derived L428 line (31) and may be the logical effects that resemble distinct clinical and morphological result of an altered activation of the c-fms promoter. Neverthe features seen in HD. For instance, IL-6 is the major hepatocyte- less, restriction enzyme analysis of DNA obtained from both stimulating factor that induces release of acute phase proteins lines failed to disclose a gross DNA rearrangement of the c-fms (67). In addition, IL-6 exhibits thrombopoietin activity, an gene (and of the M-CSF gene). Therefore, we are currently activity shared by LIF (68), and induces terminal differentiation investigating the c-fms gene in KM-H2 in more detail by Sl- of B-lymphocytes into immunoglobulin-producing cells. Injec nuclease assay. tion of TNF-a and IL-1 can cause fever and sweats (69), clinical Both KM-H2 and HDLM-2 cells display a pattern of nuclear findings similar to B symptoms in HD. TNF-a also causes proteins binding to the NF

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research. CYTOKINES IN HODGKIN'S DISEASE

8. Kadin, M. E., Stiles, O. P., Levy, R.. and Warnke, R. Exogenous immuno- 33.Burrichter, H., Heit, W., Schaadt, M., Kirchner, H., and Diehl, V. Production globulin and the macrophage origin of Reed-Sternberg cells in Hodgkin's of colony-stimulating factors by Hodgkin cell lines. Int. J. Cancer, 31: 269- disease. N. Engl. J. Med., 299: 1208-1214, 1978. 274, 1983. 9. Kaplan, H. S., and Gartner, S. "Sternberg-Reed" giant cells of Hodgkin's 34.Byrne, P. V., Heit, W., and March, C. J. Human granulocyte-macrophage disease: cultivation in vitro, heterotransplantation, and characterization as colony-stimulating factor purified from a Hodkin's tumor cell line. Biochim. neoplastic macrophages. Int. J. Cancer, 19: 511-517, 1977. Biophys. Acta, 874: 266-273, 1986. 10. Hsu, S. M., and Hsu, P. L. Aberrant expression of T cell and B cell markers 35.Naumovski, L., Utz, P. J., Bergstrom, S. K., Morgan, R., Molina, A., Toóle, in myelocyte/monocyte/histiocyte-derived lymphoma and leukemia cells. Is J. J., Glader, B. E., McFall, P., Weiss, L. M., Warnke, R., and Smith, S. D. the infrequent expression of T/B cell markers sufficient to establish a lymph- SUP-HD1: a new Hodgkin's disease-derived cell line with lymphoid features oid origin for Hodgkin's Reed-Sternberg cells? Am. J. Pathol., 134: 203- produces interferon-7. Blood, 74: 2733-2739, 1989. 210, 1989. 36.Samoszuk, M., and Nansen, L. Detection of interleukin-5 messenger RNA 11. Hansmann, M. L., Radzun, H. J., Nebendahl, C., and Parwaresch, M. R. in Reed-Sternberg cells of Hodgkin's disease with eosinophilia. Blood, 75: Immunoelectronmicroscopic investigation of Hodgkin's disease with mono 13-18, 1990. clonal antibodies against histiocytes. Eur. J. Haematol., 40: 25-31, 1988. 37.Hsu, S. M., Krupen, K., and Lachman, L. B. Heterogeneity of interleukin 1 12. Kadin, M. E. Possible origin of the Reed-Sternberg cell from an interdigitat- production in cultured Reed-Sternberg cell lines HDLM-1, HDLM-ld and ing reticulum cell. Cancer Treat. Rep., 66: 601-608, 1982. KM-H2. Am. J. Pathol., 135: 33-38, 1989. 13. Fisher, R. J., Bostick-Bruton, F., Sauder, N., Scala, G., and Diehl, V. 38.Hsu, P. L., and Hsu, S. M. Production of tumor necrosis factor-a and Neoplastic cells obtained from Hodgkin's disease are potent stimulators of lymphotoxin by cells of Hodgkin's neoplastic cell lines HDLM-1 and KMH2. human primary mixed lymphocyte cultures. J. Immunol., 130: 2666-2673, Am. J. Pathol., 135: 735-745, 1989. 1983. 39.Hsu, S. M., and Zhao, X. Expression of interleukin-1 in Reed-Sternberg cells 14. Fisher, R. J., Cossman, J., Diehl, V., and Volkman, D. Y. Antigen presen and neoplastic cells from true histiocytic malignancies. Am. J. Pathol., 725: tation by Hodgkin's disease cells. J. Immunol., 135: 3568-3573, 1985. 221-225, 1986. 15. Stein, H., Uchanska-Ziegler. B., Gerdes, J., Ziegler, A., and Wernet, P. 40.Kretschmer, C, Jones, D. B., Morrison. K., Schlüter,C., Feist, W., Ulmer, Hodgkin's and Reed-Sternberg cells contain antigens specific to late cells of A. J., Arnoldi, J., Matthes, J., Diamantstein, T., Fiad, H. D., and Gerdes, J. granulopoiesis. Int. J. Cancer, 29: 283-290, 1982. Tumor necrosis factor alpha and lymphotoxin production in Hodgkin's 16. Athan, E. S., Paietta, E., Papenhausen. P. R., Augenlicht, L., Wiernik, P. disease. Am. J. Pathol., 137: 341-351, 1990. H., and Gallagher, R. E. Stability of multiple antigen receptor gene re 41.Newcom, S. R., Kadin. M. E., Ansari, A. A., and Diehl, V. L-428 nodular arrangements and immunophenotype in Hodgkin's disease-derived cell line sclerosing Hodgkin's cell secretes a unique transforming growth factor-beta L428 and variant subline L428KSA. Leukemia (Baltimore). 3: 505-511, active at physiologic pH. J. Clin. Invest., 82: 1915-1921, 1988. 1989. 42. Kadin, M. E., Agnarsson, B. A., Ellingsworth, L. R., and Newcom, S. R. 17. Diehl, V., Kirchner, H. H., Burrichter. H., Stein, H., Fonatsch, C., Gerdes, Immunohistochemical evidence of a role for transforming growth factor beta J., Schaadt, M., Heit, W., Uchanska-Ziegler, B., Ziegler, A., Heintz, H., and in the pathogenesis of nodular sclerosing Hodgkin's disease. Am. J. Pathol., Sueno, K. Characteristics of Hodgkin's disease-derived cell lines. Cancer 136: 1209-1214, 1990. Treat. Rep., 66: 615-622, 1982. 18. Olsson, L., Olav. B., Pleibel, N., D'Amore, F., Werdelin. O., Fry, K. E., and 43.Jücker,M., Abts, H., Li, W., Schindler, R., Merz, H.. Günther,A., von Kalle, C., Schaadt, M.. Diamantstein, T.. Feller, A. C., Krueger, G. R. F., Kaplan, H. S. Establishment and characterization of a cloned giant cell line from a patient with Hodgkin's disease. J. Nail. Cancer Inst., 73: 809-815, Diehl, V., Blankenstein, T., and Tesch, H. Expression of interleukin-6 and interleukin-6 receptors in Hodgkin disease derived cell lines. Blood, 77: 1984. 2413-2418. 1991. 19. Jones, D. B., Scott, C. S.. Wright, D. H., Stein, H., Beverley. P. C. L., Payne, 44,Merz, H., Houssiau, F. A., Orscheschek, K., Renauld, J. C. Fliedner, A.. S. V., and Crawford, D. H. Phenotypic analysis of an established cell line derived from a patient with Hodgkin's disease. Hematol. Oncol., 3:133-140, Herin, M., Noel, H., Kadin, M., Mueller-Hermelink, H. K., Van Snick, J., and Feller, A. C. Interleukin-9 expression in human malignant lymphomas: 1985. unique association with Hodgkin's disease and large cell anaplastic lym 20. Poppema, S., de Long, B.. Atmosverodjo, J., Idenburg, V., Visser, L., and phoma. Blood, 78: 1311-1317, 1991. de Ley, L. Morphologic, immunologie, enzyme, histochemical and chromo somal analysis of a cell line derived from Hodgkin's disease. Evidence for a 45 Gruss, H. J., Brach, M. A., Drexler, H. G., Bross, K. J.. and Herrmann, F. Interleukin 9 is expressed by primary and cultured Hodgkin and Reed- B-cell origin of Sternberg-Reed cells. Cancer (Phila.), 55:683-689, 1985. Sternberg cells. Cancer Res., 52: 1026-1031, 1992. 21. Schaadt, M., Fonatsch, C., Kirchner, H. H., and Diehl, V. Establishment of 46 Drexler, H. G., Gaedicke, G., Lok, M. S., Diehl, V., and Minowada, J. a malignant, Epstein-Barr-virus (EBV)-negative cell-line from the pleural Hodgkin's disease derived cell lines HDLM-2 and L-428: comparison of effusion of a patient with Hodgkin's disease. Blut, 38: 185-190, 1979. 22. Drexler, H. G., Amlot, P. L., and Minowada, J. Hodgkin's disease derived morphology, immunological and isoenzyme profiles. Leuk. Res.. 10: 487- cell lines—conflicting clues for the origin of Hodgkin's disease? Leukemia 492. 1986. (Baltimore), I: 629-634, 1987. 47 Kamesaki, H., Fukuhara. S., Tatsumi. E., Uchino, H., Yamabe, H., Miwa, 23. Weiss, L. M., Strickler, J. G., Hu, E., Warnke, R. A., and Sklar, J. Immu- H., Shirakawa, S., Hatanaka. M.. and Honjo, T. Cytochemical, immunologie, noglobulin gene rearrangements in Hodgkin's disease. Hum. Pathol., 17: chromosomal and molecular genetic analysis of a novel cell line derived from Hodgkin's disease. Blood, 68: 285-290. 1986. 1009-1014, 1986. 48 Crabtree. G. R. Contingent genetic regulatory events in T lymphocyte acti 24. Brinker, M. G. L., Poppema, S., Buys, C. H. C. M., Timens. W., Osinga, J., vation. Science (Washington DC), 243: 355-358, 1989. and Visser, L. Clonal immunoglobulin gene rearrangements in tissues in volved by Hodgkin's disease. Blood, 70: 186-191, 1987. 49 Chiù,R., Boyle, W. J., Meek, J., Smeal, T., Hunter, T., and Karin, M. The c-fos protein interacts with c-jun/\P 1 to stimulate transcription of AP l 25. Sundeen, J., Lipford. E., Uppenkamp. M., Sussman, E., Wahl, L., Raffeld, M., and Cossman, J. Rearranged antigen receptor genes in Hodgkin's disease. responsive genes. Cell, 54: 541-547, 1988. Blood, 70:96-101, 1987. 50 Taniguchi. T. Regulation of cytokine gene expression. Annu. Rev. Immunol., 6:439-446, 1988. 26. Knowles, D. M., Il, Neri, A., Pelicci, P. G., Burke, J. S., Wu, A., Winberg, C. D., Sheibani, K., and Dalia-Pavera, R. Immunoglobulin and T-cell receptor 51 Shaw, J-P., Utz, P. J., Durand, D. B., Toóle, J. J., Emmel, E. A., and B-chain gene rearrangement analysis of Hodgkin's disease: implications for Crabtree, G. R. Identification of a putative regulator of early T cell activation lineage determination and differential diagnosis. Proc. Nati. Acad. Sci. USA. genes. Science (Washington DC), 241: 202-205. 1988. 83: 7942-7947, 1986. 52 Mantovani. L., Henschler, R., Brach, M. A„Wieser, R., Lübbert,M., 27. Steenvoorden, A. C. M., Janssen, J. W. G., Drexler, H. G., Lyons, J., Tesch, Lindemann. A., Mertelsmann. R. H., and Herrmann, F. Differential regula H., Binder, T., Jones, D. B., and Bartram, C. R. Ras mutations in Hodgkin's tion of interleukin-6 expression in human fibroblasts by tumor necrosis disease. Leukemia (Baltimore), 2: 325-331, 1988. factor-a and lymphotoxin. FEBS Lett., 270: 152-157, 1990. 28. Milani, S., Sugawara, I., Shiku, H., and Mori, S. Expression of c-myc 53 Lindemann, A., Dörken,B., Henschler, R., Mertelsmann, R„andHerrmann, oncogene product and rai family oncogene products in various human F. Screening for expression of cytokines with hematopoietic growth factor malignant lymphomas defined by immunohistochemical techniques. Cancer activity by permanent human B-cell lines. Leukemia (Baltimore), 5: 715- (Phila.). 62: 2085-2090, 1988. 719, 1991. 29. Tesch, H., Jiicker, M., Falk, M. H., Bornkamm, G. W., Jones, D. B., and 54 Oster, W., Lindemann, A., Horn, S., Mertelsmann, R., and Herrmann, F. Diehl, V. Molecular analysis of Hodgkin's disease-derived cell lines. Hema Tumor necrosis factor (TNF)-alpha but not TNF-beta induces secretion of tol. Oncol., 6: 223-228, 1988. colony-stimulating factor for macrophages (CSF-1) by human monocytes. 30. Slmmm. D. J., deKernion, J. B., Verma, I. M., and Cline, M. J. Expression Blood, 70: 1700-1704. 1987. of cellular oncogenes in human malignancies. Science (Washington DC), 55 Herrmann, F., Cannistra, S. C., Levine, H., and Griffin, J. D. Expression of 224:256-261, 1984. IL-2 receptors and binding of IL-2 by gamma-interferon induced human 31. Paietta, E., Racevskis. J., Stanley, R., Andreeff, M., Papenhausen, P., and leukemic and normal monocytic cells. J. Exp. Med. 162: 1111-1116, 1985. Wiernik, P. H. Expression of the macrophage growth factor, CSF-1, and its 56 Herrmann, F., Cannistra, S. A., Lindemann, A., Blohm, D., Rambaldi, A., receptor c-fms by a Hodgkin's disease-derived cell line and its variants. Cancer Mertelsmann, R. H., and Griffin. J. D. Functional consequences of monocyte Res., 50: 2049-2054. 1990. IL-2 receptor expression: induction of IL-10 secretion by IFN-f and IL-2. J. 32. Rettenmier, C. W., Sacca, R., Furman. W. L., Roussel. M. F.. Holt, J. T., Immunol., 142: 139-145, 1989. Nienhuis, A. W.. Stanley, E. R., and Sherr. C. J. Expression of the human 57.Southern, E. Detection of specific sequences among DNA fragments sepa c-fms proto-oncogene product (colony-stimulating factor-1 receptor) on pe rated by gel electrophoresis. J. Mol. Biol., 98: 503-508, 1975. ripheral blood mononuclear cells and choriocarcinoma cell lines. J. Clin. 58 Ohlsson, H., and Edlund, T. Sequence-specific interactions of nuclear factors Invest., 77: 1740-1745, 1986. with the insulin gene enhancer. Cell, 45: 35-40, 1986. 3359

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research. CYTOKJNES IN HODGKIN'S DISEASE

59. Brach, M. A., Henschler, R., Mertelsmann. R. H., and Herrmann, F. Regu R., and Herrmann, F. Interleukin-6 (IL-6) is an intermediate in IL-1-induced lation of M-CSF expression by M-CSF: role of protein kinase C and tran proliferation of leukemic human megakaryoblasts. Blood, 76: 1972-1979, scription factor NF.B. Pathobiology, 59: 284-290, 1991. 1990. 60. Sen, R., and Baltimore, D. Multiple nuclear factors interact with the immu- 69. Gamm, H., Lindemann, A., Mertelsmann, R. H., and Herrmann, F. Recom noglobulin enhancer sequences. Cell, 46: 705-710, 1986. binant human TNF-a in patients with advanced malignancy: results of a 61. Molitor, J. A., Walker, W. H., Doerre, S., Ballard, D. W., and Greene, W. phase I clinical study. Eur. J. Cancer, 27:856-863, 1991. C. NF-kB: a family of inducible and differentially expressed enhancer-binding 70. Metcalf, D., and Gearing, D. P. A myelosclerotic syndrome in mice engrafted proteins in human T cells. Proc. Nati. Acad. Sci. USA, 87: 10028-10034, with cells producing high levels of leukemia inhibitory factor (LIF). Leukemia 1990. (Baltimore), 3: 847-853, 1989. 62. Cochran, B. H., Reffel, A. C, and Stiles, C. D. Molecular cloning of gene 71. Wahl, S. M., McCartney-Francis, N., and Mergenhagen, S. E. Inflammatory sequences regulated by platelet-derived growth factor. Cell, 33: 939-945, and immunomodulatory roles of TGF-beta. Immunol. Today, 10: 258-264, 1983. 1989. 63. Rollins, B., Stier, P., Ernst, T., and Wong, G. G. The human homolog of 72. Cerdan, C., Martin, Y., Brailly, H., Courcoul, M., Flavetta, S., Costello, R., the JE gene encodes a monocyte secretory protein. Mol. Cell. Biol., 9:4687- Mawas, C., Birg, F., and Olive, D. IL-la is produced by T lymphocytes activated via the CD2 plus CD28 pathways. J. Immunol.. 146: 560-566, 4693, 1989. 64. Drexler, H. G., Jones, D. B.. Diehl, V., and Minowada. J. Is the Hodgkin's 1991. 73. Hallet, M-M., Praloran, V., Vie, H., Peyrat, M-A., Wong, G., Witek- cell a T- or B-lymphocyte? Recent evidence from geno- and immunopheno- Giannotti, J., Soulillou, .11'.. and Moreau J-F. Macrophage colony-stimulat typic analysis and in-vitro cell lines. Hematol. Oncol., 7: 95-101, 1989. ing factor (CSF-1) gene expression in human T-lymphocyte clones. Blood, 65. Hsu, S. M., Xi, S. S., and Hsu, P. L. The cultured Reed-Sternberg cells 77:780-786, 1991. HDLM-1 and KM-H2 can be induced to become histiocyte-like cells: H-RS 74. Horiguchi, J., Sherman, M. L., Sampson-Johannes, A., Weber, B. L., and cells are not derived from lymphocytes. Am. J. Pathol., 137: 353-359, 1990. Kufe, D. W. CSF-1 and c-fms gene expression in human carcinoma cell lines. 66. Drexler, H. G., Leber, B. F.. Norton, J., Yaxley, J., Tatsumi, E., Hoffbrand, Hindu-m. Biophys. Res. Commun., 157: 395-402, 1988. A. V., and Minowada. J. Genotypes and immunophenotypes of Hodgkin's 75. Kacinski, B. M., Carter, D., Mittal, K., Kohorn, E. I., Shaeffer Bloodgood, disease-derived cell lines. Leukemia (Baltimore), 2: 371-377, 1988. R., Donahue, J., Donofrio, L., Edwards, R., Schwartz, P. E., Chambers, J. 67. Bauer, J., and Herrmann, F. IL-6 in clinical medicine. Ann. Hematol., 62: T., and Chambers, S. K. High level expression of/mi protooncogene mRNA 203-209, 1991. is observed in clinically aggressive human endometrial adenocarcinomas. Int. 68. Brach, M. A., Löwenberg,B., Mantovani, L., Schwulera, U., Mertelsmann, J. Radiât.Oncol. Biol. Phys., IS: 823-830, 1988.

3360

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research. Expression of Cytokine Genes, Cytokine Receptor Genes, and Transcription Factors in Cultured Hodgkin and Reed-Sternberg Cells

Hans-Jürgen Gruss, Marion A. Brach, Hans-Günter Drexler, et al.

Cancer Res 1992;52:3353-3360.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/52/12/3353

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/52/12/3353. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1992 American Association for Cancer Research.